100% found this document useful (1 vote)
247 views26 pages

Biopython Tutorial

learning bio python in an easy way for you
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
100% found this document useful (1 vote)
247 views26 pages

Biopython Tutorial

learning bio python in an easy way for you
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
  • Basics of Biopython
  • First Steps
  • Using NCBI E-utilities
  • Diagnosing Sickle Cell Anemia
  • BLAST
  • Biopython Examples
  • Acknowledgements

Table

of Contents
Basics of Biopython 1.1
First Steps 1.2
Using NCBI E-utilities 1.3
Diagnosing Sickle Cell Anemia 1.4
BLAST 1.5
Biopython Examples 1.6
Acknowledgements 1.7

2
Basics of Biopython

Biopython Tutorial for Python 3


Course material by Dr. Kristian Rother

with contributions by Allegra Via, Magdalena Rother and Olga Sheshukova.

What is Biopython?
Biopython is a Python library for reading and writing many common biological data formats.
It contains some functionality to perform calculations, in particular on 3D structures.

The library and documentation can be found at [Link].

License
This tutorial is distributed under the conditions of the Creative Commons Attribution
Share-alike License 4.0 (CC-BY-SA 4.0).

3
First Steps

First Steps in Biopython

Preparations
1. Start a Python console
2. Type import Bio

1. Load a sequence file


Load the FASTA file [Link] into Biopython.

from Bio import SeqIO

records = list([Link]("[Link]", "fasta"))


dna = records[0]

print([Link])
print([Link])
print([Link][:100])

Check whether the following statements are True or False :

The command print(len(dna)) displays the length of the sequence.


Replacing records[0] by records[1] results in a different sequence record.
Replacing [Link][:100] by [Link][50:100] displays a different portion of the
sequence.

2. Manipulating a sequence

4
First Steps

from [Link] import Seq


dna = Seq("ACGTTGCAC")
print(dna)

result = dna.__________()
print(result)
if result == 'GTGCAACGT':
print('OK')

Which of the following needs to be inserted to obtain GTGCAACGT ?

1. reverse_complement
2. transcribe
3. translate

3. Calculating GC-content
Look up Section 3.2 of the Biopython documentation on
([Link] to find out how to calculate the GC-
content of a sequence.

What is the GC-content of the sequence loaded in task 1?

55.556
46.875
33.514
50.000

4. Print annotation of a GenBank file


Load the GenBank file [Link] . In contrast to a FastA file, this one contains not only
the sequence, but a rich set of annotations. Load the file as follows:

records = list([Link]("[Link]", "genbank"))


dna = records[0]

Answer the following questions:

5
First Steps

4.1 Which command gives the species the sequence is


from?
print([Link]['species'])

print([Link]['organism'])

4.2 Which command produces the bigger ID number


(GenBank ID or PubMed ID)
print([Link]['gi'])

print([Link]['references'][0])

4.3 How can you view a list of available annotation fields?


print([Link]('keys'))

print([Link]())

5. Count atoms in a PDB structure


The following code reads the 3D structure of a tRNA molecule from the file [Link] and
counts the number of atoms.

There is a bug in the program. Execute the program. Identify the problem and fix it.

from Bio import PDB

parser = [Link]()
struc = parser.get_structure("tRNA", "[Link]")

n_atoms = 0
for model in struc:
for chain in model:
for residue in chain:
for atom in residue:
print([Link], [Link])
n_atoms += 1

print(n_atoms)

6. Retrieve entries from NCBI databases

6
First Steps

Use the following code to download identifiers (with the esearch web app) and protein
sequences for these identifiers (with the efetch web app) from the NCBI databases.

The order of lines got messed up! Please sort the lines to make the code work.

identifiers = records['IdList']

from Bio import Entrez

records = [Link]()

handle = [Link](db="protein", id=identifiers, rettype="fasta", retmode="text")

open("[Link]", "w").write(records)

searchresult = [Link](db="protein", term="hemoglobin", retmax=5)

records = [Link](searchresult)

[Link] = "krother@[Link]"

7
Using NCBI E-utilities

Using NCBI E-utilities

Using Entrez from Biopython


Step 1: import Entrez

from Bio import Entrez

Step 2: enter your e-mail


The NCBI server might block anonymous requests, especially big ones!

