100% found this document useful (1 vote)
96 views267 pages

Support Material

bio

Uploaded by

Ishvarya
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd
100% found this document useful (1 vote)
96 views267 pages

Support Material

bio

Uploaded by

Ishvarya
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd

SUPPORT

STUDY
MATERIAL

XII Biology

Support
Material,
HOTS and VBQ
Class-XII
Biology (Theory)
Design of the Question Paper
Maximum Marks : 70 Time : 3 hours

The weightage of the distribution of marks over different dimensions of the


question paper shall be as follows :
C DE FGH
J KL 55T U
WX Y Z [ \
^_ `a bc
efg hi j
lmn opq
stu v w x
z{|} ~


































Weightage of Contents / Subject Units

Units Content Mark


VI Reproduction 14

VII Genetics and Evolution 18


VIII Biology and Human Welfare 14
IX Biotechnology and its application 10
X Ecology and Environment 14

Total 70
0 Weightage of Different Form of Questions
[Link]. Form of Questions Marks No. of Total
for each Questions Marks
1. Very Short Answer (VSA) 1 8 08
2. Short Answer (SA II) 2 10 20
3. Short Answer (SA I) 3 09 27
4. Long Answer (LA) 5 3 15

Total 30 70

0 Scheme of Option
1. Three will be no overall option.

2 XII Biology
0.0 Internal choice (either/or type) on a very selective basis has been
provided. The choice has been given in one question of 2 marks, one
question of 3 marks and all the three questions of 5 marks weightage.
0 Weightage to difficulty level of questions
S. No. Estimated Difficulty Level Percentage
1. Easy 15
2. Average 70
3. Difficult 15

About 20% weightage has been assigned to questions testing higher order
thinking skills of learners.

3 XII Biology
CONTENTS

S. No. Chapter Page


1. Reproduction in Organisms 5

2. Sexual Reproduction in Flowering Plants 9

3. Human Reproduction 16

4. Reproductive Health 24

5. Principles of Inheritance and Variation 29

6. Molecular Basis of Inheritance 35

7. Evolution 44

8. Human Health and Disease 50

9. Strategies for Enhancement in Food Production 58

10. Microbes in Human Welfare 64

11. Biotechnology : Principles and Processes 70

12. Biotechnology and Its Applications 78

13. Organisms and Populations 85

14. Ecosystem 93

15. Biodiversity and Conservation 99

16. Environmental Issues 106

Model Papers 112

4 XII Biology
CHAPTER 1

REPRODUCTION IN ORGANISMS

POINTS TO REMEMBER
Bulbils : These are small, fleshy buds which develop into new plants as in
Agave.
Clone : A group of organism derived from a single individual and hence
morphologically and genetically similar.
Embryogenesis : The process of development of embryo from zygote.
Gametogenesis: The process of formation of male and female gametes.
Isogamete : One of a pair of conjugating gametes.
Juvenile Phase : It is the period of growth before maturity when sex organs are
not functional.
Meiocytes : These are specialized cells of diploid organisms which undergo
meiosis.
Pericarp : It is the protective covering of fruit, may be divided into epicarp,
mesocarp and endocarp.
Parthenogenesis : Development of an egg into an embryo without fertilisation.

5 XII Biology
Gamete Transfer
0 In Algae,
Bryophytes and Pteridophytes : The male and female gametes are
flagellated and motile, need a medium (water) to reach the egg.

1 In seed Plants :
Pollen grains are transferred to stigma of flower of same species by various
agents.

2 In
animals :
2.0 By Copulation e.g., Reptiles, Birds and Mammals.
2.1 By External medium e.g., Fishes and Amphibians.

QUESTIONS

VSA (1 MARKS)

0 Offsprings produced by asexual reproduction are referred to as clones.


Why?
1 Name the most invasive aquatic plant weed which is called as Terror of
Bengal.
2 How does Zygote usually differ from Zoospore in terms of ploidy?
3 Mention the main difference between the offspring produced by asexual
reproduction and progeny produced by sexual reproduction.
4 Which characteristic property of Bryophyllum is exploited by gardeners and
farmers?
5 Higher organism have resorted to sexual reproduction inspite of its
complexity. Why?
6 Tapeworms posses both male and female reproductive organs. What is the
name given to such organism? Give two more examples of such organisms.
7 Study the relationship between first two words and suggest a suitable word
for fourth place.
0 Male flower : Stamens :: Female Flower : .............................
1 Birds : oviparous :: Primates : .............................
2 Chlamydomonas : Zoospores :: Penicilium : .............................
3 Ginger : Rhizome :: Agave : .............................
6 XII Biology
23 Bryophytes and Pteridophytes produce a large number of male gametes but
relatively very few female gametes. Why?
24 Mention the site of zygote formation in the ovule of a flowering plant. What
happens to sepals, petals and stamens after fertilisation? State the fate of
zygote, ovule and ovary in these plants.
25 Distinguish between gametogenesis and embryogenesis.
26 Fill the blank spaces a, b, c, and d given in the following table.

Organism Organ Gamete

a Testes Spermatozoa
Human female b Ovum
Plant (Angiosperm) c Pollen grains
Plant (pteridophytes) antheridium d

LA (5 MARKS)

23 (a) Distinguish between asexual and sexual reproduction. Why is vegetative


reproduction also considered as a type of asexual reproduction?
23 Which is better mode of reproduction : Sexual or Asexual? Why?
23 Because offsprings produced by Asexual reproduction is morphologically
and genetically identical to parent.
24 Water hyacinth (Eicchornia)
25 Zygote diploid, zoospore haploid.
26 Offspring produced by asexual reproduction are genetically similar while
progeny produced by sexual reproduction exhibit genetic variation.
27 Adventitious bud arising from margin of the leaf.

LA (II 2 MARKS)

23 Because of variations, gene pool, Vigour and Vitality and Parental care.
24 Hermaphrodite; Examples : Earthworm, Leech.
8. (a) Carpel (b) Viviparous
(c) Conidia (d) Bulbil

7 XII Biology
23 Because male gemete need medium (water) to reach egg/female gamete. A
large number of the male gametes fail to reach the female gamete.

