0% found this document useful (0 votes)
57 views10 pages

QPCR Primer Design Revisited

qPCR primer design revisited

Uploaded by

kuang
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
57 views10 pages

QPCR Primer Design Revisited

qPCR primer design revisited

Uploaded by

kuang
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Biomolecular Detection and Quantification 14 (2017) 19–28

Contents lists available at ScienceDirect

Biomolecular Detection and Quantification


journal homepage: [Link]/locate/bdq

Review Article

qPCR primer design revisited T


a,⁎ b,c
Stephen Bustin , Jim Huggett
a
Faculty of Medical Science, Anglia Ruskin University, Chelmsford CM1 1SQ, United Kingdom
b
Molecular and Cell Biology Team, LGC, Queens Road, Teddington, Middlesex TW11 0LY, United Kingdom
c
School of Biosciences & Medicine, Faculty of Health & Medical Science, University of Surrey, Guildford, GU2 7XH, United Kingdom

A R T I C L E I N F O A B S T R A C T

Handled by: Justin O’Grady Primers are arguably the single most critical components of any PCR assay, as their properties control the
Keywords: exquisite specificity and sensitivity that make this method uniquely powerful. Consequently, poor design
Real-time PCR combined with failure to optimise reaction conditions is likely to result in reduced technical precision and false
Assay design positive or negative detection of amplification targets. Despite the framework provided by the MIQE guidelines
MIQE and the accessibility of wide-ranging support from peer-reviewed publications, books and online sources as well
Oligonucleotides as commercial companies, the design of many published assays continues to be less than optimal: primers often
lack intended specificity, can form dimers, compete with template secondary structures at the primer binding
sites or hybridise only within a narrow temperature range. We present an overview of the main steps in the
primer design workflow, with data that illustrate some of the unexpected variability that often occurs when
theory is translated into practice. We also strongly urge researchers to report as much information about their
assays as possible in their publications.

1. Introduction used to purify the templates [2], what reagents were used for the PCR
reaction [3–5] and what thermal cycler was used to run the assays
The peer-reviewed literature contains references to tens, if not [6,7]. Hence researchers can be sure of an assay’s performance only by
hundreds of thousands of oligonucleotide primer sequences for use with performing their own validation and optimisation experiments. Doing
the polymerase chain reaction (PCR) and hundreds more are available this before working with precious samples will save time, expense and
from primer databases or can be bought from commercial suppliers. help avoid failed runs or inconsistent experimental data. Given the
Oligonucleotide synthesis is available at bargain prices, enzymes are significance of empirical validation, it is important that any publication
becoming faster, more reliable and cheaper, there are task-specific include that essential information [8–11]. Several reports have been
master mixes (e.g. for multiplexing) and thermal cyclers are becoming published recently that together scored thousands of peer-reviewed
more affordable and user-friendly. This makes it possible to generate papers in a wide collection of journals ranging from low to high impact
huge amounts of data with comparatively little effort. Since these data factors [12–17]. All concluded that the amount of critical information
find their way into over 15,000 qPCR-related publication every year, it provided with papers reporting qPCR data is inadequate for the purpose
is essential to try and ensure that publications report real results, rather of evaluating the validity of conclusions arising from those data, with
than technical bias [1]. many not reporting primer sequences, validation data or including
With so many ready-made assays available, one might wonder why wrong information.
anyone would want to go to the trouble of designing yet another assay. The main concerns with regards to designing assays usually relate to
Especially as the perception is that designing one’s own assay is a lot researchers being unfamiliar with the primer design process or unsure
more complex and inconvenient than simply buying it from a com- about the key parameters most likely to generate optimal primers,
mercial supplier, who in any case will have validated every one of their lacking the appropriate design tools and apprehension that the design
assays. That perception is wrong for two reasons: first, commercial process will take too long. However, assay design is usually quite
primers or assay condition may not have been experimentally validated straightforward, suitable tools are freely available online and it takes
or optimised. Second, it cannot be presumed that a primer set will less time to design a robust, sensitive and specific assay than to trou-
generate the same results under different experimental conditions since bleshoot a poorly designed one.
assay performance can vary depending on what extraction methods was We provide a concise overview of the main primer-related issues


Corresponding author.
E-mail addresses: [Link]@[Link] (S. Bustin), [Link]@[Link], [Link]@[Link] (J. Huggett).

[Link]
Received 24 March 2017; Received in revised form 8 November 2017; Accepted 12 November 2017
Available online 22 November 2017
2214-7535/ © 2017 The Authors. Published by Elsevier GmbH. This is an open access article under the CC BY-NC-ND license ([Link]
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