[Link] = "my@[Link]"

Step 3: Call esearch to find IDs

handle = [Link](db="value", term="keywords", retmax=100)

Parameters include:

parameter examples
db nucleotide

protein
pubmed

term human[Organism]

hemoglobin
hemoglobin AND alpha

retmax 10 (identifiers returned)

Step 4: get a list of IDs out of esearch

records = [Link](handle)
identifiers = records['IdList']

8
Using NCBI E-utilities

Step 5: use efetch to retrieve entries


We use the list of identifiers from step 4:

handle = [Link](db="value", id=identifiers, retmax="200",


rettype="fasta", retmode="text")
records = [Link](handle)

In addition to the above, parameters include:

parameter examples

id single id
rettype fasta
gb
retmode text
xml

Documentation:
You find a full list of available options on [Link]

Example URLs
1. Searching for papers in PubMed
[Link]
db=pubmed&term=thermophilic,packing&rettype=uilist

2. Retrieving publication records in Medline format


[Link]
db=pubmed&id=11748933,11700088&retmode=text&rettype=medline

3. Searching for protein database entries by keywords


[Link]
db=protein&term=cancer+AND+human

9
Using NCBI E-utilities

4. Retrieving protein database entries in FASTA format


[Link]

5. Retrieving protein database entries in Genbank format


[Link]

6. Retrieving nucleotide database entries


[Link]
db=nucleotide&id=9790228&rettype=gb

10
Diagnosing Sickle Cell Anemia

Project: Diagnosing Sickle Cell Anemia


Programming tasks with Biopython

Goal
Your goal is to develop an experimental test that reveals whether a patient suffers from the
hereditary disease sickle cell anemia. The test for diagnosis should use a restriction enzyme
on a patients DNA sample. For the test to work, you need to know exactly what genetic
difference to test against. In this tutorial, you will use Biopython to find out.

The idea is to compare DNA and protein sequences of sickle cell and healthy globin, and to
try out different restriction enzymes on them.

This tutorial consists of four parts:

1. Use the module [Link] to retrieve DNA and protein sequences from NCBI
databases.
2. Use the module [Link] to read, write, and filter information in sequence files.
3. Use the modules [Link] and [Link] to extract exons, transcribe and
translate them to protein sequences.
4. Use the module re to identify restriction sites.

Have fun!

What is sickle cell anemia?


At the beginning of the course, watch the 5-minute movie "Sickle Cell Anemia" by Paulo
Csar Naoum and Alia F. M. Naoum: [Link]

1. Retrieving DNA and protein sequences with


[Link]
1.1 Search identifiers on NCBI

11
Diagnosing Sickle Cell Anemia

Write Python code that searches for the cDNA sequence of the sickle cell globin protein from
NCBI. Use the [Link] function. As keywords, use sickle cell AND human NOT
chromosome. Print the resulting database identifiers (not the full sequences).

Use the NCBI examples from the back of this tutorial.

1.2 Retrieve sequences using identifiers


Use the identifiers from task 1.1, retrieve the full sequence with the [Link] function
from the NCBI server. The parameter rettype should be fasta.

Print the identifier and defline for each entry using a for loop.

1.3 Retrieve a single GenBank entry


In the output of task 1.2, locate the cDNA of the sickle cell globin manually. Copy the
identifier. Use the identifier to download the full GenBank entry only for that sequence with
efetch . Print the entry. The parameter rettype should be gb.

1.4 Write an output file


Save the GenBank entry from task 1.3 to a file [Link].

1.5 Retrieve and write multiple GenBank entries


Combine esearch and efetch to retrieve entries for the gene sequences of the human
globin family. Find appropriate keywords to limit the search to beta-globin and only complete
coding sequences. Write the outcome to a file.

Hint:
It is often more convenient to design the query in a browser window before moving to
Python.

1.6 Optional Exercises


Save the retrieved entries to a single FASTA file.
Save each of the beta-globin sequences to a separate GenBank file.
Use Entrez to search 100 recent references related to malaria and sickle cell anemia on
PubMed.

12
Diagnosing Sickle Cell Anemia

2. [Link]
Reading, writing, and filtering sequence files

2.1 Read a GenBank file


Read the [Link] file from task 1.4 using the [Link]() function:

from Bio import SeqIO

records = [Link](filename, format)

The first parameter of parse() is the filename, the format is genbank. Print the records
object.

