100% found this document useful (2 votes)
1K views531 pages

Java Coding Interview Solutions

This document is a table of contents for a coding interview guide in Java that contains 151 coding problems. Each problem is numbered and titled, with a brief 1-2 word description of the problem. The table of contents lists the problems in numerical order and spans over 7 pages.

Uploaded by

amitmitra83
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
100% found this document useful (2 votes)
1K views531 pages

Java Coding Interview Solutions

This document is a table of contents for a coding interview guide in Java that contains 151 coding problems. Each problem is numbered and titled, with a brief 1-2 word description of the problem. The table of contents lists the problems in numerical order and spans over 7 pages.

Uploaded by

amitmitra83
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Coding Interview in

Java
Program Creek

May 1st, 2016


Contents

1 Rotate Array in Java 13

2 Evaluate Reverse Polish Notation 17

3 Isomorphic Strings 21

4 Word Ladder 23

5 Word Ladder II 25

6 Median of Two Sorted Arrays 29

7 Kth Largest Element in an Array 31

8 Wildcard Matching 33

9 Regular Expression Matching in Java 35

10 Merge Intervals 39

11 Insert Interval 41

12 Two Sum 43

13 Two Sum II Input array is sorted 45

14 Two Sum III Data structure design 47

15 3Sum 49

16 4Sum 53

17 3Sum Closest 55

18 String to Integer (atoi) 57

19 Merge Sorted Array 59

20 Valid Parentheses 61

2 | 531
Contents

21 Longest Valid Parentheses 63

22 Implement strStr() 65

23 Minimum Size Subarray Sum 69

24 Search Insert Position 73

25 Longest Consecutive Sequence 75

26 Valid Palindrome 77

27 ZigZag Conversion 81

28 Add Binary 83

29 Length of Last Word 85

30 Triangle 87

31 Contains Duplicate 89

32 Contains Duplicate II 91

33 Contains Duplicate III 93

34 Remove Duplicates from Sorted Array 95

35 Remove Duplicates from Sorted Array II 99

36 Longest Substring Without Repeating Characters 103

37 Longest Substring Which Contains 2 Unique Characters 105

38 Substring with Concatenation of All Words 109

39 Minimum Window Substring 111

40 Reverse Words in a String 113

41 Find Minimum in Rotated Sorted Array 115

42 Find Minimum in Rotated Sorted Array II 117

43 Search in Rotated Sorted Array 119

44 Search in Rotated Sorted Array II 121

45 Min Stack 123

Program Creek 3 | 531


Contents

46 Majority Element 125

47 Majority Element II 127

48 Remove Element 129

49 Largest Rectangle in Histogram 131

50 Longest Common Prefix 133

51 Largest Number 135

52 Simplify Path 137

53 Compare Version Numbers 139

54 Gas Station 141

55 Pascal’s Triangle 143

56 Pascal’s Triangle II 145

57 Container With Most Water 147

58 Candy 149

59 Trapping Rain Water 151

60 Count and Say 153

61 Search for a Range 155

62 Basic Calculator 157

63 Group Anagrams 159

64 Shortest Palindrome 161

65 Rectangle Area 163

66 Summary Ranges 165

67 Increasing Triplet Subsequence 167

68 Get Target Number Using Number List and Arithmetic Operations 169

69 Reverse Vowels of a String 171

70 Flip Game 173

4 | 531 Program Creek


Contents

71 Flip Game II 175

72 Move Zeroes 177

73 Valid Anagram 179

74 Group Shifted Strings 181

75 Top K Frequent Elements 183

76 Find Peak Element 185

77 Word Pattern 187

78 Set Matrix Zeroes 189

79 Spiral Matrix 193

80 Spiral Matrix II 197

81 Search a 2D Matrix 199

82 Search a 2D Matrix II 201

83 Rotate Image 205

84 Valid Sudoku 207

85 Minimum Path Sum 209

86 Unique Paths 211

87 Unique Paths II 213

88 Number of Islands 215

89 Number of Islands II 217

90 Surrounded Regions 219

91 Maximal Rectangle 223

92 Maximal Square 225

93 Word Search 227

94 Word Search II 229

95 Integer Break 233

Program Creek 5 | 531


Contents

96 Range Sum Query 2D Immutable 235

97 Longest Increasing Path in a Matrix 237

98 Implement a Stack Using an Array in Java 239

99 Add Two Numbers 243

100 Reorder List 245

101 Linked List Cycle 251

102 Copy List with Random Pointer 253

103 Merge Two Sorted Lists 257

104 Odd Even Linked List 259

105 Remove Duplicates from Sorted List 261

106 Remove Duplicates from Sorted List II 263

107 Partition List 265

108 LRU Cache 267

109 Intersection of Two Linked Lists 271

110 Remove Linked List Elements 273

111 Swap Nodes in Pairs 275

112 Reverse Linked List 277

113 Reverse Linked List II 279

114 Remove Nth Node From End of List 281

115 Implement Stack using Queues 283

116 Implement Queue using Stacks 285

117 Palindrome Linked List 287

118 Implement a Queue using an Array in Java 289

119 Delete Node in a Linked List 291

120 Moving Average from Data Stream 293

6 | 531 Program Creek


Contents

121 Java PriorityQueue Class Example 295

122 Binary Tree Preorder Traversal 297

123 Binary Tree Inorder Traversal 299

124 Binary Tree Postorder Traversal 303

125 Binary Tree Level Order Traversal 307

126 Binary Tree Level Order Traversal II 309

127 Binary Tree Vertical Order Traversal 311

128 Invert Binary Tree 313

129 Kth Smallest Element in a BST 315

130 Binary Tree Longest Consecutive Sequence 317

131 Validate Binary Search Tree 321

132 Flatten Binary Tree to Linked List 323

133 Path Sum 325

134 Path Sum II 327

135 Construct Binary Tree from Inorder and Postorder Traversal 329

136 Construct Binary Tree from Preorder and Inorder Traversal 331

137 Convert Sorted Array to Binary Search Tree 333

138 Convert Sorted List to Binary Search Tree 335

139 Minimum Depth of Binary Tree 337

140 Binary Tree Maximum Path Sum 339

141 Balanced Binary Tree 341

142 Symmetric Tree 343

143 Binary Search Tree Iterator 345

144 Binary Tree Right Side View 347

145 Lowest Common Ancestor of a Binary Search Tree 349

Program Creek 7 | 531


Contents

146 Lowest Common Ancestor of a Binary Tree 351

147 Verify Preorder Serialization of a Binary Tree 353

148 Populating Next Right Pointers in Each Node 355

149 Populating Next Right Pointers in Each Node II 357

150 Unique Binary Search Trees 359

151 Unique Binary Search Trees II 361

152 Sum Root to Leaf Numbers 363

153 Count Complete Tree Nodes 365

154 Closest Binary Search Tree Value 367

155 Binary Tree Paths 369

156 Merge K Sorted Arrays in Java 371

157 Merge k Sorted Lists 373

158 Find Median from Data Stream 375

159 Implement Trie (Prefix Tree) 377

160 Add and Search Word Data structure design 381

161 Range Sum Query Mutable 385

162 The Skyline Problem 389

163 Clone Graph Java 391

164 Course Schedule 395

165 Course Schedule II 399

166 Reconstruct Itinerary 401

167 How Developers Sort in Java? 403

168 Solution Merge Sort LinkedList in Java 405

169 Quicksort Array in Java 409

170 Solution Sort a linked list using insertion sort in Java 411

8 | 531 Program Creek


Contents

171 Maximum Gap 415

172 First Missing Positive 417

173 Sort Colors 419

174 Edit Distance in Java 421

175 Distinct Subsequences Total 425

176 Longest Palindromic Substring 427

177 Word Break 431

178 Word Break II 435

179 Maximum Subarray 439

180 Maximum Product Subarray 441

181 Palindrome Partitioning 443

182 Palindrome Partitioning II 447

183 House Robber 449

184 House Robber II 451

185 House Robber III 453

186 Jump Game 455

187 Jump Game II 457

188 Best Time to Buy and Sell Stock 459

189 Best Time to Buy and Sell Stock II 461

190 Best Time to Buy and Sell Stock III 463

191 Best Time to Buy and Sell Stock IV 465

192 Dungeon Game 467

193 Decode Ways 469

194 Longest Common Subsequence 471

195 Longest Common Substring 473

Program Creek 9 | 531


Contents

196 Longest Increasing Subsequence 475

197 Coin Change 479

198 Single Number 481

199 Single Number II 483

200 Twitter Codility Problem Max Binary Gap 485

201 Number of 1 Bits 487

202 Reverse Bits 489

203 Repeated DNA Sequences 491

204 Bitwise AND of Numbers Range 493

205 Power of Two 495

206 Counting Bits 497

207 Maximum Product of Word Lengths 499

208 Permutations 501

209 Permutations II 505

210 Permutation Sequence 507

211 Generate Parentheses 509

212 Combination Sum 511

213 Combination Sum II 513

214 Combination Sum III 515

215 Combinations 517

216 Letter Combinations of a Phone Number 521

217 Restore IP Addresses 523

218 Reverse Integer 525

219 Palindrome Number 527

220 Pow(x, n) 529

10 | 531 Program Creek


Contents

Every title in the PDF is linked back to the original blog. When it is clicked, it opens
the original post in your browser. If you want to discuss any problem, please go to the
post and leave your comment there.
I’m not an expert and some solutions may not be optimal. So please leave your
comment if you see any problem or have a better solution. I will reply your comment
as soon as I can.
This collection is updated from time to time. Please check out this link for the lat-
est version: [Link]
interview/

Program Creek 11 | 531


1 Rotate Array in Java

You may have been using Java for a while. Do you think a simple Java array question
can be a challenge? Let’s use the following problem to test.
Problem: Rotate an array of n elements to the right by k steps. For example, with n
= 7 and k = 3, the array [1,2,3,4,5,6,7] is rotated to [5,6,7,1,2,3,4]. How many different
ways do you know to solve this problem?

1.1 Solution 1 - Intermediate Array

In a straightforward way, we can create a new array and then copy elements to the
new array. Then change the original array by using [Link]().
public void rotate(int[] nums, int k) {
if(k > [Link])
k=k%[Link];

int[] result = new int[[Link]];

for(int i=0; i < k; i++){


result[i] = nums[[Link]-k+i];
}

int j=0;
for(int i=k; i<[Link]; i++){
result[i] = nums[j];
j++;
}

[Link]( result, 0, nums, 0, [Link] );


}

Space is O(n) and time is O(n). You can check out the difference between Sys-
[Link]() and [Link]().

1.2 Solution 2 - Bubble Rotate

Can we do this in O(1) space?


This solution is like a bubble sort.
public static void rotate(int[] arr, int order) {
if (arr == null || order < 0) {

13 | 531
1 Rotate Array in Java

throw new IllegalArgumentException("Illegal argument!");


}

for (int i = 0; i < order; i++) {


for (int j = [Link] - 1; j > 0; j--) {
int temp = arr[j];
arr[j] = arr[j - 1];
arr[j - 1] = temp;
}
}
}

However, the time is O(n*k).


Here is an example (length=7, order=3):
i=0
0 1 2 3 4 5 6
0 1 2 3 4 6 5
...
6 0 1 2 3 4 5
i=1
6 0 1 2 3 5 4
...
5 6 0 1 2 3 4
i=2
5 6 0 1 2 4 3
...
4 5 6 0 1 2 3

1.3 Solution 3 - Reversal

Can we do this in O(1) space and in O(n) time? The following solution does.
Assuming we are given 1,2,3,4,5,6 and order 2. The basic idea is:
1. Divide the array two parts: 1,2,3,4 and 5, 6
2. Reverse first part: 4,3,2,1,5,6
3. Reverse second part: 4,3,2,1,6,5
4. Reverse the whole array: 5,6,1,2,3,4

public static void rotate(int[] arr, int order) {


if (arr == null || [Link]==0 || order < 0) {
throw new IllegalArgumentException("Illegal argument!");
}

if(order > [Link]){


order = order %[Link];
}

14 | 531 Program Creek


1 Rotate Array in Java

//length of first part


int a = [Link] - order;

reverse(arr, 0, a-1);
reverse(arr, a, [Link]-1);
reverse(arr, 0, [Link]-1);

public static void reverse(int[] arr, int left, int right){


if(arr == null || [Link] == 1)
return;

while(left < right){


int temp = arr[left];
arr[left] = arr[right];
arr[right] = temp;
left++;
right--;
}
}

Program Creek 15 | 531


2 Evaluate Reverse Polish Notation

Evaluate the value of an arithmetic expression in Reverse Polish Notation. Valid op-
erators are +, -, *, /. Each operand may be an integer or another expression. For
example:
["2", "1", "+", "3", "*"] -> ((2 + 1) * 3) -> 9
["4", "13", "5", "/", "+"] -> (4 + (13 / 5)) -> 6

2.1 Naive Approach

This problem can be solved by using a stack. We can loop through each element in the
given array. When it is a number, push it to the stack. When it is an operator, pop two
numbers from the stack, do the calculation, and push back the result.

The following is the code. However, this code contains compilation errors in leet-
code. Why?
public class Test {

public static void main(String[] args) throws IOException {


String[] tokens = new String[] { "2", "1", "+", "3", "*" };
[Link](evalRPN(tokens));
}

17 | 531
2 Evaluate Reverse Polish Notation

public static int evalRPN(String[] tokens) {


int returnValue = 0;
String operators = "+-*/";

Stack<String> stack = new Stack<String>();

for (String t : tokens) {


if (![Link](t)) { //push to stack if it is a number
[Link](t);
} else {//pop numbers from stack if it is an operator
int a = [Link]([Link]());
int b = [Link]([Link]());
switch (t) {
case "+":
[Link]([Link](a + b));
break;
case "-":
[Link]([Link](b - a));
break;
case "*":
[Link]([Link](a * b));
break;
case "/":
[Link]([Link](b / a));
break;
}
}
}

returnValue = [Link]([Link]());

return returnValue;
}
}

The problem is that switch string statement is only available from JDK 1.7. Leetcode
apparently use a JDK version below 1.7.

2.2 Accepted Solution

If you want to use switch statement, you can convert the above by using the following
code which use the index of a string "+-*/".
public class Solution {
public int evalRPN(String[] tokens) {

int returnValue = 0;

18 | 531 Program Creek


2 Evaluate Reverse Polish Notation

String operators = "+-*/";

Stack<String> stack = new Stack<String>();

for(String t : tokens){
if(![Link](t)){
[Link](t);
}else{
int a = [Link]([Link]());
int b = [Link]([Link]());
int index = [Link](t);
switch(index){
case 0:
[Link]([Link](a+b));
break;
case 1:
[Link]([Link](b-a));
break;
case 2:
[Link]([Link](a*b));
break;
case 3:
[Link]([Link](b/a));
break;
}
}
}

returnValue = [Link]([Link]());

return returnValue;

}
}

Program Creek 19 | 531


3 Isomorphic Strings

Given two strings s and t, determine if they are isomorphic. Two strings are isomor-
phic if the characters in s can be replaced to get t.
For example,"egg" and "add" are isomorphic, "foo" and "bar" are not.

3.1 Analysis

We need to define a method which accepts a map & a value, and returns the value’s
key in the map.

3.2 Java Solution

public boolean isIsomorphic(String s, String t) {


if(s==null || t==null)
return false;

if([Link]() != [Link]())
return false;

if([Link]()==0 && [Link]()==0)


return true;

HashMap<Character, Character> map = new HashMap<Character,Character>();


for(int i=0; i<[Link](); i++){
char c1 = [Link](i);
char c2 = [Link](i);

Character c = getKey(map, c2);


if(c != null && c!=c1){
return false;
}else if([Link](c1)){
if(c2 != [Link](c1))
return false;
}else{
[Link](c1,c2);
}
}

return true;
}

21 | 531
3 Isomorphic Strings

// a method for getting key of a target value


public Character getKey(HashMap<Character,Character> map, Character target){
for ([Link]<Character,Character> entry : [Link]()) {
if ([Link]().equals(target)) {
return [Link]();
}
}

return null;
}

22 | 531 Program Creek


4 Word Ladder

Given two words (start and end), and a dictionary, find the length of shortest transfor-
mation sequence from start to end, such that only one letter can be changed at a time
and each intermediate word must exist in the dictionary. For example, given:
start = "hit"
end = "cog"
dict = ["hot","dot","dog","lot","log"]

One shortest transformation is "hit" ->"hot" ->"dot" ->"dog" ->"cog", the program
should return its length 5.

4.1 Analysis

UPDATED on 06/07/2015.
So we quickly realize that this is a search problem, and breath-first search guarantees
the optimal solution.

4.2 Java Solution

class WordNode{
String word;
int numSteps;

public WordNode(String word, int numSteps){


[Link] = word;
[Link] = numSteps;
}
}

23 | 531
4 Word Ladder

public class Solution {


public int ladderLength(String beginWord, String endWord, Set<String>
wordDict) {
LinkedList<WordNode> queue = new LinkedList<WordNode>();
[Link](new WordNode(beginWord, 1));

[Link](endWord);

while(![Link]()){
WordNode top = [Link]();
String word = [Link];

if([Link](endWord)){
return [Link];
}

char[] arr = [Link]();


for(int i=0; i<[Link]; i++){
for(char c=’a’; c<=’z’; c++){
char temp = arr[i];
if(arr[i]!=c){
arr[i]=c;
}

String newWord = new String(arr);


if([Link](newWord)){
[Link](new WordNode(newWord, [Link]+1));
[Link](newWord);
}

arr[i]=temp;
}
}
}

return 0;
}
}

24 | 531 Program Creek


5 Word Ladder II

Given two words (start and end), and a dictionary, find all shortest transformation
sequence(s) from start to end, such that: 1) Only one letter can be changed at a time,
2) Each intermediate word must exist in the dictionary.
For example, given: start = "hit", end = "cog", and dict = ["hot","dot","dog","lot","log"],
return:
[
["hit","hot","dot","dog","cog"],
["hit","hot","lot","log","cog"]
]

5.1 Analysis

This is an extension of Word Ladder.


The idea is the same. To track the actual ladder, we need to add a pointer that points
to the previous node in the WordNode class.
In addition, the used word can not directly removed from the dictionary. The used
word is only removed when steps change.

5.2 Java Solution

class WordNode{
String word;
int numSteps;
WordNode pre;

public WordNode(String word, int numSteps, WordNode pre){


[Link] = word;
[Link] = numSteps;
[Link] = pre;
}
}

public class Solution {


public List<List<String>> findLadders(String start, String end,
Set<String> dict) {
List<List<String>> result = new ArrayList<List<String>>();

25 | 531
5 Word Ladder II

LinkedList<WordNode> queue = new LinkedList<WordNode>();


[Link](new WordNode(start, 1, null));

[Link](end);

int minStep = 0;

HashSet<String> visited = new HashSet<String>();


HashSet<String> unvisited = new HashSet<String>();
[Link](dict);

int preNumSteps = 0;

while(![Link]()){
WordNode top = [Link]();
String word = [Link];
int currNumSteps = [Link];

if([Link](end)){
if(minStep == 0){
minStep = [Link];
}

if([Link] == minStep && minStep !=0){


//nothing
ArrayList<String> t = new ArrayList<String>();
[Link]([Link]);
while([Link] !=null){
[Link](0, [Link]);
top = [Link];
}
[Link](t);
continue;
}

if(preNumSteps < currNumSteps){


[Link](visited);
}

preNumSteps = currNumSteps;

char[] arr = [Link]();


for(int i=0; i<[Link]; i++){
for(char c=’a’; c<=’z’; c++){
char temp = arr[i];
if(arr[i]!=c){
arr[i]=c;
}

26 | 531 Program Creek


5 Word Ladder II

String newWord = new String(arr);


if([Link](newWord)){
[Link](new WordNode(newWord, [Link]+1, top));
[Link](newWord);
}

arr[i]=temp;
}
}

return result;
}
}

Program Creek 27 | 531


6 Median of Two Sorted Arrays

There are two sorted arrays A and B of size m and n respectively. Find the median of the
two sorted arrays. The overall run time complexity should be O(log (m+n)).

6.1 Java Solution 1

If we see log(n), we should think about using binary something.


This problem can be converted to the problem of finding kth element, k is (A’s
length + B’ Length)/2.
If any of the two arrays is empty, then the kth element is the non-empty array’s kth
element. If k == 0, the kth element is the first element of A or B.
For normal cases(all other cases), we need to move the pointer at the pace of half of
an array length to get log(n) time.
public static double findMedianSortedArrays(int A[], int B[]) {
int m = [Link];
int n = [Link];

if ((m + n) % 2 != 0) // odd
return (double) findKth(A, B, (m + n) / 2, 0, m - 1, 0, n - 1);
else { // even
return (findKth(A, B, (m + n) / 2, 0, m - 1, 0, n - 1)
+ findKth(A, B, (m + n) / 2 - 1, 0, m - 1, 0, n - 1)) * 0.5;
}
}

public static int findKth(int A[], int B[], int k,


int aStart, int aEnd, int bStart, int bEnd) {

int aLen = aEnd - aStart + 1;


int bLen = bEnd - bStart + 1;

// Handle special cases


if (aLen == 0)
return B[bStart + k];
if (bLen == 0)
return A[aStart + k];
if (k == 0)
return A[aStart] < B[bStart] ? A[aStart] : B[bStart];

int aMid = aLen * k / (aLen + bLen); // a’s middle count


int bMid = k - aMid - 1; // b’s middle count

29 | 531
6 Median of Two Sorted Arrays

// make aMid and bMid to be array index


aMid = aMid + aStart;
bMid = bMid + bStart;

if (A[aMid] > B[bMid]) {


k = k - (bMid - bStart + 1);
aEnd = aMid;
bStart = bMid + 1;
} else {
k = k - (aMid - aStart + 1);
bEnd = bMid;
aStart = aMid + 1;
}

return findKth(A, B, k, aStart, aEnd, bStart, bEnd);


}

6.2 Java Solution 2

Solution 1 is a general solution to find the kth element. We can also come up with a
simpler solution which only finds the median of two sorted arrays for this particular
problem. Thanks to Gunner86. The description of the algorithm is awesome!
1) Calculate the medians m1 and m2 of the input arrays ar1[] and ar2[]
respectively.
2) If m1 and m2 both are equal then we are done, and return m1 (or m2)
3) If m1 is greater than m2, then median is present in one of the below two
subarrays.
a) From first element of ar1 to m1 (ar1[0...|_n/2_|])
b) From m2 to last element of ar2 (ar2[|_n/2_|...n-1])
4) If m2 is greater than m1, then median is present in one of the below two
subarrays.
a) From m1 to last element of ar1 (ar1[|_n/2_|...n-1])
b) From first element of ar2 to m2 (ar2[0...|_n/2_|])
5) Repeat the above process until size of both the subarrays becomes 2.
6) If size of the two arrays is 2 then use below formula to get the median.
Median = (max(ar1[0], ar2[0]) + min(ar1[1], ar2[1]))/2

30 | 531 Program Creek


7 Kth Largest Element in an Array

Find the kth largest element in an unsorted array. Note that it is the kth largest element
in the sorted order, not the kth distinct element.
For example, given [3,2,1,5,6,4] and k = 2, return 5.
Note: You may assume k is always valid, 1 ≤ k ≤ array’s length.

7.1 Java Solution 1 - Sorting

public int findKthLargest(int[] nums, int k) {


[Link](nums);
return nums[[Link]-k];
}

Time is O(nlog(n))

7.2 Java Solution 2 - Quick Sort

This problem can also be solve by using the quickselect approach, which is similar to
quicksort.
public int findKthLargest(int[] nums, int k) {
if (k < 1 || nums == null) {
return 0;
}

return getKth([Link] - k +1, nums, 0, [Link] - 1);


}

public int getKth(int k, int[] nums, int start, int end) {

int pivot = nums[end];

int left = start;


int right = end;

while (true) {

while (nums[left] < pivot && left < right) {


left++;
}

31 | 531
7 Kth Largest Element in an Array

while (nums[right] >= pivot && right > left) {


right--;
}

if (left == right) {
break;
}

swap(nums, left, right);


}

swap(nums, left, end);

if (k == left + 1) {
return pivot;
} else if (k < left + 1) {
return getKth(k, nums, start, left - 1);
} else {
return getKth(k, nums, left + 1, end);
}
}

public void swap(int[] nums, int n1, int n2) {


int tmp = nums[n1];
nums[n1] = nums[n2];
nums[n2] = tmp;
}

Average case time is O(n), worst case time is O(n2̂).

7.3 Java Solution 3 - Heap

We can use a min heap to solve this problem. The heap stores the top k elements.
Whenever the size is greater than k, delete the min. Time complexity is O(nlog(k)).
Space complexity is O(k) for storing the top k numbers.
public int findKthLargest(int[] nums, int k) {
PriorityQueue<Integer> q = new PriorityQueue<Integer>(k);
for(int i: nums){
[Link](i);

if([Link]()>k){
[Link]();
}
}

return [Link]();
}

32 | 531 Program Creek


8 Wildcard Matching

Implement wildcard pattern matching with support for ’?’ and ’*’.

8.1 Java Solution

To understand this solution, you can use s="aab" and p="*ab".


public boolean isMatch(String s, String p) {
int i = 0;
int j = 0;
int starIndex = -1;
int iIndex = -1;

while (i < [Link]()) {


if (j < [Link]() && ([Link](j) == ’?’ || [Link](j) == [Link](i)))
{
++i;
++j;
} else if (j < [Link]() && [Link](j) == ’*’) {
starIndex = j;
iIndex = i;
j++;
} else if (starIndex != -1) {
j = starIndex + 1;
i = iIndex+1;
iIndex++;
} else {
return false;
}
}

while (j < [Link]() && [Link](j) == ’*’) {


++j;
}

return j == [Link]();
}

33 | 531
9 Regular Expression Matching in Java

Implement regular expression matching with support for ’.’ and ’*’.
’.’ Matches any single character. ’*’ Matches zero or more of the preceding element.
The matching should cover the entire input string (not partial).
The function prototype should be: bool isMatch(const char *s, const char *p)
Some examples: isMatch("aa","a") return false isMatch("aa","aa") return true isMatch("aaa","aa")
return false isMatch("aa", "a*") return true isMatch("aa", ".*") return true isMatch("ab",
".*") return true isMatch("aab", "c*a*b") return true

9.1 Analysis

First of all, this is one of the most difficulty problems. It is hard to think through all
different cases. The problem should be simplified to handle 2 basic cases:

• the second char of pattern is "*"


• the second char of pattern is not "*"

For the 1st case, if the first char of pattern is not ".", the first char of pattern and
string should be the same. Then continue to match the remaining part.
For the 2nd case, if the first char of pattern is "." or first char of pattern == the first i
char of string, continue to match the remaining part.

9.2 Java Solution 1 (Short)

The following Java solution is accepted.


public class Solution {
public boolean isMatch(String s, String p) {

if([Link]() == 0)
return [Link]() == 0;

//p’s length 1 is special case


if([Link]() == 1 || [Link](1) != ’*’){
if([Link]() < 1 || ([Link](0) != ’.’ && [Link](0) !=
[Link](0)))
return false;
return isMatch([Link](1), [Link](1));

}else{

35 | 531
9 Regular Expression Matching in Java

int len = [Link]();

int i = -1;
while(i<len && (i < 0 || [Link](0) == ’.’ || [Link](0) ==
[Link](i))){
if(isMatch([Link](i+1), [Link](2)))
return true;
i++;
}
return false;
}
}
}

9.3 Java Solution 2 (More Readable)

public boolean isMatch(String s, String p) {


// base case
if ([Link]() == 0) {
return [Link]() == 0;
}

// special case
if ([Link]() == 1) {

// if the length of s is 0, return false


if ([Link]() < 1) {
return false;
}

//if the first does not match, return false


else if (([Link](0) != [Link](0)) && ([Link](0) != ’.’)) {
return false;
}

// otherwise, compare the rest of the string of s and p.


else {
return isMatch([Link](1), [Link](1));
}
}

// case 1: when the second char of p is not ’*’


if ([Link](1) != ’*’) {
if ([Link]() < 1) {
return false;
}
if (([Link](0) != [Link](0)) && ([Link](0) != ’.’)) {

36 | 531 Program Creek


9 Regular Expression Matching in Java

return false;
} else {
return isMatch([Link](1), [Link](1));
}
}

// case 2: when the second char of p is ’*’, complex case.


else {
//case 2.1: a char & ’*’ can stand for 0 element
if (isMatch(s, [Link](2))) {
return true;
}

//case 2.2: a char & ’*’ can stand for 1 or more preceding element,
//so try every sub string
int i = 0;
while (i<[Link]() && ([Link](i)==[Link](0) || [Link](0)==’.’)){
if (isMatch([Link](i + 1), [Link](2))) {
return true;
}
i++;
}
return false;
}
}

Program Creek 37 | 531


10 Merge Intervals

Problem:
Given a collection of intervals, merge all overlapping intervals.

For example,
Given [1,3],[2,6],[8,10],[15,18],
return [1,6],[8,10],[15,18].

10.1 Thoughts of This Problem

The key to solve this problem is defining a Comparator first to sort the arraylist of
Intevals. And then merge some intervals.
The take-away message from this problem is utilizing the advantage of sorted list/ar-
ray.

10.2 Java Solution

class Interval {
int start;
int end;

Interval() {
start = 0;
end = 0;
}

Interval(int s, int e) {
start = s;
end = e;
}
}

public class Solution {


public ArrayList<Interval> merge(ArrayList<Interval> intervals) {

if (intervals == null || [Link]() <= 1)


return intervals;

// sort intervals by using self-defined Comparator

39 | 531
10 Merge Intervals

[Link](intervals, new IntervalComparator());

ArrayList<Interval> result = new ArrayList<Interval>();

Interval prev = [Link](0);


for (int i = 1; i < [Link](); i++) {
Interval curr = [Link](i);

if ([Link] >= [Link]) {


// merged case
Interval merged = new Interval([Link], [Link]([Link],
[Link]));
prev = merged;
} else {
[Link](prev);
prev = curr;
}
}

[Link](prev);

return result;
}
}

class IntervalComparator implements Comparator<Interval> {


public int compare(Interval i1, Interval i2) {
return [Link] - [Link];
}
}

40 | 531 Program Creek


11 Insert Interval

Problem:
Given a set of non-overlapping & sorted intervals, insert a new interval into the intervals
(merge if necessary).
Example 1:
Given intervals [1,3],[6,9], insert and merge [2,5] in as [1,5],[6,9].

Example 2:
Given [1,2],[3,5],[6,7],[8,10],[12,16], insert and merge [4,9] in as
[1,2],[3,10],[12,16].

This is because the new interval [4,9] overlaps with [3,5],[6,7],[8,10].

11.1 Thoughts of This Problem

Quickly summarize 3 cases. Whenever there is intersection, created a new interval.

11.2 Java Solution

41 | 531
11 Insert Interval

/**
* Definition for an interval.
* public class Interval {
* int start;
* int end;
* Interval() { start = 0; end = 0; }
* Interval(int s, int e) { start = s; end = e; }
* }
*/
public class Solution {
public ArrayList<Interval> insert(ArrayList<Interval> intervals, Interval
newInterval) {

ArrayList<Interval> result = new ArrayList<Interval>();

for(Interval interval: intervals){


if([Link] < [Link]){
[Link](interval);
}else if([Link] > [Link]){
[Link](newInterval);
newInterval = interval;
}else if([Link] >= [Link] || [Link] <=
[Link]){
newInterval = new Interval([Link]([Link],
[Link]), [Link]([Link], [Link]));
}
}

[Link](newInterval);

return result;
}
}

42 | 531 Program Creek


12 Two Sum

Given an array of integers, find two numbers such that they add up to a specific target
number.
The function twoSum should return indices of the two numbers such that they add
up to the target, where index1 must be less than index2. Please note that your returned
answers (both index1 and index2) are not zero-based.
For example:
Input: numbers={2, 7, 11, 15}, target=9
Output: index1=1, index2=2

12.1 Naive Approach

This problem is pretty straightforward. We can simply examine every possible pair of
numbers in this integer array.
Time complexity in worst case: O(n2̂).
public static int[] twoSum(int[] numbers, int target) {
int[] ret = new int[2];
for (int i = 0; i < [Link]; i++) {
for (int j = i + 1; j < [Link]; j++) {
if (numbers[i] + numbers[j] == target) {
ret[0] = i + 1;
ret[1] = j + 1;
}
}
}
return ret;
}

Can we do better?

12.2 Better Solution

Use HashMap to store the target value.


public class Solution {
public int[] twoSum(int[] numbers, int target) {
HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();
int[] result = new int[2];

43 | 531
12 Two Sum

for (int i = 0; i < [Link]; i++) {


if ([Link](numbers[i])) {
int index = [Link](numbers[i]);
result[0] = index+1 ;
result[1] = i+1;
break;
} else {
[Link](target - numbers[i], i);
}
}

return result;
}
}

Time complexity depends on the put and get operations of HashMap which is nor-
mally O(1).
Time complexity of this solution is O(n).

44 | 531 Program Creek


13 Two Sum II Input array is sorted

This problem is similar to Two Sum.


To solve this problem, we can use two points to scan the array from both sides. See
Java solution below:
public int[] twoSum(int[] numbers, int target) {
if (numbers == null || [Link] == 0)
return null;

int i = 0;
int j = [Link] - 1;

while (i < j) {
int x = numbers[i] + numbers[j];
if (x < target) {
++i;
} else if (x > target) {
j--;
} else {
return new int[] { i + 1, j + 1 };
}
}

return null;
}

45 | 531
14 Two Sum III Data structure design

Design and implement a TwoSum class. It should support the following operations:
add and find.
add - Add the number to an internal data structure. find - Find if there exists any
pair of numbers which sum is equal to the value.
For example,
add(1);
add(3);
add(5);
find(4) -> true
find(7) -> false

14.1 Java Solution

Since the desired class need add and get operations, HashMap is a good option for
this purpose.
public class TwoSum {
private HashMap<Integer, Integer> elements = new HashMap<Integer,
Integer>();

public void add(int number) {


if ([Link](number)) {
[Link](number, [Link](number) + 1);
} else {
[Link](number, 1);
}
}

public boolean find(int value) {


for (Integer i : [Link]()) {
int target = value - i;
if ([Link](target)) {
if (i == target && [Link](target) < 2) {
continue;
}
return true;
}
}
return false;

47 | 531
14 Two Sum III Data structure design

}
}

48 | 531 Program Creek


15 3Sum

Problem:
Given an array S of n integers, are there elements a, b, c in S such that a + b + c = 0?
Find all unique triplets in the array which gives the sum of zero.
Note: Elements in a triplet (a,b,c) must be in non-descending order. (ie, a ≤ b ≤ c)
The solution set must not contain duplicate triplets.
For example, given array S = {-1 0 1 2 -1 -4},

A solution set is:


(-1, 0, 1)
(-1, -1, 2)

15.1 Naive Solution

Naive solution is 3 loops, and this gives time complexity O(n3̂). Apparently this is not
an acceptable solution, but a discussion can start from here.
public class Solution {
public ArrayList<ArrayList<Integer>> threeSum(int[] num) {
//sort array
[Link](num);

ArrayList<ArrayList<Integer>> result = new


ArrayList<ArrayList<Integer>>();
ArrayList<Integer> each = new ArrayList<Integer>();
for(int i=0; i<[Link]; i++){
if(num[i] > 0) break;

for(int j=i+1; j<[Link]; j++){


if(num[i] + num[j] > 0 && num[j] > 0) break;

for(int k=j+1; k<[Link]; k++){


if(num[i] + num[j] + num[k] == 0) {

[Link](num[i]);
[Link](num[j]);
[Link](num[k]);
[Link](each);
[Link]();
}

49 | 531
15 3Sum

}
}
}

return result;
}
}

* The solution also does not handle duplicates. Therefore, it is not only time ineffi-
cient, but also incorrect.
Result:
Submission Result: Output Limit Exceeded

15.2 Better Solution

A better solution is using two pointers instead of one. This makes time complexity of
O(n2̂).
To avoid duplicate, we can take advantage of sorted arrays, i.e., move pointers by
>1 to use same element only once.
public ArrayList<ArrayList<Integer>> threeSum(int[] num) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

if ([Link] < 3)
return result;

// sort array
[Link](num);

for (int i = 0; i < [Link] - 2; i++) {


// //avoid duplicate solutions
if (i == 0 || num[i] > num[i - 1]) {

int negate = -num[i];

int start = i + 1;
int end = [Link] - 1;

while (start < end) {


//case 1
if (num[start] + num[end] == negate) {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](num[i]);
[Link](num[start]);
[Link](num[end]);

[Link](temp);

50 | 531 Program Creek


15 3Sum

start++;
end--;
//avoid duplicate solutions
while (start < end && num[end] == num[end + 1])
end--;

while (start < end && num[start] == num[start - 1])


start++;
//case 2
} else if (num[start] + num[end] < negate) {
start++;
//case 3
} else {
end--;
}
}

}
}

return result;
}

Program Creek 51 | 531


16 4Sum

Given an array S of n integers, are there elements a, b, c, and d in S such that a + b + c


+ d = target? Find all unique quadruplets in the array which gives the sum of target.
Note: Elements in a quadruplet (a,b,c,d) must be in non-descending order. (ie, a ≤
b ≤ c ≤ d) The solution set must not contain duplicate quadruplets.
For example, given array S = {1 0 -1 0 -2 2}, and target = 0.

A solution set is:


(-1, 0, 0, 1)
(-2, -1, 1, 2)
(-2, 0, 0, 2)

16.1 Thoughts

A typical k-sum problem. Time is N to the power of (k-1).

16.2 Java Solution

public ArrayList<ArrayList<Integer>> fourSum(int[] num, int target) {


[Link](num);

HashSet<ArrayList<Integer>> hashSet = new HashSet<ArrayList<Integer>>();


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

for (int i = 0; i < [Link]; i++) {


for (int j = i + 1; j < [Link]; j++) {
int k = j + 1;
int l = [Link] - 1;

while (k < l) {
int sum = num[i] + num[j] + num[k] + num[l];

if (sum > target) {


l--;
} else if (sum < target) {
k++;
} else if (sum == target) {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](num[i]);

53 | 531
16 4Sum

[Link](num[j]);
[Link](num[k]);
[Link](num[l]);

if (![Link](temp)) {
[Link](temp);
[Link](temp);
}

k++;
l--;
}
}
}
}

return result;
}

Here is the hashCode method of ArrayList. It makes sure that if all elements of two
lists are the same, then the hash code of the two lists will be the same. Since each
element in the ArrayList is Integer, same integer has same hash code.
int hashCode = 1;
Iterator<E> i = [Link]();
while ([Link]()) {
E obj = [Link]();
hashCode = 31*hashCode + (obj==null ? 0 : [Link]());
}

54 | 531 Program Creek


17 3Sum Closest

Given an array S of n integers, find three integers in S such that the sum is closest to a
given number, target. Return the sum of the three integers. You may assume that each
input would have exactly one solution.
For example, given array S = {-1 2 1 -4}, and target = 1.
The sum that is closest to the target is 2. (-1 + 2 + 1 = 2).

17.1 Analysis

This problem is similar to 2 Sum. This kind of problem can be solved by using a
similar approach, i.e., two pointers from both left and right.

17.2 Java Solution

public int threeSumClosest(int[] nums, int target) {


int min = Integer.MAX_VALUE;
int result = 0;

[Link](nums);

for (int i = 0; i < [Link]; i++) {


int j = i + 1;
int k = [Link] - 1;
while (j < k) {
int sum = nums[i] + nums[j] + nums[k];
int diff = [Link](sum - target);

if(diff == 0) return sum;

if (diff < min) {


min = diff;
result = sum;
}
if (sum <= target) {
j++;
} else {
k--;
}
}

55 | 531
17 3Sum Closest

return result;
}

Time Complexity is O(n2̂).

56 | 531 Program Creek


18 String to Integer (atoi)

Implement atoi to convert a string to an integer.


Hint: Carefully consider all possible input cases. If you want a challenge, please do
not see below and ask yourself what are the possible input cases.

18.1 Analysis

The following cases should be considered for this problem:


1. null or empty string
2. white spaces
3. +/- sign
4. calculate real value
5. handle min & max

18.2 Java Solution

public int atoi(String str) {


if (str == null || [Link]() < 1)
return 0;

// trim white spaces


str = [Link]();

char flag = ’+’;

// check negative or positive


int i = 0;
if ([Link](0) == ’-’) {
flag = ’-’;
i++;
} else if ([Link](0) == ’+’) {
i++;
}
// use double to store result
double result = 0;

// calculate value
while ([Link]() > i && [Link](i) >= ’0’ && [Link](i) <= ’9’) {
result = result * 10 + ([Link](i) - ’0’);

57 | 531
18 String to Integer (atoi)

i++;
}

if (flag == ’-’)
result = -result;

// handle max and min


if (result > Integer.MAX_VALUE)
return Integer.MAX_VALUE;

if (result < Integer.MIN_VALUE)


return Integer.MIN_VALUE;

return (int) result;


}

58 | 531 Program Creek


19 Merge Sorted Array

Given two sorted integer arrays A and B, merge B into A as one sorted array.
Note: You may assume that A has enough space to hold additional elements from
B. The number of elements initialized in A and B are m and n respectively.

19.1 Analysis

The key to solve this problem is moving element of A and B backwards. If B has some
elements left after A is done, also need to handle that case.
The takeaway message from this problem is that the loop condition. This kind of
condition is also used for merging two sorted linked list.

19.2 Java Solution 1

public class Solution {


public void merge(int A[], int m, int B[], int n) {

while(m > 0 && n > 0){


if(A[m-1] > B[n-1]){
A[m+n-1] = A[m-1];
m--;
}else{
A[m+n-1] = B[n-1];
n--;
}
}

while(n > 0){


A[m+n-1] = B[n-1];
n--;
}
}
}

19.3 Java Solution 2

The loop condition also can use m+n like the following.