LA I (3 MARKS)

0 Embryo sac
Sepals, Petals and Stamens dry and fall off. Zygote develops into embryo.
Ovule develops into seed and ovary into fruit.

11. Gametogenesis Embryogenesis


1. Formation of gametes 1. Formation of embryo
2. Produces haploid gametes 2. Embryo is diploid
3. Cell division is meiotic 3. Cell division is mitotic.

12. a = Human male b = ovary


c = Anther d = Antherozoid
13. (a)

Asexual Reproduction Sexual Reproduction


(i) Uniparental (i) Biparental
(ii) Gametes are not involved (ii) Gametes are involved
(iii) Only mitotic division takes (iii) Meiosis at the time of gamete
place formation and mitosis after
fertilisation
(iv) Offspring genetically (iv) Offspring different from parent.
similar to parent

Vegegative propagation takes plce when new individuals arise from


vegetative part of parent and have characters similar to that of parent
plant.
0 Sexual reproduction introduces variations in offsprings and has
evolutionary significance. It helps offsprings to adjust according to the
changes in environment. It produces better offsprings due to character
combination.

8 XII Biology
CHAPTER 2

SEXUAL REPRODUCTION IN
FLOWERING PLANTS

POINTS TO REMEMBER
Autogamy : When pollen grains of a flower are transferred from anther to stigma
of the same flower.

Coleorhiza : A protective sheath of radicle in monocot seed.

Coleoptile : A protective sheath of plumule in monocot seed.

Endothecium : A fibrous layer in the anther next to epidermis.

Geitonogany : Self pollination between flowers of the same plant.

Micropyle : A small pore in the ovule through which the pollen tube enters.

Nucellus : Multicellular tissue in the centre of ovule where embryo sac is


present.

Tapetum : Inner most layer of cells in pollen sac which provide nutrition to
developing pollen grains

Viability of Seed : Ability of seed to retain the power of germination.


0























Microsporangium (Pollen sac) :

Outermost layer = Epidermis Second

layer = Endothecium Middle layer =

2 4 layers of cells

Innermost layer = Tapetum [Nourishes the developing Pollen grains


(Microspores)]









Microsporogenesis :
Process of formation of microspores from a pollen mother cell

9 XII Biology
0 Megasporogenesis Process of formation of megaspore from the mega
spore mother cell.

1 Megasporangium (Ovule) :
The ovule is a small structure attached to the placenta by means of a stalk
called funicle.
The point of attachment of the body of the ovule to the funicle is known as
hilum. The main body of the ovule is composed of paranchymatous
cells known as nucellus.
Each ovule has one or two protective integument, which encircle the ovule
except at the tip having small opening called micropyle.
Opposite to micropylar end, is chalaza.

Generally a single embryosac or female gametophyte located in nucellus.

Cells of nucellus have abundant reserve food material and provide


nourishment to the developing embryo.
2 Female gametophyte (Embryoa sac) : In a majority of flowering plant one
of the megaspore is functional while other three degenerate.
The functional megaspore develops in embryo sac.
The nucleus of the functional megaspore (n) undergoes three successive
mitotic cell division which results the formation of eight nucleate stage
of embryo sac (free nuclera division)
The cell wall formation starts at eight nuclear stages. Three cells are
grouped together at micropylar end to form the egg apparatus (2

10 XII Biology
synergids + 1 egg cell).
Three cells are grouped at chalazal end, called antipodal cells.
The remaining 2 nuclei are called polar nuclei move to the centre of
embryo sac, called central cell.
Thus typical angiospermic embryo sac at maturity is 8 nucleated and 7
celled.
0 Pollen pistil interaction
The pistil has the ability to recognize the pollen, whether it is or right type
(Compatible) or of the wrong type (incompatible).
If it is compatible, the pistil accepts the pollen.
The pollen grains germinate on stigma to produce tubes. The contents of
the generative cell (or the two male gametes in those species whose
pollen is liberated in the three celled stage).
Pollen tube grows through the tissue of stigma and style by secreting
enzyme and enters the ovule.
1 Double Fetilisation : The pollen tube releases two male gamete into the
cytoplasm of synergid
Syngamy : One male gamete + Egg cell _ Zygote (2n)
Triple Fusion : Second male gamete + 2 polar nuclei _ PEN (3n)
2 Post Fertilisation events : (i) Endosperm and embryo development (ii)
Maturation of ovule and ovary

Ovary Fruit (2n)


Ovary wall Pericarp (2n)
Ovule Seed (2n)
Outer Integument Testa (2n)
Inner Integument Tegmen (2n)
Zygote Embryo (2n)
Primary Endosperm cell Endosperm (3n)

Embryo formation starts after certain amount of endosperm is formed


Zygote Pro-embryo Globular embryo Heart shaped embryo
Mature embryo

11 XII Biology
0 Dicot Embryo : A typical dicot embryo consist of an embryonal axis and two
cotyledons. The portion of embryonal axis above the level of cotyledons is
the epicotyle which terminates with the plumule or stem tip.
The portion below the level of cotyledons is hypocotyl that terminates at its
lower end in the radicle or root tip.
Monocot Embryo : Monocot (Rice, Maize etc.) has one cotyledon called
Scutellum. The embryonal axis has the radicle and root cap enclosed by a
sheath called Coleorrhiza.
The upper end (epicotyle) has plumule which is covered by hollow folder
sturcture, the coleoptile.
Apomixis : Apomixis is a form of asexual reproduction that mimics sexual
reproduction where seed are formed without fertilisation.
Polyembryony : Occurance of more than one embryo in a seed. e.g.
Orange, lemon, onion, mango, ground nut.
Reasons : More than one egg may be formed in the embryo sac. More than
one embryo sac may be formed in an ovule.