that confront anyone wanting to design a qPCR assay, consider the main by in silico analyses, the latter two by experimental investigation
criteria that have an impact on assay performance, dissect the in-
dividual steps of the assay design workflow and analyse the perfor- 4. Target identification
mance of some real-life assays.
It is self-evident that an assay is useful only if the correct target has
2. The importance of primers been identified and used for assay design. Hence the more that is known
about the DNA or RNA of interest, the better. Accordingly, the first step
Appropriately validated primers are crucial in determining the involves accumulating as much information as possible from sequence
specificity, sensitivity and robustness of a PCR reaction [18]. Whilst it databases. This can appear to be quite daunting, but will soon become
nearly always possible to get a result with a PCR assay, this is not the second nature with a systematic, step-by-step approach. One problem
same as getting a correct result, be that a present/absent call for the with searching for sequences is that there are often numerous identical,
detection of a pathogen or mutation using an endpoint assay or an closely-related or, more surprisingly, significantly different sequences
accurate quantification of RNA copy numbers using a real-time method. listed under the same common name. An NCBI search for “Aspergillus
In reality, PCR is not as robust as many people believe and there is a terreus 18S” brings up 161 sequences of varying lengths, descriptions
need to consider the science underlying DNA folding and match versus and accession numbers. A search for “Aspergillus terreus 28S” returns
mismatch hybridisation. Having said that, it is not always obvious why 142 sequences, some the same as the previous search, but again all with
some primer combinations work, or indeed do not work well. different accession numbers and lengths. There are two lessons here: (i)
The critical variable for primer performance is its annealing tem- it is essential to have absolute clarity about the amplification target and
perature (Ta), rather than its melting temperature (Tm), as the Ta de- (ii) it is crucial always to refer to the accession or individual transcript
fines the temperature at which the maximum amount of primer is number of any sequence used for assay design, as this minimises the risk
bound to its target. The optimal primer Ta must be established experi- of confusion and makes life much simpler for reviewers and readers.
mentally as primer design programs generally calculate Tms and, in any Furthermore, many databases are not curated, so a given sequence
case, many use wrong prediction parameters [19]. Furthermore, since name is solely based on what the individual who uploaded it thought it
optimal annealing temperatures vary with different buffers, results was. Consequently, if the original sequence was incorrect, for example
obtained with one master mix cannot necessarily be extrapolated to a due to a nonspecific PCR, but this was not known when it was up-
second one. Even at the optimal Ta, non-specific amplification can loaded, then a circular problem will arise that further propagates the
occur, especially with “proofreading” enzymes, caused not just by error.
primer dimers but by physical closeness of primer pairs at mismatched Database mining assumes familiarity with its nomenclature: e.g.
sites. Furthermore, reliance on BLAST searches alone does not guar- NCBI sequences prefixed with NC_, NG_ are curated genomic sequences,
antee primer specificity, since whilst the BLAST algorithm returns fast NM_ is a curated mRNA sequence, whereas NT_ and NW_ are automated
results it may miss thermodynamically important hybridisation events genomic and XM_ automated RNA sequences. Hence the information
as it does not correctly score the gaps that generate duplex bulges [19]. with regards to some sequences (NM_) is likely to be more reliable than
Furthermore, the effects of mismatches on duplex stability are sequence that for others (XM_) and judicious choice of sequence information is
context dependent and are not correctly called by sequence in- advised. For example, if the aim is to amplify a cellular mRNA, it is
dependent approximations [20]. important to ascertain whether there are transcript or splice variants or
additional closely related paralogues and whether the assay should
3. Principal considerations for assay design target all of those or be able to distinguish between them. One im-
portant consideration is to ensure that the assay does not inadvertently
A good assay will not create primer dimers, be close to 100% effi- amplify pseudogenes. Designing PCR primers for miRNAs is somewhat
cient and exquisitely specific. Such an assay will also be robust, which more challenging, since a typical miRNA is only 22 bases long, which is
means that if conditions are not quite optimal, for example if a sample about the same size as a conventional PCR primer. Genotyping assays,
contains traces of an inhibitor, or if the thermal cycler has uneven on the other hand, place an obvious restriction on the position of the
thermal profiles across its block, then the assay may still perform re- amplicon as it must include the site of the polymorphism or mutation.
liably and generate usable data. In contrast, a poor assay will be much This highlights an important point in that while designing an optimal
more susceptible to variable conditions, and is virtually guaranteed to assay is desirable the designer is ultimately at the mercy of the sequence
result in wasted time and considerable frustration on the part of the in question and the ‘best’ assay may not be ideal. This may not preclude
researcher. As a rule of thumb, if primers perform well over a broad its use as long as the limitations of such a choice (such as possible re-
temperature gradient, the assay tends to be robust, whereas if ampli- duced efficiency, sensitivity or precision) are understood and, crucially,
fication is restricted to a narrow temperature optimum, it is not. reported in any publication.
When designing assays in-house, the design process comprises a Absolute certainty as to what is being targeted is of particular im-
comprehensive workflow that demands careful consideration not just of portance when utilising PCR as a diagnostic or forensic test. Whilst
the primers themselves but also of amplicon uniqueness, structure and assays used in clinical applications are heavily regulated (although
location, with the aim of bringing about an optimal primer/amplicon mistakes are still made), research diagnostic assays are not, so factors
combination for accurate quantification of nucleic acids. Attention to such as specificity must be considered when reaching conclusions.
such detail makes it more likely that the assays will yield data that are Human papillomavirus (HPV) is the primary aetiological factor that
sufficiently reliable and sensitive to generate consistent as well as transforms cervical epithelia into cervical cancer and causes most anal
biologically/clinically relevant results. Importantly, even when the and oropharyngeal as well as some vaginal, vulvar, and penile cancers.
primers have been designed by a colleague, tracked down from a peer- According to epidemiological case-control studies, 15 high-risk HPV
reviewed publication, acquired from a primer database or purchased types have been acknowledged, while three types have been designated
from a commercial source, reliable qPCR demands a retrospective as probable high-risk and 12 types have been classified as low-risk [21].
evaluation of most of the in silico criteria and assiduous validation of all Depending on the purpose of an associated study it could be essential to
of the wet lab parameters. distinguish between these subtypes and so appropriately designed as-
Achieving these objectives is not difficult, when following the says will be paramount [22]. Similarly, designs targeting bacterial and
workflow shown in Fig. 1 which involves four major steps: (i) target fungal pathogens require careful consideration prior to carrying out any
identification, (ii) definition of assay properties, (iii) characterisation of diagnostic experiments [23]. The recent interest in using RT-PCR to
primers and (iv) assay optimisation. The first two steps are carried out target RNA for the tissue profiling of human forensic samples [24]

20
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 1. Workflow for PCR primer design. The fol-


lowing web sites are pertinent: PrimerBlast: https://
[Link]/tools/primer-blast;
DINAmelt: [Link]
DINAMelt; Mfold: [Link]
q=mfold; BLAST: [Link]
[Link]; Ensembl: [Link]
html;.