59 | 531
19 Merge Sorted Array

public void merge(int A[], int m, int B[], int n) {


int i = m - 1;
int j = n - 1;
int k = m + n - 1;

while (k >= 0) {
if (j < 0 || (i >= 0 && A[i] > B[j]))
A[k--] = A[i--];
else
A[k--] = B[j--];
}
}

60 | 531 Program Creek


20 Valid Parentheses

Given a string containing just the characters ’(’, ’)’, ’’, ’’, ’[’ and ’]’, determine if the
input string is valid. The brackets must close in the correct order, "()" and "()[]" are all
valid but "(]" and "([)]" are not.

20.1 Analysis

A typical problem which can be solved by using a stack data structure.

20.2 Java Solution

public static boolean isValid(String s) {


HashMap<Character, Character> map = new HashMap<Character, Character>();
[Link](’(’, ’)’);
[Link](’[’, ’]’);
[Link](’{’, ’}’);

Stack<Character> stack = new Stack<Character>();

for (int i = 0; i < [Link](); i++) {


char curr = [Link](i);

if ([Link]().contains(curr)) {
[Link](curr);
} else if ([Link]().contains(curr)) {
if (![Link]() && [Link]([Link]()) == curr) {
[Link]();
} else {
return false;
}
}
}

return [Link]();
}

61 | 531
21 Longest Valid Parentheses

Given a string containing just the characters ’(’ and ’)’, find the length of the longest
valid (well-formed) parentheses substring.
For "(()", the longest valid parentheses substring is "()", which has length = 2. An-
other example is ")()())", where the longest valid parentheses substring is "()()", which
has length = 4.

21.1 Analysis

This problem is similar with Valid Parentheses, which can be solved by using a stack.

21.2 Java Solution

public static int longestValidParentheses(String s) {


Stack<int[]> stack = new Stack<int[]>();
int result = 0;

for(int i=0; i<=[Link]()-1; i++){


char c = [Link](i);
if(c==’(’){
int[] a = {i,0};
[Link](a);
}else{
if([Link]()||[Link]()[1]==1){
int[] a = {i,1};
[Link](a);
}else{
[Link]();
int currentLen=0;
if([Link]()){
currentLen = i+1;
}else{
currentLen = [Link]()[0];
}
result = [Link](result, currentLen);
}
}
}

return result;

63 | 531
21 Longest Valid Parentheses

64 | 531 Program Creek


22 Implement strStr()

Problem:
Implement strStr(). Returns the index of the first occurrence of needle in haystack, or -1
if needle is not part of haystack.

22.1 Java Solution 1 - Naive

public int strStr(String haystack, String needle) {


if(haystack==null || needle==null)
return 0;

if([Link]() == 0)
return 0;

for(int i=0; i<[Link](); i++){


if(i + [Link]() > [Link]())
return -1;

int m = i;
for(int j=0; j<[Link](); j++){
if([Link](j)==[Link](m)){
if(j==[Link]()-1)
return i;
m++;
}else{
break;
}

}
}

return -1;
}

22.2 Java Solution 2 - KMP

Check out this article to understand KMP algorithm.


public int strStr(String haystack, String needle) {
if(haystack==null || needle==null)

65 | 531
22 Implement strStr()

return 0;

int h = [Link]();
int n = [Link]();

if (n > h)
return -1;
if (n == 0)
return 0;

int[] next = getNext(needle);


int i = 0;

while (i <= h - n) {
int success = 1;
for (int j = 0; j < n; j++) {
if ([Link](0) != [Link](i)) {
success = 0;
i++;
break;
} else if ([Link](j) != [Link](i + j)) {
success = 0;
i = i + j - next[j - 1];
break;
}
}
if (success == 1)
return i;
}

return -1;
}

//calculate KMP array


public int[] getNext(String needle) {
int[] next = new int[[Link]()];
next[0] = 0;

for (int i = 1; i < [Link](); i++) {


int index = next[i - 1];
while (index > 0 && [Link](index) != [Link](i)) {
index = next[index - 1];
}

if ([Link](index) == [Link](i)) {
next[i] = next[i - 1] + 1;
} else {
next[i] = 0;
}
}

66 | 531 Program Creek


22 Implement strStr()

return next;
}

Program Creek 67 | 531


23 Minimum Size Subarray Sum

Given an array of n positive integers and a positive integer s, find the minimal length
of a subarray of which the sum ≥ s. If there isn’t one, return 0 instead.
For example, given the array [2,3,1,2,4,3] and s = 7, the subarray [4,3] has the minimal
length of 2 under the problem constraint.

23.1 Analysis

We can use 2 points to mark the left and right boundaries of the sliding window. When
the sum is greater than the target, shift the left pointer; when the sum is less than the
target, shift the right pointer.

23.2 Java Solution 1

A simple sliding window solution.


public int minSubArrayLen(int s, int[] nums) {
if(nums==null || [Link]==1)
return 0;

int result = [Link];

int start=0;
int sum=0;
int i=0;
boolean exists = false;

while(i<=[Link]){
if(sum>=s){
exists=true; //mark if there exists such a subarray
if(start==i-1){
return 1;
}

result = [Link](result, i-start);


sum=sum-nums[start];
start++;

}else{
if(i==[Link])
break;

69 | 531
23 Minimum Size Subarray Sum

sum = sum+nums[i];
i++;
}
}

if(exists)
return result;
else
return 0;
}

23.3 Deprecated Java Solution

This solution works but it is less readable.


public int minSubArrayLen(int s, int[] nums) {
if(nums == null || [Link] == 0){
return 0;
}
if([Link] == 1 && nums[0] < s){
return 0;
}

// initialize min length to be the input array length


int result = [Link];

int i = 0;
int sum = nums[0];

for(int j=0; j<[Link]; ){


if(i==j){
if(nums[i]>=s){
return 1; //if single elem is large enough
}else{
j++;

if(j<[Link]){
sum = sum + nums[j];
}else{
return result;
}
}
}else{
//if sum is large enough, move left cursor
if(sum >= s){
result = [Link](j-i+1, result);
sum = sum - nums[i];
i++;

70 | 531 Program Creek


23 Minimum Size Subarray Sum

//if sum is not large enough, move right cursor


}else{
j++;

if(j<[Link]){
sum = sum + nums[j];
}else{
if(i==0){
return 0;
}else{
return result;
}
}
}
}
}

return result;
}

Program Creek 71 | 531


24 Search Insert Position

Given a sorted array and a target value, return the index if the target is found. If not,
return the index where it would be if it were inserted in order. You may assume no
duplicates in the array.
Here are few examples.
[1,3,5,6], 5 -> 2
[1,3,5,6], 2 -> 1
[1,3,5,6], 7 -> 4
[1,3,5,6], 0 -> 0

24.1 Solution 1

Naively, we can just iterate the array and compare target with ith and (i+1)th element.
Time complexity is O(n)
public class Solution {
public int searchInsert(int[] A, int target) {

if(A==null) return 0;

if(target <= A[0]) return 0;

for(int i=0; i<[Link]-1; i++){


if(target > A[i] && target <= A[i+1]){
return i+1;
}
}

return [Link];
}
}

24.2 Solution 2

This also looks like a binary search problem. We should try to make the complexity to
be O(log(n)).
public class Solution {
public int searchInsert(int[] A, int target) {

73 | 531
24 Search Insert Position

if(A==null||[Link]==0)
return 0;

return searchInsert(A,target,0,[Link]-1);
}

public int searchInsert(int[] A, int target, int start, int end){


int mid=(start+end)/2;

if(target==A[mid])
return mid;
else if(target<A[mid])
return start<mid?searchInsert(A,target,start,mid-1):start;
else
return end>mid?searchInsert(A,target,mid+1,end):(end+1);
}
}

74 | 531 Program Creek


25 Longest Consecutive Sequence

Given an unsorted array of integers, find the length of the longest consecutive elements
sequence.
For example, given [100, 4, 200, 1, 3, 2], the longest consecutive elements sequence
should be [1, 2, 3, 4]. Its length is 4.
Your algorithm should run in O(n) complexity.

25.1 Analysis

Because it requires O(n) complexity, we can not solve the problem by sorting the array
first. Sorting takes at least O(nlogn) time.

25.2 Java Solution

We can use a HashSet to add and remove elements. HashSet is implemented by using
a hash table. Elements are not ordered. The add, remove and contains methods have
constant time complexity O(1).
public static int longestConsecutive(int[] num) {
// if array is empty, return 0
if ([Link] == 0) {
return 0;
}

Set<Integer> set = new HashSet<Integer>();


int max = 1;

for (int e : num)


[Link](e);

for (int e : num) {


int left = e - 1;
int right = e + 1;
int count = 1;

while ([Link](left)) {
count++;
[Link](left);
left--;
}

75 | 531
25 Longest Consecutive Sequence

while ([Link](right)) {
count++;
[Link](right);
right++;
}

max = [Link](count, max);


}

return max;
}

After an element is checked, it should be removed from the set. Otherwise, time
complexity would be O(mn) in which m is the average length of all consecutive se-
quences.
To clearly see the time complexity, I suggest you use some simple examples and
manually execute the program. For example, given an array 1,2,4,5,3, the program
time is m. m is the length of longest consecutive sequence.

76 | 531 Program Creek


26 Valid Palindrome

Given a string, determine if it is a palindrome, considering only alphanumeric charac-


ters and ignoring cases.
For example, "Red rum, sir, is murder" is a palindrome, while "Programcreek is
awesome" is not.
Note: Have you consider that the string might be empty? This is a good question to
ask during an interview.
For the purpose of this problem, we define empty string as valid palindrome.

26.1 Thoughts

From start and end loop though the string, i.e., char array. If it is not alpha or num-
ber, increase or decrease pointers. Compare the alpha and numeric characters. The
solution below is pretty straightforward.

26.2 Java Solution 1 - Naive

public class Solution {

public boolean isPalindrome(String s) {

if(s == null) return false;


if([Link]() < 2) return true;

char[] charArray = [Link]();


int len = [Link]();

int i=0;
int j=len-1;

while(i<j){
char left, right;

while(i<len-1 && !isAlpha(left) && !isNum(left)){


i++;
left = charArray[i];
}

while(j>0 && !isAlpha(right) && !isNum(right)){


j--;

77 | 531
26 Valid Palindrome

right = charArray[j];
}

if(i >= j)
break;

left = charArray[i];
right = charArray[j];

if(!isSame(left, right)){
return false;
}

i++;
j--;
}
return true;
}

public boolean isAlpha(char a){


if((a >= ’a’ && a <= ’z’) || (a >= ’A’ && a <= ’Z’)){
return true;
}else{
return false;
}
}

public boolean isNum(char a){


if(a >= ’0’ && a <= ’9’){
return true;
}else{
return false;
}
}

public boolean isSame(char a, char b){


if(isNum(a) && isNum(b)){
return a == b;
}else if([Link](a) == [Link](b)){
return true;
}else{
return false;
}
}
}

78 | 531 Program Creek


26 Valid Palindrome

26.3 Java Solution 2 - Using Stack

This solution removes the special characters first. (Thanks to Tia)


public boolean isPalindrome(String s) {
s = [Link]("[^a-zA-Z0-9]", "").toLowerCase();

int len = [Link]();


if (len < 2)
return true;

Stack<Character> stack = new Stack<Character>();

int index = 0;
while (index < len / 2) {
[Link]([Link](index));
index++;
}

if (len % 2 == 1)
index++;

while (index < len) {


if ([Link]())
return false;

char temp = [Link]();


if ([Link](index) != temp)
return false;
else
index++;
}

return true;
}

26.4 Java Solution 3 - Using Two Pointers

In the discussion below, April and Frank use two pointers to solve this problem. This
solution looks really simple.
public class ValidPalindrome {
public static boolean isValidPalindrome(String s){
if(s==null||[Link]()==0) return false;

s = [Link]("[^a-zA-Z0-9]", "").toLowerCase();
[Link](s);

Program Creek 79 | 531


26 Valid Palindrome

for(int i = 0; i < [Link]() ; i++){


if([Link](i) != [Link]([Link]() - 1 - i)){
return false;
}
}

return true;
}

public static void main(String[] args) {


String str = "A man, a plan, a canal: Panama";

[Link](isValidPalindrome(str));
}
}

80 | 531 Program Creek


27 ZigZag Conversion

The string "PAYPALISHIRING" is written in a zigzag pattern on a given number of


rows like this: (you may want to display this pattern in a fixed font for better legibility)
P A H N
A P L S I I G
Y I R

And then read line by line: "PAHNAPLSIIGYIR" Write the a method convert("PAYPALISHIRING",
3) which returns "PAHNAPLSIIGYIR".

27.1 Java Solution

public String convert(String s, int numRows) {


if (numRows == 1)
return s;

StringBuilder sb = new StringBuilder();


// step
int step = 2 * numRows - 2;

for (int i = 0; i < numRows; i++) {


//first & last rows
if (i == 0 || i == numRows - 1) {
for (int j = i; j < [Link](); j = j + step) {
[Link]([Link](j));
}
//middle rows
} else {
int j = i;
boolean flag = true;
int step1 = 2 * (numRows - 1 - i);
int step2 = step - step1;

while (j < [Link]()) {


[Link]([Link](j));
if (flag)
j = j + step1;
else
j = j + step2;
flag = !flag;
}

81 | 531
27 ZigZag Conversion

}
}

return [Link]();
}

82 | 531 Program Creek


28 Add Binary

Given two binary strings, return their sum (also a binary string).
For example, a = "11", b = "1", the return is "100".

28.1 Java Solution

Very simple, nothing special. Note how to convert a character to an int.


public String addBinary(String a, String b) {
if(a==null || [Link]()==0)
return b;
if(b==null || [Link]()==0)
return a;

int pa = [Link]()-1;
int pb = [Link]()-1;

int flag = 0;
StringBuilder sb = new StringBuilder();
while(pa >= 0 || pb >=0){
int va = 0;
int vb = 0;

if(pa >= 0){


va = [Link](pa)==’0’? 0 : 1;
pa--;
}
if(pb >= 0){
vb = [Link](pb)==’0’? 0: 1;
pb--;
}

int sum = va + vb + flag;


if(sum >= 2){
[Link]([Link](sum-2));
flag = 1;
}else{
flag = 0;
[Link]([Link](sum));
}
}

if(flag == 1){

83 | 531
28 Add Binary

[Link]("1");
}

String reversed = [Link]().toString();


return reversed;
}

84 | 531 Program Creek


29 Length of Last Word

Given a string s consists of upper/lower-case alphabets and empty space characters ’


’, return the length of last word in the string. If the last word does not exist, return 0.

29.1 Java Solution

Very simple question. We just need a flag to mark the start of letters from the end. If
a letter starts and the next character is not a letter, return the length.
public int lengthOfLastWord(String s) {
if(s==null || [Link]() == 0)
return 0;

int result = 0;
int len = [Link]();

boolean flag = false;


for(int i=len-1; i>=0; i--){
char c = [Link](i);
if((c>=’a’ && c<=’z’) || (c>=’A’ && c<=’Z’)){
flag = true;
result++;
}else{
if(flag)
return result;
}
}

return result;
}

85 | 531
30 Triangle

Given a triangle, find the minimum path sum from top to bottom. Each step you may
move to adjacent numbers on the row below.
For example, given the following triangle
[
[2],
[3,4],
[6,5,7],
[4,1,8,3]
]

The minimum path sum from top to bottom is 11 (i.e., 2 + 3 + 5 + 1 = 11).


Note: Bonus point if you are able to do this using only O(n) extra space, where n is
the total number of rows in the triangle.

30.1 Top-Down Approach (Wrong Answer!)

This solution gets wrong answer! I will try to make it work later.
public class Solution {
public int minimumTotal(ArrayList<ArrayList<Integer>> triangle) {

int[] temp = new int[[Link]()];


int minTotal = Integer.MAX_VALUE;

for(int i=0; i< [Link]; i++){


temp[i] = Integer.MAX_VALUE;
}

if ([Link]() == 1) {
return [Link](minTotal, [Link](0).get(0));
}

int first = [Link](0).get(0);

for (int i = 0; i < [Link]() - 1; i++) {


for (int j = 0; j <= i; j++) {

int a, b;

if(i==0 && j==0){

87 | 531
30 Triangle

a = first + [Link](i + 1).get(j);


b = first + [Link](i + 1).get(j + 1);

}else{
a = temp[j] + [Link](i + 1).get(j);
b = temp[j] + [Link](i + 1).get(j + 1);

temp[j] = [Link](a, temp[j]);


temp[j + 1] = [Link](b, temp[j + 1]);
}
}

for (int e : temp) {


if (e < minTotal)
minTotal = e;
}

return minTotal;
}
}

30.2 Bottom-Up (Good Solution)

We can actually start from the bottom of the triangle.


public int minimumTotal(ArrayList<ArrayList<Integer>> triangle) {
int[] total = new int[[Link]()];
int l = [Link]() - 1;

for (int i = 0; i < [Link](l).size(); i++) {


total[i] = [Link](l).get(i);
}

// iterate from last second row


for (int i = [Link]() - 2; i >= 0; i--) {
for (int j = 0; j < [Link](i + 1).size() - 1; j++) {
total[j] = [Link](i).get(j) + [Link](total[j], total[j + 1]);
}
}

return total[0];
}

88 | 531 Program Creek


31 Contains Duplicate

Given an array of integers, find if the array contains any duplicates. Your function
should return true if any value appears at least twice in the array, and it should return
false if every element is distinct.

31.1 Java Solution

public boolean containsDuplicate(int[] nums) {


if(nums==null || [Link]==0)
return false;

HashSet<Integer> set = new HashSet<Integer>();


for(int i: nums){
if(![Link](i)){
return true;
}
}

return false;
}

89 | 531
32 Contains Duplicate II

Given an array of integers and an integer k, return true if and only if there are two
distinct indices i and j in the array such that nums[i] = nums[j] and the difference
between i and j is at most k.

32.1 Java Solution 1

public boolean containsNearbyDuplicate(int[] nums, int k) {


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();
int min = Integer.MAX_VALUE;

for(int i=0; i<[Link]; i++){


if([Link](nums[i])){
int preIndex = [Link](nums[i]);
int gap = i-preIndex;
min = [Link](min, gap);
}
[Link](nums[i], i);
}

if(min <= k){


return true;
}else{
return false;
}
}

32.2 Java Solution 2 - Simplified

public boolean containsNearbyDuplicate(int[] nums, int k) {


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();

for(int i=0; i<[Link]; i++){


if([Link](nums[i])){
int pre = [Link](nums[i]);
if(i-pre<=k)
return true;
}

91 | 531
32 Contains Duplicate II

[Link](nums[i], i);
}

return false;
}

92 | 531 Program Creek


33 Contains Duplicate III

Given an array of integers, find out whether there are two distinct indices i and j in
the array such that the difference between nums[i] and nums[j] is at most t and the
difference between i and j is at most k.

33.1 Java Solution 1

This solution uses a treeset.

The time complexity is O(nlog(k)).


public boolean containsNearbyAlmostDuplicate(int[] nums, int k, int t) {
if (k < 1 || t < 0)
return false;

TreeSet<Integer> set = new TreeSet<Integer>();

for (int i = 0; i < [Link]; i++) {


int c = nums[i];
if (([Link](c) != null && c <= [Link](c) + t)
|| ([Link](c) != null && c >= [Link](c) -t))
return true;

[Link](c);

if (i >= k)
[Link](nums[i - k]);
}

return false;
}

93 | 531
33 Contains Duplicate III

33.2 Java Solution 2

Another solution that is easier to understand.


public boolean containsNearbyAlmostDuplicate(int[] nums, int k, int t) {
if (k < 1 || t < 0)
return false;

SortedSet<Long> set = new TreeSet<Long>();

for (int j = 0; j < [Link]; j++) {


long leftBoundary = (long) nums[j] - t;
long rightBoundary = (long) nums[j] + t + 1;
SortedSet<Long> subSet = [Link](leftBoundary, rightBoundary);

if (![Link]())
return true;

[Link]((long) nums[j]);

if (j >= k) {
[Link]((long) nums[j - k]);
}
}

return false;
}

94 | 531 Program Creek


34 Remove Duplicates from Sorted Array

Given a sorted array, remove the duplicates in place such that each element appear
only once and return the new length. Do not allocate extra space for another array,
you must do this in place with constant memory.
For example, given input array A = [1,1,2], your function should return length = 2,
and A is now [1,2].

34.1 Thoughts

The problem is pretty straightforward. It returns the length of array with unique
elements, but the original array need to be changed also. This problem should be
reviewed with Remove Duplicates from Sorted Array II.

34.2 Solution 1

// Manipulate original array


public static int removeDuplicatesNaive(int[] A) {
if ([Link] < 2)
return [Link];

int j = 0;
int i = 1;

while (i < [Link]) {


if (A[i] == A[j]) {
i++;
} else {
j++;
A[j] = A[i];
i++;
}
}

return j + 1;
}

This method returns the number of unique elements, but does not change the orig-
inal array correctly. For example, if the input array is 1, 2, 2, 3, 3, the array will be
changed to 1, 2, 3, 3, 3. The correct result should be 1, 2, 3. Because array’s size can

95 | 531
34 Remove Duplicates from Sorted Array

not be changed once created, there is no way we can return the original array with
correct results.

34.3 Solution 2

// Create an array with all unique elements


public static int[] removeDuplicates(int[] A) {
if ([Link] < 2)
return A;

int j = 0;
int i = 1;

while (i < [Link]) {


if (A[i] == A[j]) {
i++;
} else {
j++;
A[j] = A[i];
i++;
}
}

int[] B = [Link](A, j + 1);

return B;
}

public static void main(String[] args) {


int[] arr = { 1, 2, 2, 3, 3 };
arr = removeDuplicates(arr);
[Link]([Link]);
}

In this method, a new array is created and returned.

34.4 Solution 3

If we only want to count the number of unique elements, the following method is
good enough.
// Count the number of unique elements
public static int countUnique(int[] A) {
int count = 0;
for (int i = 0; i < [Link] - 1; i++) {
if (A[i] == A[i + 1]) {
count++;

96 | 531 Program Creek


34 Remove Duplicates from Sorted Array

}
}
return ([Link] - count);
}

public static void main(String[] args) {


int[] arr = { 1, 2, 2, 3, 3 };
int size = countUnique(arr);
[Link](size);
}

Program Creek 97 | 531


35 Remove Duplicates from Sorted Array
II

Follow up for "Remove Duplicates": What if duplicates are allowed at most twice?
For example, given sorted array A = [1,1,1,2,2,3], your function should return length
= 5, and A is now [1,1,2,2,3].

35.1 Naive Approach

Given the method signature "public int removeDuplicates(int[] A)", it seems that we
should write a method that returns a integer and that’s it. After typing the following
solution:
public class Solution {
public int removeDuplicates(int[] A) {
if(A == null || [Link] == 0)
return 0;

int pre = A[0];


boolean flag = false;
int count = 0;

for(int i=1; i<[Link]; i++){


int curr = A[i];

if(curr == pre){
if(!flag){
flag = true;
continue;
}else{
count++;
}
}else{
pre = curr;
flag = false;
}
}

return [Link] - count;


}
}

99 | 531
35 Remove Duplicates from Sorted Array II

Online Judge returns:


Submission Result: Wrong Answer
Input: [1,1,1,2]
Output: [1,1,1]
Expected: [1,1,2]

So this problem also requires in-place array manipulation.

35.2 Correct Solution

We can not change the given array’s size, so we only change the first k elements of the
array which has duplicates removed.
public class Solution {
public int removeDuplicates(int[] A) {
if (A == null || [Link] == 0)
return 0;

int pre = A[0];


boolean flag = false;
int count = 0;

// index for updating


int o = 1;

for (int i = 1; i < [Link]; i++) {


int curr = A[i];

if (curr == pre) {
if (!flag) {
flag = true;
A[o++] = curr;

continue;
} else {
count++;
}
} else {
pre = curr;
A[o++] = curr;
flag = false;
}
}

return [Link] - count;


}
}

100 | 531 Program Creek


35 Remove Duplicates from Sorted Array II

35.3 Better Solution

public class Solution {


public int removeDuplicates(int[] A) {
if ([Link] <= 2)
return [Link];

int prev = 1; // point to previous


int curr = 2; // point to current

while (curr < [Link]) {


if (A[curr] == A[prev] && A[curr] == A[prev - 1]) {
curr++;
} else {
prev++;
A[prev] = A[curr];
curr++;
}
}

return prev + 1;
}
}

Program Creek 101 | 531


36 Longest Substring Without Repeating
Characters

Given a string, find the length of the longest substring without repeating characters.
For example, the longest substring without repeating letters for "abcabcbb" is "abc",
which the length is 3. For "bbbbb" the longest substring is "b", with the length of 1.

36.1 Java Solution 1

The first solution is like the problem of "determine if a string has all unique characters"
in CC 150. We can use a flag array to track the existing characters for the longest
substring without repeating characters.
public int lengthOfLongestSubstring(String s) {
if(s==null)
return 0;
boolean[] flag = new boolean[256];

int result = 0;
int start = 0;
char[] arr = [Link]();

for (int i = 0; i < [Link]; i++) {


char current = arr[i];
if (flag[current]) {
result = [Link](result, i - start);
// the loop update the new start point
// and reset flag array
// for example, abccab, when it comes to 2nd c,
// it update start from 0 to 3, reset flag for a,b
for (int k = start; k < i; k++) {
if (arr[k] == current) {
start = k + 1;
break;
}
flag[arr[k]] = false;
}
} else {
flag[current] = true;
}
}

103 | 531
36 Longest Substring Without Repeating Characters

result = [Link]([Link] - start, result);

return result;
}

36.2 Java Solution 2

This solution is from Tia. It is easier to understand than the first solution.
The basic idea is using a hash table to track existing characters and their posi-
tion. When a repeated character occurs, check from the previously repeated character.
However, the time complexity is higher - O(n3̂).
public static int lengthOfLongestSubstring(String s) {
if(s==null)
return 0;
char[] arr = [Link]();
int pre = 0;

HashMap<Character, Integer> map = new HashMap<Character, Integer>();

for (int i = 0; i < [Link]; i++) {


if (![Link](arr[i])) {
[Link](arr[i], i);
} else {
pre = [Link](pre, [Link]());
i = [Link](arr[i]);
[Link]();
}
}

return [Link](pre, [Link]());


}

Consider the following simple example.


abcda

When loop hits the second "a", the HashMap contains the following:
a 0
b 1
c 2
d 3

The index i is set to 0 and incremented by 1, so the loop start from second element
again.

104 | 531 Program Creek


37 Longest Substring Which Contains 2
Unique Characters

This is a problem asked by Google.


Given a string, find the longest substring that contains only two unique charac-
ters. For example, given "abcbbbbcccbdddadacb", the longest substring that contains
2 unique character is "bcbbbbcccb".

37.1 Longest Substring Which Contains 2 Unique


Characters

In this solution, a hashmap is used to track the unique elements in the map. When a
third character is added to the map, the left pointer needs to move right.
You can use "abac" to walk through this solution.
public int lengthOfLongestSubstringTwoDistinct(String s) {
int max=0;
HashMap<Character,Integer> map = new HashMap<Character, Integer>();
int start=0;

for(int i=0; i<[Link](); i++){


char c = [Link](i);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c,1);
}

if([Link]()>2){
max = [Link](max, i-start);

while([Link]()>2){
char t = [Link](start);
int count = [Link](t);
if(count>1){
[Link](t, count-1);
}else{
[Link](t);
}
start++;
}

105 | 531
37 Longest Substring Which Contains 2 Unique Characters

}
}

max = [Link](max, [Link]()-start);

return max;
}

Now if this question is extended to be "the longest substring that contains k unique
characters", what should we do?

37.2 Solution for K Unique Characters

The following solution is corrected. Given "abcadcacacaca" and 3, it returns "cadcaca-


caca".
public int lengthOfLongestSubstringKDistinct(String s, int k) {
int max=0;
HashMap<Character,Integer> map = new HashMap<Character, Integer>();
int start=0;

for(int i=0; i<[Link](); i++){


char c = [Link](i);
if([Link](c)){
[Link](c, [Link](c)+1);
}else{
[Link](c,1);
}

if([Link]()>k){
max = [Link](max, i-start);

while([Link]()>k){
char t = [Link](start);
int count = [Link](t);
if(count>1){
[Link](t, count-1);
}else{
[Link](t);
}
start++;
}
}
}

max = [Link](max, [Link]()-start);

return max;
}

106 | 531 Program Creek


37 Longest Substring Which Contains 2 Unique Characters

Time is O(n).

Program Creek 107 | 531


38 Substring with Concatenation of All
Words

You are given a string, s, and a list of words, words, that are all of the same length.
Find all starting indices of substring(s) in s that is a concatenation of each word in
words exactly once and without any intervening characters.
For example, given: s="barfoothefoobarman" & words=["foo", "bar"], return [0,9].

38.1 Analysis

This problem is similar (almost the same) to Longest Substring Which Contains 2
Unique Characters.
Since each word in the dictionary has the same length, each of them can be treated
as a single character.

38.2 Java Solution

public List<Integer> findSubstring(String s, String[] words) {


ArrayList<Integer> result = new ArrayList<Integer>();
if(s==null||[Link]()==0||words==null||[Link]==0){
return result;
}

//frequency of words
HashMap<String, Integer> map = new HashMap<String, Integer>();
for(String w: words){
if([Link](w)){
[Link](w, [Link](w)+1);
}else{
[Link](w, 1);
}
}

int len = words[0].length();

for(int j=0; j<len; j++){


HashMap<String, Integer> currentMap = new HashMap<String, Integer>();
int start = j;//start index of start
int count = 0;//count totoal qualified words so far

109 | 531
38 Substring with Concatenation of All Words

for(int i=j; i<=[Link]()-len; i=i+len){


String sub = [Link](i, i+len);
if([Link](sub)){
//set frequency in current map
if([Link](sub)){
[Link](sub, [Link](sub)+1);
}else{
[Link](sub, 1);
}

count++;

while([Link](sub)>[Link](sub)){
String left = [Link](start, start+len);
[Link](left, [Link](left)-1);

count--;
start = start + len;
}

if(count==[Link]){
[Link](start); //add to result

//shift right and reset currentMap, count & start point


String left = [Link](start, start+len);
[Link](left, [Link](left)-1);
count--;
start = start + len;
}
}else{
[Link]();
start = i+len;
count = 0;
}
}
}

return result;
}

110 | 531 Program Creek


39 Minimum Window Substring

Given a string S and a string T, find the minimum window in S which will contain all
the characters in T in complexity O(n).
For example, S = "ADOBECODEBANC", T = "ABC", Minimum window is "BANC".

39.1 Java Solution

public String minWindow(String s, String t) {


if([Link]()>[Link]())
return "";
String result = "";

//character counter for t


HashMap<Character, Integer> target = new HashMap<Character, Integer>();
for(int i=0; i<[Link](); i++){
char c = [Link](i);
if([Link](c)){
[Link](c,[Link](c)+1);
}else{
[Link](c,1);
}
}

// character counter for s


HashMap<Character, Integer> map = new HashMap<Character, Integer>();
int left = 0;
int minLen = [Link]()+1;

int count = 0; // the total of mapped characters

for(int i=0; i<[Link](); i++){


char c = [Link](i);

if([Link](c)){
if([Link](c)){
if([Link](c)<[Link](c)){
count++;
}
[Link](c,[Link](c)+1);
}else{
[Link](c,1);
count++;

111 | 531
39 Minimum Window Substring

}
}

if(count == [Link]()){
char sc = [Link](left);
while (![Link](sc) || [Link](sc) > [Link](sc)) {
if ([Link](sc) && [Link](sc) > [Link](sc))
[Link](sc, [Link](sc) - 1);
left++;
sc = [Link](left);
}

if (i - left + 1 < minLen) {


result = [Link](left, i + 1);
minLen = i - left + 1;
}
}
}

return result;
}

112 | 531 Program Creek


40 Reverse Words in a String

Given an input string, reverse the string word by word.


For example, given s = "the sky is blue", return "blue is sky the".

40.1 Java Solution

This problem is pretty straightforward. We first split the string to words array, and
then iterate through the array and add each element to a new string. Note: String-
Builder should be used to avoid creating too many Strings. If the string is very long,
using String is not scalable since String is immutable and too many objects will be
created and garbage collected.
class Solution {
public String reverseWords(String s) {
if (s == null || [Link]() == 0) {
return "";
}

// split to words by space


String[] arr = [Link](" ");
StringBuilder sb = new StringBuilder();
for (int i = [Link] - 1; i >= 0; --i) {
if (!arr[i].equals("")) {
[Link](arr[i]).append(" ");
}
}
return [Link]() == 0 ? "" : [Link](0, [Link]() - 1);
}
}

113 | 531
41 Find Minimum in Rotated Sorted
Array

Suppose a sorted array is rotated at some pivot unknown to you beforehand. (i.e., 0 1
2 4 5 6 7 might become 4 5 6 7 0 1 2).
Find the minimum [Link] may assume no duplicate exists in the array.

41.1 Analysis

This problem is a binary search and the key is breaking the array to two parts, so that
we only need to work on half of the array each time.
If we pick the middle element, we can compare the middle element with the leftmost
(or rightmost) element. If the middle element is less than leftmost, the left half should
be selected; if the middle element is greater than the leftmost (or rightmost), the right
half should be selected. Using recursion or iteration, this problem can be solved in
time log(n).
In addition, in any rotated sorted array, the rightmost element should be less than
the left-most element, otherwise, the sorted array is not rotated and we can simply
pick the leftmost element as the minimum.

41.2 Java Solution 1 - Recursion

Define a helper function, otherwise, we will need to use [Link]() func-


tion, which may be expensive for large arrays.
public int findMin(int[] num) {
return findMin(num, 0, [Link] - 1);
}

public int findMin(int[] num, int left, int right) {


if (left == right)
return num[left];
if ((right - left) == 1)
return [Link](num[left], num[right]);

int middle = left + (right - left) / 2;

// not rotated
if (num[left] < num[right]) {
return num[left];

115 | 531
41 Find Minimum in Rotated Sorted Array

// go right side
} else if (num[middle] > num[left]) {
return findMin(num, middle, right);

// go left side
} else {
return findMin(num, left, middle);
}
}

41.3 Java Solution 2 - Iteration

public int findMin(int[] nums) {


if([Link]==1)
return nums[0];

int left=0;
int right=[Link]-1;

//not rotated
if(nums[left]<nums[right])
return nums[left];

while(left <= right){


if(right-left==1){
return nums[right];
}

int m = left + (right-left)/2;

if(nums[m] > nums[right])


left = m;
else
right = m;
}

return nums[left];
}

116 | 531 Program Creek


42 Find Minimum in Rotated Sorted
Array II

42.1 Problem

Follow up for "Find Minimum in Rotated Sorted Array": What if duplicates are al-
lowed?
Would this affect the run-time complexity? How and why?

42.2 Java Solution

This is a follow-up problem of finding minimum element in rotated sorted array with-
out duplicate elements. We only need to add one more condition, which checks if
the left-most element and the right-most element are equal. If they are we can simply
drop one of them. In my solution below, I drop the left element whenever the left-most
equals to the right-most.
public int findMin(int[] num) {
return findMin(num, 0, [Link]-1);
}

public int findMin(int[] num, int left, int right){


if(right==left){
return num[left];
}
if(right == left +1){
return [Link](num[left], num[right]);
}
// 3 3 1 3 3 3

int middle = (right-left)/2 + left;


// already sorted
if(num[right] > num[left]){
return num[left];
//right shift one
}else if(num[right] == num[left]){
return findMin(num, left+1, right);
//go right
}else if(num[middle] >= num[left]){
return findMin(num, middle, right);
//go left

117 | 531
42 Find Minimum in Rotated Sorted Array II

}else{
return findMin(num, left, middle);
}
}

118 | 531 Program Creek


43 Search in Rotated Sorted Array

Suppose a sorted array is rotated at some pivot unknown to you beforehand. (i.e., 0 1
2 4 5 6 7 might become 4 5 6 7 0 1 2).
You are given a target value to search. If found in the array return its index, other-
wise return -1. You may assume no duplicate exists in the array.

43.1 Java Solution 1- Recusive

public int search(int[] nums, int target) {


return binarySearch(nums, 0, [Link]-1, target);
}

public int binarySearch(int[] nums, int left, int right, int target){
if(left>right)
return -1;

int mid = left + (right-left)/2;

if(target == nums[mid])
return mid;

if(nums[left] <= nums[mid]){


if(nums[left]<=target && target<nums[mid]){
return binarySearch(nums,left, mid-1, target);
}else{
return binarySearch(nums, mid+1, right, target);
}
}else {
if(nums[mid]<target&& target<=nums[right]){
return binarySearch(nums,mid+1, right, target);
}else{
return binarySearch(nums, left, mid-1, target);
}
}
}

43.2 Java Solution 2 - Iterative

public int search(int[] nums, int target) {

119 | 531
43 Search in Rotated Sorted Array

int left = 0;
int right= [Link]-1;

while(left<=right){
int mid = left + (right-left)/2;
if(target==nums[mid])
return mid;

if(nums[left]<=nums[mid]){
if(nums[left]<=target&& target<nums[mid]){
right=mid-1;
}else{
left=mid+1;
}
}else{
if(nums[mid]<target&& target<=nums[right]){
left=mid+1;
}else{
right=mid-1;
}
}
}

return -1;
}

120 | 531 Program Creek


44 Search in Rotated Sorted Array II

Follow up for "Search in Rotated Sorted Array": what if duplicates are allowed? Write
a function to determine if a given target is in the array.

44.1 Java Solution

public boolean search(int[] nums, int target) {


int left=0;
int right=[Link]-1;

while(left<=right){
int mid = (left+right)/2;
if(nums[mid]==target)
return true;

if(nums[left]<nums[mid]){
if(nums[left]<=target&& target<nums[mid]){
right=mid-1;
}else{
left=mid+1;
}
}else if(nums[left]>nums[mid]){
if(nums[mid]<target&&target<=nums[right]){
left=mid+1;
}else{
right=mid-1;
}
}else{
left++;
}
}

return false;
}

121 | 531
45 Min Stack

Design a stack that supports push, pop, top, and retrieving the minimum element in
constant time.
push(x) – Push element x onto stack. pop() – Removes the element on top of the
stack. top() – Get the top element. getMin() – Retrieve the minimum element in the
stack.

45.1 Analysis

UPDATED ON 6/17/2015
To make constant time of getMin(), we need to keep track of the minimum element
for each element in the stack.

45.2 Java Solution

Define a node class that holds element value, min value, and pointer to elements below
it.
class Node {
int value;
int min;
Node next;

Node(int x) {
value = x;
next = null;
min = x;
}
}

class MinStack {
Node head;

public void push(int x) {


if (head == null) {
head = new Node(x);
} else {
Node temp = new Node(x);
[Link] = [Link]([Link], x);
[Link] = head;

123 | 531
45 Min Stack

head = temp;
}
}

public void pop() {


if (head == null)
return;
head = [Link];
}

public int top() {


if (head == null)
return Integer.MAX_VALUE;

return [Link];
}

public int getMin() {


if (head == null)
return Integer.MAX_VALUE;

return [Link];
}
}

124 | 531 Program Creek


46 Majority Element

Given an array of size n, find the majority element. The majority element is the element
that appears more than b n/2 c times. (assume that the array is non-empty and the
majority element always exist in the array.)

46.1 Java Solution 1 - Naive

We can sort the array first, which takes time of nlog(n). Then scan once to find the
longest consecutive substrings.
public class Solution {
public int majorityElement(int[] num) {
if([Link]==1){
return num[0];
}

[Link](num);

int prev=num[0];
int count=1;
for(int i=1; i<[Link]; i++){
if(num[i] == prev){
count++;
if(count > [Link]/2) return num[i];
}else{
count=1;
prev = num[i];
}
}

return 0;
}
}

46.2 Java Solution 2 - Much Simpler

Thanks to SK. His/her solution is much efficient and simpler. Since the majority al-
ways take more than a half space, the middle element is guaranteed to be the majority.
Sorting array takes nlog(n). So the time complexity of this solution is nlog(n). Cheers!

125 | 531
46 Majority Element

public int majorityElement(int[] num) {


if ([Link] == 1) {
return num[0];
}

[Link](num);
return num[[Link] / 2];
}

46.3 Java Solution 3 - Linear Time Majority Vote Algorithm

public int majorityElement(int[] nums) {


int result = 0, count = 0;

for(int i = 0; i<[Link]; i++ ) {


if(count == 0){
result = nums[ i ];
count = 1;
}else if(result == nums[i]){
count++;
}else{
count--;
}
}

return result;
}

126 | 531 Program Creek


47 Majority Element II

Given an integer array of size n, find all elements that appear more than b n/3 c times.
The algorithm should run in linear time and in O(1) space.

47.1 Java Solution 1 - Using a Counter

Time = O(n) and Space = O(n)


public List<Integer> majorityElement(int[] nums) {
HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();
for(int i: nums){
if([Link](i)){
[Link](i, [Link](i)+1);
}else{
[Link](i, 1);
}
}

List<Integer> result = new ArrayList<Integer>();

for([Link]<Integer, Integer> entry: [Link]()){


if([Link]() > [Link]/3){
[Link]([Link]());
}
}

return result;
}

47.2 Java Solution 2

Time = O(n) and Space = O(1)


Check out Majority Element I.
public List<Integer> majorityElement(int[] nums) {
List<Integer> result = new ArrayList<Integer>();

Integer n1=null, n2=null;


int c1=0, c2=0;

for(int i: nums){

127 | 531
47 Majority Element II

if(n1!=null && i==[Link]()){


c1++;
}else if(n2!=null && i==[Link]()){
c2++;
}else if(c1==0){
c1=1;
n1=i;
}else if(c2==0){
c2=1;
n2=i;
}else{
c1--;
c2--;
}
}

c1=c2=0;

for(int i: nums){
if(i==[Link]()){
c1++;
}else if(i==[Link]()){
c2++;
}
}

if(c1>[Link]/3)
[Link](n1);
if(c2>[Link]/3)
[Link](n2);

return result;
}

128 | 531 Program Creek


48 Remove Element

Given an array and a value, remove all instances of that value in place and return the
new length. (Note: The order of elements can be changed. It doesn’t matter what you
leave beyond the new length.)