Find out how to see the actual entries.

2.2 Print information for one sequence


Use the dir() function on a single record object to find out what attributes it has. Print the
id, name and description of the sickle cell globin entry.

2.3 Write a FASTA file


Save the GenBank entry from task 2.1 to a FASTA file using the [Link]() function:

[Link](records, file, format)

The first parameter of write() is a list of sequence records, the second a file open for
writing, and the third should be fasta.

2.4 Print information for multiple sequences


Print the id, name, and description of all human beta-globins.

Hint:
This is a great occasion to exercise string formatting, e.g. to obtain tabular outpus:

print("{:10s} {:7d}".format('Ada', 33))

13
Diagnosing Sickle Cell Anemia

2.5 Filtering sequence entries


Print the same information as in task 2.4, but do not show non-globin entries. If the
description contains either vector or isolate, dont print anything.

2.6 Optional Exercises


collected the entries matching all criteria in a new list
save the filtered list to a FASTA file
Filter the list of sequence entries even further using your own criteria

3. [Link] and [Link]


Working with sequences

3.1 The DNA sequence


Read the sequence of the sickle cell globin cDNA. Print the DNA sequence. Use the dir()
function to find out the name of the attribute.

3.2 Transcribe DNA to RNA


Transcribe the sickle cell cDNA sequence to RNA and print it. Use the transcribe() method
of a Seq object.

3.3 Translate RNA to protein


Translate the sickle cell RNA to a protein sequence and print it. Use the translate()
method of a Seq object.

Save the protein sequence to a separate file.

3.4 Analyze annotations of beta-globin


In the file with many globins, find the beta-globin entry with accession L26462 . Use the field
[Link]['accessions'] on a SeqRecord object to find it. Write the entry to a separate

GenBank file.

3.5 Extract sequence features

14
Diagnosing Sickle Cell Anemia

Print all features of the L26452 entry. Use the field [Link] on a SeqRecord object.

3.6 Extract exons


Print all exon features and their attributes start , end and nofuzzy_start , nofuzzy_end :

for feature in seq['features']:


print(feature)
...
# add printing attributes here

For each exon, extract the interval

feature[nofuzzy_start:nofuzzy_end]

Use the indices to extract portions of the complete sequence. Concatenate all exon
sequences to a single string.

3.7 Extract the beta-globin protein sequence


Transcribe and translate the concatenated exon sequence and print it.

3.8 Results
Print the sickle cell and healthy beta-globin sequence in subsequent lines or a text file. Also
print the two corresponding protein sequences in subsequent lines. What differences do you
see?

3.9 Optional Exercises


What are the N characters in the sickle cell globin cDNA? How did they affect the
transcription/translation?
Check in the documentation how to read an alignment of multiple sequences using
Biopython
Propose a PCR primer that specifically recognizes the sickle cell gene.

4. Pattern Matching
Identification of restriction sites

15
Diagnosing Sickle Cell Anemia

4.1 Familiarize with Regular Expressions


Do the first 3-4 exercises on the RegexOne website ([Link]

4.2 Search for a start codon


Use the [Link]() function to locate the start codon (ATG) in the cDNA sequence of
healthy beta-globin. The first parameter is a search pattern string, and the second is the
string to be searched:

import re

match = [Link]('ATG', sequence)


if match:
print([Link], [Link])

4.3 Search for a restriction site


Create a regular expression using the [Link]() function for the restriction enzyme DdeI
(cuts at NN^CTNAG ). Search with a regular expression in both sickle cell and beta-globin DNA
sequences.

For simplicity copy-paste both sequences to string variables in your program.

If the search method returns a match, print the start and stop found in both DNA sequences.

4.4 Try more restriction enzymes


Test patterns for the restriction sites of:

HinfI (GTNNAC)
BceAI (ACGGCNNNNNNNNNNNNN)
BseRI (GAGGAGNNNNNNNNNN)
EcoRI (GAATTC)
MstII (CCTNAGG)

on both DNA sequences. Which restriction enzyme could you use to specifically identify
carriers of the sickle cell anemia gene?

Optional Exercises
Take a look at the website Regex101
To facilitate the restriction analysis, replace the N's in the sickle cell DNA by the

16
Diagnosing Sickle Cell Anemia

corresponding positions from the healthy DNA. Print the resulting DNA sequence.