QUESTIONS
VSA (1 MARK)
0 In a young anther, a group of compactly arranged homogenous cells were
observed in the centre of each microsporangium. What is the name given to
these cells?
1 Give the scientific name of a plant which came to India as a contaminant
with imported wheat and causes pollen allergy.
2 Pollen grains of water pollinated species have a special characteristics for
protection from water. What is that?
3 Why are pollen grains produced in enormous quantity in Maize?
4 In same species of Asteraceae and grasses, seed are formed without fusion
of gametes. Mention the scientific term for such form of reproduction.
5 Arrange the following in correct developmental sequence :
Male gamete, Potential pollen mother cell, sporogenous tissue, Pollen
grains, Microspore tetrad.
6 If the diploid number of chromosomes in an angiospermic plant is 16.
Mention number of chromosomes in the endosperm and antipodal cell.

12 XII Biology
SA-II (2 MARKS)

0 In angiospermic plant before formation of microspore sporogenous tissue


undergo cell division
0.512 Name the type of cell division.
0.513 What would be the ploidy of the cells of tetrad?
1 Outer envelop of pollen grain made of a highly resistant substance. What is
that substance? At which particular point the substance is not present?
2 Fruits generally develops from ovary, but in few species thalamus
contributes to fruit formation.
2.512 Name the two categories of fruits.
2.513 Give one example of each.
3 Among the animal, insects particularly bees are the dominant pollinating
agents. List any four characteristic features of the insect pollinated flower.
4 Differentiate between geitonogamy and xenogamy.
5 In the given figure of a dicot embryo, label the parts (A) and (B) and give
their function.

0Name the parts A, B, C and D of the anatropous ovule (Figure 2) given above.
1Given below is an incomplete flow chart showing formation of gamete in
angiospermic plant. Observe the flow chart carefully and fill in the blank A, B,
C and D.

13 XII Biology
16. Name the blank spaces a, b, c and d is the table given below :
Item What it represents in the plant
(i) Pericarp a
(ii) b Cotyledon in seeds of grass family
(iii) Embryonal axis c
(iv) d Remains of nucellus in a seed.

0 Even though each pollen grain has two male gametes. Why are at least 10
pollen grains and not 5 pollen grains required to fertilise 10 ovules present in
a particular carpel?

SA-I (3 MARKS)

0 Continued self pollination lead to inbreeding depression. List three devices,


which flowering plant have developed to discourage self pollination?
1 What will be the fate of following structures in the angiospermic plant? Ovary
wall, Ovule, zygote, outer integument Inner integument and primary
endosperm nucleus.
2 Differentiate between microsporogenesis and megasporogenesis. What type
of cell division occurs during these events. Name the structure formed at the
end of these two events.

14 XII Biology
LA (5 MARKS

21. Draw the embryo sac of a flowering plants and label :


(a) (i) Central Cell (ii) Chalazal end (iii) Synergids
0 Name the
cell that develops into embryo sac and explain how this cell leads to
formation of embryo sac.
1 Mention the
role played by various cells of embryo sac.
2 Give the
role of filiform apparatus.

ANSWERS
0 Sporogenous tissue
1 Parthenium
2 Presence of mucilagenous covering
3 To ensure pollination because Maize is pollinated by wind.
4 Apomixis
5 Sporogenous tissue Potential pollen mother cell microspore tetrad
Pollen grain male gamete.
6 24 Chromosomes in endosperm and 16 chromosomes in antipodal cell.

SA - II (2 MARKS)

8. (a) meiosis division (b) haploid


0 Sporopollenin; at germpore sporopollenin is absent.
1 Two categories of fruits are :
0 True fruits e.g., Mango
1 False fruit e.g., Apple
2 1. Flowers are large.
0 Colorful petals of flower.
1 Presence of fragrance.
2 Rich in nectar.
15 XII Biology
12.

Geitonogamy Xenogamy

0 Transfer of pollen grains from Transfer of Pollen grains from


the another to stigma of another to stigma of defferent
another flower of the same plant.
plant
2. Does not provide opportunity Provide opportunity for gametic
for gametic recombination. recombination.

0 A = Plumule To form shoot system B


= Cotyledons Storage of food
1 A = Micropyle, B = Outer integument, C = Nucellus, D = Emnbryo sac
2 A = Ovule/megasporangium, C = Tapetum
B = Megaspore mother cell, D = Pollen grains
3 a = wall of fruit, b = scutellum, c = shoot and root tip, d = perisperm
4 Because only one male gamete is involved in syngamy. ie fursionof male
gamete with egg cell.

SA - I (3 MARKS)

0 (a) Release of pollen and stigma receptivity is not synchronised in some


species
0 Anther and stigma are at different position/heights in some plants
1 Self-incompatibility a genetic mechenism.
1 Ovary wall = Pericarp ; Ovule = Seed,
Zygote - Embryo; Outer integument = Testa;
Inner integument = Tegmen; Primary endosperm nucleus = Endosperm.
0 Microsporogenesis Process of formation of microspore from a Pollen
mother cell.
Megsporogenesis Process of formation of megaspore from megaspore
mother cell.
Meiotic division in both

16 XII Biology
Microsporogenesis results in the formation of pollen grain while
megasporogenesis results in the formation of megaspore.

LA (5 MARKS)

0 A. Refer to figure 2.8(c) page 26 NCERT book.


0.0 Functional Megaspore, Refer text on page 27 NCERT book.
0.1 Egg : Fuses with male gamete to form zygote or future embryo
Synergid : Absorption of nutrient, attract and guides pollen tube.
Central Cell : After fusion with second male gamete forms Primary
endosperm cell which gives rise to Endosperm
0.2 Guides the entry of pollen tube.

17 XII Biology
CHAPTER 3

HUMAN REPRODUCTION

POINTS TO REMEMBER
Acrosome : A small, sheathy structure at the end of a sperm.
Blastula : A stage of embryogendesis which comes after morula and has a
hollow fluid filled space called blastocoel.
Endometrium : Innermost glandular layer lining the uterine cavity.
Foetus : An advanced stage of embryo within the uterus.
Gestation Period : A period between fertilisation of ovum and the birth of a baby.

Hymen : A thin membrane partially covering the vaginal aperture. Implantation :


Fixing of embryo/fertilized egg in uterus. It leads to pregnancy. Menarche : The
beginning of first menstruation in female on attaining puberty.
Menopause : Permanent cessation of menstrual cycle in female. It occurs
between the age 45 to 50 years in human female.
Oogenesis : Formation and development of ova in ovary.
Ovulation : Process of release of mature ovum (Secondary oocyte) from the
ovary.
Parturition : Process of delivery of the foetus (Child birth).
Puberty : A stage at which immature reproductive system of boy or girl becomes
mature.
Scrotum : A muscular pouch which houses two testes.