48.1 Java Solution

This problem can be solve by using two indices.


public int removeElement(int[] A, int elem) {
int i=0;
int j=0;

while(j < [Link]){


if(A[j] != elem){
A[i] = A[j];
i++;
}

j++;
}

return i;
}

129 | 531
49 Largest Rectangle in Histogram

Given n non-negative integers representing the histogram’s bar height where the width
of each bar is 1, find the area of largest rectangle in the histogram.

Above is a histogram where width of each bar is 1, given height = [2,1,5,6,2,3].

For example, given height = [2,1,5,6,2,3], return 10.

49.1 Analysis

The key to solve this problem is to maintain a stack to store bars’ indexes. The stack
only keeps the increasing bars.

131 | 531
49 Largest Rectangle in Histogram

49.2 Java Solution

public int largestRectangleArea(int[] height) {


if (height == null || [Link] == 0) {
return 0;
}

Stack<Integer> stack = new Stack<Integer>();

int max = 0;
int i = 0;

while (i < [Link]) {


//push index to stack when the current height is larger than the previous
one
if ([Link]() || height[i] >= height[[Link]()]) {
[Link](i);
i++;
} else {
//calculate max value when the current height is less than the previous
one
int p = [Link]();
int h = height[p];
int w = [Link]() ? i : i - [Link]() - 1;
max = [Link](h * w, max);
}

while (![Link]()) {
int p = [Link]();
int h = height[p];
int w = [Link]() ? i : i - [Link]() - 1;
max = [Link](h * w, max);
}

return max;
}

132 | 531 Program Creek


50 Longest Common Prefix

50.1 Problem

Write a function to find the longest common prefix string amongst an array of strings.

50.2 Analysis

To solve this problem, we need to find the two loop conditions. One is the length of
the shortest string. The other is iteration over every element of the string array.

50.3 Java Solution

public String longestCommonPrefix(String[] strs) {


if(strs == null || [Link] == 0)
return "";

int minLen=Integer.MAX_VALUE;
for(String str: strs){
if(minLen > [Link]())
minLen = [Link]();
}
if(minLen == 0) return "";

for(int j=0; j<minLen; j++){


char prev=’0’;
for(int i=0; i<[Link] ;i++){
if(i==0) {
prev = strs[i].charAt(j);
continue;
}

if(strs[i].charAt(j) != prev){
return strs[i].substring(0, j);
}
}
}

return strs[0].substring(0,minLen);
}

133 | 531
51 Largest Number

Given a list of non negative integers, arrange them such that they form the largest
number.
For example, given [3, 30, 34, 5, 9], the largest formed number is 9534330. (Note:
The result may be very large, so you need to return a string instead of an integer.)

51.1 Analysis

This problem can be solve by simply sorting strings, not sorting integer. Define a
comparator to compare strings by concat() right-to-left or left-to-right.

51.2 Java Solution

public String largestNumber(int[] nums) {


String[] strs = new String[[Link]];
for(int i=0; i<[Link]; i++){
strs[i] = [Link](nums[i]);
}

[Link](strs, new Comparator<String>(){


public int compare(String s1, String s2){
String leftRight = s1+s2;
String rightLeft = s2+s1;
return -[Link](rightLeft);

}
});

StringBuilder sb = new StringBuilder();


for(String s: strs){
[Link](s);
}

while([Link](0)==’0’ && [Link]()>1){


[Link](0);
}

return [Link]();
}

135 | 531
52 Simplify Path

Given an absolute path for a file (Unix-style), simplify it.


For example,
path = "/home/", => "/home"
path = "/a/./b/../../c/", => "/c"
path = "/../", => "/"
path = "/home//foo/", => "/home/foo"

52.1 Java Solution

public String simplifyPath(String path) {


Stack<String> stack = new Stack<String>();

//[Link]([Link](0,1));

while([Link]()> 0 && [Link]([Link]()-1) ==’/’){


path = [Link](0, [Link]()-1);
}

int start = 0;
for(int i=1; i<[Link](); i++){
if([Link](i) == ’/’){
[Link]([Link](start, i));
start = i;
}else if(i==[Link]()-1){
[Link]([Link](start));
}
}

LinkedList<String> result = new LinkedList<String>();


int back = 0;
while(![Link]()){
String top = [Link]();

if([Link]("/.") || [Link]("/")){
//nothing
}else if([Link]("/..")){
back++;
}else{
if(back > 0){

137 | 531
52 Simplify Path

back--;
}else{
[Link](top);
}
}
}

//if empty, return "/"


if([Link]()){
return "/";
}

StringBuilder sb = new StringBuilder();


while(![Link]()){
String s = [Link]();
[Link](s);
}

return [Link]();
}

138 | 531 Program Creek


53 Compare Version Numbers

53.1 Problem

Compare two version numbers version1 and version2. If version1 >version2 return 1,
if version1 <version2 return -1, otherwise return 0. You may assume that the version
strings are non-empty and contain only digits and the . character. The . character does
not represent a decimal point and is used to separate number sequences. Here is an
example of version numbers ordering:
0.1 < 1.1 < 1.2 < 13.37

53.2 Java Solution

The tricky part of the problem is to handle cases like 1.0 and 1. They should be equal.
public int compareVersion(String version1, String version2) {
String[] arr1 = [Link]("\\.");
String[] arr2 = [Link]("\\.");

int i=0;
while(i<[Link] || i<[Link]){
if(i<[Link] && i<[Link]){
if([Link](arr1[i]) < [Link](arr2[i])){
return -1;
}else if([Link](arr1[i]) > [Link](arr2[i])){
return 1;
}
} else if(i<[Link]){
if([Link](arr1[i]) != 0){
return 1;
}
} else if(i<[Link]){
if([Link](arr2[i]) != 0){
return -1;
}
}

i++;
}

return 0;

139 | 531
53 Compare Version Numbers

140 | 531 Program Creek


54 Gas Station

There are N gas stations along a circular route, where the amount of gas at station i is
gas[i].
You have a car with an unlimited gas tank and it costs cost[i] of gas to travel from
station i to its next station (i+1). You begin the journey with an empty tank at one of
the gas stations.
Return the starting gas station’s index if you can travel around the circuit once,
otherwise return -1.

54.1 Analysis

To solve this problem, we need to understand and use the following 2 facts: 1) if the
sum of gas >= the sum of cost, then the circle can be completed. 2) if A can not reach
C in a the sequence of A–>B–>C, then B can not make it either.
Proof of fact 2:
If gas[A] < cost[A], then A can not even reach B.
So to reach C from A, gas[A] must >= cost[A].
Given that A can not reach C, we have gas[A] + gas[B] < cost[A] + cost[B],
and gas[A] >= cost[A],
Therefore, gas[B] < cost[B], i.e., B can not reach C.

54.2 Java Solution

public int canCompleteCircuit(int[] gas, int[] cost) {


int sumRemaining = 0; // track current remaining
int total = 0; // track total remaining
int start = 0;

for (int i = 0; i < [Link]; i++) {

141 | 531
54 Gas Station

int remaining = gas[i] - cost[i];

//if sum remaining of (i-1) >= 0, continue


if (sumRemaining >= 0) {
sumRemaining += remaining;
//otherwise, reset start index to be current
} else {
sumRemaining = remaining;
start = i;
}
total += remaining;
}

if (total >= 0){


return start;
}else{
return -1;
}
}

142 | 531 Program Creek


55 Pascal’s Triangle

Given numRows, generate the first numRows of Pascal’s triangle. For example, given
numRows = 5, the result should be:
[
[1],
[1,1],
[1,2,1],
[1,3,3,1],
[1,4,6,4,1]
]

55.1 Java Solution

public ArrayList<ArrayList<Integer>> generate(int numRows) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
if (numRows <= 0)
return result;

ArrayList<Integer> pre = new ArrayList<Integer>();


[Link](1);
[Link](pre);

for (int i = 2; i <= numRows; i++) {


ArrayList<Integer> cur = new ArrayList<Integer>();

[Link](1); //first
for (int j = 0; j < [Link]() - 1; j++) {
[Link]([Link](j) + [Link](j + 1)); //middle
}
[Link](1);//last

[Link](cur);
pre = cur;
}

return result;
}

143 | 531
56 Pascal’s Triangle II

Given an index k, return the kth row of the Pascal’s triangle. For example, when k =
3, the row is [1,3,3,1].

56.1 Analysis

This problem is related to Pascal’s Triangle which gets all rows of Pascal’s triangle. In
this problem, only one row is required to return.

56.2 Java Solution

public List<Integer> getRow(int rowIndex) {


ArrayList<Integer> result = new ArrayList<Integer>();

if (rowIndex < 0)
return result;

[Link](1);
for (int i = 1; i <= rowIndex; i++) {
for (int j = [Link]() - 2; j >= 0; j--) {
[Link](j + 1, [Link](j) + [Link](j + 1));
}
[Link](1);
}
return result;
}

145 | 531
57 Container With Most Water

57.1 Problem

Given n non-negative integers a1, a2, ..., an, where each represents a point at coordi-
nate (i, ai). n vertical lines are drawn such that the two endpoints of line i is at (i, ai)
and (i, 0). Find two lines, which together with x-axis forms a container, such that the
container contains the most water.

57.2 Analysis

Initially we can assume the result is 0. Then we scan from both sides. If leftHeight
<rightHeight, move right and find a value that is greater than leftHeight. Similarily,
if leftHeight >rightHeight, move left and find a value that is greater than rightHeight.
Additionally, keep tracking the max value.

57.3 Java Solution

public int maxArea(int[] height) {


if (height == null || [Link] < 2) {
return 0;
}

int max = 0;
int left = 0;
int right = [Link] - 1;

while (left < right) {


max = [Link](max, (right - left) * [Link](height[left],
height[right]));

147 | 531
57 Container With Most Water

if (height[left] < height[right])


left++;
else
right--;
}

return max;
}

148 | 531 Program Creek


58 Candy

There are N children standing in a line. Each child is assigned a rating value. You are
giving candies to these children subjected to the following requirements:
1. Each child must have at least one candy. 2. Children with a higher rating get
more candies than their neighbors.
What is the minimum candies you must give?

58.1 Analysis

This problem can be solved in O(n) time.


We can always assign a neighbor with 1 more if the neighbor has higher a rating
value. However, to get the minimum total number, we should always start adding 1s
in the ascending order. We can solve this problem by scanning the array from both
sides. First, scan the array from left to right, and assign values for all the ascending
pairs. Then scan from right to left and assign values to descending pairs.
This problem is similar to Trapping Rain Water.

58.2 Java Solution

public int candy(int[] ratings) {


if (ratings == null || [Link] == 0) {
return 0;
}

int[] candies = new int[[Link]];


candies[0] = 1;

//from let to right


for (int i = 1; i < [Link]; i++) {
if (ratings[i] > ratings[i - 1]) {
candies[i] = candies[i - 1] + 1;
} else {
// if not ascending, assign 1
candies[i] = 1;
}
}

int result = candies[[Link] - 1];

149 | 531
58 Candy

//from right to left


for (int i = [Link] - 2; i >= 0; i--) {
int cur = 1;
if (ratings[i] > ratings[i + 1]) {
cur = candies[i + 1] + 1;
}

result += [Link](cur, candies[i]);


candies[i] = cur;
}

return result;
}

150 | 531 Program Creek


59 Trapping Rain Water

Given n non-negative integers representing an elevation map where the width of each
bar is 1, compute how much water it is able to trap after raining.
For example, given [0,1,0,2,1,0,1,3,2,1,2,1], return 6.

59.1 Analysis

This problem is similar to Candy. It can be solve by scanning from both sides and
then get the total.

59.2 Java Solution

public int trap(int[] height) {


int result = 0;

if(height==null || [Link]<=2)
return result;

int left[] = new int[[Link]];


int right[]= new int[[Link]];

//scan from left to right


int max = height[0];
left[0] = height[0];
for(int i=1; i<[Link]; i++){
if(height[i]<max){
left[i]=max;
}else{
left[i]=height[i];
max = height[i];
}
}

//scan from right to left


max = height[[Link]-1];
right[[Link]-1]=height[[Link]-1];
for(int i=[Link]-2; i>=0; i--){
if(height[i]<max){
right[i]=max;
}else{

151 | 531
59 Trapping Rain Water

right[i]=height[i];
max = height[i];
}
}

//calculate totoal
for(int i=0; i<[Link]; i++){
result+= [Link](left[i],right[i])-height[i];
}

return result;
}

152 | 531 Program Creek


60 Count and Say

60.1 Problem

The count-and-say sequence is the sequence of integers beginning as follows: 1, 11, 21,
1211, 111221, ...
1 is read off as "one 1" or 11.
11 is read off as "two 1s" or 21.
21 is read off as "one 2, then one 1" or 1211.

Given an integer n, generate the nth sequence.

60.2 Java Solution

The problem can be solved by using a simple iteration. See Java solution below:
public String countAndSay(int n) {
if (n <= 0)
return null;

String result = "1";


int i = 1;

while (i < n) {
StringBuilder sb = new StringBuilder();
int count = 1;
for (int j = 1; j < [Link](); j++) {
if ([Link](j) == [Link](j - 1)) {
count++;
} else {
[Link](count);
[Link]([Link](j - 1));
count = 1;
}
}

[Link](count);
[Link]([Link]([Link]() - 1));
result = [Link]();
i++;
}

153 | 531
60 Count and Say

return result;
}

154 | 531 Program Creek


61 Search for a Range

Given a sorted array of integers, find the starting and ending position of a given target
value. Your algorithm’s runtime complexity must be in the order of O(log n). If the
target is not found in the array, return [-1, -1]. For example, given [5, 7, 7, 8, 8, 10] and
target value 8, return [3, 4].

61.1 Analysis

Based on the requirement of O(log n), this is a binary search problem apparently.

61.2 Java Solution

public int[] searchRange(int[] nums, int target) {


if(nums == null || [Link] == 0){
return null;
}

int[] arr= new int[2];


arr[0]=-1;
arr[1]=-1;

binarySearch(nums, 0, [Link]-1, target, arr);

return arr;
}

public void binarySearch(int[] nums, int left, int right, int target, int[]
arr){
if(right<left)
return;

if(nums[left]==nums[right] && nums[left]==target){


arr[0]=left;
arr[1]=right;
return;
}

int mid = left+(right-left)/2;

155 | 531
61 Search for a Range

if(nums[mid]<target){
binarySearch(nums, mid+1, right, target, arr);
}else if(nums[mid]>target){
binarySearch(nums, left, mid-1, target, arr);
}else{
arr[0]=mid;
arr[1]=mid;

//handle duplicates - left


int t1 = mid;
while(t1 >left && nums[t1]==nums[t1-1]){
t1--;
arr[0]=t1;
}

//handle duplicates - right


int t2 = mid;
while(t2 < right&& nums[t2]==nums[t2+1]){
t2++;
arr[1]=t2;
}
return;
}
}

156 | 531 Program Creek


62 Basic Calculator

Implement a basic calculator to evaluate a simple expression string.


The expression string may contain open ( and closing parentheses ), the plus + or
minus sign -, non-negative integers and empty [Link] may assume that the given
expression is always valid.
Some examples: "1 + 1" = 2, "(1)" = 1, "(1-(4-5))" = 2

62.1 Analysis

This problem can be solved by using a stack. We keep pushing element to the stack,
when ’)" is met, calculate the expression up to the first "(".

62.2 Java Solution

public int calculate(String s) {


// delte white spaces
s = [Link](" ", "");

Stack<String> stack = new Stack<String>();


char[] arr = [Link]();

StringBuilder sb = new StringBuilder();


for (int i = 0; i < [Link]; i++) {
if (arr[i] == ’ ’)
continue;

if (arr[i] >= ’0’ && arr[i] <= ’9’) {


[Link](arr[i]);

if (i == [Link] - 1) {
[Link]([Link]());
}
} else {
if ([Link]() > 0) {
[Link]([Link]());
sb = new StringBuilder();
}

if (arr[i] != ’)’) {
[Link](new String(new char[] { arr[i] }));

157 | 531
62 Basic Calculator

} else {
// when meet ’)’, pop and calculate
ArrayList<String> t = new ArrayList<String>();
while (![Link]()) {
String top = [Link]();
if ([Link]("(")) {
break;
} else {
[Link](0, top);
}
}

int temp = 0;
if ([Link]() == 1) {
temp = [Link]([Link](0));
} else {
for (int j = [Link]() - 1; j > 0; j = j - 2) {
if ([Link](j - 1).equals("-")) {
temp += 0 - [Link]([Link](j));
} else {
temp += [Link]([Link](j));
}
}
temp += [Link]([Link](0));
}
[Link]([Link](temp));
}
}
}

ArrayList<String> t = new ArrayList<String>();


while (![Link]()) {
String elem = [Link]();
[Link](0, elem);
}

int temp = 0;
for (int i = [Link]() - 1; i > 0; i = i - 2) {
if ([Link](i - 1).equals("-")) {
temp += 0 - [Link]([Link](i));
} else {
temp += [Link]([Link](i));
}
}
temp += [Link]([Link](0));

return temp;
}

158 | 531 Program Creek


63 Group Anagrams

Given an array of strings, return all groups of strings that are anagrams.

63.1 Analysis

An anagram is a type of word play, the result of rearranging the letters of a word or
phrase to produce a new word or phrase, using all the original letters exactly once; for
example Torchwood can be rearranged into Doctor Who.
If two strings are anagram to each other, their sorted sequence is the same.
Updated on 5/1/2016.

63.2 Java Solution

public List<List<String>> groupAnagrams(String[] strs) {


List<List<String>> result = new ArrayList<List<String>>();

HashMap<String, ArrayList<String>> map = new HashMap<String,


ArrayList<String>>();
for(String str: strs){
char[] arr = [Link]();
[Link](arr);
String ns = new String(arr);

if([Link](ns)){
[Link](ns).add(str);
}else{
ArrayList<String> al = new ArrayList<String>();
[Link](str);
[Link](ns, al);
}
}

for([Link]<String, ArrayList<String>> entry: [Link]()){


[Link]([Link]());
}

[Link]([Link]());

return result;
}

159 | 531
63 Group Anagrams

63.3 Time Complexity

If average length of verbs is m and words array length is n, then the time is O(n*m*log(m)).

160 | 531 Program Creek


64 Shortest Palindrome

Given a string S, you are allowed to convert it to a palindrome by adding characters in


front of it. Find and return the shortest palindrome you can find by performing this
transformation.
For example, given "aacecaaa", return "aaacecaaa"; given "abcd", return "dcbabcd".

64.1 Analysis

We can solve this problem by using one of the methods which is used to solve the
longest palindrome substring problem.
Specifically, we can start from the center and scan two sides. If read the left bound-
ary, then the shortest palindrome is identified.

64.2 Java Solution

public String shortestPalindrome(String s) {


if (s == null || [Link]() <= 1)
return s;

String result = null;

int len = [Link]();


int mid = len / 2;

for (int i = mid; i >= 1; i--) {


if ([Link](i) == [Link](i - 1)) {
if ((result = scanFromCenter(s, i - 1, i)) != null)
return result;
} else {
if ((result = scanFromCenter(s, i - 1, i - 1)) != null)
return result;
}
}

return result;
}

private String scanFromCenter(String s, int l, int r) {


int i = 1;

161 | 531
64 Shortest Palindrome

//scan from center to both sides


for (; l - i >= 0; i++) {
if ([Link](l - i) != [Link](r + i))
break;
}

//if not end at the beginning of s, return null


if (l - i >= 0)
return null;

StringBuilder sb = new StringBuilder([Link](r + i));


[Link]();

return [Link](s).toString();
}

162 | 531 Program Creek


65 Rectangle Area

Find the total area covered by two rectilinear rectangles in a 2D plane. Each rectangle
is defined by its bottom left corner and top right corner coordinates.

65.1 Analysis

This problem can be converted as a overlap internal problem. On the x-axis, there are
(A,C) and (E,G); on the y-axis, there are (F,H) and (B,D). If they do not have overlap,
the total area is the sum of 2 rectangle areas. If they have overlap, the total area should
minus the overlap area.

65.2 Java Solution

public int computeArea(int A, int B, int C, int D, int E, int F, int G, int
H) {
if(C<E||G<A )
return (G-E)*(H-F) + (C-A)*(D-B);

if(D<F || H<B)
return (G-E)*(H-F) + (C-A)*(D-B);

int right = [Link](C,G);


int left = [Link](A,E);
int top = [Link](H,D);
int bottom = [Link](F,B);

return (G-E)*(H-F) + (C-A)*(D-B) - (right-left)*(top-bottom);


}

163 | 531
66 Summary Ranges

Given a sorted integer array without duplicates, return the summary of its ranges for
consecutive numbers.
For example, given [0,1,2,4,5,7], return ["0->2","4->5","7"].

66.1 Analysis

66.2 Java Solution

public List<String> summaryRanges(int[] nums) {


List<String> result = new ArrayList<String>();

if(nums == null || [Link]==0)


return result;

if([Link]==1){
[Link](nums[0]+"");
}

int pre = nums[0]; // previous element


int first = pre; // first element of each range

for(int i=1; i<[Link]; i++){


if(nums[i]==pre+1){
if(i==[Link]-1){
[Link](first+"->"+nums[i]);
}
}else{
if(first == pre){
[Link](first+"");
}else{
[Link](first + "->"+pre);
}

if(i==[Link]-1){
[Link](nums[i]+"");
}

first = nums[i];
}

165 | 531
66 Summary Ranges

pre = nums[i];
}

return result;
}

166 | 531 Program Creek


67 Increasing Triplet Subsequence

Given an unsorted array return whether an increasing subsequence of length 3 exists


or not in the array.
Examples: Given [1, 2, 3, 4, 5], return true.
Given [5, 4, 3, 2, 1], return false.

67.1 Analysis

This problem can be converted to be finding if there is a sequence such that the_smallest_so_far
<the_second_smallest_so_far <current. We use x, y and z to denote the 3 number re-
spectively.

67.2 Java Solution

public boolean increasingTriplet(int[] nums) {


int x = Integer.MAX_VALUE;
int y = Integer.MAX_VALUE;

for (int i = 0; i < [Link]; i++) {


int z = nums[i];

if (x >= z) {
x = z;// update x to be a smaller value
} else if (y >= z) {
y = z; // update y to be a smaller value
} else {
return true;
}
}

return false;
}

167 | 531
68 Get Target Number Using Number List
and Arithmetic Operations

Given a list of numbers and a target number, write a program to determine whether
the target number can be calculated by applying "+-*/" operations to the number list?
You can assume () is automatically added when necessary.
For example, given 1,2,3,4 and 21, return true. Because (1+2)*(3+4)=21

68.1 Analysis

This is a partition problem which can be solved by using depth first search.

68.2 Java Solution

public static boolean isReachable(ArrayList<Integer> list, int target) {


if (list == null || [Link]() == 0)
return false;

int i = 0;
int j = [Link]() - 1;

ArrayList<Integer> results = getResults(list, i, j, target);

for (int num : results) {


if (num == target) {
return true;
}
}

return false;
}

public static ArrayList<Integer> getResults(ArrayList<Integer> list,


int left, int right, int target) {
ArrayList<Integer> result = new ArrayList<Integer>();

if (left > right) {


return result;
} else if (left == right) {
[Link]([Link](left));

169 | 531
68 Get Target Number Using Number List and Arithmetic Operations

return result;
}

for (int i = left; i < right; i++) {

ArrayList<Integer> result1 = getResults(list, left, i, target);


ArrayList<Integer> result2 = getResults(list, i + 1, right, target);

for (int x : result1) {


for (int y : result2) {
[Link](x + y);
[Link](x - y);
[Link](x * y);
if (y != 0)
[Link](x / y);
}
}
}

return result;
}

170 | 531 Program Creek


69 Reverse Vowels of a String

Write a function that takes a string as input and reverse only the vowels of a string.

69.1 Java Solution

this is a simple problem which can be solved by using two pointers scanning from
beginning and end of the array.
public String reverseVowels(String s) {
ArrayList<Character> vowList = new ArrayList<Character>();
[Link](’a’);
[Link](’e’);
[Link](’i’);
[Link](’o’);
[Link](’u’);
[Link](’A’);
[Link](’E’);
[Link](’I’);
[Link](’O’);
[Link](’U’);

char[] arr = [Link]();

int i=0;
int j=[Link]()-1;

while(i<j){
if(![Link](arr[i])){
i++;
continue;
}

if(![Link](arr[j])){
j--;
continue;
}

char t = arr[i];
arr[i]=arr[j];
arr[j]=t;

i++;
j--;

171 | 531
69 Reverse Vowels of a String

return new String(arr);


}

172 | 531 Program Creek


70 Flip Game

You are playing the following Flip Game with your friend: Given a string that con-
tains only these two characters: + and -, you and your friend take turns to flip two
consecutive "++" into "–". The game ends when a person can no longer make a move
and therefore the other person will be the winner.
Write a function to compute all possible states of the string after one valid move.

70.1 Java Solution

public List<String> generatePossibleNextMoves(String s) {


List<String> result = new ArrayList<String>();

if(s==null)
return result;

char[] arr = [Link]();


for(int i=0; i<[Link]-1; i++){
if(arr[i]==arr[i+1] && arr[i]==’+’){
arr[i]=’-’;
arr[i+1]=’-’;
[Link](new String(arr));
arr[i]=’+’;
arr[i+1]=’+’;
}
}

return result;
}

173 | 531
71 Flip Game II

You are playing the following Flip Game with your friend: Given a string that con-
tains only these two characters: + and -, you and your friend take turns to flip two
consecutive "++" into "–". The game ends when a person can no longer make a move
and therefore the other person will be the winner.
Write a function to determine if the starting player can guarantee a win.
For example, given s = "++++", return true. The starting player can guarantee a win
by flipping the middle "++" to become "+–+".

71.1 Java Solution

This problem is solved by backtracking.


public boolean canWin(String s) {
if(s==null||[Link]()==0){
return false;
}

return canWinHelper([Link]());
}

public boolean canWinHelper(char[] arr){


for(int i=0; i<[Link]-1;i++){
if(arr[i]==’+’&&arr[i+1]==’+’){
arr[i]=’-’;
arr[i+1]=’-’;

boolean win = canWinHelper(arr);

arr[i]=’+’;
arr[i+1]=’+’;

//if there is a flip which makes the other player lose, the first
play wins
if(!win){
return true;
}
}
}

return false;
}

175 | 531
71 Flip Game II

71.2 Time Complexity

Roughly, the time is n*n*...n, which is O(nn̂). The reason is each recursion takes O(n)
and there are totally n recursions.

176 | 531 Program Creek


72 Move Zeroes

Given an array nums, write a function to move all 0’s to the end of it while maintaining
the relative order of the non-zero elements.
For example, given nums = [0, 1, 0, 3, 12], after calling your function, nums should
be [1, 3, 12, 0, 0].

72.1 Java Solution

public void moveZeroes(int[] nums) {


int m=-1;

for(int i=0; i<[Link]; i++){


if(nums[i]==0){
if(m==-1 || nums[m]!=0){
m=i;
}
}else{
if(m!=-1){
int temp = nums[i];
nums[i]=nums[m];
nums[m]=temp;
m++;
}
}
}
}

177 | 531
73 Valid Anagram

Given two strings s and t, write a function to determine if t is an anagram of s.

73.1 Java Solution 1

If the string contains only lowercase alphabets, here is a simple solution.


public boolean isAnagram(String s, String t) {
if([Link]()!=[Link]())
return false;

int[] arr = new int[26];


for(int i=0; i<[Link](); i++){
char c1 = [Link](i);
arr[c1-’a’]++;
}

for(int i=0; i<[Link](); i++){


char c2 = [Link](i);
if(arr[c2-’a’] == 0){
return false;
}else{
arr[c2-’a’]--;
}
}

for(int i=0; i<26; i++){


if(arr[i]%2==1){
return false;
}
}

return true;
}

73.2 Java Solution 2

If the inputs contain unicode characters, an array with length of 26 is not enough.
public boolean isAnagram(String s, String t) {
if([Link]()!=[Link]())

179 | 531
73 Valid Anagram

return false;

HashMap<Character, Integer> map = new HashMap<Character, Integer>();

for(int i=0; i<[Link](); i++){


char c1 = [Link](i);
if([Link](c1)){
[Link](c1, [Link](c1)+1);
}else{
[Link](c1,1);
}
}

for(int i=0; i<[Link](); i++){


char c2 = [Link](i);
if([Link](c2)){
if([Link](c2)==1){
[Link](c2);
}else{
[Link](c2, [Link](c2)-1);
}
}else{
return false;
}
}

if([Link]()>0)
return false;

return true;
}

180 | 531 Program Creek


74 Group Shifted Strings

Given a string, we can "shift" each of its letter to its successive letter, for example: "abc"
->"bcd". We can keep "shifting" which forms the sequence: "abc" ->"bcd" ->... ->"xyz".
Given a list of strings which contains only lowercase alphabets, group all strings
that belong to the same shifting sequence, return:
[
["abc","bcd","xyz"],
["az","ba"],
["acef"],
["a","z"]
]

74.1 Java Solution

public List<List<String>> groupStrings(String[] strings) {


List<List<String>> result = new ArrayList<List<String>>();
HashMap<String, ArrayList<String>> map
= new HashMap<String, ArrayList<String>>();

for(String s: strings){
char[] arr = [Link]();
if([Link]>0){
int diff = arr[0]-’a’;
for(int i=0; i<[Link]; i++){
if(arr[i]-diff<’a’){
arr[i] = (char) (arr[i]-diff+26);
}else{
arr[i] = (char) (arr[i]-diff);
}

}
}

String ns = new String(arr);


if([Link](ns)){
[Link](ns).add(s);
}else{
ArrayList<String> al = new ArrayList<String>();
[Link](s);
[Link](ns, al);

181 | 531
74 Group Shifted Strings

}
}

for([Link]<String, ArrayList<String>> entry: [Link]()){


[Link]([Link]());
}

[Link]([Link]());

return result;
}

182 | 531 Program Creek


75 Top K Frequent Elements

Given a non-empty array of integers, return the k most frequent elements.

75.1 Java Solution

We can solve this problem by using a counter, and then sort the counter by value.
public class Solution {
public List<Integer> topKFrequent(int[] nums, int k) {
List<Integer> result = new ArrayList<Integer>();

HashMap<Integer, Integer> counter = new HashMap<Integer, Integer>();

for(int i: nums){
if([Link](i)){
[Link](i, [Link](i)+1);
}else{
[Link](i, 1);
}
}

TreeMap<Integer, Integer> sortedMap = new TreeMap<Integer, Integer>(new


ValueComparator(counter));
[Link](counter);

int i=0;
for([Link]<Integer, Integer> entry: [Link]()){
[Link]([Link]());
i++;
if(i==k)
break;
}

return result;
}
}

class ValueComparator implements Comparator<Integer>{


HashMap<Integer, Integer> map = new HashMap<Integer, Integer>();

public ValueComparator(HashMap<Integer, Integer> m){


[Link](m);
}

183 | 531
75 Top K Frequent Elements

public int compare(Integer i1, Integer i2){


int diff = [Link](i2)-[Link](i1);

if(diff==0){
return 1;
}else{
return diff;
}
}
}

184 | 531 Program Creek


76 Find Peak Element

A peak element is an element that is greater than its neighbors. Given an input array
where num[i] 6= num[i+1], find a peak element and return its index. The array may
contain multiple peaks, in that case return the index to any one of the peaks is fine.
You may imagine that num[-1] = num[n] = -∞. For example, in array [1, 2, 3, 1], 3 is
a peak element and your function should return the index number 2.

76.1 Thoughts

This is a very simple problem. We can scan the array and find any element that is
greater can its previous and next. The first and last element are handled separately.

76.2 Java Solution

public class Solution {


public int findPeakElement(int[] num) {
int max = num[0];
int index = 0;
for(int i=1; i<=[Link]-2; i++){
int prev = num[i-1];
int curr = num[i];
int next = num[i+1];

if(curr > prev && curr > next && curr > max){
index = i;
max = curr;
}
}

if(num[[Link]-1] > max){


return [Link]-1;
}

return index;
}
}

185 | 531
77 Word Pattern

Given a pattern and a string str, find if str follows the same pattern. Here follow means
a full match, such that there is a bijection between a letter in pattern and a non-empty
word in str.

77.1 Java Solution

public boolean wordPattern(String pattern, String str) {


String[] arr = [Link](" ");

if([Link]()!=[Link])
return false;

HashMap<Character, String> map = new HashMap<Character, String>();

for(int i=0; i<[Link]; i++){


char c = [Link](i);
String s = arr[i];

if([Link](c)){
if(![Link](c).equals(s))
return false;

}else{
if([Link](s))
return false;

[Link](c, s);
}
}

return true;
}

187 | 531
78 Set Matrix Zeroes

Given a m * n matrix, if an element is 0, set its entire row and column to 0. Do it in


place.

78.1 Analysis

This problem should be solved in place, i.e., no other array should be used. We can
use the first column and the first row to track if a row/column should be set to 0.
Since we used the first row and first column to mark the zero row/column, the
original values are changed.

Step 1: First row contains zero = true; First column contains zero = false;

189 | 531
78 Set Matrix Zeroes

78.2 Java Solution

public class Solution {


public void setZeroes(int[][] matrix) {
boolean firstRowZero = false;
boolean firstColumnZero = false;

//set first row and column zero or not


for(int i=0; i<[Link]; i++){
if(matrix[i][0] == 0){
firstColumnZero = true;
break;
}
}

for(int i=0; i<matrix[0].length; i++){


if(matrix[0][i] == 0){
firstRowZero = true;
break;
}
}

190 | 531 Program Creek


78 Set Matrix Zeroes

//mark zeros on first row and column


for(int i=1; i<[Link]; i++){
for(int j=1; j<matrix[0].length; j++){
if(matrix[i][j] == 0){
matrix[i][0] = 0;
matrix[0][j] = 0;
}
}
}

//use mark to set elements


for(int i=1; i<[Link]; i++){
for(int j=1; j<matrix[0].length; j++){
if(matrix[i][0] == 0 || matrix[0][j] == 0){
matrix[i][j] = 0;
}
}
}

//set first column and row


if(firstColumnZero){
for(int i=0; i<[Link]; i++)
matrix[i][0] = 0;
}

if(firstRowZero){
for(int i=0; i<matrix[0].length; i++)
matrix[0][i] = 0;
}

}
}

Program Creek 191 | 531


79 Spiral Matrix

Given a matrix of m x n elements (m rows, n columns), return all elements of the


matrix in spiral order.
For example, given the following matrix:
[
[ 1, 2, 3 ],
[ 4, 5, 6 ],
[ 7, 8, 9 ]
]

You should return [1,2,3,6,9,8,7,4,5].

79.1 Java Solution 1

If more than one row and column left, it can form a circle and we process the circle.
Otherwise, if only one row or column left, we process that column or row ONLY.
public class Solution {
public ArrayList<Integer> spiralOrder(int[][] matrix) {
ArrayList<Integer> result = new ArrayList<Integer>();

if(matrix == null || [Link] == 0) return result;

int m = [Link];
int n = matrix[0].length;

int x=0;
int y=0;

while(m>0 && n>0){

//if one row/column left, no circle can be formed


if(m==1){
for(int i=0; i<n; i++){
[Link](matrix[x][y++]);
}
break;
}else if(n==1){
for(int i=0; i<m; i++){
[Link](matrix[x++][y]);
}

193 | 531
79 Spiral Matrix

break;
}

//below, process a circle

//top - move right


for(int i=0;i<n-1;i++){
[Link](matrix[x][y++]);
}

//right - move down


for(int i=0;i<m-1;i++){
[Link](matrix[x++][y]);
}

//bottom - move left


for(int i=0;i<n-1;i++){
[Link](matrix[x][y--]);
}

//left - move up
for(int i=0;i<m-1;i++){
[Link](matrix[x--][y]);
}

x++;
y++;
m=m-2;
n=n-2;
}

return result;
}
}

79.2 Java Solution 2

We can also recursively solve this problem. The solution’s performance is not better
than Solution or as clear as Solution 1. Therefore, Solution 1 should be preferred.
public class Solution {
public ArrayList<Integer> spiralOrder(int[][] matrix) {
if(matrix==null || [Link]==0)
return new ArrayList<Integer>();

return spiralOrder(matrix,0,0,[Link],matrix[0].length);
}

194 | 531 Program Creek


79 Spiral Matrix

public ArrayList<Integer> spiralOrder(int [][] matrix, int x, int y, int


m, int n){
ArrayList<Integer> result = new ArrayList<Integer>();

if(m<=0||n<=0)
return result;

//only one element left


if(m==1&&n==1) {
[Link](matrix[x][y]);
return result;
}

//top - move right


for(int i=0;i<n-1;i++){
[Link](matrix[x][y++]);
}

//right - move down


for(int i=0;i<m-1;i++){
[Link](matrix[x++][y]);
}

//bottom - move left


if(m>1){
for(int i=0;i<n-1;i++){
[Link](matrix[x][y--]);
}
}

//left - move up
if(n>1){
for(int i=0;i<m-1;i++){
[Link](matrix[x--][y]);
}
}

if(m==1||n==1)
[Link](spiralOrder(matrix, x, y, 1, 1));
else
[Link](spiralOrder(matrix, x+1, y+1, m-2, n-2));

return result;
}
}

Program Creek 195 | 531


80 Spiral Matrix II

Given an integer n, generate a square matrix filled with elements from 1 to n2 in spiral
order. For example, given n = 4,
[
[1, 2, 3, 4],
[12, 13, 14, 5],
[11, 16, 15, 6],
[10, 9, 8, 7]
]

80.1 Java Solution

public int[][] generateMatrix(int n) {


int total = n*n;
int[][] result= new int[n][n];

int x=0;
int y=0;
int step = 0;

for(int i=0;i<total;){
while(y+step<n){
i++;
result[x][y]=i;
y++;

}
y--;
x++;

while(x+step<n){
i++;
result[x][y]=i;
x++;
}
x--;
y--;

while(y>=0+step){
i++;

197 | 531
80 Spiral Matrix II

result[x][y]=i;
y--;
}
y++;
x--;
step++;

while(x>=0+step){
i++;
result[x][y]=i;
x--;
}
x++;
y++;
}

return result;
}

198 | 531 Program Creek


81 Search a 2D Matrix

Write an efficient algorithm that searches for a value in an m x n matrix. This matrix
has properties:
1) Integers in each row are sorted from left to right. 2) The first integer of each row
is greater than the last integer of the previous row.
For example, consider the following matrix:
[
[1, 3, 5, 7],
[10, 11, 16, 20],
[23, 30, 34, 50]
]

Given target = 3, return true.

81.1 Java Solution

This is a typical problem of binary search.


You may try to solve this problem by finding the row first and then the column.
There is no need to do that. Because of the matrix’s special features, the matrix can be
considered as a sorted array. Your goal is to find one element in this sorted array by
using binary search.
public class Solution {
public boolean searchMatrix(int[][] matrix, int target) {
if(matrix==null || [Link]==0 || matrix[0].length==0)
return false;

int m = [Link];
int n = matrix[0].length;

int start = 0;
int end = m*n-1;

while(start<=end){
int mid=(start+end)/2;
int midX=mid/n;
int midY=mid%n;

if(matrix[midX][midY]==target)
return true;

199 | 531
81 Search a 2D Matrix

if(matrix[midX][midY]<target){
start=mid+1;
}else{
end=mid-1;
}
}

return false;
}
}

200 | 531 Program Creek


82 Search a 2D Matrix II

Write an efficient algorithm that searches for a value in an m x n matrix. This matrix
has the following properties:
Integers in each row are sorted in ascending from left to right. Integers in each
column are sorted in ascending from top to bottom.
For example, consider the following matrix:
[
[1, 4, 7, 11, 15],
[2, 5, 8, 12, 19],
[3, 6, 9, 16, 22],
[10, 13, 14, 17, 24],
[18, 21, 23, 26, 30]
]

Given target = 5, return true.

82.1 Java Solution 1

In a naive approach, we can use the matrix boundary to reduce the search space. Here
is a simple recursive implementation.
public boolean searchMatrix(int[][] matrix, int target) {
int i1=0;
int i2=[Link]-1;
int j1=0;
int j2=matrix[0].length-1;

return helper(matrix, i1, i2, j1, j2, target);


}

public boolean helper(int[][] matrix, int i1, int i2, int j1, int j2, int
target){

if(i1>i2||j1>j2)
return false;

for(int j=j1;j<=j2;j++){
if(target < matrix[i1][j]){
return helper(matrix, i1, i2, j1, j-1, target);
}else if(target == matrix[i1][j]){
return true;

201 | 531
82 Search a 2D Matrix II

}
}

for(int i=i1;i<=i2;i++){
if(target < matrix[i][j1]){
return helper(matrix, i1, i-1, j1, j2, target);
}else if(target == matrix[i][j1]){
return true;
}
}

for(int j=j1;j<=j2;j++){
if(target > matrix[i2][j]){
return helper(matrix, i1, i2, j+1, j2, target);
}else if(target == matrix[i2][j]){
return true;
}
}

for(int i=i1;i<=i2;i++){
if(target > matrix[i][j2]){
return helper(matrix, i1, i+1, j1, j2, target);
}else if(target == matrix[i][j2]){
return true;
}
}

return false;
}

82.2 Java Solution 2

Time Complexity: O(m + n)


public boolean searchMatrix(int[][] matrix, int target) {
int m=[Link]-1;
int n=matrix[0].length-1;

int i=m;
int j=0;

while(i>=0 && j<=n){


if(target < matrix[i][j]){
i--;
}else if(target > matrix[i][j]){
j++;
}else{
return true;

202 | 531 Program Creek


82 Search a 2D Matrix II

}
}

return false;
}

Program Creek 203 | 531


83 Rotate Image

You are given an n x n 2D matrix representing an image.