17
BLAST

Python BLAST Tutorial

Overview
In this tutorial, you will automate BLAST queries with Python. You will learn how to run
BLAST locally, multiple times, and how to read BLAST results with Python. In the
process, you will build a program pipeline, a concept useful in many biological analyses
independent of BLAST.

The tutorial consists of six parts:

1. Preparations
2. Running local BLAST manually
3. Running local BLAST from Python
4. Running BLAST many times with Python
5. Reading BLAST output with Biopython
6. Plotting the results

Case Study: Plasmodium falciparum


We have the hypothesis that Plasmodium falciparum has adapted to the human organism
during its long history as a parasite. Specifically, we want to examine whether proteins from
Plasmodium are more similar to human proteins than one would expect. If this is true, we
could interpret e.g. that more similar proteins help Plasmodium to evade the human immune
system.

As a small sample study, we will BLAST a set of peptides from a few Homo sapiens proteins
against the proteome of Plasmodium falciparum. As a control, we will use the proteome of
Schizosaccharomyces pombe.

1. Preparations
1.1 Check whether BLAST+ is properly installed
Enter the two following commands in a Linux console:

18
BLAST

makeblastdb
blastp

Both should result in an error message other than command not found.

1.2 Create a BLAST database for Plasmodium falciparum


Create a BLAST database for the Plasmodium proteins. First, open a console and go to the
folder data/ . Type:

makeblastdb -in Plasmodium_falciparum.fasta -dbtype prot

You should see a message similar to:

Adding sequences from FASTA; added 5414 sequences in 0.56993 seconds.

1.3 Create a BLAST database for the control organism


Please create a BLAST database for Schizosaccharomyces pombe as well.

1.4 Questions
What files have appeared in the data/ directory?
Why do we need to create a database first? Why can't BLAST do that right before each
query?

2. Running local BLAST manually


Before running a large series of BLAST experiments, we will run a small sequence as a
technical proof of concept. We are using a sequence copied from the Plasmodium
sequences, so we know that BLAST should generate a 100% match.

2.1 Create a query file


Create an empty file [Link] in a text editor. Write the following peptide sequence into the
file:

19
BLAST

DAAITAALNANAVK

Make sure that there are no other characters in the file (no empty lines or FASTA deflines).
Save the file to the data/ directory.

2.2 Running local BLAST against Plasmodium


Go to a console in the data/ directory and type:

blastp -query [Link] -db Plasmodium_falciparum.fasta -out [Link] -outfmt 7

2.3 Running local BLAST against the control group


Repeat the above query for Schizosaccharomyces pombe.

2.4 Adjust output formats


Insert different numbers (1-7) for the outfmt parameter and re-run the query.

2.5 Questions
Take a look at the BLAST output. Is the result what you would expect?
Does the control group support your assumptions so far?
Which of the output formats do you find the easiest to read?
Which of the output formats is probably the easiest to read for a program?

3. Running local BLAST from Python


Now we are going to do exactly the same operation from a Python program. For this we will
need the os module.

3.1 Introduction to the os module


Open the document pipelines/os_module_puzzle.pdf. Do the exercise.

3.2 Running BLAST from Python

20
BLAST

Now we will use the function [Link] to run BLAST. Create a Python script run_blast.py
in the data/ directory. Write the following commands into it:

import os

cmd = "blastp -query [Link] -db Plasmodium_falciparum.fasta -out [Link] -outfmt


7"
[Link](cmd)

Execute the program.

3.3 Customizing the query


In order to make the BLAST command in Python more flexible, we will combine it from
variables. Change the code to the following:

db = "Plasmodium_falciparum.fasta"
cmd = "blastp -query [Link] -db " + db + " -out [Link] -outfmt 7"

3.4 More variables


Now add separate variables for the query and the output file name as well.

3.5 Additional examples for using os


In the pipelines/ directory you find more examples using the os module. If you like, try them
out as well.

3.6 Questions
Is the output of the Python BLAST run identical to the one you did manually? How can
you check that?

4. Running BLAST many times with Python


4.1 Creating query files
The file data/human_peptide.fasta contains about 2000 peptides. We want to run BLAST for
each of them. To do so, we need to write each peptide to a separate file.