Fig. 2. Temperature gradient analysis of three assays targeting fungal rRNA genes. Effect of different commercial master mixes on gradient profile. Amplification was carried out in 10 μL
using BioRad’s iTaq Universal SYBR Green Supermix (172-5121) with 300 nM final primer concentration on a BioRad CFX instrument, with a three minute 95 °C denaturation step
followed by 40 cycles of 5 s at 95 °C and 30 s at 62 °C. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Primers were Asp-F: CTTGGATTTGCTGAAGACTAAC and Asp-R: CTAACTTTCGTTCCCTGATTAATG, amplicon size 76 bp. This assay is robust, with the amplification plots virtually
indistinguishable at the eight temperatures tested. B: Melt curve. C. Primers were FS1-F: GAGGATGCTTTTGGTGAG and FS1-R: GAGCTTTACAGAGGATCG, amplicon size 99 bp. This
assay is somewhat less robust, recording visible differences in Cq. D: Melt curve. E. Primers were FS2-F: CCCGAGTTGTAATTTGTAG and FS2-R: GAAGGAGCTTTACAGAGG, amplicon size
121 bp. This assay is poor, with significantly higher Cqs at temperatures away from the optimum. F: melt curve. G. Table of the Cqs recorded for the three assays, with the assays recording
ΔCqs of 0.53, 1.63 and 8.93, respectively, between optimal (highlighted in red) and least optimal temperatures. Amplification conditions were as described in the legend to Fig. 5.

21
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 3. Effect of different commercial master mixes on gradient profile. Amplification reactions were carried out as described in the legend to Fig. 2, except that seven different master
mixes were used and annealing was carried out using a temperature gradient from 60 °C–65 °C.
A. Primers CA-F: GTTTGGTGTTGAGCAATAC and CA-R: CTACCTGATTTGAGGTCAAA were used to amplify fungal genomic DNA and PCR amplicons were detected with a hydrolysis
probe CA-Pr: FAM-ACAATGGCTTAGGTCTAAC-BHQ. All master mixes record similarly robust gradient profiles, although the Cqs from one master mix are lower than those from the rest.
The optimal annealing temperatures are highlighted in red and differ between the master mixes.
B. A. Primers BAR-1F: CATGCTCCAAAATGCCCTA and BAR-1R: CTTGGTAGCACACCCAAA were used to amplify bacterial genomic DNA and PCR amplicons were detected with SYBR
Green chemistry. The quality of the gradient profile depends on the master mix used, although the specificity is not affected, as determined by the melt curves. The optimal annealing
temperatures are highlighted in red and differ between the master mixes.

makes it necessary to ensure that the new assays being developed are 5. Assay properties
species-, RNA- and tissue-specific. It is particularly worth noting that
when the intention is to achieve RNA-specificity by placing the primer 5.1. Primers
binding sites in separate exons, intron size is important. At least one fast
Taq polymerases in use today can extend at a rate of 155 nucleotides/ The discussion in the previous section highlights the importance of
second [25], and with annealing and polymerisation times of tens of considering assay design as an integration of amplicon and primer
seconds, as is still common, this can result in polymerisation through characteristics. Primers are the pivotal component of a qPCR assay:
the intron and the detection of amplified DNA, eliminating any chance their raison d'être is to prime the specific amplification of a single target
of reliably distinguishing tissue-specific RNA expression from DNA in a background of more-or-less related potential alternatives. Most
contamination. assays are designed to run under constant PCR conditions, consisting of
Surprisingly, many assays in clinical use are not as specific and/or a brief 95 °C melt followed by a single annealing and elongation step of
sensitive as one might expect, making one wonder whether or how they 60 °C as this lends itself to automation and the running of different
were ever optimised. A publication reporting the evaluation of the assays using the same parameters. However, as most polymerases used
performance of eight candidate working standards developed for di- for PCR work best at 72 °C, our advice is to consider designing assays
agnostic qPCR-based assays of clinically relevant viral targets by where primers hybridise at higher temperatures (63 ± 2 °C). This also
Central Veterinary Laboratories in the UK showed a high level of helps reduce the polymerisation time and so speeds up the time re-
variability in intra- and inter-assay detection of their targets, with the quired to complete a PCR run [30]. Since oligonucleotides are cheap, it
highest levels of variation amounting to almost 3 logs of virus [26]. This is worth designing several primers for each assay and choosing the
is rather disturbing, seeing that these results come from laboratories combination giving the lowest Cq and the least amount (ideally none)
carrying out routine RT-qPCR analyses on patient samples. Other re- of primer dimer. This could be a problem if the aim of the assay is
ports describe exon-specific primers that also may bind to introns [27], ultimate sensitivity.
where the probe binds to sequences upstream from the forward primer The Ta characteristics of PCR primers can vary widely. Some assays
[28] or where some of the published primer sequences are incorrect are not sufficiently robust and fall apart quickly if they are not per-
[29]. formed at the optimal Ta of the primers. The temperature profiles of
three assays amplifying different targets are demonstrated in Fig. 2,

22
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 4. Master mix-dependent effects of primer concentration. Amplification was carried using five commercial master mixes and conditions, except for primer concentration, were as
described in the legend to Fig. 2.
A. Primers CA-F and CA-R were used at either 300 nM or 600 nM final concentration to amplify fungal genomic DNA and PCR amplicons were detected with SYBR Green chemistry.
Doubling the primer concentration has a small deleterious effect with most master mixes, with the maximum effect an increase in Cq of 1.3.
B. Primers BAR-1F and BAR-1R were used at either 300 nM or 600 nM final concentration to amplify bacterial genomic DNA and PCR amplicons were detected with SYBR Green
chemistry. Doubling the primer concentration has an enhancing effect with all master mixes, with the maximum effect a decrease in Cq of 2.3.