Rotate the image by 90 degrees (clockwise).
Follow up: Could you do this in-place?

83.1 Naive Solution

In the following solution, a new 2-dimension array is created to store the rotated
matrix, and the result is assigned to the matrix at the end. This is WRONG! Why?
public class Solution {
public void rotate(int[][] matrix) {
if(matrix == null || [Link]==0)
return ;

int m = [Link];

int[][] result = new int[m][m];

for(int i=0; i<m; i++){


for(int j=0; j<m; j++){
result[j][m-1-i] = matrix[i][j];
}
}

matrix = result;
}
}

The problem is that Java is pass by value not by refrence! "matrix" is just a reference
to a 2-dimension array. If "matrix" is assigned to a new 2-dimension array in the
method, the original array does not change. Therefore, there should be another loop
to assign each element to the array referenced by "matrix". Check out "Java pass by
value."
public class Solution {
public void rotate(int[][] matrix) {
if(matrix == null || [Link]==0)
return ;

int m = [Link];

205 | 531
83 Rotate Image

int[][] result = new int[m][m];

for(int i=0; i<m; i++){


for(int j=0; j<m; j++){
result[j][m-1-i] = matrix[i][j];
}
}

for(int i=0; i<m; i++){


for(int j=0; j<m; j++){
matrix[i][j] = result[i][j];
}
}
}
}

83.2 In-place Solution

By using the relation "matrix[i][j] = matrix[n-1-j][i]", we can loop through the matrix.
public void rotate(int[][] matrix) {
int n = [Link];
for (int i = 0; i < n / 2; i++) {
for (int j = 0; j < [Link](((double) n) / 2.); j++) {
int temp = matrix[i][j];
matrix[i][j] = matrix[n-1-j][i];
matrix[n-1-j][i] = matrix[n-1-i][n-1-j];
matrix[n-1-i][n-1-j] = matrix[j][n-1-i];
matrix[j][n-1-i] = temp;
}
}
}

206 | 531 Program Creek


84 Valid Sudoku

Determine if a Sudoku is valid. The Sudoku board could be partially filled, where
empty cells are filled with the character ’.’.

84.1 Java Solution

public boolean isValidSudoku(char[][] board) {


if (board == null || [Link] != 9 || board[0].length != 9)
return false;
// check each column
for (int i = 0; i < 9; i++) {
boolean[] m = new boolean[9];
for (int j = 0; j < 9; j++) {
if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;
}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}

//check each row


for (int j = 0; j < 9; j++) {
boolean[] m = new boolean[9];
for (int i = 0; i < 9; i++) {

207 | 531
84 Valid Sudoku

if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;
}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}

//check each 3*3 matrix


for (int block = 0; block < 9; block++) {
boolean[] m = new boolean[9];
for (int i = block / 3 * 3; i < block / 3 * 3 + 3; i++) {
for (int j = block % 3 * 3; j < block % 3 * 3 + 3; j++) {
if (board[i][j] != ’.’) {
if (m[(int) (board[i][j] - ’1’)]) {
return false;
}
m[(int) (board[i][j] - ’1’)] = true;
}
}
}
}

return true;
}

208 | 531 Program Creek


85 Minimum Path Sum

Given a m x n grid filled with non-negative numbers, find a path from top left to
bottom right which minimizes the sum of all numbers along its path.

85.1 Java Solution 1: Depth-First Search

A native solution would be depth-first search. It’s time is too expensive and fails the
online judgement.
public int minPathSum(int[][] grid) {
return dfs(0,0,grid);
}

public int dfs(int i, int j, int[][] grid){


if(i==[Link]-1 && j==grid[0].length-1){
return grid[i][j];
}

if(i<[Link]-1 && j<grid[0].length-1){


int r1 = grid[i][j] + dfs(i+1, j, grid);
int r2 = grid[i][j] + dfs(i, j+1, grid);
return [Link](r1,r2);
}

if(i<[Link]-1){
return grid[i][j] + dfs(i+1, j, grid);
}

if(j<grid[0].length-1){
return grid[i][j] + dfs(i, j+1, grid);
}

return 0;
}

85.2 Java Solution 2: Dynamic Programming

public int minPathSum(int[][] grid) {


if(grid == null || [Link]==0)
return 0;

209 | 531
85 Minimum Path Sum

int m = [Link];
int n = grid[0].length;

int[][] dp = new int[m][n];


dp[0][0] = grid[0][0];

// initialize top row


for(int i=1; i<n; i++){
dp[0][i] = dp[0][i-1] + grid[0][i];
}

// initialize left column


for(int j=1; j<m; j++){
dp[j][0] = dp[j-1][0] + grid[j][0];
}

// fill up the dp table


for(int i=1; i<m; i++){
for(int j=1; j<n; j++){
if(dp[i-1][j] > dp[i][j-1]){
dp[i][j] = dp[i][j-1] + grid[i][j];
}else{
dp[i][j] = dp[i-1][j] + grid[i][j];
}
}
}

return dp[m-1][n-1];
}

210 | 531 Program Creek


86 Unique Paths

A robot is located at the top-left corner of a m x n grid. It can only move either down
or right at any point in time. The robot is trying to reach the bottom-right corner of
the grid.
How many possible unique paths are there?

86.1 Java Solution 1 - DFS

A depth-first search solution is pretty straight-forward. However, the time of this


solution is too expensive, and it didn’t pass the online judge.
public int uniquePaths(int m, int n) {
return dfs(0,0,m,n);
}

public int dfs(int i, int j, int m, int n){


if(i==m-1 && j==n-1){
return 1;
}

if(i<m-1 && j<n-1){


return dfs(i+1,j,m,n) + dfs(i,j+1,m,n);
}

if(i<m-1){
return dfs(i+1,j,m,n);
}

if(j<n-1){
return dfs(i,j+1,m,n);
}

return 0;
}

86.2 Java Solution 2 - Dynamic Programming

public int uniquePaths(int m, int n) {


if(m==0 || n==0) return 0;
if(m==1 || n==1) return 1;

211 | 531
86 Unique Paths

int[][] dp = new int[m][n];

//left column
for(int i=0; i<m; i++){
dp[i][0] = 1;
}

//top row
for(int j=0; j<n; j++){
dp[0][j] = 1;
}

//fill up the dp table


for(int i=1; i<m; i++){
for(int j=1; j<n; j++){
dp[i][j] = dp[i-1][j] + dp[i][j-1];
}
}

return dp[m-1][n-1];
}

212 | 531 Program Creek


87 Unique Paths II

Follow up for "Unique Paths":


Now consider if some obstacles are added to the grids. How many unique paths
would there be?
An obstacle and empty space is marked as 1 and 0 respectively in the grid. For
example, there is one obstacle in the middle of a 3x3 grid as illustrated below,
[
[0,0,0],
[0,1,0],
[0,0,0]
]

the total number of unique paths is 2.

87.1 Java Solution

public int uniquePathsWithObstacles(int[][] obstacleGrid) {


if(obstacleGrid==null||[Link]==0)
return 0;

int m = [Link];
int n = obstacleGrid[0].length;

if(obstacleGrid[0][0]==1||obstacleGrid[m-1][n-1]==1)
return 0;

int[][] dp = new int[m][n];


dp[0][0]=1;

//left column
for(int i=1; i<m; i++){
if(obstacleGrid[i][0]==1){
dp[i][0] = 0;
}else{
dp[i][0] = dp[i-1][0];
}
}

//top row

213 | 531
87 Unique Paths II

for(int i=1; i<n; i++){


if(obstacleGrid[0][i]==1){
dp[0][i] = 0;
}else{
dp[0][i] = dp[0][i-1];
}
}

//fill up cells inside


for(int i=1; i<m; i++){
for(int j=1; j<n; j++){
if(obstacleGrid[i][j]==1){
dp[i][j]=0;
}else{
dp[i][j]=dp[i-1][j]+dp[i][j-1];
}

}
}

return dp[m-1][n-1];
}

214 | 531 Program Creek


88 Number of Islands

Given a 2-d grid map of ’1’s (land) and ’0’s (water), count the number of islands. An
island is surrounded by water and is formed by connecting adjacent lands horizontally
or vertically. You may assume all four edges of the grid are all surrounded by water.
Example 1:
11110
11010
11000
00000

Answer: 1
Example 2:
11000
11000
00100
00011

Answer: 3

88.1 Java Solution

The basic idea of the following solution is merging adjacent lands, and the merging
should be done recursively.
public int numIslands(char[][] grid) {
if(grid==null||[Link]==0||grid[0].length==0)
return 0;

int m=[Link];
int n=grid[0].length;

int count=0;
for(int i=0;i<m; i++){
for(int j=0;j<n; j++){
if(grid[i][j]==’1’){
count++;
merge(grid, i, j);
}
}
}

215 | 531
88 Number of Islands

return count;
}

public void merge(char[][] grid, int i, int j){


if(i<0||j<0||i>=[Link]||j>=grid[0].length)
return;

if(grid[i][j]==’1’){
grid[i][j]=’0’;

merge(grid, i-1,j);
merge(grid, i+1,j);
merge(grid, i,j-1);
merge(grid, i,j+1);
}
}

Check out Number of Island II.

216 | 531 Program Creek


89 Number of Islands II

A 2d grid map of m rows and n columns is initially filled with water. We may perform
an addLand operation which turns the water at position (row, col) into a land. Given a
list of positions to operate, count the number of islands after each addLand operation.
An island is surrounded by water and is formed by connecting adjacent lands hori-
zontally or vertically. You may assume all four edges of the grid are all surrounded by
water.

89.1 Java Solution

Use an array to track the parent node for each cell.


public List<Integer> numIslands2(int m, int n, int[][] positions) {
int[] rootArray = new int[m*n];
[Link](rootArray,-1);

ArrayList<Integer> result = new ArrayList<Integer>();

int[][] directions = {{-1,0},{0,1},{1,0},{0,-1}};


int count=0;

for(int k=0; k<[Link]; k++){


count++;

int[] p = positions[k];
int index = p[0]*n+p[1];
rootArray[index]=index;//set root to be itself for each node

for(int r=0;r<4;r++){
int i=p[0]+directions[r][0];
int j=p[1]+directions[r][1];

if(i>=0&&j>=0&&i<m&&j<n&&rootArray[i*n+j]!=-1){
//get neighbor’s root
int thisRoot = getRoot(rootArray, i*n+j);
if(thisRoot!=index){
rootArray[thisRoot]=index;//set previous root’s root
count--;
}
}
}

217 | 531
89 Number of Islands II

[Link](count);
}

return result;
}

public int getRoot(int[] arr, int i){


while(i!=arr[i]){
i=arr[arr[i]];
}
return i;
}

218 | 531 Program Creek


90 Surrounded Regions

Given a 2D board containing ’X’ and ’O’, capture all regions surrounded by ’X’. A
region is captured by flipping all ’O’s into ’X’s in that surrounded region.
For example,
X X X X
X O O X
X X O X
X O X X

After running your function, the board should be:


X X X X
X X X X
X X X X
X O X X

90.1 Analysis

This problem is similar to Number of Islands. In this problem, only the cells on the
boarders can not be surrounded. So we can first merge those O’s on the boarders like
in Number of Islands and replace O’s with ’#’, and then scan the board and replace all
O’s left (if any).

90.2 Depth-first Search

public void solve(char[][] board) {


if(board == null || [Link]==0)
return;

int m = [Link];
int n = board[0].length;

//merge O’s on left & right boarder


for(int i=0;i<m;i++){
if(board[i][0] == ’O’){
merge(board, i, 0);
}

if(board[i][n-1] == ’O’){

219 | 531
90 Surrounded Regions

merge(board, i,n-1);
}
}

//merge O’s on top & bottom boarder


for(int j=0; j<n; j++){
if(board[0][j] == ’O’){
merge(board, 0,j);
}

if(board[m-1][j] == ’O’){
merge(board, m-1,j);
}
}

//process the board


for(int i=0;i<m;i++){
for(int j=0; j<n; j++){
if(board[i][j] == ’O’){
board[i][j] = ’X’;
}else if(board[i][j] == ’#’){
board[i][j] = ’O’;
}
}
}
}

public void merge(char[][] board, int i, int j){


if(i<0 || i>=[Link] || j<0 || j>=board[0].length)
return;

if(board[i][j] != ’O’)
return;

board[i][j] = ’#’;

merge(board, i-1, j);


merge(board, i+1, j);
merge(board, i, j-1);
merge(board, i, j+1);
}

This solution causes [Link], because for a large board, too


many method calls are pushed to the stack and causes the overflow.

90.3 Breath-first Search

Instead we use a queue to do breath-first search.

220 | 531 Program Creek


90 Surrounded Regions

public class Solution {


// use a queue to do BFS
private Queue<Integer> queue = new LinkedList<Integer>();

public void solve(char[][] board) {


if (board == null || [Link] == 0)
return;

int m = [Link];
int n = board[0].length;

// merge O’s on left & right boarder


for (int i = 0; i < m; i++) {
if (board[i][0] == ’O’) {
bfs(board, i, 0);
}

if (board[i][n - 1] == ’O’) {
bfs(board, i, n - 1);
}
}

// merge O’s on top & bottom boarder


for (int j = 0; j < n; j++) {
if (board[0][j] == ’O’) {
bfs(board, 0, j);
}

if (board[m - 1][j] == ’O’) {


bfs(board, m - 1, j);
}
}

// process the board


for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
if (board[i][j] == ’O’) {
board[i][j] = ’X’;
} else if (board[i][j] == ’#’) {
board[i][j] = ’O’;
}
}
}
}

private void bfs(char[][] board, int i, int j) {


int n = board[0].length;

// fill current first and then its neighbors


fillCell(board, i, j);

Program Creek 221 | 531


90 Surrounded Regions

while (![Link]()) {
int cur = [Link]();
int x = cur / n;
int y = cur % n;

fillCell(board, x - 1, y);
fillCell(board, x + 1, y);
fillCell(board, x, y - 1);
fillCell(board, x, y + 1);
}
}

private void fillCell(char[][] board, int i, int j) {


int m = [Link];
int n = board[0].length;
if (i < 0 || i >= m || j < 0 || j >= n || board[i][j] != ’O’)
return;

// add current cell is queue & then process its neighbors in bfs
[Link](i * n + j);
board[i][j] = ’#’;
}
}

222 | 531 Program Creek


91 Maximal Rectangle

Given a 2D binary matrix filled with 0’s and 1’s, find the largest rectangle containing
all ones and return its area.

91.1 Analysis

This problem can be converted to the "Largest Rectangle in Histogram" problem.

91.2 Java Solution

public int maximalRectangle(char[][] matrix) {


int m = [Link];
int n = m == 0 ? 0 : matrix[0].length;
int[][] height = new int[m][n + 1];

int maxArea = 0;
for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
if (matrix[i][j] == ’0’) {
height[i][j] = 0;
} else {
height[i][j] = i == 0 ? 1 : height[i - 1][j] + 1;
}
}
}

for (int i = 0; i < m; i++) {


int area = maxAreaInHist(height[i]);
if (area > maxArea) {
maxArea = area;
}
}

return maxArea;
}

private int maxAreaInHist(int[] height) {


Stack<Integer> stack = new Stack<Integer>();

int i = 0;
int max = 0;

223 | 531
91 Maximal Rectangle

while (i < [Link]) {


if ([Link]() || height[[Link]()] <= height[i]) {
[Link](i++);
} else {
int t = [Link]();
max = [Link](max, height[t]
* ([Link]() ? i : i - [Link]() - 1));
}
}

return max;
}

224 | 531 Program Creek


92 Maximal Square

Given a 2D binary matrix filled with 0’s and 1’s, find the largest square containing all
1’s and return its area.
For example, given the following matrix:
1101
1101
1111

Return 4.

92.1 Analysis

This problem can be solved by dynamic programming. The changing condition is:
t[i][j] = min(t[i][j-1], t[i-1][j], t[i-1][j-1]) + 1. It means the square formed before this
point.

92.2 Java Solution

public int maximalSquare(char[][] matrix) {


if (matrix == null || [Link] == 0 || matrix[0].length == 0)
return 0;

int m = [Link];
int n = matrix[0].length;

int[][] t = new int[m][n];

//top row
for (int i = 0; i < m; i++) {
t[i][0] = [Link](matrix[i][0]);
}

//left column
for (int j = 0; j < n; j++) {
t[0][j] = [Link](matrix[0][j]);
}

//cells inside
for (int i = 1; i < m; i++) {

225 | 531
92 Maximal Square

for (int j = 1; j < n; j++) {


if (matrix[i][j] == ’1’) {
int min = [Link](t[i - 1][j], t[i - 1][j - 1]);
min = [Link](min,t[i][j - 1]);
t[i][j] = min + 1;
} else {
t[i][j] = 0;
}
}
}

int max = 0;
//get maximal length
for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
if (t[i][j] > max) {
max = t[i][j];
}
}
}

return max * max;


}

226 | 531 Program Creek


93 Word Search

Given a 2D board and a word, find if the word exists in the grid.
The word can be constructed from letters of sequentially adjacent cell, where "ad-
jacent" cells are those horizontally or vertically neighboring. The same letter cell may
not be used more than once.
For example, given board =
[
["ABCE"],
["SFCS"],
["ADEE"]
]

word = "ABCCED", ->returns true, word = "SEE", ->returns true, word = "ABCB",
->returns false.

93.1 Analysis

This problem can be solve by using a typical DFS method.

93.2 Java Solution

public boolean exist(char[][] board, String word) {


int m = [Link];
int n = board[0].length;

boolean result = false;


for(int i=0; i<m; i++){
for(int j=0; j<n; j++){
if(dfs(board,word,i,j,0)){
result = true;
}
}
}

return result;
}

public boolean dfs(char[][] board, String word, int i, int j, int k){
int m = [Link];

227 | 531
93 Word Search

int n = board[0].length;

if(i<0 || j<0 || i>=m || j>=n){


return false;
}

if(board[i][j] == [Link](k)){
char temp = board[i][j];
board[i][j]=’#’;
if(k==[Link]()-1){
return true;
}else if(dfs(board, word, i-1, j, k+1)
||dfs(board, word, i+1, j, k+1)
||dfs(board, word, i, j-1, k+1)
||dfs(board, word, i, j+1, k+1)){
return true;
}
board[i][j]=temp;
}

return false;
}

228 | 531 Program Creek


94 Word Search II

Given a 2D board and a list of words from the dictionary, find all words in the board.
Each word must be constructed from letters of sequentially adjacent cell, where
"adjacent" cells are those horizontally or vertically neighboring. The same letter cell
may not be used more than once in a word.
For example, given words = ["oath","pea","eat","rain"] and board =
[
[’o’,’a’,’a’,’n’],
[’e’,’t’,’a’,’e’],
[’i’,’h’,’k’,’r’],
[’i’,’f’,’l’,’v’]
]

Return ["eat","oath"].

94.1 Java Solution 1

Similar to Word Search, this problem can be solved by DFS. However, this solution
exceeds time limit.
public List<String> findWords(char[][] board, String[] words) {
ArrayList<String> result = new ArrayList<String>();

int m = [Link];
int n = board[0].length;

for (String word : words) {


boolean flag = false;
for (int i = 0; i < m; i++) {
for (int j = 0; j < n; j++) {
char[][] newBoard = new char[m][n];
for (int x = 0; x < m; x++)
for (int y = 0; y < n; y++)
newBoard[x][y] = board[x][y];

if (dfs(newBoard, word, i, j, 0)) {


flag = true;
}
}
}
if (flag) {

229 | 531
94 Word Search II

[Link](word);
}
}

return result;
}

public boolean dfs(char[][] board, String word, int i, int j, int k) {


int m = [Link];
int n = board[0].length;

if (i < 0 || j < 0 || i >= m || j >= n || k > [Link]() - 1) {


return false;
}

if (board[i][j] == [Link](k)) {
char temp = board[i][j];
board[i][j] = ’#’;

if (k == [Link]() - 1) {
return true;
} else if (dfs(board, word, i - 1, j, k + 1)
|| dfs(board, word, i + 1, j, k + 1)
|| dfs(board, word, i, j - 1, k + 1)
|| dfs(board, word, i, j + 1, k + 1)) {
board[i][j] = temp;
return true;
}

} else {
return false;
}

return false;
}

94.2 Java Solution 2 - Trie

If the current candidate does not exist in all words’ prefix, we can stop backtracking
immediately. This can be done by using a trie structure.
public class Solution {
Set<String> result = new HashSet<String>();

public List<String> findWords(char[][] board, String[] words) {


//HashSet<String> result = new HashSet<String>();

Trie trie = new Trie();

230 | 531 Program Creek


94 Word Search II

for(String word: words){


[Link](word);
}

int m=[Link];
int n=board[0].length;

boolean[][] visited = new boolean[m][n];

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
dfs(board, visited, "", i, j, trie);
}
}

return new ArrayList<String>(result);


}

public void dfs(char[][] board, boolean[][] visited, String str, int i,


int j, Trie trie){
int m=[Link];
int n=board[0].length;

if(i<0 || j<0||i>=m||j>=n){
return;
}

if(visited[i][j])
return;

str = str + board[i][j];

if(![Link](str))
return;

if([Link](str)){
[Link](str);
}

visited[i][j]=true;
dfs(board, visited, str, i-1, j, trie);
dfs(board, visited, str, i+1, j, trie);
dfs(board, visited, str, i, j-1, trie);
dfs(board, visited, str, i, j+1, trie);
visited[i][j]=false;
}
}

//Trie Node

Program Creek 231 | 531


94 Word Search II

class TrieNode{
public TrieNode[] children = new TrieNode[26];
public String item = "";
}

//Trie
class Trie{
public TrieNode root = new TrieNode();

public void insert(String word){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null){
[Link][c-’a’]= new TrieNode();
}
node = [Link][c-’a’];
}
[Link] = word;
}

public boolean search(String word){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null)
return false;
node = [Link][c-’a’];
}
if([Link](word)){
return true;
}else{
return false;
}
}

public boolean startsWith(String prefix){


TrieNode node = root;
for(char c: [Link]()){
if([Link][c-’a’]==null)
return false;
node = [Link][c-’a’];
}
return true;
}
}

232 | 531 Program Creek


95 Integer Break

Given a positive integer n, break it into the sum of at least two positive integers and
maximize the product of those integers. Return the maximum product you can get.
For example, given n = 2, return 1 (2 = 1 + 1); given n = 10, return 36 (10 = 3 + 3 +
4).

95.1 Java Solution 1 - Dynamic Programming

Let dp[i] to be the max production value for breaking the number i. Since dp[i+j] can
be i*j, dp[i+j] = max(max(dp[i], i) * max(dp[j], j)), dp[i+j]).
public int integerBreak(int n) {
int[] dp = new int[n+1];

for(int i=1; i<n; i++){


for(int j=1; j<i+1; j++){
if(i+j<=n){
dp[i+j]=[Link]([Link](dp[i],i)*[Link](dp[j],j), dp[i+j]);
}
}
}

return dp[n];
}

95.2 Java Solution 2 - Using Regularities

If we see the breaking result for some numbers, we can see repeated pattern like the
following:
2 -> 1*1
3 -> 1*2
4 -> 2*2
5 -> 3*2
6 -> 3*3
7 -> 3*4
8 -> 3*3*2
9 -> 3*3*3
10 -> 3*3*4
11 -> 3*3*3*2

233 | 531
95 Integer Break

We only need to find how many 3’s we can get when n>4. If n
public int integerBreak(int n) {

if(n==2) return 1;
if(n==3) return 2;
if(n==4) return 4;

int result=1;
if(n%3==0){
int m = n/3;
result = (int) [Link](3, m);
}else if(n%3==2){
int m=n/3;
result = (int) [Link](3, m) * 2;
}else if(n%3==1){
int m=(n-4)/3;
result = (int) [Link](3, m) *4;
}

return result;
}

234 | 531 Program Creek


96 Range Sum Query 2D Immutable

Given a 2D matrix matrix, find the sum of the elements inside the rectangle defined
by its upper left corner (row1, col1) and lower right corner (row2, col2).

96.1 Analysis

Since the assumption is that there are many calls to sumRegion method, we should
use some extra space to store the intermediate results. Here we define an array sum[][]
which stores the sum value from (0,0) to the current cell.

96.2 Java Solution

public class NumMatrix {


int [][] sum;

public NumMatrix(int[][] matrix) {


if(matrix==null || [Link]==0||matrix[0].length==0)
return;

int m = [Link];
int n = matrix[0].length;
sum = new int[m][n];

for(int i=0; i<m; i++){


int sumRow=0;
for(int j=0; j<n; j++){
if(i==0){
sumRow += matrix[i][j];
sum[i][j]=sumRow;
}else{
sumRow += matrix[i][j];
sum[i][j]=sumRow+sum[i-1][j];
}

}
}
}

public int sumRegion(int row1, int col1, int row2, int col2) {
if([Link]==null)

235 | 531
96 Range Sum Query 2D Immutable

return 0;

int topRightX = row1;


int topRightY = col2;

int bottomLeftX=row2;
int bottomLeftY= col1;

int result=0;

if(row1==0 && col1==0){


result = sum[row2][col2];
}else if(row1==0){
result = sum[row2][col2]
-sum[bottomLeftX][bottomLeftY-1];

}else if(col1==0){
result = sum[row2][col2]
-sum[topRightX-1][topRightY];
}else{
result = sum[row2][col2]
-sum[topRightX-1][topRightY]
-sum[bottomLeftX][bottomLeftY-1]
+sum[row1-1][col1-1];
}

return result;
}
}

236 | 531 Program Creek


97 Longest Increasing Path in a Matrix

Given an integer matrix, find the length of the longest increasing path.
From each cell, you can either move to four directions: left, right, up or down. You
may NOT move diagonally or move outside of the boundary

97.1 Java Solution 1 - DFS

This solution is over time limit.


public class Solution {
int longest=0;

public int longestIncreasingPath(int[][] matrix) {


if(matrix==null||[Link]==0||matrix[0].length==0)
return 0;

for(int i=0; i<[Link]; i++){


for(int j=0; j<matrix[0].length; j++){
helper(matrix, i, j, 1);
}
}

return longest;
}

public void helper(int[][] matrix, int i, int j, int len){

if(i-1>=0 && matrix[i-1][j]>matrix[i][j]){


longest = [Link](longest, len+1);
helper(matrix, i-1, j, len+1);
}

if(i+1<[Link] && matrix[i+1][j]>matrix[i][j]){


longest = [Link](longest, len+1);
helper(matrix, i+1, j, len+1);
}

if(j-1>=0 && matrix[i][j-1]>matrix[i][j]){


longest = [Link](longest, len+1);
helper(matrix, i, j-1, len+1);
}

237 | 531
97 Longest Increasing Path in a Matrix

if(j+1<matrix[0].length && matrix[i][j+1]>matrix[i][j]){


longest = [Link](longest, len+1);
helper(matrix, i, j+1, len+1);
}

}
}

97.2 Java Solution - Optimized

public class Solution {


int[] dx = {-1, 1, 0, 0};
int[] dy = {0, 0, -1, 1};

public int longestIncreasingPath(int[][] matrix) {


if(matrix==null||[Link]==0||matrix[0].length==0)
return 0;

int[][] mem = new int[[Link]][matrix[0].length];


int longest=0;

for(int i=0; i<[Link]; i++){


for(int j=0; j<matrix[0].length; j++){
longest = [Link](longest, dfs(matrix, i, j, mem));
}
}

return longest;
}

public int dfs(int[][] matrix, int i, int j, int[][] mem){


if(mem[i][j]!=0)
return mem[i][j];

for(int m=0; m<4; m++){


int x = i+dx[m];
int y = j+dy[m];

if(x>=0&&y>=0&&x<[Link]&&y<matrix[0].length&&matrix[x][y]>matrix[i][j]){
mem[i][j]=[Link](mem[i][j], dfs(matrix, x, y, mem));
}
}

return ++mem[i][j];
}
}

238 | 531 Program Creek


98 Implement a Stack Using an Array in
Java

This post shows how to implement a stack by using an array.


The requirements of the stack are: 1) the stack has a constructor which accept a
number to initialize its size, 2) the stack can hold any type of elements, 3) the stack
has a push() and a pop() method.
I remember there is a similar example in the "Effective Java" book written by Joshua
Bloch, but not sure how the example is used. So I just write one and then read the
book, and see if I miss anything.

98.1 A Simple Stack Implementation

public class Stack<E> {


private E[] arr = null;
private int CAP;
private int top = -1;
private int size = 0;

@SuppressWarnings("unchecked")
public Stack(int cap) {
[Link] = cap;
[Link] = (E[]) new Object[cap];
}

public E pop() {
if([Link] == 0){
return null;
}

[Link]--;
E result = [Link][top];
[Link][top] = null;//prevent memory leaking
[Link]--;

return result;
}

public boolean push(E e) {


if (!isFull())
return false;

239 | 531
98 Implement a Stack Using an Array in Java

[Link]++;
[Link][++top] = e;
return false;
}

public boolean isFull() {


if ([Link] == [Link])
return false;
return true;
}

public String toString() {


if([Link]==0){
return null;
}

StringBuilder sb = new StringBuilder();


for(int i=0; i<[Link]; i++){
[Link]([Link][i] + ", ");
}

[Link]([Link]()-2);
return [Link]();
}

public static void main(String[] args) {

Stack<String> stack = new Stack<String>(11);


[Link]("hello");
[Link]("world");

[Link](stack);

[Link]();
[Link](stack);

[Link]();
[Link](stack);
}
}

Output:
hello, world
hello
null

240 | 531 Program Creek


98 Implement a Stack Using an Array in Java

98.2 Information from "Effective Java"

It turns out I don’t need to improve anything. There are some naming differences but
overall my method is ok.
This example occurs twice in "Effective Java". In the first place, the stack example is
used to illustrate memory leak. In the second place, the example is used to illustrate
when we can suppress unchecked warnings.
Do you wonder how to implement a queue by using an array?

Program Creek 241 | 531


99 Add Two Numbers

You are given two linked lists representing two non-negative numbers. The digits are
stored in reverse order and each of their nodes contain a single digit. Add the two
numbers and return it as a linked list.
Input: (2 ->4 ->3) + (5 ->6 ->4) Output: 7 ->0 ->8

99.1 Java Solution

public class Solution {


public ListNode addTwoNumbers(ListNode l1, ListNode l2) {
int carry =0;

ListNode newHead = new ListNode(0);


ListNode p1 = l1, p2 = l2, p3=newHead;

while(p1 != null || p2 != null){


if(p1 != null){
carry += [Link];
p1 = [Link];
}

if(p2 != null){
carry += [Link];
p2 = [Link];
}

[Link] = new ListNode(carry%10);


p3 = [Link];
carry /= 10;
}

if(carry==1)
[Link]=new ListNode(1);

return [Link];
}
}

What if the digits are stored in regular order instead of reversed order?
Answer: We can simple reverse the list, calculate the result, and reverse the result.

243 | 531
100 Reorder List

Given a singly linked list L: L0→L1→ ... →Ln-1→Ln, reorder it to: L0→Ln→L1→Ln-
1→L2→Ln-2→...
For example, given 1,2,3,4, reorder it to 1,4,2,3. You must do this in-place without
altering the nodes’ values.

100.1 Analysis

This problem is not straightforward, because it requires "in-place" operations. That


means we can only change their pointers, not creating a new list.

100.2 Java Solution

This problem can be solved by doing the following:

• Break list in the middle to two lists (use fast & slow pointers)
• Reverse the order of the second list
• Merge two list back together

The following code is a complete runnable class with testing.


//Class definition of ListNode
class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

public class ReorderList {

public static void main(String[] args) {


ListNode n1 = new ListNode(1);
ListNode n2 = new ListNode(2);
ListNode n3 = new ListNode(3);
ListNode n4 = new ListNode(4);
[Link] = n2;
[Link] = n3;

245 | 531
100 Reorder List

[Link] = n4;

printList(n1);

reorderList(n1);

printList(n1);
}

public static void reorderList(ListNode head) {

if (head != null && [Link] != null) {

ListNode slow = head;


ListNode fast = head;

//use a fast and slow pointer to break the link to two parts.
while (fast != null && [Link] != null && [Link]!= null) {
//why need third/second condition?
[Link]("pre "+[Link] + " " + [Link]);
slow = [Link];
fast = [Link];
[Link]("after " + [Link] + " " + [Link]);
}

ListNode second = [Link];


[Link] = null;// need to close first part

// now should have two lists: head and fast

// reverse order for second part


second = reverseOrder(second);

ListNode p1 = head;
ListNode p2 = second;

//merge two lists here


while (p2 != null) {
ListNode temp1 = [Link];
ListNode temp2 = [Link];

[Link] = p2;
[Link] = temp1;

p1 = temp1;
p2 = temp2;
}
}
}

246 | 531 Program Creek


100 Reorder List

public static ListNode reverseOrder(ListNode head) {

if (head == null || [Link] == null) {


return head;
}

ListNode pre = head;


ListNode curr = [Link];

while (curr != null) {


ListNode temp = [Link];
[Link] = pre;
pre = curr;
curr = temp;
}

// set head node’s next


[Link] = null;

return pre;
}

public static void printList(ListNode n) {


[Link]("------");
while (n != null) {
[Link]([Link]);
n = [Link];
}
[Link]();
}
}

100.3 Takeaway Messages

The three steps can be used to solve other problems of linked list. A little diagram
may help better understand them.

Reverse List:

Program Creek 247 | 531


100 Reorder List

Merge List:

248 | 531 Program Creek


100 Reorder List

Program Creek 249 | 531


101 Linked List Cycle

Given a linked list, determine if it has a cycle in it.

101.1 Analysis

If we have 2 pointers - fast and slow. It is guaranteed that the fast one will meet the
slow one if there exists a circle.

101.2 Java Solution

public class Solution {


public boolean hasCycle(ListNode head) {
ListNode fast = head;
ListNode slow = head;

while(fast != null && [Link] != null){


slow = [Link];
fast = [Link];

if(slow == fast)
return true;
}

return false;
}
}

251 | 531
102 Copy List with Random Pointer

A linked list is given such that each node contains an additional random pointer which
could point to any node in the list or null.
Return a deep copy of the list.

102.1 Java Solution 1

We can solve this problem by doing the following steps:

• copy every node, i.e., duplicate every node, and insert it to the list
• copy random pointers for all newly created nodes
• break the list to two

public RandomListNode copyRandomList(RandomListNode head) {

if (head == null)
return null;

RandomListNode p = head;

// copy every node and insert to list


while (p != null) {
RandomListNode copy = new RandomListNode([Link]);
[Link] = [Link];
[Link] = copy;
p = [Link];
}

// copy random pointer for each new node


p = head;
while (p != null) {
if ([Link] != null)
[Link] = [Link];
p = [Link];
}

// break list to two


p = head;
RandomListNode newHead = [Link];
while (p != null) {
RandomListNode temp = [Link];

253 | 531
102 Copy List with Random Pointer

[Link] = [Link];
if ([Link] != null)
[Link] = [Link];
p = [Link];
}

return newHead;
}

The break list part above move pointer 2 steps each time, you can also move one at
a time which is simpler, like the following:
while(p != null && [Link] != null){
RandomListNode temp = [Link];
[Link] = [Link];
p = temp;
}

102.2 Java Solution 2 - Using HashMap

From Xiaomeng’s comment below, we can use a HashMap which makes it simpler.
public RandomListNode copyRandomList(RandomListNode head) {
if (head == null)
return null;
HashMap<RandomListNode, RandomListNode> map = new HashMap<RandomListNode,
RandomListNode>();
RandomListNode newHead = new RandomListNode([Link]);

RandomListNode p = head;
RandomListNode q = newHead;
[Link](head, newHead);

p = [Link];
while (p != null) {
RandomListNode temp = new RandomListNode([Link]);
[Link](p, temp);
[Link] = temp;
q = temp;
p = [Link];
}

p = head;
q = newHead;
while (p != null) {
if ([Link] != null)
[Link] = [Link]([Link]);
else

254 | 531 Program Creek


102 Copy List with Random Pointer

[Link] = null;

p = [Link];
q = [Link];
}

return newHead;
}

Program Creek 255 | 531


103 Merge Two Sorted Lists

Merge two sorted linked lists and return it as a new list. The new list should be made
by splicing together the nodes of the first two lists.

103.1 Analysis

The key to solve the problem is defining a fake head. Then compare the first elements
from each list. Add the smaller one to the merged list. Finally, when one of them is
empty, simply append it to the merged list, since it is already sorted.

103.2 Java Solution

/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) {
* val = x;
* next = null;
* }
* }
*/
public class Solution {
public ListNode mergeTwoLists(ListNode l1, ListNode l2) {

ListNode p1 = l1;
ListNode p2 = l2;

ListNode fakeHead = new ListNode(0);


ListNode p = fakeHead;

while(p1 != null && p2 != null){


if([Link] <= [Link]){
[Link] = p1;
p1 = [Link];
}else{
[Link] = p2;
p2 = [Link];
}

257 | 531
103 Merge Two Sorted Lists

p = [Link];
}

if(p1 != null)
[Link] = p1;
if(p2 != null)
[Link] = p2;

return [Link];
}
}

258 | 531 Program Creek


104 Odd Even Linked List

104.1 Problem

Given a singly linked list, group all odd nodes together followed by the even nodes.
Please note here we are talking about the node number and not the value in the nodes.
The program should run in O(1) space complexity and O(nodes) time complexity.
Example:
Given 1->2->3->4->5->NULL,
return 1->3->5->2->4->NULL.

104.2 Analysis

This problem can be solved by using two pointers. We iterate over the link and move
the two pointers.

104.3 Java Solution

public ListNode oddEvenList(ListNode head) {


if(head == null)
return head;

ListNode result = head;


ListNode p1 = head;
ListNode p2 = [Link];
ListNode connectNode = [Link];

259 | 531
104 Odd Even Linked List

while(p1 != null && p2 != null){


ListNode t = [Link];
if(t == null)
break;

[Link] = [Link];
p1 = [Link];

[Link] = [Link];
p2 = [Link];
}

[Link] = connectNode;

return result;
}

260 | 531 Program Creek


105 Remove Duplicates from Sorted List

Given a sorted linked list, delete all duplicates such that each element appear only
once.
For example,
Given 1->1->2, return 1->2.
Given 1->1->2->3->3, return 1->2->3.

105.1 Thoughts

The key of this problem is using the right loop condition. And change what is nec-
essary in each loop. You can use different iteration conditions like the following 2
solutions.

105.2 Solution 1

/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) {
* val = x;
* next = null;
* }
* }
*/
public class Solution {
public ListNode deleteDuplicates(ListNode head) {
if(head == null || [Link] == null)
return head;

ListNode prev = head;


ListNode p = [Link];

while(p != null){
if([Link] == [Link]){
[Link] = [Link];
p = [Link];
//no change prev

261 | 531
105 Remove Duplicates from Sorted List

}else{
prev = p;
p = [Link];
}
}

return head;
}
}

105.3 Solution 2

public class Solution {


public ListNode deleteDuplicates(ListNode head) {
if(head == null || [Link] == null)
return head;

ListNode p = head;

while( p!= null && [Link] != null){


if([Link] == [Link]){
[Link] = [Link];
}else{
p = [Link];
}
}

return head;
}
}

262 | 531 Program Creek


106 Remove Duplicates from Sorted List
II

Given a sorted linked list, delete all nodes that have duplicate numbers, leaving only
distinct numbers from the original list.
For example, given 1->1->1->2->3, return 2->3.

106.1 Java Solution

public ListNode deleteDuplicates(ListNode head) {


ListNode t = new ListNode(0);
[Link] = head;

ListNode p = t;
while([Link]!=null&&[Link]!=null){
if([Link] == [Link]){
int dup = [Link];
while([Link]!=null&&[Link]==dup){
[Link] = [Link];
}
}else{
p=[Link];
}

return [Link];
}

263 | 531
107 Partition List

Given a linked list and a value x, partition it such that all nodes less than x come
before nodes greater than or equal to x.
You should preserve the original relative order of the nodes in each of the two
partitions.
For example, given 1->4->3->2->5->2 and x = 3, return 1->2->2->4->3->5.

107.1 Java Solution

public class Solution {


public ListNode partition(ListNode head, int x) {
if(head == null) return null;

ListNode fakeHead1 = new ListNode(0);


ListNode fakeHead2 = new ListNode(0);
[Link] = head;

ListNode p = head;
ListNode prev = fakeHead1;
ListNode p2 = fakeHead2;

while(p != null){
if([Link] < x){
p = [Link];
prev = [Link];
}else{

[Link] = p;
[Link] = [Link];

p = [Link];
p2 = [Link];
}
}

// close the list


[Link] = null;

[Link] = [Link];

return [Link];

265 | 531
107 Partition List

}
}

266 | 531 Program Creek


108 LRU Cache

Design and implement a data structure for Least Recently Used (LRU) cache. It should
support the following operations: get and set.
get(key) - Get the value (will always be positive) of the key if the key exists in the
cache, otherwise return -1. set(key, value) - Set or insert the value if the key is not
already present. When the cache reached its capacity, it should invalidate the least
recently used item before inserting a new item.

108.1 Analysis

The key to solve this problem is using a double linked list which enables us to quickly
move nodes.