21
BLAST

First, create a new folder for the query files:

mkdir data/queries

The Python script multiblast/split_fasta.py does that using [Link]. You can use it by
typing in the multiblast/ directory:

python split_fasta.py ../data/human_peptide.fasta ../data/queries

If you want, you can try writing that script by yourself.

4.2 Validate the queries


Make sure that the query files have been generated and that they are not empty. You can
check both with:

ls -l data/queries
more data/queries/9568103_99.fasta

4.3 Create output directories


Prepare a place where the results from each BLAST run will be stored:

mkdir data/Plasmodium_out
mkdir data/Pombe_out

4.4 Run BLAST


You can run BLAST for all queries with the script multiblast/run_blast.py. It uses os for
three different things:

1. Reading directory names as command-line parameters


2. Looping through all files in a directory
3. Running the BLAST command

However, the program is incomplete.

You need to complete the BLAST command inserting the file names from the given
variables. Use the parameter -outfmt 5 in order to create XML output. We will need this later
to read it from Biopython.

When everything is done, you should be able to execute the script with:

22
BLAST

python run_blast.py ../data/queries/ ../data/Plasmodium_falciparum.fasta ../data/Plasm


odium_out/

Inspect the result.

5. Reading BLAST output with Biopython


5.1 Reading XML data
Run the program BLAST_XML/parse_blast_xml.py.

python parse_blast_xml.py

5.2 Read one of your BLAST result files


Adjust the program to read one of your BLAST output files. Try to figure out how many HSPs
there are, and how many are below an e-value threshold of 0.001.

5.3 Read all of your BLAST result files


Customize the program to read all of your result files. How many hits do you have in total.
What is the hit with the highest score?

References
BLAST+ is a new, faster (C++ based) version that replaces BLAST2, as of Oct 2013. Also
see: [Link]
CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=Download

23
Biopython Examples

Biopython Examples

1. Getting started
import Bio
from [Link] import Seq
dna = Seq("ACGTTGCAC")
print(dna)

(alternative)

from [Link] import IUPAC


dna = Seq("AGTACACTGGT", IUPAC.unambiguous_dna)

2. Reverse complement, transcribing &


translating
dna.reverse_complement()
rna = [Link]()
[Link]()

(alternative)

from [Link] import reverse_complement, transcribe, translate


reverse_complement("GCTGTTATGGGTCGTTGGAAGGGTGGTCGTGCT")

3. Calculating GC-content
from [Link] import GC
GC(dna)

4. Caculating molecular weight (DNA only)

24
Biopython Examples

from [Link] import molecular_weight


molecular_weight("ACCCGT")

5. Loading sequences from a FASTA file


from Bio import SeqIO
for record in [Link]("ls_orchid.fasta", "fasta"):
print [Link], len([Link])

6. Plotting a histogram of seq lengths with


pylab
pylab aka matplotlib needs to be installed separately.

import pylab
sizes=[len([Link]) for r in [Link]("ls_orchid.fasta","fasta")]
[Link](sizes, bins=20)
[Link]("%i orchid sequences\nLengths %i to %i" \
% (len(sizes), min(sizes), max(sizes)))
[Link]("Sequence length (bp)")
[Link]("Count")
[Link]()

25
Acknowledgements

Authors
2015 Kristian Rother (krother@[Link])

This document contains contributions by Allegra Via, Magdalena Rother and Olga
Sheshukova. I would like to thank Pedro Fernandes, Janick Mathys, Janusz M. Bujnicki and
Artur Jarmolowski for their support during the courses in which the material was developed.

License
Distributed under the conditions of a Creative Commons Attribution Share-alike License 3.0.

26

Common questions

Powered by AI

To diagnose sickle cell anemia using restriction enzymes in Biopython, identify the genetic difference by retrieving and comparing DNA sequences of sickle cell and healthy beta-globin using Bio.Entrez and Bio.SeqIO . Use the re module to match restriction sites, like DdeI, in these sequences by creating a regular expression pattern for the enzyme's recognition site and searching each DNA . The presence or absence of specific restriction sites can distinguish normal from mutated sequences .

To differentiate sickle cell from normal globin sequences using Biopython, first retrieve the sequences with Bio.Entrez. Then, read and parse these with Bio.SeqIO or Bio.SeqRecord . Next, analyze for specific allelic variations linked to sickle cell anemia using pattern matching to identify differences. Additionally, transcribe these sequences to RNA and translate them to proteins to verify phenotypic expression .