Spermiation : A process by which spher matozora are released from the


sominiferous tubules.

Spermatogenesis : Process of formation of sperm from malegerm. cell in the


testes.

18 XII Biology
19 XII Biology
Fertilisation : Process of fusion of sperm with ovum

Site of fertilisation in human female : Ampullary isthmic junction

Secretion of acrosome helps the sperm entry into cytoplasm of ovum through
zona pellucida and plasma membrane. Sperm entry induce the completion of the
2nd meiotic division of secondary oocyte.

Placenta : An intimate connection between foetus and uterine wall of the mother
to exchange materials.
Function of Placenta : Nutrition, Respiration, Excretion, as barrier, Endocrine
function.
Placenta as Endocrine tissue : Placenta Produces several hormones such as
Estrogen, hCG, hPL, Progesterone and relaxin (in late phase of pregnancy).

Embryonic Development : at various month of Pregnancy After1 month =


Heart, 2 months = Limbs and digits, 3 months = External genital organ, 5 months
= First movement, 6 months = body covered with fine hairs, eye lid, eye lashes, 9
months = Fully developed and ready for delivery.

VSA (1 MARK)
0 Failure of testes to descend into scrotal sacs leads to sterility. Why?
1 Both vaccine and colostrum produce immunity. Name type of immunity
produced by these.
2 How many sperms will be produced from 10 primary spermatocytes and how
many eggs will be produced from 10 primary oocytes?

20 XII Biology
0 The spermatogonial cell has 46 chromosomes in human male. Give the
number of chromosomes in
(a) Primary spermatocyte (b) Spermatid
23 In ovary which structure transforms as corpus luteum and name the
hormone secreted by corpus luteum?
24 Each and every coitus does not results in fertilisation and pregnancy.
Justify the statement.

VSA-II (2 MARKS)
23 Give the function of
(a) Corpus luteum (b) Endometrium
8. In the given figure, give the name and functions of parts labelled
A and B.

0 Given below is an incomplete flow chart showing influence of hormone on


gametogenesis in male, observe the flow chart carefully and fill in the blank
A, B, C and D.

21 XII Biology
0 Give reason for the following :
0 The first half of the menstrual cycle is called follicular phase as well as
proliferative phase.
1 The second half of the menstrual cycle is called luteal phase as well as
secretory phase.
1 What is meant by L.H. Surge? Write the role of L.H.
2 Explain significance of the condition in which the testes remain suspended in
scrotum outside the abdomen.

SA-I (3 MARKS)
0 Mention the name and role of hormones which are involved in regulation of
gamete formation in human male.
1 Three of the steps of neuro endocrine mechanism in respect of parturition
are mentioned below.
Write the missing steps in proper sequence.
0 Signals originate from fully developed foetus and placenta.
1 ______________________________.
2 ______________________________.
3 Oxytocin causes strong uterine contraction
4 Uterine contraction stimulates further secretion of oxytocin.
5 ______________________________.

2 The events of the menstrual cycle are represented below. Answer the
following questions.

0 State the levels of FSH, LH and Progesterone simply by mentioning


high or low around 13th and 14th day and 21st to 23rd day.

22 XII Biology
0 In which of the above mentioned phases does egg travel to fallopian
tube?
1 Why there is no mensuration after fertilisation?
0 (a) Read the graph given below. Correlate the ovarian events that take place
in the human female according to the level of the pituitary hormone during
the following day.

(i) 10th 14th days (ii) 14th 15th days


(iii) 16th 23th days (iv) 25th 29th days
(If the ovum is not fertilised)
0.0 What are the uterine events that follow beyond 29th day if the ovum is
not fertilised?
0 T.S. of mammalian testis revealing seminiferous tubules show different types
of cell.
0 Name the two types of cells of germinal epithelium.
0 Name of cells scattered in connective tissue and lying between
seminiferous tubules.
Differentiate between them on the basis of their functions.

LA (5 MARKS)
18.

23 XII Biology
Study the figure given :
0 Pick out and name the cells that undergo spermiogenesis.
1 Name A and C cells.
2 Give ploidy of B and E
3 What are the cells marked as F? Mention their function.
4 Mention the type of cell division in A and B.

ANSWERS

VSA (1 MARKS)

0 High temperature of abdomen kills the spermatogenic tissue of the testes, so


no sperm are formed.
1 Vaccine Active immunity Colostrum Passive immunity.
2 40 sperms, 10 eggs.
3 (i) 46 in Primary spermatocyte
0 23 in spermatid.
4 Follicular cells of empty Graafian follicle.
Progesterone.
0 Ovum and sperm should reach simultaneously to the ampullary - isthmic
junction.

SA-II (2 MARKS)

23 Corpus luteum : It secretes progesterone which prepares endometrium of


uterus for implantation and normal development of foetus.
Endometrium : It undergoes cyclic changes during menstrual cycle and
prepares itself for implantation of blastocyst.
24 A = Trophoblast Gets attached to endometrium and draws nutritive
material secreted by uterine endometrium gland.
B = Inner cell mass Differentiates as Embryo.
25 A = Testosterone; B = Spermatogenesis C
= Sertoli cells; D Spermiogenesis

24 XII Biology
768 (a) During this phase, primary follicles transform into Graafian follicle under
FSH stimulation. Graafian follicles secrete estrogens with stimulate
enlargement of Endometrium of uterus.
768.0 During this phase, Corpus luteum is fully formed and secretes
large quantity of Progestrone.
769 Refer page 51 NCERT book
770 Refer page 43 NCERT book.