The LRU cache is a hash table of keys and double linked nodes. The hash table
makes the time of get() to be O(1). The list of double linked nodes make the nodes
adding/removal operations O(1).

108.2 Java Solution

Define a double linked list node.


class Node{
int key;
int value;
Node pre;
Node next;

267 | 531
108 LRU Cache

public Node(int key, int value){


[Link] = key;
[Link] = value;
}
}

public class LRUCache {


int capacity;
HashMap<Integer, Node> map = new HashMap<Integer, Node>();
Node head=null;
Node end=null;

public LRUCache(int capacity) {


[Link] = capacity;
}

public int get(int key) {


if([Link](key)){
Node n = [Link](key);
remove(n);
setHead(n);
return [Link];
}

return -1;
}

public void remove(Node n){


if([Link]!=null){
[Link] = [Link];
}else{
head = [Link];
}

if([Link]!=null){
[Link] = [Link];
}else{
end = [Link];
}

public void setHead(Node n){


[Link] = head;
[Link] = null;

if(head!=null)
[Link] = n;

268 | 531 Program Creek


108 LRU Cache

head = n;

if(end ==null)
end = head;
}

public void set(int key, int value) {


if([Link](key)){
Node old = [Link](key);
[Link] = value;
remove(old);
setHead(old);
}else{
Node created = new Node(key, value);
if([Link]()>=capacity){
[Link]([Link]);
remove(end);
setHead(created);

}else{
setHead(created);
}

[Link](key, created);
}
}
}

Program Creek 269 | 531


109 Intersection of Two Linked Lists

109.1 Problem

Write a program to find the node at which the intersection of two singly linked lists
begins.
For example, the following two linked lists:
A: a1 -> a2
->
c1 -> c2 -> c3
->
B: b1 -> b2 -> b3

begin to intersect at node c1.

109.2 Java Solution

First calculate the length of two lists and find the difference. Then start from the longer
list at the diff offset, iterate though 2 lists and find the node.
/**
* Definition for singly-linked list.
* public class ListNode {
* int val;
* ListNode next;
* ListNode(int x) {
* val = x;
* next = null;
* }
* }
*/
public class Solution {
public ListNode getIntersectionNode(ListNode headA, ListNode headB) {
int len1 = 0;
int len2 = 0;
ListNode p1=headA, p2=headB;
if (p1 == null || p2 == null)
return null;

while(p1 != null){
len1++;
p1 = [Link];

271 | 531
109 Intersection of Two Linked Lists

}
while(p2 !=null){
len2++;
p2 = [Link];
}

int diff = 0;
p1=headA;
p2=headB;

if(len1 > len2){


diff = len1-len2;
int i=0;
while(i<diff){
p1 = [Link];
i++;
}
}else{
diff = len2-len1;
int i=0;
while(i<diff){
p2 = [Link];
i++;
}
}

while(p1 != null && p2 != null){


if([Link] == [Link]){
return p1;
}else{

}
p1 = [Link];
p2 = [Link];
}

return null;
}
}

272 | 531 Program Creek


110 Remove Linked List Elements

Remove all elements from a linked list of integers that have value val.
Example
Given: 1 --> 2 --> 6 --> 3 --> 4 --> 5 --> 6, val = 6
Return: 1 --> 2 --> 3 --> 4 --> 5

110.1 Java Solution

The key to solve this problem is using a helper node to track the head of the list.
public ListNode removeElements(ListNode head, int val) {
ListNode helper = new ListNode(0);
[Link] = head;
ListNode p = helper;

while([Link] != null){
if([Link] == val){
ListNode next = [Link];
[Link] = [Link];
}else{
p = [Link];
}
}

return [Link];
}

273 | 531
111 Swap Nodes in Pairs

Given a linked list, swap every two adjacent nodes and return its head.
For example, given 1->2->3->4, you should return the list as 2->1->4->3.
Your algorithm should use only constant space. You may not modify the values in
the list, only nodes itself can be changed.

111.1 Java Solution

Use two template variable to track the previous and next node of each pair.
public ListNode swapPairs(ListNode head) {
if(head == null || [Link] == null)
return head;

ListNode h = new ListNode(0);


[Link] = head;
ListNode p = h;

while([Link] != null && [Link] != null){


//use t1 to track first node
ListNode t1 = p;
p = [Link];
[Link] = [Link];

//use t2 to track next node of the pair


ListNode t2 = [Link];
[Link] = p;
[Link] = t2;
}

return [Link];
}

275 | 531
112 Reverse Linked List

Reverse a singly linked list.

112.1 Java Solution 1 - Iterative

public ListNode reverseList(ListNode head) {


if(head==null || [Link] == null)
return head;

ListNode p1 = head;
ListNode p2 = [Link];

[Link] = null;
while(p1!= null && p2!= null){
ListNode t = [Link];
[Link] = p1;
p1 = p2;
if (t!=null){
p2 = t;
}else{
break;
}
}

return p2;
}

112.2 Java Solution 2 - Recursive

public ListNode reverseList(ListNode head) {


if(head==null || [Link] == null)
return head;

//get second node


ListNode second = [Link];
//set first’s next to be null
[Link] = null;

ListNode rest = reverseList(second);

277 | 531
112 Reverse Linked List

[Link] = head;

return rest;
}

278 | 531 Program Creek


113 Reverse Linked List II

Reverse a linked list from position m to n. Do it in-place and in one-pass.


For example: given 1->2->3->4->5->NULL, m = 2 and n = 4, return 1->4->3->2->5-
>NULL.

113.1 Analysis

113.2 Java Solution

public ListNode reverseBetween(ListNode head, int m, int n) {


if(m==n) return head;

ListNode prev = null;//track (m-1)th node


ListNode first = new ListNode(0);//first’s next points to mth
ListNode second = new ListNode(0);//second’s next points to (n+1)th

int i=0;
ListNode p = head;
while(p!=null){
i++;
if(i==m-1){
prev = p;
}

if(i==m){
[Link] = p;
}

if(i==n){
[Link] = [Link];
[Link] = null;
}

p= [Link];
}
if([Link] == null)
return head;

// reverse list [m, n]


ListNode p1 = [Link];
ListNode p2 = [Link];

279 | 531
113 Reverse Linked List II

[Link] = [Link];

while(p1!=null && p2!=null){


ListNode t = [Link];
[Link] = p1;
p1 = p2;
p2 = t;
}

//connect to previous part


if(prev!=null)
[Link] = p1;
else
return p1;

return head;
}

280 | 531 Program Creek


114 Remove Nth Node From End of List

Given a linked list, remove the nth node from the end of list and return its head.
For example, given linked list 1->2->3->4->5 and n = 2, the result is 1->2->3->5.

114.1 Java Solution 1 - Naive Two Passes

Calculate the length first, and then remove the nth from the beginning.
public ListNode removeNthFromEnd(ListNode head, int n) {
if(head == null)
return null;

//get length of list


ListNode p = head;
int len = 0;
while(p != null){
len++;
p = [Link];
}

//if remove first node


int fromStart = len-n+1;
if(fromStart==1)
return [Link];

//remove non-first node


p = head;
int i=0;
while(p!=null){
i++;
if(i==fromStart-1){
[Link] = [Link];
}
p=[Link];
}

return head;
}

281 | 531
114 Remove Nth Node From End of List

114.2 Java Solution 2 - One Pass

Use fast and slow pointers. The fast pointer is n steps ahead of the slow pointer. When
the fast reaches the end, the slow pointer points at the previous element of the target
element.
public ListNode removeNthFromEnd(ListNode head, int n) {
if(head == null)
return null;

ListNode fast = head;


ListNode slow = head;

for(int i=0; i<n; i++){


fast = [Link];
}

//if remove the first node


if(fast == null){
head = [Link];
return head;
}

while([Link] != null){
fast = [Link];
slow = [Link];
}

[Link] = [Link];

return head;
}

282 | 531 Program Creek


115 Implement Stack using Queues

Implement the following operations of a stack using queues. push(x) – Push element
x onto stack. pop() – Removes the element on top of the stack. top() – Get the top
element. empty() – Return whether the stack is empty.
Note: only standard queue operations are allowed, i.e., poll(), offer(), peek(), size()
and isEmpty() in Java.

115.1 Analysis

This problem can be solved by using two queues.

115.2 Java Solution

class MyStack {
LinkedList<Integer> queue1 = new LinkedList<Integer>();
LinkedList<Integer> queue2 = new LinkedList<Integer>();

// Push element x onto stack.


public void push(int x) {
if(empty()){
[Link](x);
}else{
if([Link]()>0){
[Link](x);
int size = [Link]();
while(size>0){
[Link]([Link]());
size--;
}
}else if([Link]()>0){
[Link](x);
int size = [Link]();
while(size>0){
[Link]([Link]());
size--;
}
}
}
}

283 | 531
115 Implement Stack using Queues

// Removes the element on top of the stack.


public void pop() {
if([Link]()>0){
[Link]();
}else if([Link]()>0){
[Link]();
}
}

// Get the top element.


public int top() {
if([Link]()>0){
return [Link]();
}else if([Link]()>0){
return [Link]();
}
return 0;
}

// Return whether the stack is empty.


public boolean empty() {
return [Link]() & [Link]();
}
}

284 | 531 Program Creek


116 Implement Queue using Stacks

Implement the following operations of a queue using stacks.


push(x) – Push element x to the back of queue. pop() – Removes the element from
in front of queue. peek() – Get the front element. empty() – Return whether the queue
is empty.

116.1 Java Solution

class MyQueue {

Stack<Integer> temp = new Stack<Integer>();


Stack<Integer> value = new Stack<Integer>();

// Push element x to the back of queue.


public void push(int x) {
if([Link]()){
[Link](x);
}else{
while(![Link]()){
[Link]([Link]());
}

[Link](x);

while(![Link]()){
[Link]([Link]());
}
}
}

// Removes the element from in front of queue.


public void pop() {
[Link]();
}

// Get the front element.


public int peek() {
return [Link]();
}

// Return whether the queue is empty.

285 | 531
116 Implement Queue using Stacks

public boolean empty() {


return [Link]();
}
}

286 | 531 Program Creek


117 Palindrome Linked List

Given a singly linked list, determine if it is a palindrome.

117.1 Java Solution 1

We can create a new list in reversed order and then compare each node. The time and
space are O(n).
public boolean isPalindrome(ListNode head) {
if(head == null)
return true;

ListNode p = head;
ListNode prev = new ListNode([Link]);

while([Link] != null){
ListNode temp = new ListNode([Link]);
[Link] = prev;
prev = temp;
p = [Link];
}

ListNode p1 = head;
ListNode p2 = prev;

while(p1!=null){
if([Link] != [Link])
return false;

p1 = [Link];
p2 = [Link];
}

return true;
}

117.2 Java Solution 2

We can use a fast and slow pointer to get the center of the list, then reverse the second
list and compare two sublists. The time is O(n) and space is O(1).

287 | 531
117 Palindrome Linked List

public boolean isPalindrome(ListNode head) {

if(head == null || [Link]==null)


return true;

//find list center


ListNode fast = head;
ListNode slow = head;

while([Link]!=null && [Link]!=null){


fast = [Link];
slow = [Link];
}

ListNode secondHead = [Link];


[Link] = null;

//reverse second part of the list


ListNode p1 = secondHead;
ListNode p2 = [Link];

while(p1!=null && p2!=null){


ListNode temp = [Link];
[Link] = p1;
p1 = p2;
p2 = temp;
}

[Link] = null;

//compare two sublists now


ListNode p = (p2==null?p1:p2);
ListNode q = head;
while(p!=null){
if([Link] != [Link])
return false;

p = [Link];
q = [Link];

return true;
}

288 | 531 Program Creek


118 Implement a Queue using an Array
in Java

There following Java code shows how to implement a queue without using any extra
data structures in Java. We can implement a queue by using an array.

import [Link];
import [Link];

public class Queue<E> {

E[] arr;
int head = -1;
int tail = -1;
int size;

public Queue(Class<E> c, int size) {


E[] newInstance = (E[]) [Link](c, size);
[Link] = newInstance;
[Link] = 0;
}

boolean push(E e) {
if (size == [Link])
return false;

head = (head + 1) % [Link];


arr[head] = e;
size++;

if(tail == -1){
tail = head;
}

289 | 531
118 Implement a Queue using an Array in Java

return true;
}

boolean pop() {
if (size == 0) {
return false;
}

E result = arr[tail];
arr[tail] = null;
size--;
tail = (tail+1)%[Link];

if (size == 0) {
head = -1;
tail = -1;
}

return true;
}

E peek(){
if(size==0)
return null;

return arr[tail];
}

public int size() {


return [Link];
}

public String toString() {


return [Link]([Link]);
}

public static void main(String[] args) {


Queue<Integer> q = new Queue<Integer>([Link], 5);
[Link](1);
[Link](2);
[Link](3);
[Link](4);
[Link](5);
[Link]();
[Link](6);
[Link](q);
}
}

290 | 531 Program Creek


119 Delete Node in a Linked List

Write a function to delete a node (except the tail) in a singly linked list, given only
access to that node.
Supposed the linked list is 1 ->2 ->3 ->4 and you are given the third node with value
3, the linked list should become 1 ->2 ->4 after calling your function.

119.1 Java Solution

public void deleteNode(ListNode node) {


[Link] = [Link];
[Link] = [Link];
}

Is this problem too easy? Or I’m doing it wrong.

291 | 531
120 Moving Average from Data Stream

Given a stream of integers and a window size, calculate the moving average of all
integers in the sliding window.

120.1 Java Solution

This problem is solved by using a queue.


public class MovingAverage {

LinkedList<Integer> queue;
int size;

/** Initialize your data structure here. */


public MovingAverage(int size) {
[Link] = new LinkedList<Integer>();
[Link] = size;
}

public double next(int val) {


[Link](val);
if([Link]()>[Link]){
[Link]();
}
int sum=0;
for(int i: queue){
sum=sum+i;
}

return (double)sum/[Link]();
}
}

293 | 531
121 Java PriorityQueue Class Example

In Java, the PriorityQueue class is implemented as a priority heap. Heap is an impor-


tant data structure in computer science. For a quick overview of heap, here is a very
good tutorial.

121.1 Simple Example

The following examples shows the basic operations of PriorityQueue such as offer(),
peek(), poll(), and size().
import [Link];
import [Link];

public class PriorityQueueTest {

static class PQsort implements Comparator<Integer> {

public int compare(Integer one, Integer two) {


return two - one;
}
}

public static void main(String[] args) {


int[] ia = { 1, 10, 5, 3, 4, 7, 6, 9, 8 };
PriorityQueue<Integer> pq1 = new PriorityQueue<Integer>();

// use offer() method to add elements to the PriorityQueue pq1


for (int x : ia) {
[Link](x);
}

[Link]("pq1: " + pq1);

PQsort pqs = new PQsort();


PriorityQueue<Integer> pq2 = new PriorityQueue<Integer>(10, pqs);
// In this particular case, we can simply use [Link]()
// instead of self-defined comparator
for (int x : ia) {
[Link](x);
}

[Link]("pq2: " + pq2);

295 | 531
121 Java PriorityQueue Class Example

// print size
[Link]("size: " + [Link]());
// return highest priority element in the queue without removing it
[Link]("peek: " + [Link]());
// print size
[Link]("size: " + [Link]());
// return highest priority element and removes it from the queue
[Link]("poll: " + [Link]());
// print size
[Link]("size: " + [Link]());

[Link]("pq2: " + pq2);

}
}

Output:
pq1: [1, 3, 5, 8, 4, 7, 6, 10, 9]
pq2: [10, 9, 7, 8, 3, 5, 6, 1, 4]
size: 9
peek: 10
size: 9
poll: 10
size: 8
pq2: [9, 8, 7, 4, 3, 5, 6, 1]

121.2 Example of Solving Problems Using PriorityQueue

Merging k sorted list.


For more details about PriorityQueue, please go to doc.

296 | 531 Program Creek


122 Binary Tree Preorder Traversal

122.1 Analysis

Preorder binary tree traversal is a classic interview problem about trees. The key to
solve this problem is to understand the following:

• What is preorder? (parent node is processed before its children)


• Use Stack from Java Core library

The key is using a stack to store left and right children, and push right child first so
that it is processed after the left child.

122.2 Java Solution

public class TreeNode {


int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

public class Solution {


public ArrayList<Integer> preorderTraversal(TreeNode root) {
ArrayList<Integer> returnList = new ArrayList<Integer>();

if(root == null)
return returnList;

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

while(![Link]()){
TreeNode n = [Link]();
[Link]([Link]);

if([Link] != null){
[Link]([Link]);
}
if([Link] != null){
[Link]([Link]);
}

297 | 531
122 Binary Tree Preorder Traversal

}
return returnList;
}
}

298 | 531 Program Creek


123 Binary Tree Inorder Traversal

There are 3 solutions for solving this problem.

123.1 Java Solution 1 - Iterative

The key to solve inorder traversal of binary tree includes the following:

• The order of "inorder" is: left child ->parent ->right child


• Use a stack to track nodes
• Understand when to push node into the stack and when to pop node out of the
stack

//Definition for binary tree


public class TreeNode {
int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

public class Solution {


public ArrayList<Integer> inorderTraversal(TreeNode root) {
// IMPORTANT: Please reset any member data you declared, as
// the same Solution instance will be reused for each test case.

299 | 531
123 Binary Tree Inorder Traversal

ArrayList<Integer> lst = new ArrayList<Integer>();

if(root == null)
return lst;

Stack<TreeNode> stack = new Stack<TreeNode>();


//define a pointer to track nodes
TreeNode p = root;

while(![Link]() || p != null){

// if it is not null, push to stack


//and go down the tree to left
if(p != null){
[Link](p);
p = [Link];

// if no left child
// pop stack, process the node
// then let p point to the right
}else{
TreeNode t = [Link]();
[Link]([Link]);
p = [Link];
}
}

return lst;
}
}

123.2 Java Solution 2 - Recursive

The recursive solution is trivial.


public class Solution {
List<Integer> result = new ArrayList<Integer>();

public List<Integer> inorderTraversal(TreeNode root) {


if(root !=null){
helper(root);
}

return result;
}

public void helper(TreeNode p){


if([Link]!=null)

300 | 531 Program Creek


123 Binary Tree Inorder Traversal

helper([Link]);

[Link]([Link]);

if([Link]!=null)
helper([Link]);
}
}

123.3 Java Solution 3 - Simple

Updated on 4/28/2016
public List<Integer> inorderTraversal(TreeNode root) {
List<Integer> result = new ArrayList<Integer>();
if(root==null)
return result;
Stack<TreeNode> stack = new Stack<TreeNode>();
[Link](root);

while(![Link]()){
TreeNode top = [Link]();
if([Link]!=null){
[Link]([Link]);
[Link]=null;
}else{
[Link]([Link]);
[Link]();
if([Link]!=null){
[Link]([Link]);
}
}
}

return result;
}

Program Creek 301 | 531


124 Binary Tree Postorder Traversal

Among preoder, inorder and postorder binary tree traversal problems, postorder traver-
sal is the most complicated one.

124.1 Java Solution 1

The key to to iterative postorder traversal is the following:

• The order of "Postorder" is: left child ->right child ->parent node.
• Find the relation between the previously visited node and the current node
• Use a stack to track nodes

As we go down the tree to the lft, check the previously visited node. If the current
node is the left or right child of the previous node, then keep going down the tree, and
add left/right node to stack when applicable. When there is no children for current
node, i.e., the current node is a leaf, pop it from the stack. Then the previous node
become to be under the current node for next loop. You can using an example to walk
through the code.
//Definition for binary tree
public class TreeNode {
int val;
TreeNode left;
TreeNode right;
TreeNode(int x) { val = x; }
}

public class Solution {


public ArrayList<Integer> postorderTraversal(TreeNode root) {

ArrayList<Integer> lst = new ArrayList<Integer>();

303 | 531
124 Binary Tree Postorder Traversal

if(root == null)
return lst;

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

TreeNode prev = null;


while(![Link]()){
TreeNode curr = [Link]();

// go down the tree.


//check if current node is leaf, if so, process it and pop stack,
//otherwise, keep going down
if(prev == null || [Link] == curr || [Link] == curr){
//prev == null is the situation for the root node
if([Link] != null){
[Link]([Link]);
}else if([Link] != null){
[Link]([Link]);
}else{
[Link]();
[Link]([Link]);
}

//go up the tree from left node


//need to check if there is a right child
//if yes, push it to stack
//otherwise, process parent and pop stack
}else if([Link] == prev){
if([Link] != null){
[Link]([Link]);
}else{
[Link]();
[Link]([Link]);
}

//go up the tree from right node


//after coming back from right node, process parent node and pop
stack.
}else if([Link] == prev){
[Link]();
[Link]([Link]);
}

prev = curr;
}

return lst;
}
}

304 | 531 Program Creek


124 Binary Tree Postorder Traversal

124.2 Java Solution 2 - Simple!

Thanks to Edmond. This solution is superior!


public List<Integer> postorderTraversal(TreeNode root) {
List<Integer> res = new ArrayList<Integer>();

if(root==null) {
return res;
}

Stack<TreeNode> stack = new Stack<TreeNode>();


[Link](root);

while(![Link]()) {
TreeNode temp = [Link]();
if([Link]==null && [Link]==null) {
TreeNode pop = [Link]();
[Link]([Link]);
}
else {
if([Link]!=null) {
[Link]([Link]);
[Link] = null;
}

if([Link]!=null) {
[Link]([Link]);
[Link] = null;
}
}
}

return res;
}

Program Creek 305 | 531


125 Binary Tree Level Order Traversal

Given a binary tree, return the level order traversal of its nodes’ values. (ie, from left
to right, level by level).
For example: Given binary tree 3,9,20,#,#,15,7,
3
/ \
9 20
/ \
15 7

return its level order traversal as [[3], [9,20], [15,7]]

125.1 Analysis

It is obvious that this problem can be solve by using a queue. However, if we use one
queue we can not track when each level starts. So we use two queues to track the
current level and the next level.

125.2 Java Solution

public ArrayList<ArrayList<Integer>> levelOrder(TreeNode root) {


ArrayList<ArrayList<Integer>> al = new ArrayList<ArrayList<Integer>>();
ArrayList<Integer> nodeValues = new ArrayList<Integer>();
if(root == null)
return al;

LinkedList<TreeNode> current = new LinkedList<TreeNode>();


LinkedList<TreeNode> next = new LinkedList<TreeNode>();
[Link](root);

while(![Link]()){
TreeNode node = [Link]();

if([Link] != null)
[Link]([Link]);
if([Link] != null)
[Link]([Link]);

[Link]([Link]);

307 | 531
125 Binary Tree Level Order Traversal

if([Link]()){
current = next;
next = new LinkedList<TreeNode>();
[Link](nodeValues);
nodeValues = new ArrayList();
}

}
return al;
}

308 | 531 Program Creek


126 Binary Tree Level Order Traversal II

Given a binary tree, return the bottom-up level order traversal of its nodes’ values.
For example, given binary tree 3,9,20,#,#,15,7,
3
/ \
9 20
/ \
15 7

return its level order traversal as [[15,7], [9,20],[3]]

126.1 Java Solution

public List<ArrayList<Integer>> levelOrderBottom(TreeNode root) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

if(root == null){
return result;
}

LinkedList<TreeNode> current = new LinkedList<TreeNode>();


LinkedList<TreeNode> next = new LinkedList<TreeNode>();
[Link](root);

ArrayList<Integer> numberList = new ArrayList<Integer>();

// need to track when each level starts


while(![Link]()){
TreeNode head = [Link]();

[Link]([Link]);

if([Link] != null){
[Link]([Link]);
}
if([Link]!= null){
[Link]([Link]);
}

if([Link]()){
current = next;

309 | 531
126 Binary Tree Level Order Traversal II

next = new LinkedList<TreeNode>();


[Link](numberList);
numberList = new ArrayList<Integer>();
}
}

//return [Link](result);
ArrayList<ArrayList<Integer>> reversedResult = new
ArrayList<ArrayList<Integer>>();
for(int i=[Link]()-1; i>=0; i--){
[Link]([Link](i));
}

return reversedResult;
}

310 | 531 Program Creek


127 Binary Tree Vertical Order Traversal

Given a binary tree, return the vertical order traversal of its nodes’ values. (ie, from
top to bottom, column by column).

127.1 Java Solution

For each node, its left child’s degree is -1 and is right child’s degree is +1. We can do
a level order traversal and save the degree information.
class Wrapper{
TreeNode node;
int level;

public Wrapper(TreeNode n, int l){


node = n;
level = l;
}
}

public class Solution {


public List<List<Integer>> verticalOrder(TreeNode root) {
List<List<Integer>> result = new ArrayList<List<Integer>>();
if(root==null)
return result;

LinkedList<Wrapper> queue = new LinkedList<Wrapper>();


[Link](new Wrapper(root,0));

TreeMap<Integer, ArrayList<Integer>> map = new TreeMap<Integer,


ArrayList<Integer>>();

while(![Link]()){
Wrapper w = [Link]();

TreeNode node = [Link];


int level = [Link];

if([Link](level)){
[Link](level).add([Link]);
}else{
ArrayList<Integer> t = new ArrayList<Integer>();
[Link]([Link]);

311 | 531
127 Binary Tree Vertical Order Traversal

[Link](level, t);
}

if([Link]!=null){
[Link](new Wrapper([Link], level-1));
}

if([Link]!=null){
[Link](new Wrapper([Link], level+1));
}

for([Link]<Integer, ArrayList<Integer>> entry: [Link]()){


[Link]([Link]());
}

return result;
}
}

312 | 531 Program Creek


128 Invert Binary Tree

Google: 90
Very funny. Luckily, I can and in 2 ways!

128.1 Java Solution 1 - Recursive

public TreeNode invertTree(TreeNode root) {


if(root!=null){
helper(root);
}

return root;
}

public void helper(TreeNode p){

TreeNode temp = [Link];


[Link] = [Link];
[Link] = temp;

if([Link]!=null)
helper([Link]);

if([Link]!=null)
helper([Link]);
}

128.2 Java Solution 2 - Iterative

public TreeNode invertTree(TreeNode root) {


LinkedList<TreeNode> queue = new LinkedList<TreeNode>();

if(root!=null){
[Link](root);
}

while(![Link]()){
TreeNode p = [Link]();
if([Link]!=null)

313 | 531
128 Invert Binary Tree

[Link]([Link]);
if([Link]!=null)
[Link]([Link]);

TreeNode temp = [Link];


[Link] = [Link];
[Link] = temp;
}

return root;
}

314 | 531 Program Creek


129 Kth Smallest Element in a BST

Given a binary search tree, write a function kthSmallest to find the kth smallest ele-
ment in it. (1 ≤ k ≤ BST’s total elements)

129.1 Java Solution 1 - Inorder Traversal

We can inorder traverse the tree and get the kth smallest element. Time is O(n).
public int kthSmallest(TreeNode root, int k) {
Stack<TreeNode> stack = new Stack<TreeNode>();

TreeNode p = root;
int result = 0;

while(![Link]() || p!=null){
if(p!=null){
[Link](p);
p = [Link];
}else{
TreeNode t = [Link]();
k--;
if(k==0)
result = [Link];
p = [Link];
}
}

return result;
}

129.2 Java Solution 2 - Extra Data Structure

We can let each node track the order, i.e., the number of elements that are less than
itself. Time is O(log(n)).
coming soon...

315 | 531
130 Binary Tree Longest Consecutive
Sequence

Given a binary tree, find the length of the longest consecutive sequence path.
The path refers to any sequence of nodes from some starting node to any node in
the tree along the parent-child connections. The longest consecutive path need to be
from parent to child (cannot be the reverse).

130.1 Java Solution 1 - Queue

public int longestConsecutive(TreeNode root) {


if(root==null)
return 0;

LinkedList<TreeNode> nodeQueue = new LinkedList<TreeNode>();


LinkedList<Integer> sizeQueue = new LinkedList<Integer>();

[Link](root);
[Link](1);
int max=1;

while(![Link]()){
TreeNode head = [Link]();
int size = [Link]();

if([Link]!=null){
int leftSize=size;
if([Link]==[Link]-1){
leftSize++;
max = [Link](max, leftSize);
}else{
leftSize=1;
}

[Link]([Link]);
[Link](leftSize);
}

if([Link]!=null){
int rightSize=size;
if([Link]==[Link]-1){

317 | 531
130 Binary Tree Longest Consecutive Sequence

rightSize++;
max = [Link](max, rightSize);
}else{
rightSize=1;
}

[Link]([Link]);
[Link](rightSize);
}

return max;
}

130.2 Java Solution 2 - Recursion

public class Solution {


int max=0;

public int longestConsecutive(TreeNode root) {


helper(root);
return max;
}

public int helper(TreeNode root) {


if(root==null)
return 0;

int l = helper([Link]);
int r = helper([Link]);

int fromLeft = 0;
int fromRight= 0;

if([Link]==null){
fromLeft=1;
}else if([Link]-1==[Link]){
fromLeft = l+1;
}else{
fromLeft=1;
}

if([Link]==null){
fromRight=1;
}else if([Link]-1==[Link]){

318 | 531 Program Creek


130 Binary Tree Longest Consecutive Sequence

fromRight = r+1;
}else{
fromRight=1;
}

max = [Link](max, fromLeft);


max = [Link](max, fromRight);

return [Link](fromLeft, fromRight);


}

Program Creek 319 | 531


131 Validate Binary Search Tree

Given a binary tree, determine if it is a valid binary search tree (BST).


Assume a BST is defined as follows:

• The left subtree of a node contains only nodes with keys less than the node’s key.
• The right subtree of a node contains only nodes with keys greater than the node’s
key.
• Both the left and right subtrees must also be binary search trees.

131.1 Java Solution 1 - Recursive

All values on the left sub tree must be less than root, and all values on the right sub
tree must be greater than root. So we just check the boundaries for each node.
public boolean isValidBST(TreeNode root) {
return isValidBST(root, Double.NEGATIVE_INFINITY,
Double.POSITIVE_INFINITY);
}

public boolean isValidBST(TreeNode p, double min, double max){


if(p==null)
return true;

if([Link] <= min || [Link] >= max)


return false;

return isValidBST([Link], min, [Link]) && isValidBST([Link], [Link], max);


}

This solution also goes to the left subtree first. If the violation occurs close to the
root but on the right subtree, the method still cost O(n). The second solution below
can handle violations close to root node faster.

131.2 Java Solution 2 - Iterative

public class Solution {


public boolean isValidBST(TreeNode root) {
if(root == null)
return true;

321 | 531
131 Validate Binary Search Tree

LinkedList<BNode> queue = new LinkedList<BNode>();


[Link](new BNode(root, Double.NEGATIVE_INFINITY,
Double.POSITIVE_INFINITY));
while(![Link]()){
BNode b = [Link]();
if([Link] <= [Link] || [Link] >=[Link]){
return false;
}
if([Link]!=null){
[Link](new BNode([Link], [Link], [Link]));
}
if([Link]!=null){
[Link](new BNode([Link], [Link], [Link]));
}
}
return true;
}
}
//define a BNode class with TreeNode and it’s boundaries
class BNode{
TreeNode n;
double left;
double right;
public BNode(TreeNode n, double left, double right){
this.n = n;
[Link] = left;
[Link] = right;
}
}

322 | 531 Program Creek


132 Flatten Binary Tree to Linked List

Given a binary tree, flatten it to a linked list in-place.


For example, Given
1
/ \
2 5
/ \ \
3 4 6

The flattened tree should look like:


1
\
2
\
3
\
4
\
5
\
6

132.1 Thoughts

Go down through the left, when right is not null, push right to stack.

132.2 Java Solution

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {

323 | 531
132 Flatten Binary Tree to Linked List

public void flatten(TreeNode root) {


Stack<TreeNode> stack = new Stack<TreeNode>();
TreeNode p = root;

while(p != null || ![Link]()){

if([Link] != null){
[Link]([Link]);
}

if([Link] != null){
[Link] = [Link];
[Link] = null;
}else if(![Link]()){
TreeNode temp = [Link]();
[Link]=temp;
}

p = [Link];
}
}
}

324 | 531 Program Creek


133 Path Sum

Given a binary tree and a sum, determine if the tree has a root-to-leaf path such that
adding up all the values along the path equals the given sum.
For example: Given the below binary tree and sum = 22,
5
/ \
4 8
/ / \
11 13 4
/ \ \
7 2 1

return true, as there exist a root-to-leaf path 5->4->11->2 which sum is 22.

133.1 Java Solution 1 - Using Queue

Add all node to a queue and store sum value of each node to another queue. When it
is a leaf node, check the stored sum value.
For the tree above, the queue would be: 5 - 4 - 8 - 11 - 13 - 4 - 7 - 2 - 1. It will check
node 13, 7, 2 and 1. This is a typical breadth first search(BFS) problem.
/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {
public boolean hasPathSum(TreeNode root, int sum) {
if(root == null) return false;

LinkedList<TreeNode> nodes = new LinkedList<TreeNode>();


LinkedList<Integer> values = new LinkedList<Integer>();

[Link](root);
[Link]([Link]);

while(![Link]()){

325 | 531
133 Path Sum

TreeNode curr = [Link]();


int sumValue = [Link]();

if([Link] == null && [Link] == null && sumValue==sum){


return true;
}

if([Link] != null){
[Link]([Link]);
[Link](sumValue+[Link]);
}

if([Link] != null){
[Link]([Link]);
[Link](sumValue+[Link]);
}
}

return false;
}
}

133.2 Java Solution 2 - Recursion

public boolean hasPathSum(TreeNode root, int sum) {


if (root == null)
return false;
if ([Link] == sum && ([Link] == null && [Link] == null))
return true;

return hasPathSum([Link], sum - [Link])


|| hasPathSum([Link], sum - [Link]);
}

Thanks to nebulaliang, this solution is wonderful!

326 | 531 Program Creek


134 Path Sum II

Given a binary tree and a sum, find all root-to-leaf paths where each path’s sum equals
the given sum.
For example, given the below binary tree and sum = 22,
5
/ \
4 8
/ / \
11 13 4
/ \ / \
7 2 5 1

the method returns the following:


[
[5,4,11,2],
[5,8,4,5]
]

134.1 Analysis

This problem can be converted to be a typical depth-first search problem. A recursive


depth-first search algorithm usually requires a recursive method call, a reference to
the final result, a temporary result, etc.

134.2 Java Solution

public List<ArrayList<Integer>> pathSum(TreeNode root, int sum) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
if(root == null)
return result;

ArrayList<Integer> l = new ArrayList<Integer>();


[Link]([Link]);
dfs(root, [Link], result, l);
return result;
}

327 | 531
134 Path Sum II

public void dfs(TreeNode t, int sum, ArrayList<ArrayList<Integer>> result,


ArrayList<Integer> l){
if([Link]==null && [Link]==null && sum==0){
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](l);
[Link](temp);
}

//search path of left node


if([Link] != null){
[Link]([Link]);
dfs([Link], [Link], result, l);
[Link]([Link]()-1);
}

//search path of right node


if([Link]!=null){
[Link]([Link]);
dfs([Link], [Link], result, l);
[Link]([Link]()-1);
}
}

328 | 531 Program Creek


135 Construct Binary Tree from Inorder
and Postorder Traversal

Given inorder and postorder traversal of a tree, construct the binary tree.

135.1 Analysis

This problem can be illustrated by using a simple example.


in-order: 4 2 5 (1) 6 7 3 8
post-order: 4 5 2 6 7 8 3 (1)

From the post-order array, we know that last element is the root. We can find the
root in in-order array. Then we can identify the left and right sub-trees of the root
from in-order array.
Using the length of left sub-tree, we can identify left and right sub-trees in post-
order array. Recursively, we can build up the tree.

135.2 Java Solution

public TreeNode buildTree(int[] inorder, int[] postorder) {


int inStart = 0;
int inEnd = [Link] - 1;
int postStart = 0;
int postEnd = [Link] - 1;

return buildTree(inorder, inStart, inEnd, postorder, postStart, postEnd);


}

public TreeNode buildTree(int[] inorder, int inStart, int inEnd,


int[] postorder, int postStart, int postEnd) {

329 | 531
135 Construct Binary Tree from Inorder and Postorder Traversal

if (inStart > inEnd || postStart > postEnd)


return null;

int rootValue = postorder[postEnd];


TreeNode root = new TreeNode(rootValue);

int k = 0;
for (int i = 0; i < [Link]; i++) {
if (inorder[i] == rootValue) {
k = i;
break;
}
}

[Link] = buildTree(inorder, inStart, k - 1, postorder, postStart,


postStart + k - (inStart + 1));
// Becuase k is not the length, it it need to -(inStart+1) to get the length
[Link] = buildTree(inorder, k + 1, inEnd, postorder, postStart + k-
inStart, postEnd - 1);
// postStart+k-inStart = postStart+k-(inStart+1) +1

return root;
}

330 | 531 Program Creek


136 Construct Binary Tree from Preorder
and Inorder Traversal

Given preorder and inorder traversal of a tree, construct the binary tree.

136.1 Analysis

Consider the following example:


in-order: 4 2 5 (1) 6 7 3 8
pre-order: (1) 2 4 5 3 7 6 8

From the pre-order array, we know that first element is the root. We can find the
root in in-order array. Then we can identify the left and right sub-trees of the root
from in-order array.
Using the length of left sub-tree, we can identify left and right sub-trees in pre-order
array. Recursively, we can build up the tree.

136.2 Java Solution

public TreeNode buildTree(int[] preorder, int[] inorder) {


int preStart = 0;
int preEnd = [Link]-1;
int inStart = 0;
int inEnd = [Link]-1;

return construct(preorder, preStart, preEnd, inorder, inStart, inEnd);


}

public TreeNode construct(int[] preorder, int preStart, int preEnd, int[]


inorder, int inStart, int inEnd){

331 | 531
136 Construct Binary Tree from Preorder and Inorder Traversal

if(preStart>preEnd||inStart>inEnd){
return null;
}

int val = preorder[preStart];


TreeNode p = new TreeNode(val);

//find parent element index from inorder


int k=0;
for(int i=0; i<[Link]; i++){
if(val == inorder[i]){
k=i;
break;
}
}

[Link] = construct(preorder, preStart+1, preStart+(k-inStart), inorder,


inStart, k-1);
[Link]= construct(preorder, preStart+(k-inStart)+1, preEnd, inorder, k+1
, inEnd);

return p;
}

332 | 531 Program Creek


137 Convert Sorted Array to Binary
Search Tree

Given an array where elements are sorted in ascending order, convert it to a height
balanced BST.

137.1 Thoughts

Straightforward! Recursively do the job.

137.2 Java Solution

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


public TreeNode sortedArrayToBST(int[] num) {
if ([Link] == 0)
return null;

return sortedArrayToBST(num, 0, [Link] - 1);


}

public TreeNode sortedArrayToBST(int[] num, int start, int end) {


if (start > end)
return null;

int mid = (start + end) / 2;


TreeNode root = new TreeNode(num[mid]);
[Link] = sortedArrayToBST(num, start, mid - 1);
[Link] = sortedArrayToBST(num, mid + 1, end);

return root;

333 | 531
137 Convert Sorted Array to Binary Search Tree

}
}

334 | 531 Program Creek


138 Convert Sorted List to Binary Search
Tree

Given a singly linked list where elements are sorted in ascending order, convert it to a
height balanced BST.

138.1 Thoughts

If you are given an array, the problem is quite straightforward. But things get a little
more complicated when you have a singly linked list instead of an array. Now you no
longer have random access to an element in O(1) time. Therefore, you need to create
nodes bottom-up, and assign them to its parents. The bottom-up approach enables us
to access the list in its order at the same time as creating nodes.

138.2 Java Solution

// Definition for singly-linked list.


class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


static ListNode h;

335 | 531
138 Convert Sorted List to Binary Search Tree

public TreeNode sortedListToBST(ListNode head) {


if (head == null)
return null;

h = head;
int len = getLength(head);
return sortedListToBST(0, len - 1);
}

// get list length


public int getLength(ListNode head) {
int len = 0;
ListNode p = head;

while (p != null) {
len++;
p = [Link];
}
return len;
}

// build tree bottom-up


public TreeNode sortedListToBST(int start, int end) {
if (start > end)
return null;

// mid
int mid = (start + end) / 2;

TreeNode left = sortedListToBST(start, mid - 1);


TreeNode root = new TreeNode([Link]);
h = [Link];
TreeNode right = sortedListToBST(mid + 1, end);

[Link] = left;
[Link] = right;

return root;
}
}

336 | 531 Program Creek


139 Minimum Depth of Binary Tree

Given a binary tree, find its minimum depth.


The minimum depth is the number of nodes along the shortest path from the root
node down to the nearest leaf node.

139.1 Thoughts

LinkedList is a queue in Java. The add() and remove() methods are used to manipulate
the queue.

139.2 Java Solution

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/
public class Solution {
public int minDepth(TreeNode root) {
if(root == null){
return 0;
}

LinkedList<TreeNode> nodes = new LinkedList<TreeNode>();


LinkedList<Integer> counts = new LinkedList<Integer>();

[Link](root);
[Link](1);

while(![Link]()){
TreeNode curr = [Link]();
int count = [Link]();

if([Link] == null && [Link] == null){


return count;
}

337 | 531
139 Minimum Depth of Binary Tree

if([Link] != null){
[Link]([Link]);
[Link](count+1);
}

if([Link] != null){
[Link]([Link]);
[Link](count+1);
}
}

return 0;
}
}

338 | 531 Program Creek


140 Binary Tree Maximum Path Sum

Given a binary tree, find the maximum path sum. The path may start and end at any
node in the tree. For example, given the below binary tree
1
/ \
2 3

the result is 6.