To retrieve DNA and protein sequences from NCBI using Bio.Entrez, you need to follow these steps: First, import Entrez from Bio.Entrez and set your email to avoid blocking by the NCBI server . Next, use Entrez.esearch to find IDs by specifying the database (db) and search terms (term), then read these IDs with Entrez.read to create an ID list. Finally, use Entrez.efetch with these IDs to retrieve sequence entries in the desired format such as 'fasta' or 'gb' .

When using BLAST to compare protein sequences between Plasmodium falciparum and human proteins, a primary challenge is generating databases for each organism's proteome to ensure accurate and efficient querying, since BLAST can't create databases on-the-fly . Also, results might be confounded by the inherent similarity of Plasmodium proteins to the host, impacting interpretations about immune evasion mechanisms. Moreover, technical considerations include handling different file formats for both input and output to facilitate downstream analysis .

To automate multiple BLAST queries, write Python scripts using the os module to run the BLAST commands for each query file systematically. First, split the large input sequence into individual files . Then, use a loop to execute BLAST on each file, directing output to specific result directories . This automation is advantageous for handling large datasets as it reduces manual errors, improves efficiency, and allows easy scaling to handle hundreds or thousands of sequences, facilitating comprehensive analysis faster than manual BLAST entry .

When filtering sequence records from a GenBank file with Biopython, consider attributes like ID, description, and sequence type, using conditions to exclude unwanted records. For instance, to analyze globin entries, filter out records with descriptors like 'vector' or 'isolate' . It’s crucial to verify that data is not over-filtered to avoid omitting relevant entries. Properly formatted filtering and output also facilitate downstream data consumption .

Regular expressions simulate restriction site recognition by defining patterns corresponding to enzyme cut sites, such as DdeI which cuts at NN^CTNAG . Using re.compile and re.search, you can efficiently locate these patterns in DNA sequences, allowing for automation of recognition processes. This approach benefits bioinformatics by enabling rapid, repeatable detection of restriction sites across large DNA datasets, crucial for applications in cloning and diagnostics .

Validating query files before running them through BLAST ensures each file is correctly formatted, non-empty, and without errors that could cause the BLAST process to fail or yield incorrect results. In Python, validation involves verifying file existence, ensuring adequate sequence content, and checking file size to confirm non-zero content, all achievable through commands like ls -l for listing file details and simple file read checks for content confirmation .

Setting the email parameter in Biopython's Entrez module is crucial as it identifies the user to the NCBI server. This is important because the NCBI blocks anonymous requests, especially large ones. Having the email parameter set ensures that the user's requests are not blocked and complies with NCBI usage policies .

To extract exons using Biopython, first parse the DNA entry with Bio.SeqIO to access individual SeqRecord objects. Then use the r.features property to isolate features labeled as exons . Record the start and end positions of these features and extract the interval from the complete sequence. This process not only provides the exon sequences but also metadata on exon structure, such as exact genomic locations and potential functional annotations .

1.1
1.2
1.3
1.4
1.5
1.6
1.7
Table of Contents
Basics of Biopython
First Steps
Using NCBI E-utilities
Diagnosing Sickle Cell A
Biopython Tutorial for Python 3
Course material by Dr. Kristian Rother
with contributions by Allegra Via, Magdalena Rother an
First Steps in Biopython
Preparations
1. Start a Python console
2. Type  import Bio 
1. Load a sequence file
Load the FASTA f
from Bio.Seq import Seq
dna = Seq("ACGTTGCAC")
print(dna)
result = dna.__________()
print(result)
if result == 'GTGCAACGT':
4.1 Which command gives the species the sequence is
from?
 print(dna.annotation['species']) 
 print(dna.annotations['organism
Use the following code to download identifiers (with the  esearch  web app) and protein
sequences for these identifiers (with
Using NCBI E-utilities
Using Entrez from Biopython
Step 1: import Entrez
from Bio import Entrez 
Step 2: enter your e-mail
Th
Step 5: use efetch to retrieve entries
We use the list of identifiers from step 4:
handle = Entrez.efetch(db="value", id=iden
4. Retrieving protein database entries in FASTA format
http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=protein&id

You might also like