SA-1 (3 MARKS)

0 GnRH : Stimulates adenophysis to secrete gonadotrophins.


GSH : Stimulates Sertoli cells to secrete factors while help in
spermatogenesis.
ICSH : Stimulates interstitial cells to secrete testosterone.
1 (b) Foetal ejection reflex
(c) The reflex triggers release of oxytocin
0 Expulsion of the baby out through birth canal.
15. (i) 13 14th day 21st 23rd day
FSH High Low
LH High Low
Progesterone Low High

0.512 End of follicular or proliferative phase.


0.513 Menstruation does not occur during pregnancy upon fertilisation due to
high level of progestenone secreted by persisting corpus luteum and
Placenta.
(a) (i) Gonadotropins and FSH increases
LH attains peak level but FSH decreases
LH and FSH level decreases
LH remains low and FSH increases.
After 29th day there is a mentrual flow involving discharge of blood and cast
off endometrium lining.

25 XII Biology
(i) Germinal epithelium have two types of cell. 1. Spermatogonium. 2. Sertoli cells
Leydig cells or Interstitial cells.
Functions
Spermatogonium undergoes meiotic division leading to sperm
formation.
Sertoli cell : Nourishes germ cells
Leydig cell : Synthesise and Secrete hormone androgen.
(i) D Spermatids = undergo spermiogenesis
(ii) A = Spermatogonium; B = Primary spermatocyte
(iii) B = Diploid E = Haploid

F = Sertoli cells Nutrition to germ cells


Mitosis in Cell A, Meiosis in cell B

26 XII Biology
CHAPTER 4

REPRODUCTIVE HEALTH

POINTS TO REMEMBER
Amniocentesis : Diagnostic technique to detect genetic disorder in the foetus.
Infertility : Inability to produce children in spite of unprotected sexual
cohabitation of a couple.
Mortality : Death rate (number of persons removed from a population by death)
at a given time.
Sterilization : A permanent method of birth control through surgery in male or
female.
IUCD : Intra Uterine Contraceptive Device
RCH : Reproductive and Child Health care
STD : Sexually Transmitted Disease
CDRI : Central Drug Research Institute
MMR : Maternal Mortality Rate
MTP : Medical Termination of Pregnancy
VD : Veneral Disease
RTI : Reproductive Tract Infection
PID : Pelvic Inflammatory Disease
ART : Assisted Reproductive Technologies
IVF : In Vitro Fertilisation
ZIFT : Zygote Intra Fallopian Transfer
Reasons for Infertility
Physical
Congenital diseases
Drugs
Immunological reaction

27 XII Biology
The couple can be assisted to have children through certain special techniques
commonly known as assisted reproductive technologies (ART).
In Vitro Fertilisation (IVF) : Fertilization outside the body in almost similar
conditions as that in the body, followed by embryo transfer (E.T.).
Test Tube baby Programme : Ova from the wife/donor female and sperm
from husband/donor male are allowed to fuse under simulated condition in
the laboratory.
ZIFT : Zygote intra fallopian transfer Zygote or early embryo upto Eight
blastomeres is transferred into the fallopian tube.
IUT : Intra Uterine Transfer Embryo with more than eight blasomeres are
transferred.
Gamete intra fallopian transfer (GIFT) : Transfer of an ovum collected from a
donor to fallopian tube of another female who can not produce ova, but can
provide suitable conditions for fertilization and further development of the
foetus upto parturition,
Intra Cytoplasmic sperm injection (ICSI) : The sperm is directly injected into
the ovum to form an embryo in the laboratory and then embryo transfer is
carried out.
Artificial Insemination : This method is used in cases where infertility is due to
the inability of the male partner to inseminate the female or due to very low
sperm counts in the ejaculates. In this method, the semen collected from the
husband or a healthy donor is artifictally introduced into the vagina or into
the uterus (IUI-Intra uterine insemination).
Method of Birth Control
Natural Methods :Periodic abstinence
Coitus interruptus
Lactational amenorrhea.
Barrier methods :Condom, Diaphragms, Cervical cap.
Intra uterine devices : Non medicated e.g. Lippes loop
Copper releasing e.g., Cu-T, multiload 375
Hormone releasing e.g. LNG20, progestasert
(iv) Oral contraceptives : Pills / Saheli
Small doses of either progestogens or
Progestogen estrogen combination
(v) Surgical (Sterilisation) : (1) Tubectomy; (2) Vasectomy

28 XII Biology
QUESTIONS

VSA (1 MARK)

Give the term for prenatal diagnostic technique aimed to know the sex of
developing foetus and to detect congenital disorders.
After a successful in vitro fertilisation, the fertilised egg begins to divide. Where is
this egg transferred before it reaches the 8-celled stage and what is this
technique called?
Give the term for rapid population growth.
Name the fluid from which foetal cells are extracted for chromosomal analysis.
Give technical name of female used to bring up in vitro fertilized egg to maturity.
Name the oral contraceptive developed by CDRI, Lucknow.

SA-II (2 MARKS)
Lactational Amenorrhea is a method of contraception Justify. What is the
maximum effectiveness of this method in terms of period/duration?
How are non medicated IUDS different from hormone releasing IUDS? Give
examples.
What are implants? How do they help in preventing fertilisation?
Briefly explain two natural barriers for birth control.
Enlist any four possible reasons for infertility in human beings.

SA-1 (3 MARKS)
Give another name for sexually transmitted diseases. Name two sexually
transmitted diseases which are curable and two diseases which are not
curable.
Differentiate between Vasectomy and Tubectomy.
Name the techniques which are employed in following cases :
Transfer of an ovum collected from a donor into the fallopian tube of another
female who cannot produce ova but can provide suitable environment
for fertilisation and development.

29 XII Biology
Embryo is formed in laboratory in which sperm is directly injected into ovum.
Semen collected either from husband or a healthy donor is artificially
introduced either into vagina or uterus.
Mention the various precautions one has to take in order to protect himself/
herself form STDs.
What are the disturbing trends observed regarding MTP?

LA (5 MARKS)
Briefly explain the various reproductive technologies to assist an infertile couple
to have children.