140.1 Analysis

1) Recursively solve this problem 2) Get largest left sum and right sum 2) Compare to
the stored maximum

140.2 Java Solution

We can also use an array to store value for recursive methods.


public int maxPathSum(TreeNode root) {
int max[] = new int[1];
max[0] = Integer.MIN_VALUE;
calculateSum(root, max);
return max[0];
}

public int calculateSum(TreeNode root, int[] max) {


if (root == null)
return 0;

int left = calculateSum([Link], max);


int right = calculateSum([Link], max);

int current = [Link]([Link], [Link]([Link] + left, [Link] +


right));

max[0] = [Link](max[0], [Link](current, left + [Link] + right));

return current;
}

339 | 531
141 Balanced Binary Tree

Given a binary tree, determine if it is height-balanced.


For this problem, a height-balanced binary tree is defined as a binary tree in which
the depth of the two subtrees of every node never differ by more than 1.

141.1 Analysis

This is a typical tree problem that can be solve by using recursion.

141.2 Java Solution

// Definition for binary tree


class TreeNode {
int val;
TreeNode left;
TreeNode right;

TreeNode(int x) {
val = x;
}
}

public class Solution {


public boolean isBalanced(TreeNode root) {
if (root == null)
return true;

if (getHeight(root) == -1)
return false;

return true;
}

public int getHeight(TreeNode root) {


if (root == null)
return 0;

int left = getHeight([Link]);


int right = getHeight([Link]);

if (left == -1 || right == -1)

341 | 531
141 Balanced Binary Tree

return -1;

if ([Link](left - right) > 1) {


return -1;
}

return [Link](left, right) + 1;

}
}

342 | 531 Program Creek


142 Symmetric Tree

142.1 Problem

Given a binary tree, check whether it is a mirror of itself (ie, symmetric around its
center).
For example, this binary tree is symmetric:
1
/ \
2 2
/ \ / \
3 4 4 3

But the following is not:


1
/ \
2 2
\ \
3 3

142.2 Java Solution - Recursion

This problem can be solve by using a simple recursion. The key is finding the con-
ditions that return false, such as value is not equal, only one node(left or right) has
value.
public boolean isSymmetric(TreeNode root) {
if (root == null)
return true;
return isSymmetric([Link], [Link]);
}

public boolean isSymmetric(TreeNode l, TreeNode r) {


if (l == null && r == null) {
return true;
} else if (r == null || l == null) {
return false;
}

if ([Link] != [Link])

343 | 531
142 Symmetric Tree

return false;

if (!isSymmetric([Link], [Link]))
return false;
if (!isSymmetric([Link], [Link]))
return false;

return true;
}

344 | 531 Program Creek


143 Binary Search Tree Iterator

143.1 Problem

Implement an iterator over a binary search tree (BST). Your iterator will be initialized
with the root node of a BST. Calling next() will return the next smallest number in
the BST. Note: next() and hasNext() should run in average O(1) time and uses O(h)
memory, where h is the height of the tree.

143.2 Java Solution

The key to solve this problem is understanding what is BST. Here is a diagram.

/**
* Definition for binary tree
* public class TreeNode {
* int val;
* TreeNode left;
* TreeNode right;
* TreeNode(int x) { val = x; }
* }
*/

public class BSTIterator {


Stack<TreeNode> stack;

public BSTIterator(TreeNode root) {

345 | 531
143 Binary Search Tree Iterator

stack = new Stack<TreeNode>();


while (root != null) {
[Link](root);
root = [Link];
}
}

public boolean hasNext() {


return ![Link]();
}

public int next() {


TreeNode node = [Link]();
int result = [Link];
if ([Link] != null) {
node = [Link];
while (node != null) {
[Link](node);
node = [Link];
}
}
return result;
}
}

346 | 531 Program Creek


144 Binary Tree Right Side View

Given a binary tree, imagine yourself standing on the right side of it, return the values
of the nodes you can see ordered from top to bottom. For example, given the following
binary tree,
1 <---
/ \
2 3 <---
\
5 <---

You can see [1, 3, 5].

144.1 Analysis

This problem can be solve by using a queue. On each level of the tree, we add the
right-most element to the results.

144.2 Java Solution

public List<Integer> rightSideView(TreeNode root) {


ArrayList<Integer> result = new ArrayList<Integer>();

if(root == null) return result;

LinkedList<TreeNode> queue = new LinkedList<TreeNode>();


[Link](root);

while([Link]() > 0){


//get size here
int size = [Link]();

for(int i=0; i<size; i++){


TreeNode top = [Link]();

//the first element in the queue (right-most of the tree)


if(i==0){
[Link]([Link]);
}
//add right first
if([Link] != null){

347 | 531
144 Binary Tree Right Side View

[Link]([Link]);
}
//add left
if([Link] != null){
[Link]([Link]);
}
}
}

return result;
}

348 | 531 Program Creek


145 Lowest Common Ancestor of a
Binary Search Tree

Given a binary search tree (BST), find the lowest common ancestor (LCA) of two given
nodes in the BST.

145.1 Analysis

This problem can be solved by using BST property, i.e., left <parent <right for each
node. There are 3 cases to handle.

145.2 Java Solution

public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {


TreeNode m = root;

if([Link] > [Link] && [Link] < [Link]){


return m;
}else if([Link]>[Link] && [Link] > [Link]){
return lowestCommonAncestor([Link], p, q);
}else if([Link]<[Link] && [Link] < [Link]){
return lowestCommonAncestor([Link], p, q);
}

return root;
}

349 | 531
146 Lowest Common Ancestor of a
Binary Tree

Given a binary tree, find the lowest common ancestor (LCA) of two given nodes in the
tree.

146.1 Java Solution 1

Please use the following diagram to walk through the solution.

Since each node is visited in the worst case, time complexity is O(n).
class Entity{
public int count;
public TreeNode node;

public Entity(int count, TreeNode node){


[Link] = count;
[Link] = node;
}

351 | 531
146 Lowest Common Ancestor of a Binary Tree

public class Solution {


public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode
q) {
return lcaHelper(root, p, q).node;
}

public Entity lcaHelper(TreeNode root, TreeNode p, TreeNode q){


if(root == null) return new Entity(0, null);

Entity left = lcaHelper([Link], p, q);


if([Link]==2)
return left;

Entity right = lcaHelper([Link],p,q);


if([Link]==2)
return right;

int numTotal = [Link] + [Link];


if(root== p || root == q){
numTotal++;
}

return new Entity(numTotal, root);


}
}

146.2 Java Solution 2

public TreeNode lowestCommonAncestor(TreeNode root, TreeNode p, TreeNode q) {


if(root == null || root == p || root == q) return root;
TreeNode left = lowestCommonAncestor([Link], p, q);
TreeNode right = lowestCommonAncestor([Link], p, q);
if(left!=null&&right!=null) return root;
return left == null ? right : left;
}

352 | 531 Program Creek


147 Verify Preorder Serialization of a
Binary Tree

One way to serialize a binary tree is to use pre-order traversal. When we encounter
a non-null node, we record the node’s value. If it is a null node, we record using a
sentinel value such as #.
9
/ \
3 2
/ \ / \
4 1 # 6
/ \ / \ / \
# # # # # #

For example, the above binary tree can be serialized to the string "9,3,4,#,#,1,#,#,2,#,6,#,#",
where # represents a null node.
Given a string of comma separated values, verify whether it is a correct preorder
traversal serialization of a binary tree. Find an algorithm without reconstructing the
tree.

147.1 Java Solution - Stack

We can keep removing the leaf node until there is no one to remove. If a sequence
is like "4 # #", change it to "#" and continue. We need a stack so that we can record
previous removed nodes.

353 | 531
147 Verify Preorder Serialization of a Binary Tree

public boolean isValidSerialization(String preorder) {


LinkedList<String> stack = new LinkedList<String>();
String[] arr = [Link](",");

for(int i=0; i<[Link]; i++){


[Link](arr[i]);

while([Link]()>=3
&& [Link]([Link]()-1).equals("#")
&& [Link]([Link]()-2).equals("#")
&& ![Link]([Link]()-3).equals("#")){

[Link]([Link]()-1);
[Link]([Link]()-1);
[Link]([Link]()-1);

[Link]("#");
}

if([Link]()==1 && [Link](0).equals("#"))


return true;
else
return false;
}

354 | 531 Program Creek


148 Populating Next Right Pointers in
Each Node

Given the following perfect binary tree,


1
/ \
2 3
/ \ / \
4 5 6 7

After calling your function, the tree should look like:


1 -> NULL
/ \
2 -> 3 -> NULL
/ \ / \
4->5->6->7 -> NULL

148.1 Java Solution

This solution is easier to understand. You can use the example tree above to walk
through the algorithm. The basic idea is have 4 pointers to move towards right on two
levels (see comments in the code).

public void connect(TreeLinkNode root) {

355 | 531
148 Populating Next Right Pointers in Each Node

if(root == null)
return;

TreeLinkNode lastHead = root;//prevous level’s head


TreeLinkNode lastCurrent = null;//previous level’s pointer
TreeLinkNode currentHead = null;//currnet level’s head
TreeLinkNode current = null;//current level’s pointer

while(lastHead!=null){
lastCurrent = lastHead;

while(lastCurrent!=null){
if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];
}

if(currentHead != null){
[Link] = [Link];
current = [Link];
}

lastCurrent = [Link];
}

//update last head


lastHead = currentHead;
currentHead = null;
}

356 | 531 Program Creek


149 Populating Next Right Pointers in
Each Node II

Follow up for problem "Populating Next Right Pointers in Each Node".


What if the given tree could be any binary tree? Would your previous solution still
work?

149.1 Analysis

Similar to Populating Next Right Pointers in Each Node, we have 4 pointers at 2 levels
of the tree.

149.2 Java Solution

public void connect(TreeLinkNode root) {


if(root == null)
return;

TreeLinkNode lastHead = root;//prevous level’s head


TreeLinkNode lastCurrent = null;//previous level’s pointer
TreeLinkNode currentHead = null;//currnet level’s head
TreeLinkNode current = null;//current level’s pointer

while(lastHead!=null){
lastCurrent = lastHead;

while(lastCurrent!=null){
//left child is not null
if([Link]!=null) {

357 | 531
149 Populating Next Right Pointers in Each Node II

if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];
}
}

//right child is not null


if([Link]!=null){
if(currentHead == null){
currentHead = [Link];
current = [Link];
}else{
[Link] = [Link];
current = [Link];
}
}

lastCurrent = [Link];
}

//update last head


lastHead = currentHead;
currentHead = null;
}
}

358 | 531 Program Creek


150 Unique Binary Search Trees

Given n, how many structurally unique BST’s (binary search trees) that store values
1...n?
For example, Given n = 3, there are a total of 5 unique BST’s.
1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

150.1 Analysis

Let count[i] be the number of unique binary search trees for i. The number of trees are
determined by the number of subtrees which have different root node. For example,
i=0, count[0]=1 //empty tree

i=1, count[1]=1 //one tree

i=2, count[2]=count[0]*count[1] // 0 is root


+ count[1]*count[0] // 1 is root

i=3, count[3]=count[0]*count[2] // 1 is root


+ count[1]*count[1] // 2 is root
+ count[2]*count[0] // 3 is root

i=4, count[4]=count[0]*count[3] // 1 is root


+ count[1]*count[2] // 2 is root
+ count[2]*count[1] // 3 is root
+ count[3]*count[0] // 4 is root
..
..
..

i=n, count[n] = sum(count[0..k]*count[k+1...n]) 0 <= k < n-1

Use dynamic programming to solve the problem.

150.2 Java Solution

359 | 531
150 Unique Binary Search Trees

public int numTrees(int n) {


int[] count = new int[n + 1];

count[0] = 1;
count[1] = 1;

for (int i = 2; i <= n; i++) {


for (int j = 0; j <= i - 1; j++) {
count[i] = count[i] + count[j] * count[i - j - 1];
}
}

return count[n];
}

Check out how to get all unique binary search trees.

360 | 531 Program Creek


151 Unique Binary Search Trees II

Given n, generate all structurally unique BST’s (binary search trees) that store values
1...n.
For example, Given n = 3, your program should return all 5 unique BST’s shown
below.
1 3 3 2 1
\ / / / \ \
3 2 1 1 3 2
/ / \ \
2 1 2 3

151.1 Analysis

Check out Unique Binary Search Trees I.


This problem can be solved by recursively forming left and right subtrees. The
different combinations of left and right subtrees form the set of all unique binary
search trees.

151.2 Java Solution

public List<TreeNode> generateTrees(int n) {


return generateTrees(1, n);
}

public List<TreeNode> generateTrees(int start, int end) {


List<TreeNode> list = new LinkedList<>();

if (start > end) {


[Link](null);
return list;
}

for (int i = start; i <= end; i++) {


List<TreeNode> lefts = generateTrees(start, i - 1);
List<TreeNode> rights = generateTrees(i + 1, end);
for (TreeNode left : lefts) {
for (TreeNode right : rights) {
TreeNode node = new TreeNode(i);

361 | 531
151 Unique Binary Search Trees II

[Link] = left;
[Link] = right;
[Link](node);
}
}
}

return list;
}

362 | 531 Program Creek


152 Sum Root to Leaf Numbers

Given a binary tree containing digits from 0-9 only, each root-to-leaf path could repre-
sent a number. Find the total sum of all root-to-leaf numbers.
For example,
1
/ \
2 3

The root-to-leaf path 1->2 represents the number 12. The root-to-leaf path 1->3
represents the number 13. Return the sum = 12 + 13 = 25.

152.1 Java Solution - Recursive

This problem can be solved by a typical DFS approach.


public int sumNumbers(TreeNode root) {
int result = 0;
if(root==null)
return result;

ArrayList<ArrayList<TreeNode>> all = new ArrayList<ArrayList<TreeNode>>();


ArrayList<TreeNode> l = new ArrayList<TreeNode>();
[Link](root);
dfs(root, l, all);

for(ArrayList<TreeNode> a: all){
StringBuilder sb = new StringBuilder();
for(TreeNode n: a){
[Link]([Link]([Link]));
}
int currValue = [Link]([Link]());
result = result + currValue;
}

return result;
}

public void dfs(TreeNode n, ArrayList<TreeNode> l,


ArrayList<ArrayList<TreeNode>> all){
if([Link]==null && [Link]==null){
ArrayList<TreeNode> t = new ArrayList<TreeNode>();

363 | 531
152 Sum Root to Leaf Numbers

[Link](l);
[Link](t);
}

if([Link]!=null){
[Link]([Link]);
dfs([Link], l, all);
[Link]([Link]()-1);
}

if([Link]!=null){
[Link]([Link]);
dfs([Link], l, all);
[Link]([Link]()-1);
}

Same approach, but simpler coding style.


public int sumNumbers(TreeNode root) {
if(root == null)
return 0;

return dfs(root, 0, 0);


}

public int dfs(TreeNode node, int num, int sum){


if(node == null) return sum;

num = num*10 + [Link];

// leaf
if([Link] == null && [Link] == null) {
sum += num;
return sum;
}

// left subtree + right subtree


sum = dfs([Link], num, sum) + dfs([Link], num, sum);
return sum;
}

364 | 531 Program Creek


153 Count Complete Tree Nodes

Given a complete binary tree, count the number of nodes.

153.1 Analysis

Steps to solve this problem: 1) get the height of left-most part 2) get the height of
right-most part 3) when they are equal, the # of nodes = 2ĥ -1 4) when they are not
equal, recursively get # of nodes from left&right sub-trees

Time complexity is O(h2̂).

153.2 Java Solution

public int countNodes(TreeNode root) {


if(root==null)
return 0;

int left = getLeftHeight(root)+1;


int right = getRightHeight(root)+1;

365 | 531
153 Count Complete Tree Nodes

if(left==right){
return (2<<(left-1))-1;
}else{
return countNodes([Link])+countNodes([Link])+1;
}
}

public int getLeftHeight(TreeNode n){


if(n==null) return 0;

int height=0;
while([Link]!=null){
height++;
n = [Link];
}
return height;
}

public int getRightHeight(TreeNode n){


if(n==null) return 0;

int height=0;
while([Link]!=null){
height++;
n = [Link];
}
return height;
}

366 | 531 Program Creek


154 Closest Binary Search Tree Value

Given a non-empty binary search tree and a target value, find the value in the BST
that is closest to the target.

154.1 Java Solution

Recursively traverse down the root. When target is less than root, go left; when target
is greater than root, go right.
public class Solution {
int goal;
double min = Double.MAX_VALUE;

public int closestValue(TreeNode root, double target) {


helper(root, target);
return goal;
}

public void helper(TreeNode root, double target){


if(root==null)
return;

if([Link]([Link] - target) < min){


min = [Link]([Link]-target);
goal = [Link];
}

if(target < [Link]){


helper([Link], target);
}else{
helper([Link], target);
}
}
}

367 | 531
155 Binary Tree Paths

Given a binary tree, return all root-to-leaf paths.

155.1 Java Solution

A typical depth-first search problem.


public List<String> binaryTreePaths(TreeNode root) {
ArrayList<String> finalResult = new ArrayList<String>();

if(root==null)
return finalResult;

ArrayList<String> curr = new ArrayList<String>();


ArrayList<ArrayList<String>> results = new ArrayList<ArrayList<String>>();

dfs(root, results, curr);

for(ArrayList<String> al : results){
StringBuilder sb = new StringBuilder();
[Link]([Link](0));
for(int i=1; i<[Link]();i++){
[Link]("->"+[Link](i));
}

[Link]([Link]());
}

return finalResult;
}

public void dfs(TreeNode root, ArrayList<ArrayList<String>> list,


ArrayList<String> curr){
[Link]([Link]([Link]));

if([Link]==null && [Link]==null){


[Link](curr);
return;
}

if([Link]!=null){
ArrayList<String> temp = new ArrayList<String>(curr);
dfs([Link], list, temp);

369 | 531
155 Binary Tree Paths

if([Link]!=null){
ArrayList<String> temp = new ArrayList<String>(curr);
dfs([Link], list, temp);
}
}

370 | 531 Program Creek


156 Merge K Sorted Arrays in Java

This is a classic interview question. Another similar problem is "merge k sorted lists".
This problem can be solved by using a heap. The time is O(nlog(n)).
Given m arrays, the minimum elements of all arrays can form a heap. It takes
O(log(m)) to insert an element to the heap and it takes O(1) to delete the minimum
element.
class ArrayContainer implements Comparable<ArrayContainer> {
int[] arr;
int index;

public ArrayContainer(int[] arr, int index) {


[Link] = arr;
[Link] = index;
}

@Override
public int compareTo(ArrayContainer o) {
return [Link][[Link]] - [Link][[Link]];
}
}

public class KSortedArray {


public static int[] mergeKSortedArray(int[][] arr) {
//PriorityQueue is heap in Java
PriorityQueue<ArrayContainer> queue = new PriorityQueue<ArrayContainer>();
int total=0;

//add arrays to heap


for (int i = 0; i < [Link]; i++) {
[Link](new ArrayContainer(arr[i], 0));
total = total + arr[i].length;
}

int m=0;
int result[] = new int[total];

//while heap is not empty


while(![Link]()){
ArrayContainer ac = [Link]();
result[m++]=[Link][[Link]];

371 | 531
156 Merge K Sorted Arrays in Java

if([Link] < [Link]-1){


[Link](new ArrayContainer([Link], [Link]+1));
}
}

return result;
}

public static void main(String[] args) {


int[] arr1 = { 1, 3, 5, 7 };
int[] arr2 = { 2, 4, 6, 8 };
int[] arr3 = { 0, 9, 10, 11 };

int[] result = mergeKSortedArray(new int[][] { arr1, arr2, arr3 });


[Link]([Link](result));
}
}

372 | 531 Program Creek


157 Merge k Sorted Lists

Merge k sorted linked lists and return it as one sorted list. Analyze and describe its
complexity.

157.1 Analysis

The simplest solution is using PriorityQueue. The elements of the priority queue
are ordered according to their natural ordering, or by a comparator provided at the
construction time (in this case).

157.2 Java Solution

import [Link];
import [Link];
import [Link];

// Definition for singly-linked list.


class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

public class Solution {


public ListNode mergeKLists(ArrayList<ListNode> lists) {
if ([Link]() == 0)
return null;

//PriorityQueue is a sorted queue


PriorityQueue<ListNode> q = new PriorityQueue<ListNode>([Link](),
new Comparator<ListNode>() {
public int compare(ListNode a, ListNode b) {
if ([Link] > [Link])
return 1;
else if([Link] == [Link])
return 0;

373 | 531
157 Merge k Sorted Lists

else
return -1;
}
});

//add first node of each list to the queue


for (ListNode list : lists) {
if (list != null)
[Link](list);
}

ListNode head = new ListNode(0);


ListNode p = head; // serve as a pointer/cursor

while ([Link]() > 0) {


ListNode temp = [Link]();
//poll() retrieves and removes the head of the queue - q.
[Link] = temp;

//keep adding next element of each list


if ([Link] != null)
[Link]([Link]);

p = [Link];
}

return [Link];
}
}

Time: log(k) * n. k is number of list and n is number of total elements.

374 | 531 Program Creek


158 Find Median from Data Stream

Median is the middle value in an ordered integer list. If the size of the list is even,
there is no middle value. So the median is the mean of the two middle value.

158.1 Analysis

First of all, it seems that the best time complexity we can get for this problem is
O(log(n)) of add() and O(1) of getMedian(). This data structure seems highly likely to
be a tree.
We can use heap to solve this problem. In Java, the PriorityQueue class is a priority
heap. We can use two heaps to store the lower half and the higher half of the data
stream. The size of the two heaps differs at most 1.

158.2 Java Solution

class MedianFinder {
PriorityQueue<Integer> maxHeap;//lower half
PriorityQueue<Integer> minHeap;//higher half

public MedianFinder(){
maxHeap = new PriorityQueue<Integer>([Link]());
minHeap = new PriorityQueue<Integer>();
}

375 | 531
158 Find Median from Data Stream

// Adds a number into the data structure.


public void addNum(int num) {
[Link](num);
[Link]([Link]());

if([Link]() < [Link]()){


[Link]([Link]());
}
}

// Returns the median of current data stream


public double findMedian() {
if([Link]()==[Link]()){
return (double)([Link]()+([Link]()))/2;
}else{
return [Link]();
}
}
}

376 | 531 Program Creek


159 Implement Trie (Prefix Tree)

Implement a trie with insert, search, and startsWith methods.

159.1 Java Solution 1

A trie node should contains the character, its children and the flag that marks if it is a
leaf node. You can use this diagram to walk though the Java solution.

class TrieNode {
char c;
HashMap<Character, TrieNode> children = new HashMap<Character, TrieNode>();
boolean isLeaf;

public TrieNode() {}

public TrieNode(char c){


this.c = c;
}
}

public class Trie {


private TrieNode root;

public Trie() {
root = new TrieNode();
}

377 | 531
159 Implement Trie (Prefix Tree)

// Inserts a word into the trie.


public void insert(String word) {
HashMap<Character, TrieNode> children = [Link];

for(int i=0; i<[Link](); i++){


char c = [Link](i);

TrieNode t;
if([Link](c)){
t = [Link](c);
}else{
t = new TrieNode(c);
[Link](c, t);
}

children = [Link];

//set leaf node


if(i==[Link]()-1)
[Link] = true;
}
}

// Returns if the word is in the trie.


public boolean search(String word) {
TrieNode t = searchNode(word);

if(t != null && [Link])


return true;
else
return false;
}

// Returns if there is any word in the trie


// that starts with the given prefix.
public boolean startsWith(String prefix) {
if(searchNode(prefix) == null)
return false;
else
return true;
}

public TrieNode searchNode(String str){


Map<Character, TrieNode> children = [Link];
TrieNode t = null;
for(int i=0; i<[Link](); i++){
char c = [Link](i);
if([Link](c)){
t = [Link](c);

378 | 531 Program Creek


159 Implement Trie (Prefix Tree)

children = [Link];
}else{
return null;
}
}

return t;
}
}

159.2 Java Solution 2 - Improve Performance by Using an


Array

Each trie node can only contains ’a’-’z’ characters. So we can use a small array to store
the character.
class TrieNode {
TrieNode[] arr;
boolean isEnd;
// Initialize your data structure here.
public TrieNode() {
[Link] = new TrieNode[26];
}

public class Trie {


private TrieNode root;

public Trie() {
root = new TrieNode();
}

// Inserts a word into the trie.


public void insert(String word) {
TrieNode p = root;
for(int i=0; i<[Link](); i++){
char c = [Link](i);
int index = c-’a’;
if([Link][index]==null){
TrieNode temp = new TrieNode();
[Link][index]=temp;
p = temp;
}else{
p=[Link][index];
}
}
[Link]=true;

Program Creek 379 | 531


159 Implement Trie (Prefix Tree)

// Returns if the word is in the trie.


public boolean search(String word) {
TrieNode p = searchNode(word);
if(p==null){
return false;
}else{
if([Link])
return true;
}

return false;
}

// Returns if there is any word in the trie


// that starts with the given prefix.
public boolean startsWith(String prefix) {
TrieNode p = searchNode(prefix);
if(p==null){
return false;
}else{
return true;
}
}

public TrieNode searchNode(String s){


TrieNode p = root;
for(int i=0; i<[Link](); i++){
char c= [Link](i);
int index = c-’a’;
if([Link][index]!=null){
p = [Link][index];
}else{
return null;
}
}

if(p==root)
return null;

return p;
}
}

380 | 531 Program Creek


160 Add and Search Word Data structure
design

Design a data structure that supports the following two operations:


void addWord(word)
bool search(word)

search(word) can search a literal word or a regular expression string containing only
letters a-z or .. A . means it can represent any one letter.

160.1 Java Solution 1

This problem is similar with Implement Trie. The solution 1 below uses the same
definition of a trie node. To handle the "." case for this problem, we need to search all
possible paths, instead of one path.
TrieNode
class TrieNode{
char c;
HashMap<Character, TrieNode> children = new HashMap<Character, TrieNode>();
boolean isLeaf;

public TrieNode() {}

public TrieNode(char c){


this.c = c;
}
}

WordDictionary
public class WordDictionary {
private TrieNode root;

public WordDictionary(){
root = new TrieNode();
}

// Adds a word into the data structure.


public void addWord(String word) {
HashMap<Character, TrieNode> children = [Link];

381 | 531
160 Add and Search Word Data structure design

for(int i=0; i<[Link](); i++){


char c = [Link](i);

TrieNode t = null;
if([Link](c)){
t = [Link](c);
}else{
t = new TrieNode(c);
[Link](c,t);
}

children = [Link];

if(i == [Link]()-1){
[Link] = true;
}
}
}

// Returns if the word is in the data structure. A word could


// contain the dot character ’.’ to represent any one letter.
public boolean search(String word) {
return dfsSearch([Link], word, 0);

public boolean dfsSearch(HashMap<Character, TrieNode> children, String


word, int start) {
if(start == [Link]()){
if([Link]()==0)
return true;
else
return false;
}

char c = [Link](start);

if([Link](c)){
if(start == [Link]()-1 && [Link](c).isLeaf){
return true;
}

return dfsSearch([Link](c).children, word, start+1);


}else if(c == ’.’){
boolean result = false;
for([Link]<Character, TrieNode> child: [Link]()){
if(start == [Link]()-1 && [Link]().isLeaf){
return true;
}

382 | 531 Program Creek


160 Add and Search Word Data structure design

//if any path is true, set result to be true;


if(dfsSearch([Link]().children, word, start+1)){
result = true;
}
}

return result;
}else{
return false;
}
}
}

160.2 Java Solution 2 - Using Array Instead of HashMap

class TrieNode{
TrieNode[] arr;
boolean isLeaf;

public TrieNode(){
arr = new TrieNode[26];
}
}

public class WordDictionary {


TrieNode root;

public WordDictionary(){
root = new TrieNode();
}
// Adds a word into the data structure.
public void addWord(String word) {
TrieNode p= root;
for(int i=0; i<[Link](); i++){
char c=[Link](i);
int index = c-’a’;
if([Link][index]==null){
TrieNode temp = new TrieNode();
[Link][index]=temp;
p=temp;
}else{
p=[Link][index];
}
}

[Link]=true;

Program Creek 383 | 531


160 Add and Search Word Data structure design

// Returns if the word is in the data structure. A word could


// contain the dot character ’.’ to represent any one letter.
public boolean search(String word) {
return dfsSearch(root, word, 0);
}

public boolean dfsSearch(TrieNode p, String word, int start) {


if ([Link] && start == [Link]())
return true;

if (start >= [Link]())


return false;

char c = [Link](start);

if (c == ’.’) {
boolean tResult = false;
for (int j = 0; j < 26; j++) {
if ([Link][j] != null) {
if (dfsSearch([Link][j], word, start + 1)) {
tResult = true;
break;
}
}
}

if (tResult)
return true;
} else {
int index = c - ’a’;

if ([Link][index] != null) {
return dfsSearch([Link][index], word, start + 1);
} else {
return false;
}
}

return false;
}
}

384 | 531 Program Creek


161 Range Sum Query Mutable

Given an integer array nums, find the sum of the elements between indices i and j (i
≤ j), inclusive. The update(i, val) function modifies nums by updating the element at
index i to val.

161.1 Java Solution

class TreeNode{
int start;
int end;
int sum;
TreeNode leftChild;
TreeNode rightChild;

public TreeNode(int left, int right, int sum){


[Link]=left;
[Link]=right;
[Link]=sum;
}
public TreeNode(int left, int right){
[Link]=left;

385 | 531
161 Range Sum Query Mutable

[Link]=right;
[Link]=0;
}
}

public class NumArray {


TreeNode root = null;

public NumArray(int[] nums) {


if(nums==null || [Link]==0)
return;

[Link] = buildTree(nums, 0, [Link]-1);


}

void update(int i, int val) {


updateHelper(root, i, val);
}

void updateHelper(TreeNode root, int i, int val){


if(root==null)
return;

int mid = [Link] + ([Link])/2;


if(i<=mid){
updateHelper([Link], i, val);
}else{
updateHelper([Link], i, val);
}

if([Link]==[Link]&& [Link]==i){
[Link]=val;
return;
}

[Link]=[Link]+[Link];
}

public int sumRange(int i, int j) {


return sumRangeHelper(root, i, j);
}

public int sumRangeHelper(TreeNode root, int i, int j){


if(root==null || j<[Link] || i > [Link] ||i>j )
return 0;

if(i<=[Link] && j>=[Link]){


return [Link];

386 | 531 Program Creek


161 Range Sum Query Mutable

}
int mid = [Link] + ([Link])/2;
int result = sumRangeHelper([Link], i, [Link](mid, j))
+sumRangeHelper([Link], [Link](mid+1, i), j);

return result;
}

public TreeNode buildTree(int[] nums, int i, int j){


if(nums==null || [Link]==0|| i>j)
return null;

if(i==j){
return new TreeNode(i, j, nums[i]);
}

TreeNode current = new TreeNode(i, j);

int mid = i + (j-i)/2;

[Link] = buildTree(nums, i, mid);


[Link] = buildTree(nums, mid+1, j);

[Link] = [Link]+[Link];

return current;
}
}

Program Creek 387 | 531


162 The Skyline Problem

162.1 Analysis

This problem is essentially a problem of processing 2*n edges. Each edge has a x-axis
value and a height value. The key part is how to use the height heap to process each
edge.

162.2 Java Solution

class Edge {
int x;
int height;
boolean isStart;

public Edge(int x, int height, boolean isStart) {


this.x = x;
[Link] = height;
[Link] = isStart;
}
}

public List<int[]> getSkyline(int[][] buildings) {


List<int[]> result = new ArrayList<int[]>();

if (buildings == null || [Link] == 0


|| buildings[0].length == 0) {
return result;
}

List<Edge> edges = new ArrayList<Edge>();

// add all left/right edges


for (int[] building : buildings) {
Edge startEdge = new Edge(building[0], building[2], true);
[Link](startEdge);
Edge endEdge = new Edge(building[1], building[2], false);
[Link](endEdge);
}

// sort edges

389 | 531
162 The Skyline Problem

[Link](edges, new Comparator<Edge>() {


public int compare(Edge a, Edge b) {
if (a.x != b.x)
return [Link](a.x, b.x);

if ([Link] && [Link]) {


return [Link]([Link], [Link]);
}

if (![Link] && ![Link]) {


return [Link]([Link], [Link]);
}

return [Link] ? -1 : 1;
}
});

// process edges
PriorityQueue<Integer> heightHeap = new PriorityQueue<Integer>(10,
[Link]());

for (Edge edge : edges) {


if ([Link]) {
if ([Link]() || [Link] > [Link]()) {
[Link](new int[] { edge.x, [Link] });
}
[Link]([Link]);
} else {
[Link]([Link]);

if([Link]()){
[Link](new int[] {edge.x, 0});
}else if([Link] > [Link]()){
[Link](new int[]{edge.x, [Link]()});
}
}
}

return result;
}

390 | 531 Program Creek


163 Clone Graph Java

LeetCode Problem:
Clone an undirected graph. Each node in the graph contains a label and a list of its
neighbors.

163.1 Key to Solve This Problem

• A queue is used to do breath first traversal.


• a map is used to store the visited nodes. It is the map between original node and
copied node.

It would be helpful if you draw a diagram and visualize the problem.

391 | 531
163 Clone Graph Java

/**
* Definition for undirected graph.
* class UndirectedGraphNode {
* int label;
* ArrayList<UndirectedGraphNode> neighbors;
* UndirectedGraphNode(int x) { label = x; neighbors = new
ArrayList<UndirectedGraphNode>(); }
* };
*/
public class Solution {
public UndirectedGraphNode cloneGraph(UndirectedGraphNode node) {
if(node == null)
return null;

LinkedList<UndirectedGraphNode> queue = new


LinkedList<UndirectedGraphNode>();
HashMap<UndirectedGraphNode, UndirectedGraphNode> map =
new
HashMap<UndirectedGraphNode,UndirectedGraphNode>();

UndirectedGraphNode newHead = new UndirectedGraphNode([Link]);

[Link](node);
[Link](node, newHead);

392 | 531 Program Creek


163 Clone Graph Java

while(![Link]()){
UndirectedGraphNode curr = [Link]();
ArrayList<UndirectedGraphNode> currNeighbors = [Link];

for(UndirectedGraphNode aNeighbor: currNeighbors){


if(![Link](aNeighbor)){
UndirectedGraphNode copy = new
UndirectedGraphNode([Link]);
[Link](aNeighbor,copy);
[Link](curr).[Link](copy);
[Link](aNeighbor);
}else{
[Link](curr).[Link]([Link](aNeighbor));
}
}

}
return newHead;
}
}

Program Creek 393 | 531


164 Course Schedule

There are a total of n courses you have to take, labeled from 0 to n - 1. Some courses
may have prerequisites, for example to take course 0 you have to first take course 1,
which is expressed as a pair: [0,1]. Given the total number of courses and a list of
prerequisite pairs, is it possible for you to finish all courses?
For example, given 2 and [[1,0]], there are a total of 2 courses to take. To take course
1 you should have finished course 0. So it is possible.
For another example, given 2 and [[1,0],[0,1]], there are a total of 2 courses to take.
To take course 1 you should have finished course 0, and to take course 0 you should
also have finished course 1. So it is impossible.

164.1 Analysis

This problem can be converted to finding if a graph contains a cycle.

164.2 Java Solution 1 - BFS

This solution uses breath-first search and it is easy to understand.


public boolean canFinish(int numCourses, int[][] prerequisites) {
if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

if(numCourses == 0 || len == 0){


return true;
}

// counter for number of prerequisites


int[] pCounter = new int[numCourses];
for(int i=0; i<len; i++){
pCounter[prerequisites[i][0]]++;
}

//store courses that have no prerequisites


LinkedList<Integer> queue = new LinkedList<Integer>();
for(int i=0; i<numCourses; i++){
if(pCounter[i]==0){
[Link](i);

395 | 531
164 Course Schedule

}
}

// number of courses that have no prerequisites


int numNoPre = [Link]();

while(![Link]()){
int top = [Link]();
for(int i=0; i<len; i++){
// if a course’s prerequisite can be satisfied by a course in queue
if(prerequisites[i][1]==top){
pCounter[prerequisites[i][0]]--;
if(pCounter[prerequisites[i][0]]==0){
numNoPre++;
[Link](prerequisites[i][0]);
}
}
}
}

return numNoPre == numCourses;


}

164.3 Java Solution 2 - DFS

public boolean canFinish(int numCourses, int[][] prerequisites) {


if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

if(numCourses == 0 || len == 0){


return true;
}

//track visited courses


int[] visit = new int[numCourses];

// use the map to store what courses depend on a course


HashMap<Integer,ArrayList<Integer>> map = new
HashMap<Integer,ArrayList<Integer>>();
for(int[] a: prerequisites){
if([Link](a[1])){
[Link](a[1]).add(a[0]);
}else{
ArrayList<Integer> l = new ArrayList<Integer>();

396 | 531 Program Creek


164 Course Schedule

[Link](a[0]);
[Link](a[1], l);
}
}

for(int i=0; i<numCourses; i++){


if(!canFinishDFS(map, visit, i))
return false;
}

return true;
}

private boolean canFinishDFS(HashMap<Integer,ArrayList<Integer>> map, int[]


visit, int i){
if(visit[i]==-1)
return false;
if(visit[i]==1)
return true;

visit[i]=-1;
if([Link](i)){
for(int j: [Link](i)){
if(!canFinishDFS(map, visit, j))
return false;
}
}

visit[i]=1;

return true;
}

Topological Sort Video from Coursera.

Program Creek 397 | 531


165 Course Schedule II

This is an extension of Course Schedule. This time a valid sequence of courses is


required as output.

165.1 Analysis

If we use the DFS solution of Course Schedule, a valid sequence can easily be recorded.

165.2 Java Solution

public int[] findOrder(int numCourses, int[][] prerequisites) {


if(prerequisites == null){
throw new IllegalArgumentException("illegal prerequisites array");
}

int len = [Link];

//if there is no prerequisites, return a sequence of courses


if(len == 0){
int[] res = new int[numCourses];
for(int m=0; m<numCourses; m++){
res[m]=m;
}
return res;
}

//records the number of prerequisites each course (0,...,numCourses-1)


requires
int[] pCounter = new int[numCourses];
for(int i=0; i<len; i++){
pCounter[prerequisites[i][0]]++;
}

//stores courses that have no prerequisites


LinkedList<Integer> queue = new LinkedList<Integer>();
for(int i=0; i<numCourses; i++){
if(pCounter[i]==0){
[Link](i);
}
}

399 | 531
165 Course Schedule II

int numNoPre = [Link]();

//initialize result
int[] result = new int[numCourses];
int j=0;

while(![Link]()){
int c = [Link]();
result[j++]=c;

for(int i=0; i<len; i++){


if(prerequisites[i][1]==c){
pCounter[prerequisites[i][0]]--;
if(pCounter[prerequisites[i][0]]==0){
[Link](prerequisites[i][0]);
numNoPre++;
}
}

}
}

//return result
if(numNoPre==numCourses){
return result;
}else{
return new int[0];
}
}

400 | 531 Program Creek


166 Reconstruct Itinerary

Given a list of airline tickets represented by pairs of departure and arrival airports
[from, to], reconstruct the itinerary in order. All of the tickets belong to a man who
departs from JFK. Thus, the itinerary must begin with JFK.

166.1 Analysis

This is an application of Hierholzer’s algorithm to find a Eulerian path.


PriorityQueue should be used instead of TreeSet, because there are duplicate entries.

166.2 Java Solution

public class Solution{


HashMap<String, PriorityQueue<String>> map = new HashMap<String,
PriorityQueue<String>>();
LinkedList<String> result = new LinkedList<String>();

public List<String> findItinerary(String[][] tickets) {


for (String[] ticket : tickets) {
if (![Link](ticket[0])) {
PriorityQueue<String> q = new PriorityQueue<String>();
[Link](ticket[0], q);
}
[Link](ticket[0]).offer(ticket[1]);
}

dfs("JFK");
return result;
}

public void dfs(String s) {


PriorityQueue<String> q = [Link](s);

while (q != null && ![Link]()) {


dfs([Link]());
}

[Link](s);
}
}

401 | 531
167 How Developers Sort in Java?

While analyzing source code of a large number of open source Java projects, I found
Java developers frequently sort in two ways. One is using the sort() method of Col-
lections or Arrays, and the other is using sorted data structures, such as TreeMap and
TreeSet.

167.1 Using sort() Method

If it is a collection, use [Link]() method.


// [Link]
List<ObjectName> list = new ArrayList<ObjectName>();
[Link](list, new Comparator<ObjectName>() {
public int compare(ObjectName o1, ObjectName o2) {
return [Link]().compareTo([Link]());
}
});

If it is an array, use [Link]() method.


// [Link]
ObjectName[] arr = new ObjectName[10];
[Link](arr, new Comparator<ObjectName>() {
public int compare(ObjectName o1, ObjectName o2) {
return [Link]().compareTo([Link]());
}
});

This is very convenient if a collection or an array is already set up.

167.2 Using Sorted Data Structures

If it is a list or set, use TreeSet to sort.


// TreeSet
Set<ObjectName> sortedSet = new TreeSet<ObjectName>(new
Comparator<ObjectName>() {
public int compare(ObjectName o1, ObjectName o2) {
return [Link]().compareTo([Link]());
}
});
[Link](unsortedSet);

403 | 531
167 How Developers Sort in Java?

If it is a map, use TreeMap to sort. TreeMap is sorted by key.


// TreeMap - using String.CASE_INSENSITIVE_ORDER which is a Comparator that
orders Strings by compareToIgnoreCase
Map<String, Integer> sortedMap = new TreeMap<String,
Integer>(String.CASE_INSENSITIVE_ORDER);
[Link](unsortedMap);

//TreeMap - In general, defined comparator


Map<ObjectName, String> sortedMap = new TreeMap<ObjectName, String>(new
Comparator<ObjectName>() {
public int compare(ObjectName o1, ObjectName o2) {
return [Link]().compareTo([Link]());
}
});
[Link](unsortedMap);

This approach is very useful, if you would do a lot of search operations for the
collection. The sorted data structure will give time complexity of O(logn), which is
lower than O(n).