where there is a clear difference in the results obtained for the three record significantly less robust profiles, with one especially poor.
primer sets. The assay in panel A is optimal and characterised by a Primer concentrations for SYBR I Green assays tend to be lower
broad optimal Ta range with similar Cqs (maximum ΔCq = 0.53) over a (100–400 nM) than for probe-based assays (300–900 nM), but there are
59 °C–64 °C range. The assay in panel B is not quite as robust, with a always exceptions that prove that rule. The effects of varying primer
maximum ΔCq of 1.63, whereas the assay in panel C has a narrow concentrations can differ dramatically between different primer pairs.
optimum range between 59 °C and 60 °C, resulting in significantly Sometimes the effects can be dramatic and extend over several mag-
lower Cqs away from that optimum (ΔCq = 8.93). This is quite separate nitudes, with primer combinations from 50 to 600 nM resulting in a Cq
from the specificity of the amplification reaction, where the melt curves range of more than 20 cycles [31]. Generally, however, the effects are
reveal a single peak indicative of the assay remaining specific at the less pronounced as long as primer concentration does not dip below
temperatures tested (panels D, E and F). Unfortunately, it is not possible 100 nM, and of concern mainly if sensitivity is the major consideration.
to come up with a fail-safe prediction of which primers or combinations This is demonstrated in Fig. 4, where two primer sets at two con-
of primer will generate the most temperature-tolerant, efficient, or centrations were used with five different master mixes. The results
specific assays. Hence any in silico design must be followed by experi- demonstrate that optimal primer annealing and concentration condi-
mental validation and optimisation. This takes time, effort and costs tions are affected by the master mix, with different suppliers using
money − but is an integral part of performing a PCR assay and the different Mg2+ concentrations and adding undisclosed stabilisers to
more thorough the experimental validation, the more likely any sub- their buffers. Unfortunately, the results are not consistent between
sequent results will be accurate and not the product of measurement primers and master mixes. Master mixes B-E record higher Cqs with
error that has no true biological meaning. higher primer concentrations for one of the primer sets, whereas master
A major consideration is the fact that different assays perform dif- mix A records lower Cqs (Fig. 4A). Yet master mixes B-E record lower
ferently with different master mixes, so there is no one size fits all rule. Cqs with higher primer concentrations for the second set of primers
This is shown in Fig. 3, where two primer sets show significantly dif- (Fig. 4B). Hence annealing conditions may need to be re-evaluated
ferent properties. Primer set A records a robust temperature gradient when switching from one master mix to another.
profile with seven master mixes, although one of the master mixes re- qPCR assays generally use symmetric primers. However, this results
cords much higher Cqs than the rest. In contrast, the results obtained in the reactions typically slowing down and entering the plateau phase
primer set B depend on what master mix was used: three master mixes in a stochastic manner, because reannealing of the template strands
have a profile that is similarly robust to primer set A, the other four gradually outcompetes primer and probe binding to the template

23
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 5. Comparison of Clostridium difficile assays targeting the toxin gene tcdB.
A. Location of the assays. Amplicon A (blue) is 149 bp, amplicon B (green) is 121 bp and amplicon C (black) is 76 bp. The primers for assay A are tcdB-FA:
GTCCATCCTGTTTCCCAAGCAA, tcdB-RA: AGCCACACTTATCTATATATGACGTATTGGA, those for assay B are tcdB-FB: CAACTGAACAAGAAATGGCTAGCTT and tcdB-RB:
CTCCTTGTCAACTACTATATTTTGAG, those assay C are tcdB-FC: GCGGCAGCTTATCAAGATTT and tcdB-RC: TTCTTAAATCAGCTTCTATCAAATGG.
B. Mfold analysis indicates no secondary structure issues at the primer binding sites.
C. Amplification plots and melt curves for the PCR amplicons A and B. D. Amplification plots and melt curves for the PCR amplicons B and C. The blue, green and black data were obtained
for amplicons A, B or C, respectively. Amplification conditions were as described in the legend to Fig. 2.

strands and sequesters the polymerase. This is a particular problem doubling of target at each PCR cycle. Hence PCR amplicons detected by
when the aim is to detect specific DNA targets down to alleles of single- probes are generally short, as the suboptimal elongation temperature,
copy genes in single cells. Asymmetric PCR potentially circumvents the generally 60 °C, does not always result in completed products that can
problem of amplicon strand reannealing by using unequal primer be used as templates in further amplifications [35]. Nevertheless, the
concentrations. However, asymmetric amplification can be much less choice of amplicon size depends on usage and for some applications
efficient and requires extensive optimisation to identify the proper longer amplicons work better [36,37]. With SYBR Green, one might
primer ratios, the amounts of starting material, and the number of expect longer PCR amplicons to result in lower Cqs, since they can bind
amplification cycles that can generate reasonable amounts of product more SYBR Green molecules. However, this expectation is not always
for individual template/target combinations. This issue is addressed by born out in practice and shorter amplicons can record lower Cqs than
LATE-PCR, which uses unequal primer concentrations but takes into longer ones [35]. This is illustrated by a comparison of the performance
account the effect of the actual primer concentrations on primer an- of three assays A, B and C, which target the same gene in the human
nealing [32]. It corrects for the fact that the optimal Ta of the limiting intestinal pathogen Clostridium difficile. The assays amplify sequences
primer is often several degrees below the Ta of excess primer and allows 1532–1680, 3589–3710 and 1423–1498 respectively of the bacterial
the asymmetric PCR to proceed as efficiently as symmetric PCR [33]. toxin B (tcdB) gene (NC_009089) (Fig. 5A). An Mfold analysis [38]
Furthermore, single stranded amplicons are generated with predictable suggests that the three PCR amplicons, comprising 149, 121 and 76 bp,
kinetics for many cycles beyond the exponential phase. This permits are free from significant secondary structure, with all primer binding
uncoupling of primer annealing from product detection via a fluor- sites accessible for primer annealing (Fig. 5B). This is probably helped
escent probe. As a result, the Ta of the probe no longer needs to be by the high AT content of the bacterial DNA. Assay A records a Cq of
higher than the Tm of either primer. This permits the use of low-Tm 27.25, whereas assay B records a Cq of 26.14, i.e. the shorter amplicon
probes, which are inherently more allele-discriminating, generate lower is detected 1.1 cycles earlier than the longer amplicon (Fig. 2C). The
background, and can be used at saturating concentrations without in- melt curves are similar, showing a single peak for either assay, with
terfering with the efficiency of amplification [34]. amplicon B having a slightly lower peak at 75 °C, compared with peak
for amplicon A at 76 °C.
In contrast, a comparison between amplicons B and C generates the
5.2. Amplicons expected result: B is significantly longer (121 bp) than amplicon C
(76 bp) and records a Cq of 26.14, whereas assay C records a Cq of
Reliable amplification and precise quantification requires complete