ANSWERS
VSA (1 MARKS)
Amniocentesis.
Fallopian tube; Zygote intra fallopian transfer (ZIFT)
Population explosion.
Amniotic fluid.
Surrogate mother.
Saheli

SA-II (2 MARKS)
(a) Ovulation and menstrual cycle do not occur during the period of intense
lactation following parturition. Therefore, as the mother breast feeds,
chances of conception are nil.
It is effective only upto a maximum period of six months following parturition.
(a) Non medicated IUDs = Lippes loop, Copper releasing IUDS ( CuT, Multiload
375) These increase phagocytosis of sperms within uterus and
release copper ions which suppress sperm motility and fertilising
capacity of sperm.
Hormone releasing IUDs Progestasert, LNG20 These makes uterus
unsuitable for implantation and the cervix hostile to sperms.
The structures which contain hormones like progesterone and estrogen and are
placed under the skin.

30 XII Biology
Periodic abstinence couple should avoid coitus from 10th to 17th day of
menstrual cycle.
Coitus interruptus Male partner withdraws his penis from the vagina just
before ejaculation of semen.
Physical, congenital disease, Drugs, Immunological and even psychological (any
four).

SA-I (3 MARKS)
Veneral disease (VD)/Reproductive tract infection (RTI)
Curable : Syphilis, Gonorrhoea
Non Curable : Hepatitis B, AIDS, Genital herpes
13.
Vasectomy Tubectomy

1. Method of sterilisation in 1. Method of sterilisation in


males females.
2. Vasa defferentia of both 2. Fallopian tube of both sides are
sides are cut and tied cut and tied.
3. Prevents movement of 3. Prevent movement of egg at
sperms at cut end. cut end.

(a) Gamete intra fallopian transfer.


Intra cytoplasmic sperm injection
Intra uterine insemination.
(i) Avoid blood transfusion from an infected person.
Avoid sex with an unknown partner or multiple partners.
Always use condom.
Avoid sharing of injections needles and syringes and surgical instruments.
Majority MTPs performed illegally by unqualified quacks, missuse for female
foeticide.

LA (5 MARKS)
Refer page no. 64, NCERT textbook for class XII/Points to remember in this
chapter.

31 XII Biology
CHAPTER 5

PRINCIPLES OF INHERITANCE AND


VARIATION

POINTS TO REMEMBER
Allele : Various or slightly different forms of a gene, having same position on
chromosomes.
Phenotype : The observable or external characteristics of an organism
Genotype : The genetic constitution of an organism.
Monohybrid cross : A cross between two individuals of species, considering the
inheritance of single pair of contrasting character e.g., a cross between pure tall
(TT) and Dwarf (tt).
Dihybrid cross : A cross between two individuals of a species, considering the
inheritance of two pairs of contrasting traits/characters e.g., a cross between
Round and Yellow (RRYY) and wrinkled and green (rryy) pea seeds
Incomplete dominance : When one of the two alleles of a gene is incompletely
dominant over the other allele.
Co-dominance : When two alleles of a gene are equally dominant and express
themselves even when they are together.
Multiple allelism : When a gene exists in more than two allelic forms e.g., gene
A B
for blood group exist in three allelic forms, I , I and i.
Aneuploidy : The phenomenon of gain or loss of one or more chromosome(s),
that results due to failure of separation of homologous pair of chromosomes
during meiosis.
Trisomy : The condition in which a particular chromosome is present in three
copies in a diploid cell/ nucleus.
Male heterogamety : When male produces two different types of gametes/
sperms e.g., In human beings X and Y.

32 XII Biology
Mutation : The sudden heritable change in the base sequence of DNA, or
structure of chromosome or a change in the number of chromosomes.
Pedigree Analysis : The analysis of the distribution and movement of trait in a
series of generations of a family.
Female Heterogamety : When female produces two different types of
gametes/ova e.g., female bird produces Z and W gametes.
Law of Dominance : When two individuals of a species differing in a pair of
contrasting characters/traits are crossed, the trait that appears in the F 1 hybrid is
dominant and the alternate from that remain hidden, is called recessive.
Law of Segregation : The members of allelic pair that remained together in the
parent, segregate/separate during gamete formation and only one of the factors
enters a gamete.
Law of Independent Assortment : In the inheritance of two pairs of contrasting
characters, the factors of each pair of characters segregate independently of the
factors of the other pair of characters.
Test Cross : When offspring or individual with dominant phenotype, whose
genotype is not known, is crossed with an individual who is homozygous
recessive for the trait.
The progeny of monohybrid test cross ratio is 1 : 1 while the dihybrid test cross
ratio is 1 : 1 : 1 : 1.

33 XII Biology
Use of Test Cross : The test cross is used to find the genotype of an organism.

Incomplete dominance : It is the phenomenon where none of the two


contrasting alleles is dominant but express themselves partially when present
togoether in a hybrid and somewhat intermediate.
Co-dominance : The alleles which do not show dominance recessive
relationship and are able to express themselves independently when present
together are called co-dominant alleles and this phenomenon is known as co-
dominance. Example : Human blood groups.
Blood Group Genotype
A AA A
I I ,I i

B BB B
I I ,I i
AB AB
I I
O ii
In human blood, there are six genotype and four phenotypes.
Chromosonal Theory of Inhertance : proposed by Suttan and Boveri. The
pairing and separation of a pair of chromosomes would lead to the segregation of
a pair of factors they carried. They united the knowledge of segregation with
mendelian principles.
Linkage is the tendency of genes on a chromosome to remain together.
Linked genes occur in the same chromosome

34 XII Biology
They lie in linear sequence in the chromosome
There is a tendency to maintain the parental combination of genes except for
accessional choosers.
Strength of linkage between genes is inversely proportional to the distance
between the two.
Recombination is the generation of non-parental gene combinations to the
offsprings.
Tightly linked genes show very low recombination frequency. Loosely linked
genes show higher recombination frequency.
The frequency of recombination between gene pairs on the same chromosome is
a measure of distance between genes and is used to map the position of genes
on the chromosome.
Chromosomal basis of sex determination
XX - XY type - female homogametic ie XX and male heterogametic ie. XY is
Drosophila, humans.
XX - XO type All eggs bear additional X chromosome, Makes have only one X
chromosome besides autosomes whereas females have a pair of X
chromosomes eg grasshoppers.
ZW - ZZ type - The females are hetegametic and have one Z and one W
chromosome. The males are homogametic with a pair of Z chromosomes
besides autosomes eg - birds.
Pedigree Analysis
A record of inheritance of certain genetic traits for two or more generation
presented in the form of diagram or family tree is called pedigree.
Usefulness of Pedigree Analysis
It is useful for genetic counsellors to advice intending couples about the
possibility of having children with genetic defects like haemophilia,
thalassemia etc.
It is helpful to study certain genetic trait and find out the possibility or absence or
presence of that trait in homozygous or heterozygous condition in a
particular individual.
Mendelian disorders
These are mainly determined by alternation or mutation in single genes. or
mutation in single genes.