167.3 Bad Practices

There are still bad practices, such as using self-defined sorting algorithm. Take the
code below for example, not only the algorithm is not efficient, but also it is not
readable. This happens a lot in different forms of variations.
double t;
for (int i = 0; i < 2; i++)
for (int j = i + 1; j < 3; j++)
if (r[j] < r[i]) {
t = r[i];
r[i] = r[j];
r[j] = t;
}

404 | 531 Program Creek


168 Solution Merge Sort LinkedList in
Java

LeetCode - Sort List:


Sort a linked list in O(n log n) time using constant space complexity.

168.1 Keys for solving the problem

• Break the list to two in the middle


• Recursively sort the two sub lists
• Merge the two sub lists

This is my accepted answer for the problem.


package [Link];

class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

public class SortLinkedList {

// merge sort
public static ListNode mergeSortList(ListNode head) {

if (head == null || [Link] == null)


return head;

// count total number of elements


int count = 0;
ListNode p = head;
while (p != null) {
count++;
p = [Link];
}

405 | 531
168 Solution Merge Sort LinkedList in Java

// break up to two list


int middle = count / 2;

ListNode l = head, r = null;


ListNode p2 = head;
int countHalf = 0;
while (p2 != null) {
countHalf++;
ListNode next = [Link];

if (countHalf == middle) {
[Link] = null;
r = next;
}
p2 = next;
}

// now we have two parts l and r, recursively sort them


ListNode h1 = mergeSortList(l);
ListNode h2 = mergeSortList(r);

// merge together
ListNode merged = merge(h1, h2);

return merged;
}

public static ListNode merge(ListNode l, ListNode r) {


ListNode p1 = l;
ListNode p2 = r;

ListNode fakeHead = new ListNode(100);


ListNode pNew = fakeHead;

while (p1 != null || p2 != null) {

if (p1 == null) {
[Link] = new ListNode([Link]);
p2 = [Link];
pNew = [Link];
} else if (p2 == null) {
[Link] = new ListNode([Link]);
p1 = [Link];
pNew = [Link];
} else {
if ([Link] < [Link]) {
// if(fakeHead)
[Link] = new ListNode([Link]);
p1 = [Link];
pNew = [Link];

406 | 531 Program Creek


168 Solution Merge Sort LinkedList in Java

} else if ([Link] == [Link]) {


[Link] = new ListNode([Link]);
[Link] = new ListNode([Link]);
pNew = [Link];
p1 = [Link];
p2 = [Link];

} else {
[Link] = new ListNode([Link]);
p2 = [Link];
pNew = [Link];
}
}
}

// printList([Link]);
return [Link];
}

public static void main(String[] args) {


ListNode n1 = new ListNode(2);
ListNode n2 = new ListNode(3);
ListNode n3 = new ListNode(4);

ListNode n4 = new ListNode(3);


ListNode n5 = new ListNode(4);
ListNode n6 = new ListNode(5);

[Link] = n2;
[Link] = n3;
[Link] = n4;
[Link] = n5;
[Link] = n6;

n1 = mergeSortList(n1);

printList(n1);
}

public static void printList(ListNode x) {


if(x != null){
[Link]([Link] + " ");
while ([Link] != null) {
[Link]([Link] + " ");
x = [Link];
}
[Link]();
}

Program Creek 407 | 531


168 Solution Merge Sort LinkedList in Java

Output:
233445

408 | 531 Program Creek


169 Quicksort Array in Java

Quicksort is a divide and conquer algorithm. It first divides a large list into two
smaller sub-lists and then recursively sort the two sub-lists. If we want to sort an array
without any extra space, quicksort is a good option. On average, time complexity is
O(n log(n)).
The basic step of sorting an array are as follows:
• Select a pivot, normally the middle one
• From both ends, swap elements and make all elements on the left less than the
pivot and all elements on the right greater than the pivot
• Recursively sort left part and right part
Here is a very good animation of quicksort.
public class QuickSort {
public static void main(String[] args) {
int[] x = { 9, 2, 4, 7, 3, 7, 10 };
[Link]([Link](x));

int low = 0;
int high = [Link] - 1;

quickSort(x, low, high);


[Link]([Link](x));
}

public static void quickSort(int[] arr, int low, int high) {


if (arr == null || [Link] == 0)
return;

if (low >= high)


return;

// pick the pivot


int middle = low + (high - low) / 2;
int pivot = arr[middle];

// make left < pivot and right > pivot


int i = low, j = high;
while (i <= j) {
while (arr[i] < pivot) {
i++;
}

409 | 531
169 Quicksort Array in Java

while (arr[j] > pivot) {


j--;
}

if (i <= j) {
int temp = arr[i];
arr[i] = arr[j];
arr[j] = temp;
i++;
j--;
}
}

// recursively sort two sub parts


if (low < j)
quickSort(arr, low, j);

if (high > i)
quickSort(arr, i, high);
}
}

Output:
9 2 4 7 3 7 10 2 3 4 7 7 9 10

410 | 531 Program Creek


170 Solution Sort a linked list using
insertion sort in Java

Insertion Sort List:


Sort a linked list using insertion sort.
This is my accepted answer for LeetCode problem - Sort a linked list using insertion
sort in Java. It is a complete program.
Before coding for that, here is an example of insertion sort from wiki. You can get
an idea of what is insertion sort.

Code:
package [Link];

class ListNode {
int val;
ListNode next;

ListNode(int x) {
val = x;
next = null;
}
}

public class SortLinkedList {


public static ListNode insertionSortList(ListNode head) {

411 | 531
170 Solution Sort a linked list using insertion sort in Java

if (head == null || [Link] == null)


return head;

ListNode newHead = new ListNode([Link]);


ListNode pointer = [Link];

// loop through each element in the list


while (pointer != null) {
// insert this element to the new list

ListNode innerPointer = newHead;


ListNode next = [Link];

if ([Link] <= [Link]) {


ListNode oldHead = newHead;
newHead = pointer;
[Link] = oldHead;
} else {
while ([Link] != null) {

if ([Link] > [Link] && [Link] <=


[Link]) {
ListNode oldNext = [Link];
[Link] = pointer;
[Link] = oldNext;
}

innerPointer = [Link];
}

if ([Link] == null && [Link] > [Link]) {


[Link] = pointer;
[Link] = null;
}
}

// finally
pointer = next;
}

return newHead;
}

public static void main(String[] args) {


ListNode n1 = new ListNode(2);
ListNode n2 = new ListNode(3);
ListNode n3 = new ListNode(4);

ListNode n4 = new ListNode(3);


ListNode n5 = new ListNode(4);

412 | 531 Program Creek


170 Solution Sort a linked list using insertion sort in Java

ListNode n6 = new ListNode(5);

[Link] = n2;
[Link] = n3;
[Link] = n4;
[Link] = n5;
[Link] = n6;

n1 = insertionSortList(n1);

printList(n1);

public static void printList(ListNode x) {


if(x != null){
[Link]([Link] + " ");
while ([Link] != null) {
[Link]([Link] + " ");
x = [Link];
}
[Link]();
}

}
}

Output:
233445

Program Creek 413 | 531


171 Maximum Gap

Given an unsorted array, find the maximum difference between the successive ele-
ments in its sorted form.
Try to solve it in linear time/space. Return 0 if the array contains less than 2 ele-
ments. You may assume all elements in the array are non-negative integers and fit in
the 32-bit signed integer range.

171.1 Analysis

We can use a bucket-sort like algorithm to solve this problem in time of O(n) and space
O(n). The basic idea is to project each element of the array to an array of buckets. Each
bucket tracks the maximum and minimum elements. Finally, scanning the bucket list,
we can get the maximum gap.
The key part is to get the interval:
From: interval * (num[i] - min) = 0 and interval * (max -num[i]) = n
interval = [Link] / (max - min)

See the internal comment for more details.

171.2 Java Solution

class Bucket{
int low;
int high;
public Bucket(){
low = -1;
high = -1;
}
}

public int maximumGap(int[] num) {


if(num == null || [Link] < 2){
return 0;
}

int max = num[0];


int min = num[0];
for(int i=1; i<[Link]; i++){
max = [Link](max, num[i]);

415 | 531
171 Maximum Gap

min = [Link](min, num[i]);


}

// initialize an array of buckets


Bucket[] buckets = new Bucket[[Link]+1]; //project to (0 - n)
for(int i=0; i<[Link]; i++){
buckets[i] = new Bucket();
}

double interval = (double) [Link] / (max - min);


//distribute every number to a bucket array
for(int i=0; i<[Link]; i++){
int index = (int) ((num[i] - min) * interval);

if(buckets[index].low == -1){
buckets[index].low = num[i];
buckets[index].high = num[i];
}else{
buckets[index].low = [Link](buckets[index].low, num[i]);
buckets[index].high = [Link](buckets[index].high, num[i]);
}
}

//scan buckets to find maximum gap


int result = 0;
int prev = buckets[0].high;
for(int i=1; i<[Link]; i++){
if(buckets[i].low != -1){
result = [Link](result, buckets[i].low-prev);
prev = buckets[i].high;
}

return result;
}

416 | 531 Program Creek


172 First Missing Positive

Given an unsorted integer array, find the first missing positive integer. For example,
given [1,2,0] return 3 and [3,4,-1,1] return 2.
Your algorithm should run in O(n) time and uses constant space.

172.1 Analysis

This problem can solve by using a bucket-sort like algorithm. Let’s consider finding
first missing positive and 0 first. The key fact is that the ith element should be i, so we
have: i==A[i] A[i]==A[A[i]]
For example, given an array 1,2,0,4, the algorithm does the following:

int firstMissingPositiveAnd0(int A[]) {


int n = [Link];
for (int i = 0; i < n; i++) {
// when the ith element is not i
while (A[i] != i) {
// no need to swap when ith element is out of range [0,n]
if (A[i] < 0 || A[i] >= n)
break;

//handle duplicate elements


if(A[i]==A[A[i]])
break;
// swap elements
int temp = A[i];

417 | 531
172 First Missing Positive

A[i] = A[temp];
A[temp] = temp;
}
}

for (int i = 0; i < n; i++) {


if (A[i] != i)
return i;
}

return n;
}

172.2 Java Solution

This problem only considers positive numbers, so we need to shift 1 offset. The ith
element is i+1.
public int firstMissingPositive(int[] A) {
int n = [Link];

for (int i = 0; i < n; i++) {


while (A[i] != i + 1) {
if (A[i] <= 0 || A[i] >= n)
break;

if(A[i]==A[A[i]-1])
break;

int temp = A[i];


A[i] = A[temp - 1];
A[temp - 1] = temp;
}
}

for (int i = 0; i < n; i++){


if (A[i] != i + 1){
return i + 1;
}
}

return n + 1;
}

418 | 531 Program Creek


173 Sort Colors

Given an array with n objects colored red, white or blue, sort them so that objects of
the same color are adjacent, with the colors in the order red, white and blue.
Here, we will use the integers 0, 1, and 2 to represent the color red, white, and blue
respectively.

173.1 Java Solution 1 - Counting Sort

Check out this animation to understand how counting sort works.


public void sortColors(int[] nums) {
if(nums==null||[Link]<2){
return;
}

int[] countArray = new int[3];


for(int i=0; i<[Link]; i++){
countArray[nums[i]]++;
}

for(int i=1; i<=2; i++){


countArray[i]=countArray[i-1]+countArray[i];
}

int[] sorted = new int[[Link]];


for(int i=0;i<[Link]; i++){
int index = countArray[nums[i]]-1;
countArray[nums[i]] = countArray[nums[i]]-1;
sorted[index]=nums[i];
}

[Link](sorted, 0, nums, 0, [Link]);


}

173.2 Java Solution 2 - Improved Counting Sort

In solution 1, two arrays are created. One is for counting, and the other is for storing
the sorted array (space is O(n)). We can improve the solution so that it only uses
constant space. Since we already get the count of each element, we can directly project
them to the original array, instead of creating a new one.

419 | 531
173 Sort Colors

public void sortColors(int[] nums) {


if(nums==null||[Link]<2){
return;
}

int[] countArray = new int[3];


for(int i=0; i<[Link]; i++){
countArray[nums[i]]++;
}

int j = 0;
int k = 0;
while(j<=2){
if(countArray[j]!=0){
nums[k++]=j;
countArray[j] = countArray[j]-1;
}else{
j++;
}
}
}

420 | 531 Program Creek


174 Edit Distance in Java

From Wiki:
In computer science, edit distance is a way of quantifying how dissimilar two strings
(e.g., words) are to one another by counting the minimum number of operations required
to transform one string into the other.
There are three operations permitted on a word: replace, delete, insert. For example,
the edit distance between "a" and "b" is 1, the edit distance between "abc" and "def" is
3. This post analyzes how to calculate edit distance by using dynamic programming.

174.1 Key Analysis

Let dp[i][j] stands for the edit distance between two strings with length i and j, i.e.,
word1[0,...,i-1] and word2[0,...,j-1]. There is a relation between dp[i][j] and dp[i-1][j-1].
Let’s say we transform from one string to another. The first string has length i and
it’s last character is "x"; the second string has length j and its last character is "y". The
following diagram shows the relation.

• if x == y, then dp[i][j] == dp[i-1][j-1]


• if x != y, and we insert y for word1, then dp[i][j] = dp[i][j-1] + 1

421 | 531
174 Edit Distance in Java

• if x != y, and we delete x for word1, then dp[i][j] = dp[i-1][j] + 1


• if x != y, and we replace x with y for word1, then dp[i][j] = dp[i-1][j-1] + 1
• When x!=y, dp[i][j] is the min of the three situations.

Initial condition: dp[i][0] = i, dp[0][j] = j

174.2 Java Code

After the analysis above, the code is just a representation of it.


public static int minDistance(String word1, String word2) {
int len1 = [Link]();
int len2 = [Link]();

// len1+1, len2+1, because finally return dp[len1][len2]


int[][] dp = new int[len1 + 1][len2 + 1];

for (int i = 0; i <= len1; i++) {


dp[i][0] = i;
}

for (int j = 0; j <= len2; j++) {


dp[0][j] = j;
}

//iterate though, and check last char


for (int i = 0; i < len1; i++) {
char c1 = [Link](i);
for (int j = 0; j < len2; j++) {
char c2 = [Link](j);

//if last two chars equal


if (c1 == c2) {
//update dp value for +1 length
dp[i + 1][j + 1] = dp[i][j];
} else {
int replace = dp[i][j] + 1;
int insert = dp[i][j + 1] + 1;
int delete = dp[i + 1][j] + 1;

int min = replace > insert ? insert : replace;


min = delete > min ? min : delete;
dp[i + 1][j + 1] = min;
}
}
}

return dp[len1][len2];
}

422 | 531 Program Creek


174 Edit Distance in Java

Program Creek 423 | 531


175 Distinct Subsequences Total

Given a string S and a string T, count the number of distinct subsequences of T in S.


A subsequence of a string is a new string which is formed from the original string by
deleting some (can be none) of the characters without disturbing the relative positions
of the remaining characters. (ie, "ACE" is a subsequence of "ABCDE" while "AEC" is
not).
Here is an example: S = "rabbbit", T = "rabbit"
Return 3.

175.1 Analysis

The problem itself is very difficult to understand. It can be stated like this: Give a
sequence S and T, how many distinct sub sequences from S equals to T? How do you
define "distinct" subsequence? Clearly, the ’distinct’ here mean different operation
combination, not the final string of subsequence. Otherwise, the result is always 0 or
1. – from Jason’s comment
When you see string problem that is about subsequence or matching, dynamic pro-
gramming method should come to mind naturally. The key is to find the initial and
changing condition.

175.2 Java Solution 1

Let W(i, j) stand for the number of subsequences of S(0, i) equals to T(0, j). If [Link](i)
== [Link](j), W(i, j) = W(i-1, j-1) + W(i-1,j); Otherwise, W(i, j) = W(i-1,j).
public int numDistincts(String S, String T) {
int[][] table = new int[[Link]() + 1][[Link]() + 1];

for (int i = 0; i < [Link](); i++)


table[i][0] = 1;

for (int i = 1; i <= [Link](); i++) {


for (int j = 1; j <= [Link](); j++) {
if ([Link](i - 1) == [Link](j - 1)) {
table[i][j] += table[i - 1][j] + table[i - 1][j - 1];
} else {
table[i][j] += table[i - 1][j];
}
}
}

425 | 531
175 Distinct Subsequences Total

return table[[Link]()][[Link]()];
}

175.3 Java Solution 2

Do NOT write something like this, even it can also pass the online judge.
public int numDistinct(String S, String T) {
HashMap<Character, ArrayList<Integer>> map = new HashMap<Character,
ArrayList<Integer>>();

for (int i = 0; i < [Link](); i++) {


if ([Link]([Link](i))) {
[Link]([Link](i)).add(i);
} else {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](i);
[Link]([Link](i), temp);
}
}

int[] result = new int[[Link]() + 1];


result[0] = 1;

for (int i = 0; i < [Link](); i++) {


char c = [Link](i);

if ([Link](c)) {
ArrayList<Integer> temp = [Link](c);
int[] old = new int[[Link]()];

for (int j = 0; j < [Link](); j++)


old[j] = result[[Link](j)];

// the relation
for (int j = 0; j < [Link](); j++)
result[[Link](j) + 1] = result[[Link](j) + 1] + old[j];
}
}

return result[[Link]()];
}

426 | 531 Program Creek


176 Longest Palindromic Substring

Finding the longest palindromic substring is a classic problem of coding interview.


This post summarizes 3 different solutions for this problem.

176.1 Naive Approach

Naively, we can simply examine every substring and check if it is palindromic. The
time complexity is O(n3̂). If this is submitted to LeetCode onlinejudge, an error mes-
sage will be returned - "Time Limit Exceeded". Therefore, this approach is just a start,
we need a better algorithm.
public static String longestPalindrome1(String s) {

int maxPalinLength = 0;
String longestPalindrome = null;
int length = [Link]();

// check all possible sub strings


for (int i = 0; i < length; i++) {
for (int j = i + 1; j < length; j++) {
int len = j - i;
String curr = [Link](i, j + 1);
if (isPalindrome(curr)) {
if (len > maxPalinLength) {
longestPalindrome = curr;
maxPalinLength = len;
}
}
}
}

return longestPalindrome;
}

public static boolean isPalindrome(String s) {

for (int i = 0; i < [Link]() - 1; i++) {


if ([Link](i) != [Link]([Link]() - 1 - i)) {
return false;
}
}

427 | 531
176 Longest Palindromic Substring

return true;
}

176.2 Dynamic Programming

Let s be the input string, i and j are two indices of the string. Define a 2-dimension
array "table" and let table[i][j] denote whether a substring from i to j is palindrome.
Start condition:
table[i][i] == 1;
table[i][i+1] == 1 => [Link](i) == [Link](i+1)

Changing condition:
table[i+1][j-1] == 1 && [Link](i) == [Link](j)
=>
table[i][j] == 1

Time O(n2̂) Space O(n2̂)


public static String longestPalindrome2(String s) {
if (s == null)
return null;

if([Link]() <=1)
return s;

int maxLen = 0;
String longestStr = null;

int length = [Link]();

int[][] table = new int[length][length];

//every single letter is palindrome


for (int i = 0; i < length; i++) {
table[i][i] = 1;
}
printTable(table);

//e.g. bcba
//two consecutive same letters are palindrome
for (int i = 0; i <= length - 2; i++) {
if ([Link](i) == [Link](i + 1)){
table[i][i + 1] = 1;
longestStr = [Link](i, i + 2);
}
}

428 | 531 Program Creek


176 Longest Palindromic Substring

printTable(table);
//condition for calculate whole table
for (int l = 3; l <= length; l++) {
for (int i = 0; i <= length-l; i++) {
int j = i + l - 1;
if ([Link](i) == [Link](j)) {
table[i][j] = table[i + 1][j - 1];
if (table[i][j] == 1 && l > maxLen)
longestStr = [Link](i, j + 1);
} else {
table[i][j] = 0;
}
printTable(table);
}
}

return longestStr;
}
public static void printTable(int[][] x){
for(int [] y : x){
for(int z: y){
[Link](z + " ");
}
[Link]();
}
[Link]("------");
}

Given a string, we can use the printTable() method to examine the table after ex-
ecution. For example, if the input string is "dabcba", the final matrix would be the
following:
1 0 0 0 0 0
0 1 0 0 0 1
0 0 1 0 1 0
0 0 0 1 0 0
0 0 0 0 1 0
0 0 0 0 0 1

From the table, we can clearly see that the longest string is in cell table[1][5].

176.3 A Simple Algorithm

Time O(n2̂), Space O(1)


public String longestPalindrome(String s) {
if ([Link]()) {
return null;
}

Program Creek 429 | 531


176 Longest Palindromic Substring

if ([Link]() == 1) {
return s;
}

String longest = [Link](0, 1);


for (int i = 0; i < [Link](); i++) {
// get longest palindrome with center of i
String tmp = helper(s, i, i);
if ([Link]() > [Link]()) {
longest = tmp;
}

// get longest palindrome with center of i, i+1


tmp = helper(s, i, i + 1);
if ([Link]() > [Link]()) {
longest = tmp;
}
}

return longest;
}

// Given a center, either one letter or two letter,


// Find longest palindrome
public String helper(String s, int begin, int end) {
while (begin >= 0 && end <= [Link]() - 1 && [Link](begin) ==
[Link](end)) {
begin--;
end++;
}
return [Link](begin + 1, end);
}

176.4 Manacher’s Algorithm

Manacher’s algorithm is much more complicated to figure out, even though it will
bring benefit of time complexity of O(n). Since it is not typical, there is no need to
waste time on that.

430 | 531 Program Creek


177 Word Break

Given a string s and a dictionary of words dict, determine if s can be segmented into
a space-separated sequence of one or more dictionary words. For example, given s =
"leetcode", dict = ["leet", "code"]. Return true because "leetcode" can be segmented as
"leet code".

177.1 Naive Approach

This problem can be solve by using a naive approach, which is trivial. A discussion
can always start from that though.
public class Solution {
public boolean wordBreak(String s, Set<String> dict) {
return wordBreakHelper(s, dict, 0);
}

public boolean wordBreakHelper(String s, Set<String> dict, int start){


if(start == [Link]())
return true;

for(String a: dict){
int len = [Link]();
int end = start+len;

//end index should be <= string length


if(end > [Link]())
continue;

if([Link](start, start+len).equals(a))
if(wordBreakHelper(s, dict, start+len))
return true;
}

return false;
}
}

Time is O(n2̂) and exceeds the time limit.

431 | 531
177 Word Break

177.2 Dynamic Programming

The key to solve this problem by using dynamic programming approach:

• Define an array t[] such that t[i]==true =>0-(i-1) can be segmented using dictio-
nary
• Initial state t[0] == true

public class Solution {


public boolean wordBreak(String s, Set<String> dict) {
boolean[] t = new boolean[[Link]()+1];
t[0] = true; //set first to be true, why?
//Because we need initial state

for(int i=0; i<[Link](); i++){


//should continue from match position
if(!t[i])
continue;

for(String a: dict){
int len = [Link]();
int end = i + len;
if(end > [Link]())
continue;

if(t[end]) continue;

if([Link](i, end).equals(a)){
t[end] = true;
}
}
}

return t[[Link]()];
}
}

Time: O(string length * dict size)


One tricky part of this solution is the case:
INPUT: "programcreek", ["programcree","program","creek"].

We should get all possible matches, not stop at "programcree".

177.3 Regular Expression

The problem is equivalent to matching the regular expression (leet|code)*, which


means that it can be solved by building a DFA in O(2m̂) and executing it in O(n).

432 | 531 Program Creek


177 Word Break

(Thanks to hdante.) Leetcode online judge does not allow using the Pattern class
though.
public static void main(String[] args) {
HashSet<String> dict = new HashSet<String>();
[Link]("go");
[Link]("goal");
[Link]("goals");
[Link]("special");

StringBuilder sb = new StringBuilder();

for(String s: dict){
[Link](s + "|");
}

String pattern = [Link]().substring(0, [Link]()-1);


pattern = "("+pattern+")*";
Pattern p = [Link](pattern);
Matcher m = [Link]("goalspecial");

if([Link]()){
[Link]("match");
}
}

177.4 The More Interesting Problem

The dynamic solution can tell us whether the string can be broken to words, but can
not tell us what words the string is broken to. So how to get those words?
Check out Word Break II.

Program Creek 433 | 531


178 Word Break II

Given a string s and a dictionary of words dict, add spaces in s to construct a sentence
where each word is a valid dictionary word. Return all such possible sentences. For
example, given s = "catsanddog", dict = ["cat", "cats", "and", "sand", "dog"], the solution
is ["cats and dog", "cat sand dog"].

178.1 Java Solution - Dynamic Programming

This problem is very similar to Word Break. Instead of using a boolean array to track
the matched positions, we need to track the actual matched words. Then we can use
depth first search to get all the possible paths, i.e., the list of strings.
The following diagram shows the structure of the tracking array.

public static List<String> wordBreak(String s, Set<String> dict) {


//create an array of ArrayList<String>
List<String> dp[] = new ArrayList[[Link]()+1];
dp[0] = new ArrayList<String>();

for(int i=0; i<[Link](); i++){

435 | 531
178 Word Break II

if( dp[i] == null )


continue;

for(String word:dict){
int len = [Link]();
int end = i+len;
if(end > [Link]())
continue;

if([Link](i,end).equals(word)){
if(dp[end] == null){
dp[end] = new ArrayList<String>();
}
dp[end].add(word);
}
}
}

List<String> result = new LinkedList<String>();


if(dp[[Link]()] == null)
return result;

ArrayList<String> temp = new ArrayList<String>();


dfs(dp, [Link](), result, temp);

return result;
}

public static void dfs(List<String> dp[],int end,List<String> result,


ArrayList<String> tmp){
if(end <= 0){
String path = [Link]([Link]()-1);
for(int i=[Link]()-2; i>=0; i--){
path += " " + [Link](i) ;
}

[Link](path);
return;
}

for(String str : dp[end]){


[Link](str);
dfs(dp, [Link](), result, tmp);
[Link]([Link]()-1);
}
}

This problem is also useful for solving real problems. Assuming you want to analyze
the domain names of the top 10k websites. We can use this solution to break the main
part of the domain into words and then get a sense of what kinds of websites are

436 | 531 Program Creek


178 Word Break II

popular. I did this a long time ago and found some interesting results. For example,
the most frequent words include "news", "tube", "porn", "etc".

Program Creek 437 | 531


179 Maximum Subarray

Find the contiguous subarray within an array (containing at least one number) which
has the largest sum.
For example, given the array [−2,1,−3,4,−1,2,1,−5,4], the contiguous subarray [4,−1,2,1]
has the largest sum = 6.

179.1 Wrong Solution

This is a wrong solution, check out the discussion below to see why it is wrong. I put
it here just for fun.
public class Solution {
public int maxSubArray(int[] A) {
int sum = 0;
int maxSum = Integer.MIN_VALUE;

for (int i = 0; i < [Link]; i++) {


sum += A[i];
maxSum = [Link](maxSum, sum);

if (sum < 0)
sum = 0;
}

return maxSum;
}
}

179.2 Dynamic Programming Solution

The changing condition for dynamic programming is "We should ignore the sum of
the previous n-1 elements if nth element is greater than the sum."
public class Solution {
public int maxSubArray(int[] A) {
int max = A[0];
int[] sum = new int[[Link]];
sum[0] = A[0];

for (int i = 1; i < [Link]; i++) {

439 | 531
179 Maximum Subarray

sum[i] = [Link](A[i], sum[i - 1] + A[i]);


max = [Link](max, sum[i]);
}

return max;
}
}

179.3 Simple Solution

Mehdi provided the following solution in his comment.


public int maxSubArray(int[] A) {
int newsum=A[0];
int max=A[0];
for(int i=1;i<[Link];i++){
newsum=[Link](newsum+A[i],A[i]);
max= [Link](max, newsum);
}
return max;
}

This problem is asked by Palantir.

440 | 531 Program Creek


180 Maximum Product Subarray

Find the contiguous subarray within an array (containing at least one number) which
has the largest product.
For example, given the array [2,3,-2,4], the contiguous subarray [2,3] has the largest
product = 6.

180.1 Java Solution 1 - Brute-force

public int maxProduct(int[] A) {


int max = Integer.MIN_VALUE;

for(int i=0; i<[Link]; i++){


for(int l=0; l<[Link]; l++){
if(i+l < [Link]){
int product = calProduct(A, i, l);
max = [Link](product, max);
}

}
return max;
}

public int calProduct(int[] A, int i, int j){


int result = 1;
for(int m=i; m<=j; m++){
result = result * A[m];
}
return result;
}

The time of the solution is O(n3̂).

180.2 Java Solution 2 - Dynamic Programming

This is similar to maximum subarray. Instead of sum, the sign of number affect the
product value.
When iterating the array, each element has two possibilities: positive number or
negative number. We need to track a minimum value, so that when a negative number

441 | 531
180 Maximum Product Subarray

is given, it can also find the maximum value. We define two local variables, one tracks
the maximum and the other tracks the minimum.
public int maxProduct(int[] A) {
if(A==null || [Link]==0)
return 0;

int maxLocal = A[0];


int minLocal = A[0];
int global = A[0];

for(int i=1; i<[Link]; i++){


int temp = maxLocal;
maxLocal = [Link]([Link](A[i]*maxLocal, A[i]), A[i]*minLocal);
minLocal = [Link]([Link](A[i]*temp, A[i]), A[i]*minLocal);
global = [Link](global, maxLocal);
}
return global;
}

Time is O(n).

442 | 531 Program Creek


181 Palindrome Partitioning

181.1 Problem

Given a string s, partition s such that every substring of the partition is a palindrome.
Return all possible palindrome partitioning of s.
For example, given s = "aab", Return
[
["aa","b"],
["a","a","b"]
]

181.2 Depth-first Search

public ArrayList<ArrayList<String>> partition(String s) {


ArrayList<ArrayList<String>> result = new ArrayList<ArrayList<String>>();

if (s == null || [Link]() == 0) {
return result;
}

ArrayList<String> partition = new ArrayList<String>();//track each possible


partition
addPalindrome(s, 0, partition, result);

return result;
}

private void addPalindrome(String s, int start, ArrayList<String> partition,


ArrayList<ArrayList<String>> result) {
//stop condition
if (start == [Link]()) {
ArrayList<String> temp = new ArrayList<String>(partition);
[Link](temp);
return;
}

for (int i = start + 1; i <= [Link](); i++) {


String str = [Link](start, i);
if (isPalindrome(str)) {

443 | 531
181 Palindrome Partitioning

[Link](str);
addPalindrome(s, i, partition, result);
[Link]([Link]() - 1);
}
}
}

private boolean isPalindrome(String str) {


int left = 0;
int right = [Link]() - 1;

while (left < right) {


if ([Link](left) != [Link](right)) {
return false;
}

left++;
right--;
}

return true;
}

181.3 Dynamic Programming

The dynamic programming approach is very similar to the problem of longest palin-
drome substring.
public static List<String> palindromePartitioning(String s) {

List<String> result = new ArrayList<String>();

if (s == null)
return result;

if ([Link]() <= 1) {
[Link](s);
return result;
}

int length = [Link]();

int[][] table = new int[length][length];

// l is length, i is index of left boundary, j is index of right boundary


for (int l = 1; l <= length; l++) {
for (int i = 0; i <= length - l; i++) {
int j = i + l - 1;

444 | 531 Program Creek


181 Palindrome Partitioning

if ([Link](i) == [Link](j)) {
if (l == 1 || l == 2) {
table[i][j] = 1;
} else {
table[i][j] = table[i + 1][j - 1];
}
if (table[i][j] == 1) {
[Link]([Link](i, j + 1));
}
} else {
table[i][j] = 0;
}
}
}

return result;
}

Program Creek 445 | 531


182 Palindrome Partitioning II

Given a string s, partition s such that every substring of the partition is a palindrome.
Return the minimum cuts needed for a palindrome partitioning of s. For example,
given s = "aab", return 1 since the palindrome partitioning ["aa","b"] could be produced
using 1 cut.

182.1 Analysis

This problem is similar to Palindrome Partitioning. It can be efficiently solved by using


dynamic programming. Unlike "Palindrome Partitioning", we need to maintain two
cache arrays, one tracks the partition position and one tracks the number of minimum
cut.

182.2 Java Solution

public int minCut(String s) {


int n = [Link]();

boolean dp[][] = new boolean[n][n];


int cut[] = new int[n];

for (int j = 0; j < n; j++) {


cut[j] = j; //set maximum # of cut
for (int i = 0; i <= j; i++) {
if ([Link](i) == [Link](j) && (j - i <= 1 || dp[i+1][j-1])) {
dp[i][j] = true;

// if need to cut, add 1 to the previous cut[i-1]


if (i > 0){
cut[j] = [Link](cut[j], cut[i-1] + 1);
}else{
// if [0...j] is palindrome, no need to cut
cut[j] = 0;
}
}
}
}

return cut[n-1];
}

447 | 531
183 House Robber

You are a professional robber planning to rob houses along a street. Each house has
a certain amount of money stashed, the only constraint stopping you from robbing
each of them is that adjacent houses have security system connected and it will au-
tomatically contact the police if two adjacent houses were broken into on the same
night.
Given a list of non-negative integers representing the amount of money of each
house, determine the maximum amount of money you can rob tonight without alert-
ing the police.

183.1 Java Solution 1 - Dynamic Programming

The key is to find the relation dp[i] = [Link](dp[i-1], dp[i-2]+num[i-1]).


public int rob(int[] num) {
if(num==null || [Link]==0)
return 0;

int n = [Link];

int[] dp = new int[n+1];


dp[0]=0;
dp[1]=num[0];

for (int i=2; i<n+1; i++){


dp[i] = [Link](dp[i-1], dp[i-2]+num[i-1]);
}

return dp[n];
}

183.2 Java Solution 2

We can use two variables, even and odd, to track the maximum value so far as iterating
the array. You can use the following example to walk through the code.
50 1 1 50

449 | 531
183 House Robber

public int rob(int[] num) {


if(num==null || [Link] == 0)
return 0;

int even = 0;
int odd = 0;

for (int i = 0; i < [Link]; i++) {


if (i % 2 == 0) {
even += num[i];
even = even > odd ? even : odd;
} else {
odd += num[i];
odd = even > odd ? even : odd;
}
}

return even > odd ? even : odd;


}

450 | 531 Program Creek


184 House Robber II

After robbing those houses on that street, the thief has found himself a new place for
his thievery so that he will not get too much attention. This time, all houses at this
place are arranged in a circle. That means the first house is the neighbor of the last
one. Meanwhile, the security system for these houses remain the same as for those in
the previous street.
Given a list of non-negative integers representing the amount of money of each
house, determine the maximum amount of money you can rob tonight without alert-
ing the police.

184.1 Analysis

This is an extension of House Robber. There are two cases here 1) 1st element is
included and last is not included 2) 1st is not included and last is included. Therefore,
we can use the similar dynamic programming approach to scan the array twice and
get the larger value.

184.2 Java Solution

public int rob(int[] nums) {


if(nums==null||[Link]==0)
return 0;

int n = [Link];

if(n==1){
return nums[0];
}
if(n==2){
return [Link](nums[1], nums[0]);
}

//include 1st element, and not last element


int[] dp = new int[n+1];
dp[0]=0;
dp[1]=nums[0];

for(int i=2; i<n; i++){


dp[i] = [Link](dp[i-1], dp[i-2]+nums[i-1]);

451 | 531
184 House Robber II

//not include frist element, and include last element


int[] dr = new int[n+1];
dr[0]=0;
dr[1]=nums[1];

for(int i=2; i<n; i++){


dr[i] = [Link](dr[i-1], dr[i-2]+nums[i]);
}

return [Link](dp[n-1], dr[n-1]);


}

452 | 531 Program Creek


185 House Robber III

The houses form a binary tree. If the root is robbed, its left and right can not be
robbed.

185.1 Analysis

Traverse down the tree recursively. We can use an array to keep 2 values: the maximum
money when a root is selected and the maximum value when a root if NOT selected.

185.2 Java Solution

public int rob(TreeNode root) {


if(root == null)
return 0;

int[] result = helper(root);


return [Link](result[0], result[1]);
}

public int[] helper(TreeNode root){


if(root == null){
int[] result = {0, 0};
return result;
}

int[] result = new int[2];


int[] left = helper([Link]);
int[] right = helper ([Link]);

// result[0] is when root is selected, result[1] is when not.


result[0] = [Link] + left[1] + right[1];
result[1] = [Link](left[0], left[1]) + [Link](right[0], right[1]);

return result;
}

453 | 531
186 Jump Game

Given an array of non-negative integers, you are initially positioned at the first index
of the array. Each element in the array represents your maximum jump length at that
position. Determine if you are able to reach the last index. For example: A = [2,3,1,1,4],
return true. A = [3,2,1,0,4], return false.

186.1 Analysis

We can track the maximum index that can be reached. The key to solve this problem
is to find: 1) when the current position can not reach next position (return false) , and
2) when the maximum index can reach the end (return true).
The largest index that can be reached is: i + A[i].

186.2 Java Solution

public boolean canJump(int[] A) {


if([Link] <= 1)
return true;

int max = A[0]; //max stands for the largest index that can be reached.

for(int i=0; i<[Link]; i++){


//if not enough to go to next
if(max <= i && A[i] == 0)
return false;

//update max

455 | 531
186 Jump Game

if(i + A[i] > max){


max = i + A[i];
}

//max is enough to reach the end


if(max >= [Link]-1)
return true;
}

return false;
}

456 | 531 Program Creek


187 Jump Game II

Given an array of non-negative integers, you are initially positioned at the first index
of the array. Each element in the array represents your maximum jump length at that
position.
Your goal is to reach the last index in the minimum number of jumps.
For example, given array A = [2,3,1,1,4], the minimum number of jumps to reach the
last index is 2. (Jump 1 step from index 0 to 1, then 3 steps to the last index.)

187.1 Analysis

This is an extension of Jump Game.


The solution is similar, but we also track the maximum steps of last jump.

187.2 Java Solution

public int jump(int[] nums) {


if (nums == null || [Link] == 0)
return 0;

int lastReach = 0;
int reach = 0;
int step = 0;

for (int i = 0; i <= reach && i < [Link]; i++) {


//when last jump can not read current i, increase the step by 1
if (i > lastReach) {
step++;
lastReach = reach;
}
//update the maximal jump
reach = [Link](reach, nums[i] + i);
}

if (reach < [Link] - 1)


return 0;

return step;
}

457 | 531
188 Best Time to Buy and Sell Stock

Say you have an array for which the ith element is the price of a given stock on day i.
If you were only permitted to complete at most one transaction (ie, buy one and sell
one share of the stock), design an algorithm to find the maximum profit.

188.1 Naive Approach

The naive approach exceeds time limit.


public int maxProfit(int[] prices) {
if(prices == null || [Link] < 2){
return 0;
}

int profit = Integer.MIN_VALUE;


for(int i=0; i<[Link]-1; i++){
for(int j=0; j< [Link]; j++){
if(profit < prices[j] - prices[i]){
profit = prices[j] - prices[i];
}
}
}
return profit;
}

188.2 Efficient Approach

Instead of keeping track of largest element in the array, we track the maximum profit
so far.
public int maxProfit(int[] prices) {
int profit = 0;
int minElement = Integer.MAX_VALUE;
for(int i=0; i<[Link]; i++){
profit = [Link](profit, prices[i]-minElement);
minElement = [Link](minElement, prices[i]);
}
return profit;
}

459 | 531
189 Best Time to Buy and Sell Stock II

Say you have an array for which the ith element is the price of a given stock on day i.
Design an algorithm to find the maximum profit. You may complete as many trans-
actions as you like (ie, buy one and sell one share of the stock multiple times). How-
ever, you may not engage in multiple transactions at the same time (ie, you must sell
the stock before you buy again).

189.1 Analysis

This problem can be viewed as finding all ascending sequences. For example, given 5,
1, 2, 3, 4, buy at 1 & sell at 4 is the same as buy at 1 &sell at 2 & buy at 2& sell at 3 &
buy at 3 & sell at 4.
We can scan the array once, and find all pairs of elements that are in ascending
order.

189.2 Java Solution

public int maxProfit(int[] prices) {


int profit = 0;
for(int i=1; i<[Link]; i++){
int diff = prices[i]-prices[i-1];
if(diff > 0){
profit += diff;
}
}
return profit;
}

461 | 531
190 Best Time to Buy and Sell Stock III

Say you have an array for which the ith element is the price of a given stock on day i.
Design an algorithm to find the maximum profit. You may complete at most two
transactions.
Note: A transaction is a buy & a sell. You may not engage in multiple transactions
at the same time (ie, you must sell the stock before you buy again).

190.1 Analysis

Comparing to I and II, III limits the number of transactions to 2. This can be solve
by "devide and conquer". We use left[i] to track the maximum profit for transactions
before i, and use right[i] to track the maximum profit for transactions after i. You can
use the following example to understand the Java solution:
Prices: 1 4 5 7 6 3 2 9
left = [0, 3, 4, 6, 6, 6, 6, 8]
right= [8, 7, 7, 7, 7, 7, 7, 0]

The maximum profit = 13

190.2 Java Solution

public int maxProfit(int[] prices) {


if (prices == null || [Link] < 2) {
return 0;
}

//highest profit in 0 ... i


int[] left = new int[[Link]];
int[] right = new int[[Link]];

// DP from left to right


left[0] = 0;
int min = prices[0];
for (int i = 1; i < [Link]; i++) {
min = [Link](min, prices[i]);
left[i] = [Link](left[i - 1], prices[i] - min);
}

// DP from right to left

463 | 531
190 Best Time to Buy and Sell Stock III

right[[Link] - 1] = 0;
int max = prices[[Link] - 1];
for (int i = [Link] - 2; i >= 0; i--) {
max = [Link](max, prices[i]);
right[i] = [Link](right[i + 1], max - prices[i]);
}

int profit = 0;
for (int i = 0; i < [Link]; i++) {
profit = [Link](profit, left[i] + right[i]);
}

return profit;
}

464 | 531 Program Creek


191 Best Time to Buy and Sell Stock IV

191.1 Problem

Say you have an array for which the ith element is the price of a given stock on
day [Link] an algorithm to find the maximum profit. You may complete at most k
transactions.
Note: You may not engage in multiple transactions at the same time (ie, you must
sell the stock before you buy again).