24
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 6. Effects of different master mixes on amplification. Amplification reactions were carried out as described in the legend to Fig. 2.
A. A qPCR assay targeting fungal DNA was used with two sets of forward and reverse primers, which differ mainly at their 3′-ends. The PCR amplicon has no secondary structure issues at
the primer binding sites.
B. When used with master mix A, the maximum ΔCq between the primer combinations was 4.64, the equivalent of a 25-fold difference in sensitivity. The assays using CA-R recorded the
lowest Cqs, whereas those using CA-RB recorded higher Cqs. When used with master mix B, the maximum ΔCq between the primer combinations was 2.98, the equivalent of an 8-fold
difference in sensitivity. The assay using CA-F/CA-R recorded the lowest Cqs, with the other three broadly equivalent.
C. Melt curves for master mixes A (green) and B (blue) show that the specificity of the assays is the same for all primer combinations.

27.87, i.e. the longer PCR amplicon is detected 1.7 cycles earlier than binding, reduce priming efficiency and hence reduce the amplification
the short one. In general, too short an amplicon, (< 80 bp) in SYBR efficiency [40]. Hence the binding regions for primers should be com-
Green assays may result in difficulties when differentiating amplicon pletely accessible; if the predictions suggest any secondary structures at
and primer dimer(s) and can result in later Cq readings. Hence it is a those sites, the amplicon should, where possible, be moved. If the price
good idea to keep SYBR Green amplicons a little longer (80–150) than of avoiding secondary structures at the primer binding sites is a longer
those targeted by probe-based assays (60–90). In addition, SYBR Green amplicon, then that may be a price worth paying, especially with the
has a greater affinity for AT–rich than GC–rich DNA, hence G-C rich introduction of the latest fast reagents.
PCR amplicons may record higher Cqs than A-T rich ones. Of course, the secondary structures are only predictive, and it may
Melt curve analysis is also not always what it seems as, since also be necessary to consider the sequences directly upstream or
whereas SYBR Green intercalates at low dye:base pair ratios, at higher downstream from the amplicon, as they could interfere with the initial
ratios its conformation changes and it interacts with the minor groove stages of the PCR assay [41]. The GC content of amplicons should be as
[39]. It is this interaction that results in a significant increase in close to 50% as possible and the inclusion of Guanine (G) repeats
fluorescence. An important characteristic of SYBR Green binding to should be avoided, since they may prevent complete strand dissociation
DNA is that in PCR the dye:base pair ratio is not constant, since it and so also reduce amplification efficiency.
changes with cycle number as more double stranded DNA is produced. However, it is important to realise that these are general rules and in
Consequently, melt curve analysis can be influenced by the number of practice, an assay that amplifies a longer product can perform better
cycles and the amount of DNA present after amplification. than a shorter one, many bacterial PCR amplicons will be AT rich and
Amplicons should always be checked for secondary structure, as sometimes secondary structures just cannot be avoided. Consequently,
areas of extensive secondary structure can be an important cause of although there are guidelines for everything, in practice things often
reduced amplification efficiency. Possible structures must be checked work out different than theory asserts and in the end, all that matters is
using the actual reaction conditions, especially the Ta, salt and Mg2+ how a design works in the laboratory. If all else fails, as long as the
ion concentrations and the simplest way to check secondary structures assay is specific, most other conditions can be tweaked to achieve a
is by using the Mfold website. The hybridisation kinetics of the an- satisfactory efficiency. Most importantly, if despite all best efforts an
nealing reaction will favour intramolecular binding, obstruct primer assay is only 85% efficient, then it is acceptable to report the results

25
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 7. Linearity of a well-designed qPCR assay. Amplification reactions


were carried out as described in the legend to Fig. 2. Ten-fold serial di-
lutions of target DNA were subjected to amplification with the Asp-F and R
primers. The variability recorded by the four replicates increases with
decreasing target copy number, until the nominal single copy target fails
to record a Cq in 4/5 replicates.