35 XII Biology
Haemophilia sex linked recessive disease which is transmitted from unaffected
carriers female to male pregnancy. A single protein is affected that is a part
of the cascade of proteins involved in the clothing of blood.
h
X Y Sufferer male
h
X X carrier female
The heterozygous female for haemophilia may transmit the disease to her
sons. The possibility of a female suffering from the disease is extremely rare (only
h
when the mother of the female is a carrier ie X X and father is haemophilic ie.
h
X Y.
2. Sickle - cell anaemia : This is an autosome linked recessive trait. The defect
th
is caused by substitution of glutamic acid by valine at the 6 position of the beta
globin chain of the haemoglobin molecule. The mutant Hb molecule undergoes
polymerisation under low oxygen tension causing change in shape of RBC from
biconcave disc to elongated sickle like structure. The disease is controlled by a
A S
pair of allele, Hb and Hb
A A
Hb Hb Normal
A s s s
Hb Hb Apparently unaffected, carriers Hb Hb sufferer
Phenylketonuria Inborn error of metabolism autosomal recessive trait.
Affected individual lacks an enzyme that converts amino acid Phenylalanine into
tyrosine. Phenylalanine is accumulated and converted into phenylpyruvic acid
which accumulates in brain resulting in mental retardation.
Chromosomal disorders
These are caused due to absence or excess of one or more chromosomes.
Downs syndrome Trisomy of chromosome number 21.
Affected individual is short statured with small round head, furrowed tongue,
partially open month, broad palm. Physical, psychomotor and mental
development is retarded.
Klinefelters syndrome extra copy of X chromosome; karyotype XXY. Affected
individual has overall masculine development with feminine characters like
gynaecomastia (development of breast) and is sterile.
Turners syndrome has absence of one X chromosome ie. 45 with XO.
Affected females are sterile with rudimentary ovaries and lack secondary sexual
characters.

36 XII Biology
PLEIOTROPY
The ability of a gene to have multiple phenotypic effects because it influences a
number of characters simultaneously is known as pleiotropy. The gene having a
multiple phenotypic effect because of its ability to control expression of a number
of characters is called pleiotropic gene.
Eg. in Garden Pea, the gene which controls the flower colour also controls the
colour of seed coat and presence of red spot in the leaf axil.

POLYGENIC INHERITANCE
It is a type of inheritance controlled by two or more genes in which the dominant
alleles have cumulative effect with each dominant allele expressing a part of the
trait, the full trait being shown only when all the dominant alleles are present.
Eg. Kernel colour in wheat, skin colour in human beings, height in humans, cob
length in maize etc.
In polygenic inheritance, a cross between two pure breeding parents produces an
intermediate trait in F1. In F2 generation, apart from the two parental types, there
are several intermediates (gradiations, show a bell shaped curve). F1 hybrid form
8 kinds of gamete in each sex giving 64 combination in F2 having 7 genotype and
phenotype.
Polygenic inheritance of skin tone
3 loci : each has two possible alleles : Aa, Bb, Cc, each capital allele adds one
unit of darkness, each lower case allele adds nothing
Parents with intermediate tone

Offspring can have tone darker or lighter than either parent

37 XII Biology
QUESTIONS
VSA (1 MARK)
Give any two reasons for the selection of pea plants by Mendel for his
experiments.
Name any one plant that shows the phenomenon of incomplete dominance
during the inheritance of its flower colour.
Name the base change and the amino acid change, responsible for sickle cell
anaemia.
Name the disorder with the following chromosome complement.
22 pairs of autosomes + X X Y
22 pairs of autosomes + 21st chromosome + XY.
A haemophilic man marries a normal homozygous woman. What is the probability
that their daughter will be haemophilic?
A test is performed to know whether the given plant is homozygous dominant or
heterozygous. Name the test and phenotypic ratio of this test for a
monohybrid cross.

SA-II (2 MARKS)
Identify the sex of organism as male or female in which the sex chromosome are
found as
ZW in bird (ii) XY in Drosophila (iii) ZZ in birds. (iv) XO in grasshopper.
Mention two differences between Turners syndrome and Klinefelters syndome.
The human male never passes on the gene for haemophilia to his son. Why is it
so?
Mention four reasons why Drosophila was chosen by Morgan for his
experiments in genetics.
Differentiate between point mutation and frameshift mutations.

SA-I (3 MARKS)

A woman with O blood group marries a man with AB blood group


work out all the possible phenotypes and genotypes of the progeny.
Discuss the kind of dominance in the parents and the progeny in this case.

38 XII Biology
Explain the cause of Klinefelters syndrome. Give any four symptoms shown by
sufferer of this syndrome.
In Mendels breeding experiment on garden pea, the offspring of F2 generation
are obtained in the ratio of 25% pure yellow pod, 50% hybrid green pods and
25% green pods State (i) which pod colour is dominant
The Phenotypes of the individuals of F1 generation. (iii) Workout the cross.

LA (5 MARKS)

A dihybrid heterozygous round, yellow seeded garden pea (Pisum sativum) was
crossed with a double recessive plant.
What type of cross is this?
Work out the genotype and phenotype of the progeny.
What principle of Mendel is illustrated through the result of this cross?

ANSWERS

VSA (1 MARK)

(i) Many varieties with contrasting forms of characters


Can easily be cross pollinated as well as self pollinated.
Dog flower (Snapdragon or Antirrhinum sp.)
GAG changes as GUG, Glutamic acid is substituted by valine.
4. (i) Klinefelters Syndrome (ii) Downs syndrome
Their daughter can never be haemophilic. (0%).
Test cross 1 : 1.