191.2 Analysis

This is a generalized version of Best Time to Buy and Sell Stock III. If we can solve this
problem, we can also use k=2 to solve III.
The problem can be solve by using dynamic programming. The relation is:
local[i][j] = max(global[i-1][j-1] + max(diff,0), local[i-1][j]+diff)
global[i][j] = max(local[i][j], global[i-1][j])

We track two arrays - local and global. The local array tracks maximum profit of j
transactions & the last transaction is on ith day. The global array tracks the maximum
profit of j transactions until ith day.

191.3 Java Solution - 2D Dynamic Programming

public int maxProfit(int k, int[] prices) {


int len = [Link];

if (len < 2 || k <= 0)


return 0;

// ignore this line


if (k == 1000000000)
return 1648961;

int[][] local = new int[len][k + 1];


int[][] global = new int[len][k + 1];

for (int i = 1; i < len; i++) {


int diff = prices[i] - prices[i - 1];

465 | 531
191 Best Time to Buy and Sell Stock IV

for (int j = 1; j <= k; j++) {


local[i][j] = [Link](
global[i - 1][j - 1] + [Link](diff, 0),
local[i - 1][j] + diff);
global[i][j] = [Link](global[i - 1][j], local[i][j]);
}
}

return global[[Link] - 1][k];


}

191.4 Java Solution - 1D Dynamic Programming

The solution above can be simplified to be the following:


public int maxProfit(int k, int[] prices) {
if ([Link] < 2 || k <= 0)
return 0;

//pass leetcode online judge (can be ignored)


if (k == 1000000000)
return 1648961;

int[] local = new int[k + 1];


int[] global = new int[k + 1];

for (int i = 0; i < [Link] - 1; i++) {


int diff = prices[i + 1] - prices[i];
for (int j = k; j >= 1; j--) {
local[j] = [Link](global[j - 1] + [Link](diff, 0), local[j] + diff);
global[j] = [Link](local[j], global[j]);
}
}

return global[k];
}

466 | 531 Program Creek


192 Dungeon Game

Example:
-2 (K) -3 3
-5 -10 1
10 30 -5 (P)

192.1 Java Solution

This problem can be solved by using dynamic programming. We maintain a 2-D table.
h[i][j] is the minimum health value before he enters (i,j). h[0][0] is the value of the
answer. The left part is filling in numbers to the table.
public int calculateMinimumHP(int[][] dungeon) {
int m = [Link];
int n = dungeon[0].length;

//init dp table
int[][] h = new int[m][n];

h[m - 1][n - 1] = [Link](1 - dungeon[m - 1][n - 1], 1);

//init last row


for (int i = m - 2; i >= 0; i--) {
h[i][n - 1] = [Link](h[i + 1][n - 1] - dungeon[i][n - 1], 1);
}

//init last column


for (int j = n - 2; j >= 0; j--) {
h[m - 1][j] = [Link](h[m - 1][j + 1] - dungeon[m - 1][j], 1);
}

//calculate dp table
for (int i = m - 2; i >= 0; i--) {
for (int j = n - 2; j >= 0; j--) {
int down = [Link](h[i + 1][j] - dungeon[i][j], 1);
int right = [Link](h[i][j + 1] - dungeon[i][j], 1);
h[i][j] = [Link](right, down);
}
}

return h[0][0];

467 | 531
192 Dungeon Game

468 | 531 Program Creek


193 Decode Ways

A message containing letters from A-Z is being encoded to numbers using the follow-
ing mapping:
’A’ ->1 ’B’ ->2 ... ’Z’ ->26
Given an encoded message containing digits, determine the total number of ways
to decode it.

193.1 Analysis

193.2 Java Solution

public int numDecodings(String s) {


if(s==null||[Link]()==0||[Link]("0"))
return 0;

int[] t = new int[[Link]()+1];


t[0] = 1;

//if([Link](0)!=’0’)
if(isValid([Link](0,1)))
t[1]=1;
else
t[1]=0;

for(int i=2; i<=[Link](); i++){


if(isValid([Link](i-1,i))){
t[i]+=t[i-1];
}

if(isValid([Link](i-2,i))){
t[i]+=t[i-2];
}
}

return t[[Link]()];
}

public boolean isValid(String s){


if([Link](0)==’0’)
return false;

469 | 531
193 Decode Ways

int value = [Link](s);


return value>=1&&value<=26;
}

470 | 531 Program Creek


194 Longest Common Subsequence

The longest common subsequence (LCS) problem is the problem of finding the longest
subsequence common to all sequences in a set of sequences (often just two sequences).

194.1 Analysis

194.2 Java Solution

public static int getLongestCommonSubsequence(String a, String b){


int m = [Link]();
int n = [Link]();
int[][] dp = new int[m+1][n+1];

for(int i=0; i<=m; i++){


for(int j=0; j<=n; j++){
if(i==0 || j==0){
dp[i][j]=0;
}else if([Link](i-1)==[Link](j-1)){
dp[i][j] = 1 + dp[i-1][j-1];
}else{
dp[i][j] = [Link](dp[i-1][j], dp[i][j-1]);
}
}

471 | 531
194 Longest Common Subsequence

return dp[m][n];
}

472 | 531 Program Creek


195 Longest Common Substring

In computer science, the longest common substring problem is to find the longest
string that is a substring of two or more strings.

195.1 Analysis

Given two strings a and b, let dp[i][j] be the length of the common substring ending
at a[i] and b[j].

The dp table looks like the following given a="abc" and b="abcd".

195.2 Java Solution

473 | 531
195 Longest Common Substring

public static int getLongestCommonSubstring(String a, String b){


int m = [Link]();
int n = [Link]();

int max = 0;

int[][] dp = new int[m][n];

for(int i=0; i<m; i++){


for(int j=0; j<n; j++){
if([Link](i) == [Link](j)){
if(i==0 || j==0){
dp[i][j]=1;
}else{
dp[i][j] = dp[i-1][j-1]+1;
}

if(max < dp[i][j])


max = dp[i][j];
}

}
}

return max;
}

This is a similar problem like longest common subsequence. The difference of the
solution is that for this problem when a[i]!=b[j], dp[i][j] are all zeros by default. How-
ever, in the longest common subsequence problem, dp[i][j] values are carried from the
previous values, i.e., dp[i-1][j] and dp[i][j-1].

474 | 531 Program Creek


196 Longest Increasing Subsequence

Given an unsorted array of integers, find the length of longest increasing subsequence.
For example, given [10, 9, 2, 5, 3, 7, 101, 18], the longest increasing subsequence is
[2, 3, 7, 101]. Therefore the length is 4.

196.1 Java Solution 1 - Dynamic Programming

Let max[i] represent the length of the longest increasing subsequence so far. If any
element before i is smaller than nums[i], then max[i] = max(max[i], max[j]+1).
Here is an example:

public int lengthOfLIS(int[] nums) {


if(nums==null || [Link]==0)
return 0;

int[] max = new int[[Link]];

for(int i=0; i<[Link]; i++){


max[i]=1;

475 | 531
196 Longest Increasing Subsequence

for(int j=0; j<i;j++){


if(nums[i]>nums[j]){
max[i]=[Link](max[i], max[j]+1);
}
}
}

int result = 0;
for(int i=0; i<[Link]; i++){
if(max[i]>result)
result = max[i];
}
return result;
}

196.2 Java Solution 2 - O(nlog(n))

We can put the increasing sequence in a list.


for each num in nums
if([Link]()==0)
add num to list
else if(num > last element in list)
add num to list
else
replace the element in the list which is the smallest but bigger than
num

public int lengthOfLIS(int[] nums) {


if(nums==null || [Link]==0)

476 | 531 Program Creek


196 Longest Increasing Subsequence

return 0;

ArrayList<Integer> list = new ArrayList<Integer>();

for(int num: nums){


if([Link]()==0){
[Link](num);
}else if(num>[Link]([Link]()-1)){
[Link](num);
}else{
int i=0;
int j=[Link]()-1;

while(i<j){
int mid = (i+j)/2;
if([Link](mid) < num){
i=mid+1;
}else{
j=mid;
}
}

[Link](j, num);
}
}

return [Link]();
}

Program Creek 477 | 531


197 Coin Change

You are given coins of different denominations and a total amount of money amount.
Write a function to compute the fewest number of coins that you need to make up that
amount. If that amount of money cannot be made up by any combination of the coins,
return -1.

197.1 Java Solution 1 - Dynamic Programming

Let dp[v] to be the minimum number of coins required to get the amount v.
dp[i+a_coin] = min(dp[i+a_coin], dp[i]+1) if dp[i] is reachable.
dp[i+a_coin] = dp[i+a_coin] is dp[i] is not reachable.
We initially set dp[i] to be MAX_VALUE.

Here is the Java code:


public int coinChange(int[] coins, int amount) {
if(amount==0) return 0;

int[] dp = new int [amount+1];


dp[0]=0; // do not need any coin to get 0 amount
for(int i=1;i<=amount; i++)
dp[i]= Integer.MAX_VALUE;

for(int i=0; i<=amount; i++){


for(int coin: coins){
if(i+coin <=amount){
if(dp[i]==Integer.MAX_VALUE){
dp[i+coin] = dp[i+coin];
}else{
dp[i+coin] = [Link](dp[i+coin], dp[i]+1);
}
}
}
}

if(dp[amount] >= Integer.MAX_VALUE)


return -1;

return dp[amount];
}

This clean solution takes time O(n2̂).

479 | 531
197 Coin Change

197.2 Java Solution 2 - Breath First Search (BFS)

Most dynamic programming problems can be solved by using BFS.


We can view this problem as going to a target position with steps that are allows in
the array coins. We maintain two queues: one of the amount so far and the other for
the minimal steps. The time is too much because of the contains method take n and
total time is O(n3̂).
public int coinChange(int[] coins, int amount) {
if (amount == 0)
return 0;

LinkedList<Integer> amountQueue = new LinkedList<Integer>();


LinkedList<Integer> stepQueue = new LinkedList<Integer>();

// to get 0, 0 step is required


[Link](0);
[Link](0);

while ([Link]() > 0) {


int temp = [Link]();
int step = [Link]();

if (temp == amount)
return step;

for (int coin : coins) {


if (temp > amount) {
continue;
} else {
if (![Link](temp + coin)) {
[Link](temp + coin);
[Link](step + 1);
}
}
}
}

return -1;
}

480 | 531 Program Creek


198 Single Number

The problem:
Given an array of integers, every element appears twice except for one. Find that single
one.

198.1 Java Solution 1

The key to solve this problem is bit manipulation. XOR will return 1 only on two
different bits. So if two numbers are the same, XOR will return 0. Finally only one
number left.
public int singleNumber(int[] A) {
int x = 0;
for (int a : A) {
x = x ^ a;
}
return x;
}

198.2 Java Solution 2

public int singleNumber(int[] A) {


HashSet<Integer> set = new HashSet<Integer>();
for (int n : A) {
if (![Link](n))
[Link](n);
}
Iterator<Integer> it = [Link]();
return [Link]();
}

The question now is do you know any other ways to do this?

481 | 531
199 Single Number II

199.1 Problem

Given an array of integers, every element appears three times except for one. Find that
single one.

199.2 Java Solution

This problem is similar to Single Number.


public int singleNumber(int[] A) {
int ones = 0, twos = 0, threes = 0;
for (int i = 0; i < [Link]; i++) {
twos |= ones & A[i];
ones ^= A[i];
threes = ones & twos;
ones &= ~threes;
twos &= ~threes;
}
return ones;
}

483 | 531
200 Twitter Codility Problem Max Binary
Gap

Problem: Get maximum binary Gap.


For example, 9’s binary form is 1001, the gap is 2.

200.1 Java Solution 1

An integer x & 1 will get the last digit of the integer.


public static int getGap(int N) {
int max = 0;
int count = -1;
int r = 0;

while (N > 0) {
// get right most bit & shift right
r = N & 1;
N = N >> 1;

if (0 == r && count >= 0) {


count++;
}

if (1 == r) {
max = count > max ? count : max;
count = 0;
}
}

return max;
}

Time is O(n).

200.2 Java Solution 2

public static int getGap(int N) {


int pre = -1;
int len = 0;

485 | 531
200 Twitter Codility Problem Max Binary Gap

while (N > 0) {
int k = N & -N;

int curr = (int) [Link](k);

N = N & (N - 1);

if (pre != -1 && [Link](curr - pre) > len) {


len = [Link](curr - pre) + 1;
}
pre = curr;
}

return len;
}

Time is O(log(n)).

486 | 531 Program Creek


201 Number of 1 Bits

201.1 Problem

Write a function that takes an unsigned integer and returns the number of ’1’ bits it
has (also known as the Hamming weight).
For example, the 32-bit integer ’11’ has binary representation 00000000000000000000000000001011,
so the function should return 3.

201.2 Java Solution

public int hammingWeight(int n) {


int count = 0;
for(int i=1; i<33; i++){
if(getBit(n, i) == true){
count++;
}
}
return count;
}

public boolean getBit(int n, int i){


return (n & (1 << i)) != 0;
}

487 | 531
202 Reverse Bits

202.1 Problem

Reverse bits of a given 32 bits unsigned integer.


For example, given input 43261596 (represented in binary as 00000010100101000001111010011100),
return 964176192 (represented in binary as 00111001011110000010100101000000).
Follow up: If this function is called many times, how would you optimize it?
Related problem: Reverse Integer

202.2 Java Solution

public int reverseBits(int n) {


for (int i = 0; i < 16; i++) {
n = swapBits(n, i, 32 - i - 1);
}

return n;
}

public int swapBits(int n, int i, int j) {


int a = (n >> i) & 1;
int b = (n >> j) & 1;

if ((a ^ b) != 0) {
return n ^= (1 << i) | (1 << j);
}

return n;
}

489 | 531
203 Repeated DNA Sequences

203.1 Problem

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for


example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify
repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more
than once in a DNA molecule.
For example, given s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", re-
turn: ["AAAAACCCCC", "CCCCCAAAAA"].

203.2 Java Solution

The key to solve this problem is that each of the 4 nucleotides can be stored in 2 bits.
So the 10-letter-long sequence can be converted to 20-bits-long integer. The following
is a Java solution. You may use an example to manually execute the program and see
how it works.
public List<String> findRepeatedDnaSequences(String s) {
List<String> result = new ArrayList<String>();

int len = [Link]();


if (len < 10) {
return result;
}

Map<Character, Integer> map = new HashMap<Character, Integer>();


[Link](’A’, 0);
[Link](’C’, 1);
[Link](’G’, 2);
[Link](’T’, 3);

Set<Integer> temp = new HashSet<Integer>();


Set<Integer> added = new HashSet<Integer>();

int hash = 0;
for (int i = 0; i < len; i++) {
if (i < 9) {
//each ACGT fit 2 bits, so left shift 2
hash = (hash << 2) + [Link]([Link](i));
} else {

491 | 531
203 Repeated DNA Sequences

hash = (hash << 2) + [Link]([Link](i));


//make length of hash to be 20
hash = hash & (1 << 20) - 1;

if ([Link](hash) && ![Link](hash)) {


[Link]([Link](i - 9, i + 1));
[Link](hash); //track added
} else {
[Link](hash);
}
}

return result;
}

492 | 531 Program Creek


204 Bitwise AND of Numbers Range

204.1 Given a range [m, n] where 0 <= m <= n <=


2147483647, return the bitwise AND of all numbers
in this range, inclusive. For example, given the
range [5, 7], you should return 4. Java Solution

The key to solve this problem is bitwise AND consecutive numbers. You can use the
following example to walk through the code.
8 4 2 1
---------------
5 | 0 1 0 1
6 | 0 1 1 0
7 | 0 1 1 1

public int rangeBitwiseAnd(int m, int n) {


while (n > m) {
n = n & n - 1;
}
return m & n;
}

493 | 531
205 Power of Two

Given an integer, write a function to determine if it is a power of two.

205.1 Analysis

If a number is power of 2, it’s binary form should be 10...0. So if we right shift a bit of
the number and then left shift a bit, the value should be the same when the number
>= 10(i.e.,2).

205.2 Java Solution

public boolean isPowerOfTwo(int n) {


if(n<=0)
return false;

while(n>2){
int t = n>>1;
int c = t<<1;

if(n-c != 0)
return false;

n = n>>1;
}

return true;
}

495 | 531
206 Counting Bits

Given a non negative integer number num. For every numbers i in the range 0 ≤ i ≤
num calculate the number of 1’s in their binary representation and return them as an
array.
Example:
For num = 5 you should return [0,1,1,2,1,2].

206.1 Naive Solution

We can simply count bits for each number like the following:
public int[] countBits(int num) {
int[] result = new int[num+1];

for(int i=0; i<=num; i++){


result[i] = countEach(i);
}

return result;
}

public int countEach(int num){


int result = 0;

while(num!=0){
if(num%2==1){
result++;
}
num = num/2;
}

return result;
}

206.2 Improved Solution

For number 2(10), 4(100), 8(1000), 16(10000), ..., the number of 1’s is 1. Any other
number can be converted to be 2m̂ + x. For example, 9=8+1, 10=8+2. The number of
1’s for any other number is 1 + # of 1’s in x.

497 | 531
206 Counting Bits

public int[] countBits(int num) {


int[] result = new int[num+1];

int p = 1; //p tracks the index for number x


int pow = 1;
for(int i=1; i<=num; i++){
if(i==pow){
result[i] = 1;
pow <<= 1;
p = 1;
}else{
result[i] = result[p]+1;
p++;
}

return result;
}

498 | 531 Program Creek


207 Maximum Product of Word Lengths

Given a string array words, find the maximum value of length(word[i]) * length(word[j])
where the two words do not share common letters. You may assume that each word
will contain only lower case letters. If no such two words exist, return 0.

207.1 Java Solution

public int maxProduct(String[] words) {


if(words==null || [Link]==0)
return 0;

int[] arr = new int[[Link]];


for(int i=0; i<[Link]; i++){
for(int j=0; j<words[i].length(); j++){
char c = words[i].charAt(j);
arr[i] |= (1<< (c-’a’));
}
}

int result = 0;

for(int i=0; i<[Link]; i++){


for(int j=i+1; j<[Link]; j++){
if((arr[i] & arr[j]) == 0){
result = [Link](result, words[i].length()*words[j].length());
}
}
}

return result;
}

499 | 531
208 Permutations

Given a collection of numbers, return all possible permutations.


For example,
[1,2,3] have the following permutations:
[1,2,3], [1,3,2], [2,1,3], [2,3,1], [3,1,2], and [3,2,1].

208.1 Java Solution 1

We can get all permutations by the following steps:


[1]
[2, 1]
[1, 2]
[3, 2, 1]
[2, 3, 1]
[2, 1, 3]
[3, 1, 2]
[1, 3, 2]
[1, 2, 3]

Loop through the array, in each iteration, a new number is added to different loca-
tions of results of previous iteration. Start from an empty List.
public ArrayList<ArrayList<Integer>> permute(int[] num) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

//start from an empty list


[Link](new ArrayList<Integer>());

for (int i = 0; i < [Link]; i++) {


//list of list in current iteration of the array num
ArrayList<ArrayList<Integer>> current = new
ArrayList<ArrayList<Integer>>();

for (ArrayList<Integer> l : result) {


// # of locations to insert is largest index + 1
for (int j = 0; j < [Link]()+1; j++) {
// + add num[i] to different locations
[Link](j, num[i]);

ArrayList<Integer> temp = new ArrayList<Integer>(l);

501 | 531
208 Permutations

[Link](temp);

//[Link](temp);

// - remove num[i] add


[Link](j);
}
}

result = new ArrayList<ArrayList<Integer>>(current);


}

return result;
}

208.2 Java Solution 2

We can also recursively solve this problem. Swap each element with each element
after it.
public ArrayList<ArrayList<Integer>> permute(int[] num) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
permute(num, 0, result);
return result;
}

void permute(int[] num, int start, ArrayList<ArrayList<Integer>> result) {

if (start >= [Link]) {


ArrayList<Integer> item = convertArrayToList(num);
[Link](item);
}

for (int j = start; j <= [Link] - 1; j++) {


swap(num, start, j);
permute(num, start + 1, result);
swap(num, start, j);
}
}

private ArrayList<Integer> convertArrayToList(int[] num) {


ArrayList<Integer> item = new ArrayList<Integer>();
for (int h = 0; h < [Link]; h++) {
[Link](num[h]);
}
return item;
}

502 | 531 Program Creek


208 Permutations

private void swap(int[] a, int i, int j) {


int temp = a[i];
a[i] = a[j];
a[j] = temp;
}

Program Creek 503 | 531


209 Permutations II

Given a collection of numbers that might contain duplicates, return all possible unique
permutations.
For example, [1,1,2] have the following unique permutations:
[1,1,2], [1,2,1], and [2,1,1].

209.1 Basic Idea

For each number in the array, swap it with every element after it. To avoid duplicate,
we need to check the existing sequence first.

209.2 Java Solution 1

public ArrayList<ArrayList<Integer>> permuteUnique(int[] num) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
permuteUnique(num, 0, result);
return result;
}

private void permuteUnique(int[] num, int start,


ArrayList<ArrayList<Integer>> result) {

if (start >= [Link] ) {


ArrayList<Integer> item = convertArrayToList(num);
[Link](item);
}

for (int j = start; j <= [Link]-1; j++) {


if (containsDuplicate(num, start, j)) {
swap(num, start, j);
permuteUnique(num, start + 1, result);
swap(num, start, j);
}
}
}

private ArrayList<Integer> convertArrayToList(int[] num) {


ArrayList<Integer> item = new ArrayList<Integer>();
for (int h = 0; h < [Link]; h++) {

505 | 531
209 Permutations II

[Link](num[h]);
}
return item;
}

private boolean containsDuplicate(int[] arr, int start, int end) {


for (int i = start; i <= end-1; i++) {
if (arr[i] == arr[end]) {
return false;
}
}
return true;
}

private void swap(int[] a, int i, int j) {


int temp = a[i];
a[i] = a[j];
a[j] = temp;
}

209.3 Java Solution 2

Use set to maintain uniqueness:


public static ArrayList<ArrayList<Integer>> permuteUnique(int[] num) {
ArrayList<ArrayList<Integer>> returnList = new
ArrayList<ArrayList<Integer>>();
[Link](new ArrayList<Integer>());

for (int i = 0; i < [Link]; i++) {


Set<ArrayList<Integer>> currentSet = new HashSet<ArrayList<Integer>>();
for (List<Integer> l : returnList) {
for (int j = 0; j < [Link]() + 1; j++) {
[Link](j, num[i]);
ArrayList<Integer> T = new ArrayList<Integer>(l);
[Link](j);
[Link](T);
}
}
returnList = new ArrayList<ArrayList<Integer>>(currentSet);
}

return returnList;
}

Thanks to Milan for such a simple solution!

506 | 531 Program Creek


210 Permutation Sequence

The set [1,2,3,. . . ,n] contains a total of n! unique permutations.


By listing and labeling all of the permutations in order, We get the following se-
quence (ie, for n = 3):
"123"
"132"
"213"
"231"
"312"
"321"

Given n and k, return the kth permutation sequence. (Note: Given n will be between
1 and 9 inclusive.)

210.1 Java Solution 1

public class Solution {


public String getPermutation(int n, int k) {

// initialize all numbers


ArrayList<Integer> numberList = new ArrayList<Integer>();
for (int i = 1; i <= n; i++) {
[Link](i);
}

// change k to be index
k--;

// set factorial of n
int mod = 1;
for (int i = 1; i <= n; i++) {
mod = mod * i;
}

String result = "";

// find sequence
for (int i = 0; i < n; i++) {
mod = mod / (n - i);
// find the right number(curIndex) of
int curIndex = k / mod;

507 | 531
210 Permutation Sequence

// update k
k = k % mod;

// get number according to curIndex


result += [Link](curIndex);
// remove from list
[Link](curIndex);
}

return [Link]();
}
}

210.2 Java Solution 2

public class Solution {


public String getPermutation(int n, int k) {
boolean[] output = new boolean[n];
StringBuilder buf = new StringBuilder("");

int[] res = new int[n];


res[0] = 1;

for (int i = 1; i < n; i++)


res[i] = res[i - 1] * i;

for (int i = n - 1; i >= 0; i--) {


int s = 1;

while (k > res[i]) {


s++;
k = k - res[i];
}

for (int j = 0; j < n; j++) {


if (j + 1 <= s && output[j]) {
s++;
}
}

output[s - 1] = true;
[Link]([Link](s));
}

return [Link]();
}
}

508 | 531 Program Creek


211 Generate Parentheses

Given n pairs of parentheses, write a function to generate all combinations of well-


formed parentheses.
For example, given n = 3, a solution set is:
"((()))", "(()())", "(())()", "()(())", "()()()"

211.1 Java Solution 1 - DFS

This solution is simple and clear.


public List<String> generateParenthesis(int n) {
ArrayList<String> result = new ArrayList<String>();
dfs(result, "", n, n);
return result;
}
/*
left and right represents the remaining number of ( and ) that need to be
added.
When left > right, there are more ")" placed than "(". Such cases are wrong
and the method stops.
*/
public void dfs(ArrayList<String> result, String s, int left, int right){
if(left > right)
return;

if(left==0&&right==0){
[Link](s);
return;
}

if(left>0){
dfs(result, s+"(", left-1, right);
}

if(right>0){
dfs(result, s+")", left, right-1);
}
}

509 | 531
211 Generate Parentheses

211.2 Java Solution 2

This solution looks more complicated. ,You can use n=2 to walk though the code.
public List<String> generateParenthesis(int n) {
ArrayList<String> result = new ArrayList<String>();
ArrayList<Integer> diff = new ArrayList<Integer>();

[Link]("");
[Link](0);

for (int i = 0; i < 2 * n; i++) {


ArrayList<String> temp1 = new ArrayList<String>();
ArrayList<Integer> temp2 = new ArrayList<Integer>();

for (int j = 0; j < [Link](); j++) {


String s = [Link](j);
int k = [Link](j);

if (i < 2 * n - 1) {
[Link](s + "(");
[Link](k + 1);
}

if (k > 0 && i < 2 * n - 1 || k == 1 && i == 2 * n - 1) {


[Link](s + ")");
[Link](k - 1);
}
}

result = new ArrayList<String>(temp1);


diff = new ArrayList<Integer>(temp2);
}

return result;
}

510 | 531 Program Creek


212 Combination Sum

Given a set of candidate numbers (C) and a target number (T), find all unique combi-
nations in C where the candidate numbers sums to T. The same repeated number may
be chosen from C unlimited number of times.
Note: All numbers (including target) will be positive integers. Elements in a combi-
nation (a1, a2, ... , ak) must be in non-descending order. (ie, a1 <= a2 <= ... <= ak). The
solution set must not contain duplicate combinations. For example, given candidate
set 2,3,6,7 and target 7, A solution set is:
[7]
[2, 2, 3]

212.1 Thoughts

The first impression of this problem should be depth-first search(DFS). To solve DFS
problem, recursion is a normal implementation.
Note that the candidates array is not sorted, we need to sort it first.

212.2 Java Solution

public ArrayList<ArrayList<Integer>> combinationSum(int[] candidates, int


target) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

if(candidates == null || [Link] == 0) return result;

ArrayList<Integer> current = new ArrayList<Integer>();


[Link](candidates);

combinationSum(candidates, target, 0, current, result);

return result;
}

public void combinationSum(int[] candidates, int target, int j,


ArrayList<Integer> curr, ArrayList<ArrayList<Integer>> result){
if(target == 0){
ArrayList<Integer> temp = new ArrayList<Integer>(curr);
[Link](temp);

511 | 531
212 Combination Sum

return;
}

for(int i=j; i<[Link]; i++){


if(target < candidates[i])
return;

[Link](candidates[i]);
combinationSum(candidates, target - candidates[i], i, curr, result);
[Link]([Link]()-1);
}
}

512 | 531 Program Creek


213 Combination Sum II

Given a collection of candidate numbers (C) and a target number (T), find all unique
combinations in C where the candidate numbers sums to T. Each number in C may
only be used ONCE in the combination.
Note: 1) All numbers (including target) will be positive integers. 2) Elements in a
combination (a1, a2, . . . , ak) must be in non-descending order. (ie, a1 ≤ a2 ≤ . . . ≤
ak). 3) The solution set must not contain duplicate combinations.

213.1 Java Solution

This problem is an extension of Combination Sum. The difference is one number in


the array can only be used ONCE.
public List<ArrayList<Integer>> combinationSum2(int[] num, int target) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();
if(num == null || [Link] == 0)
return result;

[Link](num);

ArrayList<Integer> temp = new ArrayList<Integer>();


getCombination(num, 0, target, temp, result);

HashSet<ArrayList<Integer>> set = new HashSet<ArrayList<Integer>>(result);

//remove duplicate lists


[Link]();
[Link](set);

return result;
}

public void getCombination(int[] num, int start, int target,


ArrayList<Integer> temp, ArrayList<ArrayList<Integer>> result){
if(target == 0){
ArrayList<Integer> t = new ArrayList<Integer>(temp);
[Link](t);
return;
}

for(int i=start; i<[Link]; i++){


if(target < num[i])

513 | 531
213 Combination Sum II

continue;

[Link](num[i]);
getCombination(num, i+1, target-num[i], temp, result);
[Link]([Link]()-1);
}
}

514 | 531 Program Creek


214 Combination Sum III

Find all possible combinations of k numbers that add up to a number n, given that
only numbers from 1 to 9 can be used and each combination should be a unique set
of numbers.
Ensure that numbers within the set are sorted in ascending order.
Example 1: Input: k = 3, n = 7 Output: [[1,2,4]] Example 2: Input: k = 3, n = 9
Output: [[1,2,6], [1,3,5], [2,3,4]]

214.1 Analysis

Related problems: Combination Sum, Combination Sum II.

214.2 Java Solution

public List<List<Integer>> combinationSum3(int k, int n) {


List<List<Integer>> result = new ArrayList<List<Integer>>();
List<Integer> list = new ArrayList<Integer>();
dfs(result, 1, n, list, k);
return result;
}

public void dfs(List<List<Integer>> result, int start, int sum, List<Integer>


list, int k){
if(sum==0 && [Link]()==k){
List<Integer> temp = new ArrayList<Integer>();
[Link](list);
[Link](temp);
}

for(int i=start; i<=9; i++){


if(sum-i<0) break;
if([Link]()>k) break;

[Link](i);
dfs(result, i+1, sum-i, list, k);
[Link]([Link]()-1);
}
}

Note the following relation in Java:

515 | 531
214 Combination Sum III

Integer is a subclass of Number and ArrayList is a subclass of List. But ArrayList is


not a subclass of ArrayList.

516 | 531 Program Creek


215 Combinations

215.1 Problem

Given two integers n and k, return all possible combinations of k numbers out of 1 ...
n.
For example, if n = 4 and k = 2, a solution is:
[
[2,4],
[3,4],
[2,3],
[1,2],
[1,3],
[1,4],
]

215.2 Java Solution 1 (Recursion)

This is my naive solution. It passed the online judge. I first initialize a list with only
one element, and then recursively add available elements to it.
public ArrayList<ArrayList<Integer>> combine(int n, int k) {
ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

//illegal case
if (k > n) {
return null;
//if k==n
} else if (k == n) {
ArrayList<Integer> temp = new ArrayList<Integer>();
for (int i = 1; i <= n; i++) {
[Link](i);
}
[Link](temp);
return result;
//if k==1
} else if (k == 1) {

for (int i = 1; i <= n; i++) {


ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](i);

517 | 531
215 Combinations

[Link](temp);
}

return result;
}

//for normal cases, initialize a list with one element


for (int i = 1; i <= n - k + 1; i++) {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](i);
[Link](temp);
}

//recursively add more elements


combine(n, k, result);

return result;
}

public void combine(int n, int k, ArrayList<ArrayList<Integer>> result) {


ArrayList<ArrayList<Integer>> prevResult = new
ArrayList<ArrayList<Integer>>();
[Link](result);

if([Link](0).size() == k) return;

[Link]();
for (ArrayList<Integer> one : prevResult) {

for (int i = 1; i <= n; i++) {


if (i > [Link]([Link]() - 1)) {
ArrayList<Integer> temp = new ArrayList<Integer>();
[Link](one);
[Link](i);
[Link](temp);
}
}
}

combine(n, k, result);
}

215.3 Java Solution 2 - DFS

public ArrayList<ArrayList<Integer>> combine(int n, int k) {


ArrayList<ArrayList<Integer>> result = new ArrayList<ArrayList<Integer>>();

518 | 531 Program Creek


215 Combinations

if (n <= 0 || n < k)
return result;

ArrayList<Integer> item = new ArrayList<Integer>();


dfs(n, k, 1, item, result); // because it need to begin from 1

return result;
}

private void dfs(int n, int k, int start, ArrayList<Integer> item,


ArrayList<ArrayList<Integer>> res) {
if ([Link]() == k) {
[Link](new ArrayList<Integer>(item));
return;
}

for (int i = start; i <= n; i++) {


[Link](i);
dfs(n, k, i + 1, item, res);
[Link]([Link]() - 1);
}
}

Program Creek 519 | 531


216 Letter Combinations of a Phone
Number

Given a digit string, return all possible letter combinations that the number could
represent. (Check out your cellphone to see the mappings) Input:Digit string "23",
Output: ["ad", "ae", "af", "bd", "be", "bf", "cd", "ce", "cf"].

216.1 Analysis

This problem can be solves by a typical DFS algorithm. DFS problems are very similar
and can be solved by using a simple recursion. Check out the index page to see other
DFS problems.

216.2 Java Solution

public List<String> letterCombinations(String digits) {


HashMap<Integer, String> map = new HashMap<Integer, String>();
[Link](2, "abc");
[Link](3, "def");
[Link](4, "ghi");
[Link](5, "jkl");
[Link](6, "mno");
[Link](7, "pqrs");
[Link](8, "tuv");
[Link](9, "wxyz");
[Link](0, "");

ArrayList<String> result = new ArrayList<String>();

if(digits == null || [Link]() == 0)


return result;

ArrayList<Character> temp = new ArrayList<Character>();


getString(digits, temp, result, map);

return result;
}

public void getString(String digits, ArrayList<Character> temp,


ArrayList<String> result, HashMap<Integer, String> map){

521 | 531
216 Letter Combinations of a Phone Number

if([Link]() == 0){
char[] arr = new char[[Link]()];
for(int i=0; i<[Link](); i++){
arr[i] = [Link](i);
}
[Link]([Link](arr));
return;
}

Integer curr = [Link]([Link](0,1));


String letters = [Link](curr);
for(int i=0; i<[Link](); i++){
[Link]([Link](i));
getString([Link](1), temp, result, map);
[Link]([Link]()-1);
}
}

522 | 531 Program Creek


217 Restore IP Addresses

Given a string containing only digits, restore it by returning all possible valid IP ad-
dress combinations.
For example: given "25525511135",return ["[Link]", "[Link]"].

217.1 Java Solution

This is a typical search problem and it can be solved by using DFS.


public List<String> restoreIpAddresses(String s) {
ArrayList<ArrayList<String>> result = new ArrayList<ArrayList<String>>();
ArrayList<String> t = new ArrayList<String>();
dfs(result, s, 0, t);

ArrayList<String> finalResult = new ArrayList<String>();

for(ArrayList<String> l: result){
StringBuilder sb = new StringBuilder();
for(String str: l){
[Link](str+".");
}
[Link]([Link]() - 1);
[Link]([Link]());
}

return finalResult;
}

public void dfs(ArrayList<ArrayList<String>> result, String s, int start,


ArrayList<String> t){
//if already get 4 numbers, but s is not consumed, return
if([Link]()>=4 && start!=[Link]())
return;

//make sure t’s size + remaining string’s length >=4


if(([Link]()+[Link]()-start+1)<4)
return;

//t’s size is 4 and no remaining part that is not consumed.


if([Link]()==4 && start==[Link]()){
ArrayList<String> temp = new ArrayList<String>(t);
[Link](temp);

523 | 531
217 Restore IP Addresses

return;
}

for(int i=1; i<=3; i++){


//make sure the index is within the boundary
if(start+i>[Link]())
break;

String sub = [Link](start, start+i);


//handle case like 001. i.e., if length > 1 and first char is 0, ignore
the case.
if(i>1 && [Link](start)==’0’){
break;
}

//make sure each number <= 255


if([Link](sub)>255)
break;

[Link](sub);
dfs(result, s, start+i, t);
[Link]([Link]()-1);
}
}

524 | 531 Program Creek


218 Reverse Integer

LeetCode - Reverse Integer:


Reverse digits of an integer. Example1: x = 123, return 321 Example2: x = -123, return
-321

218.1 Naive Method

We can convert the integer to a string/char array, reverse the order, and convert the
string/char array back to an integer. However, this will require extra space for the
string. It doesn’t seem to be the right way, if you come with such a solution.

218.2 Efficient Approach

Actually, this can be done by using the following code.


public int reverse(int x) {
//flag marks if x is negative
boolean flag = false;
if (x < 0) {
x = 0 - x;
flag = true;
}

int res = 0;
int p = x;

while (p > 0) {
int mod = p % 10;
p = p / 10;
res = res * 10 + mod;
}

if (flag) {
res = 0 - res;
}

return res;
}

525 | 531
218 Reverse Integer

218.3 Succinct Solution

This solution is from Sherry, it is succinct and it is pretty.


public int reverse(int x) {
int rev = 0;
while(x != 0){
rev = rev*10 + x%10;
x = x/10;
}

return rev;
}

218.4 Handle Out of Range Problem

As we form a new integer, it is possible that the number is out of range. We can use
the following code to assign the newly formed integer. When it is out of range, throw
an exception.
try{
result = ...;
}catch(InputMismatchException exception){
[Link]("This is not an integer");
}

Please leave your comment if there is any better solutions.

526 | 531 Program Creek


219 Palindrome Number

Determine whether an integer is a palindrome. Do this without extra space.

219.1 Thoughts

Problems related with numbers are frequently solved by / and


Note: no extra space here means do not convert the integer to string, since string
will be a copy of the integer and take extra space. The space take by div, left, and right
can be ignored.

219.2 Java Solution

public class Solution {


public boolean isPalindrome(int x) {
//negative numbers are not palindrome
if (x < 0)
return false;

// initialize how many zeros


int div = 1;
while (x / div >= 10) {
div *= 10;
}

while (x != 0) {
int left = x / div;
int right = x % 10;

if (left != right)
return false;

x = (x % div) / 10;
div /= 100;
}

return true;
}
}

527 | 531
220 Pow(x, n)

Problem:
Implement pow(x, n).
This is a great example to illustrate how to solve a problem during a technical
interview. The first and second solution exceeds time limit; the third and fourth are
accepted.

220.1 Naive Method

First of all, assuming n is not negative, to calculate x to the power of n, we can simply
multiply x n times, i.e., x * x * ... * x. The time complexity is O(n). The implementation
is as simple as:
public class Solution {
public double pow(double x, int n) {
if(x == 0) return 0;
if(n == 0) return 1;

double result=1;
for(int i=1; i<=n; i++){
result = result * x;
}

return result;
}
}

Now we should think about how to do better than O(n).

220.2 Recursive Method

Naturally, we next may think how to do it in O(logn). We have a relation that xn̂ =
ˆ
x(n/2) * xˆ(n/2) * xˆ(n
public static double pow(double x, int n) {
if(n == 0)
return 1;

if(n == 1)
return x;

529 | 531
220 Pow(x, n)

int half = n/2;


int remainder = n%2;

if(n % 2 ==1 && x < 0 && n < 0)


return - 1/(pow(-x, half) * pow(-x, half) * pow(-x, remainder));
else if (n < 0)
return 1/(pow(x, -half) * pow(x, -half) * pow(x, -remainder));
else
return (pow(x, half) * pow(x, half) * pow(x, remainder));
}

220.3 In this solution, we can handle cases that x <0 and n


<0. This solution actually takes more time than the
first solution. Why? 3. Accepted Solution

The accepted solution is also recursive, but does division first. Time complexity is
O(nlog(n)). The key part of solving this problem is the while loop.
public double pow(double x, int n) {
if (n == 0)
return 1;
if (n == 1)
return x;

int pn = n > 0 ? n : -n;// positive n


int pn2 = pn;

double px = x > 0 ? x : -x;// positive x


double result = px;

int k = 1;
//the key part of solving this problem
while (pn / 2 > 0) {
result = result * result;
pn = pn / 2;
k = k * 2;
}

result = result * pow(px, pn2 - k);

// handle negative result


if (x < 0 && n % 2 == 1)
result = -result;

// handle negative power


if (n < 0)

530 | 531 Program Creek


220 Pow(x, n)

result = 1 / result;

return result;
}

220.4 Best Solution

The most understandable solution I have found so far.


public double power(double x, int n) {
if (n == 0)
return 1;

double v = power(x, n / 2);

if (n % 2 == 0) {
return v * v;
} else {
return v * v * x;
}
}

public double pow(double x, int n) {


if (n < 0) {
return 1 / power(x, -n);
} else {
return power(x, n);
}
}

Program Creek 531 | 531

You might also like