together with supporting evidence to show standard curves, report is evident that with master mix A the CA-F/CA-RB grouping is the worst
precision and limits of quantification and of detection. Thus, the lim- grouping, as the Cqs translate into assays that are between 8- and 25-
itations of such an approach can be determined and validity of asso- fold less sensitive than those using the CA-R primer. In contrast, only
ciated conclusions evaluated. the CA-F/CA-R combination works optimally with master mix B, with
the other three recording similar, higher Cqs. The melt curves obtained
6. Assay optimisation using the two master mixes are slightly different, which is not un-
expected as they contain different ingredients.
The precision and reliability of a qPCR assay depends on rigorous Quantification by qPCR assumes a linear relationship between the
optimisation of every aspect of the PCR reaction. In some cases assays logarithm of the initial template quantity and the Cq value obtained
may not require extensive optimisation, but for qPCR assays that are during amplification. This permits calculations of an assay’s amplifi-
performed for challenging measurement such as the precise quantifi- cation efficiency and delineating its limits of detection and quantifica-
cation of small differences in nucleic acid quantities (be they DNA or tion [42]. The hallmarks of an optimised qPCR assay are:
RNA), reliable detection of pathogens with good sensitivity or specific
discrimination of polymorphisms or mutations this is not the case. • High amplification efficiency (95–105%)
Thorough optimisation of the PCR protocol, reagents, instrumentation • Linear standard curve (R2 > 0.980)
and analysis methodologies are a critical prerequisite for obtaining • High precision between experimental experiments
valid, reproducible results with maximum specificity and sensitivity. • Consistency across replicate experiments
Incidentally, sensitivity is not dependent on a given Cq value; high • No primer dimers
sensitivity is achieved if an assay can reliably amplify and detect low • Wide dynamic range
copy number targets. While high detection sensitivity may not be ne-
cessary for a given experiment, it is worth remembering that a well Amplification efficiency is best determined by generating a standard
optimised qPCR is able to amplify single molecules of DNA and this curve using serial dilutions of a template and determining the slope
ability usually goes hand in hand with high efficiency and quantitative from the linear regression of a plot of Cq (y-axis) vs log [quantity] [43].
precision. If perfect doubling occurs with each amplification cycle, the spacing of
The results shown in Fig. 6 demonstrate the effects of using an the fluorescence curves will be determined by the equation
optimised primer/master mix combination. The assay is targeting 2n = dilution factor, where n is the number of cycles between curves.
fungal DNA and forward and reverse primers bind to regions of the PCR For example, with a 10-fold serial dilution of DNA, 2n = 10. Therefore,
amplicon that are free from secondary structure. There are two forward n = 3.32 and the Cq values should increase by approximately 3.32
and two reverse primers and when used in all possible combinations it cycles for every ten-fold dilution. An acceptable evaluation of PCR

26
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

Fig. 8. Comparability of two optimised qPCR assays targeting the same gene HIF-1α (NM_181054.2). Amplification reactions were carried out as described in the legend to Fig. 2, except
that annealing was carried out using a temperature gradient from 55 °C–65 °C.
A. Exon/intron structure of the gene, with assay 1 (HIF-AF: CCGAGGAAGAACTATGAA and HIF-AR:TGGTTACTGTTGGTATCA) amplifying sequences in exons 5 and 6 and assay 2 (HIF-
BF: AAGAACTTTTAGGCCGCTCA and HIF-BR:TGTCCTGTGGTGACTTGTCC) amplifying sequences in exons 7 and 8.
B. There are no secondary structures issues at the primer binding sites.
C. Both assays are robust, with the 55°–65° gradient recording similar qs of 24.68 ± 0.07 and 24.32 ± 0.12, respectively. Melt curve analysis shows a single peak.
D. Standard curves are comparable, showing linearity at least over five orders of magnitude.

efficiency requires a minimum of three replicates and four, ideally five, varying by vast amounts can be accurately quantified.
orders of magnitude of template concentration. This is because even if If assays are well-designed and properly optimised, it should be
the assay is 100% efficient, variability in the dilutions will result in a possible to get comparable results from separate assays that use the
range of efficiencies when testing a dilution series of a single log. A same master mix to detect the same target gene or genome, but amplify
slope of −3.32 reflects an efficiency of around 100%. A PCR reaction different regions on that target. This implies that if two laboratories use
with lower efficiency will have lower sensitivity [5,44]. optimised assays to amplify, for example, the same mRNA, their results
The R2 value is the square of the correlation between the response should be equivalent. The example in Fig. 8 demonstrates this nicely.
values and the predicted response values and measures how successful a Fig. 8A shows the location of assays amplifying exons 5/6 (A) or exons
fit is in explaining the variation of the data. R2 can take on any value 7/8 (B) of the hypoxia inducible factor 1, alpha subunit transcript
between 0 and 1, with a value closer to 1 indicating that a greater variant 2 gene (NM_181054). An analysis of the secondary structures
proportion of variance is accounted for by the model. For example, an indicates that there are none at the primer annealing sites (Fig. 8B). The
R2 value of 0.998 means that the fit explains 99.8% of the total var- amplification plots in Fig. 8C obtained over a temperature gradient
iation in the data about the average. An R2 value > 0.980 provides from 55 °C to 65 °C on a BioRad CFX confirm that both assays are
good confidence in correlating Cq and target copy number. comparable and robust in performance resulting in comparable Cqs,
The amplification plots and standard curve shown in Fig. 7 illustrate with a single peak detected in the melt curve analysis. Standard curves
a typical optimised qPCR assay. It shows good linearity over a wide are also similar, with comparable amplification efficiencies (Fig. 8D).
dynamic range from 1 × 108 copies all the way down to a nominal However, it must be remembered that while general fold-change dif-
single copy. A wide dynamic range of a well-designed assay is one of the ferences, especially large ones, may be easier to reproduce, it is far
key features of qPCR assays and ensures that target copy numbers more challenging to obtain comparable absolute quantities. This is

27
S. Bustin, J. Huggett Biomolecular Detection and Quantification 14 (2017) 19–28

because upstream steps prior to the amplification step, such as nucleic [17] S.A. Bustin, T. Nolan, Talking the talk, but not walking the walk: RT-qPCR as a
extraction and reverse transcription, can contribute considerable un- paradigm for the lack of reproducibility in molecular research, Eur. J. Clin. Invest.
47 (2017) 756–774.
certainty [45] and employing comparable calibration standards is far [18] J.M. Robertson, J. Walsh-Weller, An introduction to PCR primer design and opti-
from trivial. mization of amplification reactions, Methods Mol. Biol. 98 (1998) 121–154.
[19] J. SantaLucia, Physical principles and visual-OMP software for optimal PCR design,
Methods Mol. Biol. 402 (2007) 3–34.
7. Conclusions [20] J.J. SantaLucia, D. Hicks, The thermodynamics of DNA structural motifs, Annu.
Rev. Biophys. Biomol. Struct. 33 (2004) 415–440.
Knowledgeable and consistent assay design is at the heart of any [21] N. Muñoz, F.X. Bosch, S. de Sanjosé, R. Herrero, X. Castellsagué, K.V. Shah, et al.,
Epidemiologic classification of human papillomavirus types associated with cervical
research project designed to quantify nucleic acids. It must be carried cancer, N. Engl. J. Med. 348 (2003) 518–527.
out with care, but can be simplified by following a straightforward [22] H. Ikenberg, Laboratory diagnosis of human papillomavirus infection, Curr. Probl.
workflow, as is detailed above. Reliable qPCR demands good primers. Dermatol. 45 (2014) 166–174.
[23] S.A. Bustin, H.H. Kessler, Amplification and detection methods, in: H.H. Kessler
This usually means absolute specificity, absence of hairpin structures or
(Ed.), Molecular Diagnostics of Infectious Diseases, 3rd edition, De Gruyter, Berlin,
cross-dimerisation potential and temperature tolerance. Good assay 2014, pp. 63–84.
design must consider amplicon structure and ensure that primer target [24] Z. Li, P. Bai, D. Peng, B. Long, L. Zhang, W. Liang, Influences of different RT-qPCR
sites are free from secondary structure. There are numerous opinions methods on forensic body fluid identification by microRNA, Forensic Sci. Int.:
Genet. Suppl. Series 5 (2015) e295–e297.
and guidelines available; an internet search for the terms “qPCR assay [25] J.L. Montgomery, N. Rejali, C.T. Wittwer, Stopped-flow DNA polymerase assay by
design” lists 695,000 pages. However, many of these are based on continuous monitoring of dNTP incorporation by fluorescence, Anal. Biochem. 441
myths or may have been appropriate for legacy PCR but require subtle (2013) 133–139.
[26] J.F. Fryer, S.A. Baylis, A.L. Gottlieb, M. Ferguson, G.A. Vincini, V.M. Bevan, et al.,
(or not so subtle) modifications for use with qPCR. Each “new” assay Development of working reference materials for clinical virology, J. Clin. Virol. 43
must be properly validated, with in silico validation acting as an initial (2008) 367–371.
filter to screen designs and dismiss those that do not fulfil clearly de- [27] T.K. Lee, S.R. Murthy, N.X. Cawley, S. Dhanvantari, S.M. Hewitt, H. Lou, et al., An
N-terminal truncated carboxypeptidase E splice isoform induces tumor growth and
fined quality criteria. Empirical optimisation and validation are an es- is a biomarker for predicting future metastasis in human cancers, J. Clin. Invest. 121
sential, yet frequently neglected, part of any qPCR experiment. This (2011) 880–892.
applies to both newly designed assays as well as assays obtained from [28] R. Torelli, M. Sanguinetti, A. Moody, L. Pagano, M. Caira, E. De Carolis, et al.,
Diagnosis of invasive aspergillosis by a commercial real-time PCR assay for
elsewhere. Finally, results of optimisation and validation processes Aspergillus DNA in bronchoalveolar lavage fluid samples from high-risk patients
should be reported when qPCR data are published. compared to a galactomannan enzyme immunoassay, J. Clin. Microbiol. 49 (2011)
4273–4278.
[29] K.B. Brajao de Oliveira, R. Losi Guembarovski, A.M.F. Losi Guembarovski, A.C. da
References
Silva do Amaral Herrera, W.J. Sobrinho, C. Batista Ariza, M.A. Ehara Watanabe,
CXCL12, CXCR4 and IFNγ genes expression: implications for proinflammatory mi-
[1] S.A. Bustin, The reproducibility of biomedical research: sleepers awake, Biomol. croenvironment of breast cancer, Clin. Exp. Med. 13 (2013) 211–219.
Detect. Quantif. 2 (2014) 35–42. [30] S.A. Bustin, How to speed up the polymerase chain reaction, Biomol. Detect.
[2] K. Cankar, D. Stebih, T. Dreo, J. Zel, K. Gruden, Critical points of DNA quantifi- Quantif. 12 (2017) 10–14.
cation by real-time PCR-effects of DNA extraction method and sample matrix on [31] T. Nolan, R.E. Hands, S.A. Bustin, Quantification of mRNA using real-time RT-PCR,
quantification of genetically modified organisms, BMC Biotechnol. 6 (2006) 37. Nat. Protoc. 1 (2006) 1559–1582.
[3] C.C. Raggi, P. Verderio, M. Pazzagli, E. Marubini, L. Simi, P. Pinzani, et al., An [32] J.A. Sanchez, K.E. Pierce, J.E. Rice, L.J. Wangh, Linear-after-the-exponential
Italian program of external quality control for quantitative assays based on real- (LATE)-PCR: an advanced method of asymmetric PCR and its uses in quantitative
time PCR with Taq-Man probes, Clin. Chem. Lab. Med. 43 (2005) 542–548. real-time analysis, Proc. Natl. Acad. Sci. U. S. A. 101 (2004) 1933–1938.
[4] G.S. Buzard, D. Baker, M.J. Wolcott, D.A. Norwood, L.A. Dauphin, Multi-platform [33] K.E. Pierce, J.A. Sanchez, J.E. Rice, L.J. Wangh, Linear-After-The-Exponential
comparison of ten commercial master mixes for probe-based real-time polymerase (LATE)-PCR: primer design criteria for high yields of specific single-stranded DNA
chain reaction detection of bioterrorism threat agents for surge preparedness, and improved real-time detection, Proc. Natl. Acad. Sci. U. S. A. 102 (2005)
Forensic Sci. Int. 223 (2012) 292–297. 8609–8614.
[5] S. Alemayehu, K.C. Feghali, J. Cowden, J. Komisar, C.F. Ockenhouse, E. Kamau, [34] K.E. Pierce, L.J. Wangh, LATE-PCR and allied technologies: real-time detection
Comparative evaluation of published real-time PCR assays for the detection of strategies for rapid, reliable diagnosis from single cells, Methods Mol. Biol. 688
malaria following MIQE guidelines, Malar. J. 12 (2013) 277. (2011) 47–66.
[6] S. Lu, A.P. Smith, D. Moore, N.M. Lee, Different real-time PCR systems yield dif- [35] F. Debode, A. Marien, E. Janssen, C. Bragard, G. Berben, The influence of amplicon
ferent gene expression values, Mol. Cell. Probes 24 (2010) 315–320. length on real-time PCR results, Biotechnol. Agron. Soc. Environ. 21 (2017) 3–11.
[7] E. Picard-Meyer, C. Peytavin de Garam, J.L. Schereffer, C. Marchal, E. Robardet, [36] P.J. Contreras, H. Urrutia, K. Sossa, A. Nocker, Effect of PCR amplicon length on
F. Cliquet, Cross-platform evaluation of commercial real-time SYBR green RT-PCR suppressing signals from membrane-compromised cells by propidium monoazide
kits for sensitive and rapid detection of European bat Lyssavirus type 1, BioMed Res. treatment, J. Microbiol. Methods 87 (2011) 89–95.
Int. 2015 (2015) 839518. [37] B.K. Martin, S. Raurich, M. Garriga, T. Aymerich, Effect of amplicon length in
[8] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, et al., The propidium monoazide quantitative PCR for the enumeration of viable cells of sal-
MIQE guidelines: minimum information for publication of quantitative real-time monella in cooked ham, Food Anal Methods. 6 (2013) 683–690.
PCR experiments, Clin. Chem. 55 (2009) 611–622. [38] M. Zuker, Mfold web server for nucleic acid folding and hybridization prediction,
[9] S.A. Bustin, J.F. Beaulieu, J. Huggett, R. Jaggi, F.S. Kibenge, P.A. Olsvik, et al., Nucleic Acids Res. 31 (2003) 3406–3415.
MIQE precis: practical implementation of minimum standard guidelines for fluor- [39] H. Zipper, H. Brunner, J. Bernhagen, F. Vitzthum, Investigations on DNA inter-
escence-based quantitative real-time PCR experiments, BMC Mol. Biol. 11 calation and surface binding by SYBR Green I, its structure determination and
(2010) 74. methodological implications, Nucleic Acids Res. 32 (2004) e103.
[10] S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, et al., [40] Y. Gao, L.K. Wolf, R.M. Georgiadis, Secondary structure effects on DNA hy-
Primer sequence disclosure: a clarification of the MIQE guidelines, Clin. Chem. 57 bridization kinetics: a solution versus surface comparison, Nucleic Acids Res. 34
(2011) 919–921. (2006) 3370–3377.
[11] J.F. Huggett, C.A. Foy, V. Benes, K. Emslie, J.A. Garson, R. Haynes, et al., The [41] J. Wilhelm, M. Hahn, A. Pingoud, Influence of DNA target melting behavior on real-
digital MIQE guidelines: minimum information for publication of quantitative di- time PCR quantification, Clin. Chem. 46 (2000) 1738–1743.
gital PCR experiments, Clin. Chem. 59 (2013) 892–902. [42] A. Forootan, R. Sjöback, J. Björkman, B. Sjögreen, L. Linz, M. Kubista, Methods to
[12] S. Bustin, Transparency of reporting in molecular diagnostics, Int. J. Mol. Sci. 14 determine limit of detection and limit of quantification in quantitative real-time
(2013) 15878–15884. PCR (qPCR), Biomol. Detect. Quantif. 12 (2017) 1–6.
[13] J.R. Dijkstra, L.C. van Kempen, I.D. Nagtegaal, S.A. Bustin, Critical appraisal of [43] S.A. Bustin, Why the need for qPCR publication guidelines?–The case for MIQE,
quantitative PCR results in colorectal cancer research: can we rely on published Methods 50 (2010) 217–226.
qPCR results, Mol. Oncol. 8 (2014) 813–818. [44] C. Hilscher, W. Vahrson, D.P. Dittmer, Faster quantitative real-time PCR protocols
[14] A.M. Abdel Nour, E. Azhar, G. Damanhouri, S.A. Bustin, Five years MIQE guide- may lose sensitivity and show increased variability, Nucleic Acids Res. 33 (2005)
lines: the case of the Arabian countries, PLoS One 9 (2014) e88266. e182.
[15] J. Huggett, S.A. Bustin, Standardisation and reporting for nucleic acid quantifica- [45] R. Sanders, D.J. Mason, C.A. Foy, J.F. Huggett, Considerations for accurate gene
tion, Accredit. Qual. Assur. 16 (2011) 399–405. expression measurement by reverse transcription quantitative PCR when analysing
[16] S.A. Bustin, T. Nolan, Improving the reliability of peer-reviewed publications: we clinical samples, Anal. Bioanal. Chem. 406 (2014) 6471–6483.
are all in it together, Biomol. Detect. Quantif. 7 (2016) A1–5.

28

You might also like