SA-II (2 MARKS)

(i) Female; (ii) Male; (iii) Female (iv) Male


Turners Syndrome : The individual is female and it has 45 chromosomes i.e.,
one X chromosome is less.
Klinefelters Syndome : The individual is male and has 47 chromosomes
i.e., one extra X chromosome.

39 XII Biology
The gene for haemophilia is present on X chromosome. A male has only one X
chromosome which he receives from his mother and Y chromosome from
father. The human male passes the X chromosome to his daughters but not
to the male progeny (sons).
(i) Very short life cycle (2-weeks)
Can be grown easily in laboratory
In single mating produce a large no. of flies.
Male and female show many hereditary variations
It has only 4 pairs of chromosomes which are distinct in size and Shape.
Point Mutations : Arises due to change in a single base pair of DNA e.g., sickle
cell anaemia.
Frame shift mutations : Deletion or insertion/duplication/addition of one or
two bases in DNA.

SA-I (3 MARKS)
A B
(i) Blood group AB has alleles as I , I and O group has ii which on cross gives
A
the both blood groups A and B while the genotype of progeny will be I i
B
and I i.
A B
I and I are equally dominant (co-dominant). In multiple allelism, the gene I
A B
exists in 3 allelic forms, I , I and i.
Cause : Presence of an extra chromosome in male i.e., XXY.
Symptoms : Development of breast, Female type pubic hair pattern, poor
beard growth, under developed testes and tall stature with feminised
physique.
(i) Green pod colour is dominant
Green pod colour
(iii) Parents GG(green) X gg (yellow)
Gametes G g
F1 generation Gg (Hybrid green)
Gametes G g X G g
F2 generation GG Gg Gg gg
Phenotypic ratio 3 : 1
Genotypic ratio 1 : 2 : 1

40 XII Biology
LA (5 MARKS)

15. (i) It is a dihybrid test cross


(ii) Parent RrYy (Round Yellow) rryy (Wrinkled green)
Gametes RY , Ry , rY , ry X ry

Gametes RY Ry rY ry
F progeny ry RrYy Rryy rrYy rryy
1
Round, Round and Wrinkled Wrinkled,
Yellow Green Yellow Green
Phenotypic ratio : 1 : 1 : 1 : 1
Genytopic ratio : 1 : 1 : 1 : 1
(iii) It illustrates the Principle of independent assortment.

41 XII Biology
CHAPTER 6

MOLECULAR BASIS OF INHERITANCE

POINTS TO REMEMBER
Anticodon : A sequence of three nitrogenous bases on tRNA which is
complementary to the codon on mRNA.
Transformation : The phenomenon by which the DNA isolated from one type of
a cell, when introduced into another type, is able to express some of the
properties of the former into the latter.
Transcription : The process of copying genetic information from one strand of
DNA into RNA.
Translation : The process of polymerisation of amino-acids to form a polypeptide
as dictated by mRNA.
Nucleosome : The structure formed when negatively charged DNA is wrapped
around positively charged histone octamer.
DNA Polymorphism : The variations at genetic level, where an inheritable
mutation is observed.
Satellite DNA : The repetitive DNA sequences which form a large portion of
genome and have high degree of polymorphism but do not code for any proteins.

Operon : A group of genes which control a metabolic pathway.


Exons : The regions of a gene which become part of mRNA and code for
different regions of proteins.
Introns : The regions of a gene which are removed during the processing of
mRNA.
Euchromatin : The region of chromatin which is loosely packed and
transcriptionally active.
Heterochromatin : The chromatin that is more densely packed, stains dark and
is transcriptionally inactive.
Capping : Adding of methyl guanosine triphosphate to the 5 end of hnRNA.
Splicing : The process in eukaryotic genes in which introns are removed and the
exons are joined together to form mRNA.

42 XII Biology
Central Dogma :
Replication

Replication fork : The Y shaped structure formed when double stranded DNA is
unwound upto a point during its replication.
VNTR : Variable Number Tandem Repeats
YAC : Yeast Artificial Chromosome
BAC : Bacterial Artificial Chromosome
SNPs : Single Nucleotide polymorphism
HGP : Human Genome Project
hnRNA : Heterogenous nuclear RNA. It is precursor of mRNA.
Chemical Structure of Polynucleotide Chain (DNA/RNA) : A nucleotide has
three components
Nitrogen base
Purines : Adenine and Guanine
Pyrimidines : Cytosine, Thymine and Uracil
Thymine in DNA and Uracil in RNA.
Pentose Sugar : Ribose (in RNA) or Deoxyribose (in DNA).
Phosphate Group

Nitrogen base is linked to pentose sugar through N-glycosidic linkage.


Nitrogen base + Sugar = Nucleoside
Phosphate group is linked to 5OH of a nucleoside through phosphoester
linkage.
Nucleoside + Phosphate group = Nucleotide.
Two nucleotides are linked through 35 phosphodiester linkage to form a
dinucleotide
A polynucleotide chain has free phosphate group at 5end of ribose
sugar and 3OH group at other end.
RNA is highly reactive than DNA : In RNA nucleotide has an addition OH
group at 2position in the ribose; RNA is also catalytic.

43 XII Biology
Double-helix Structure of DNA : Proposed by Watson and Crick in 1953.
DNA is made up of two polynucleotide chains.
The backbone is made up of sugar and phosphate and the bases project
inside.
Both polynucleotide chains are antiparallel i.e. one chain has polarity 5-3
and other chain has 35.
These two strands of chains are held together by hydrogen bonds i.e. A=T,
GC.
Both chains are coiled in right handed fashion. The pitch of helix is 3.4 nm
with 10 bp in each turn.
Hershey and Chase Experiement : In 1952, Hershey and Chase performed an
experiment on bacteriophages (Viruses that infect bacteria) and proved that DNA
is the genetic material.
Bacteriophage Bacteriophage
Radioactive (35S) Radioactive (32P)
labelled protein coat labelled DNA

Infection : [Link] [Link]

Blending : Viral coats removed from the bacteria.



Centrifugation : Viral particles separated from the bacterial cell.

No radioactive (35S) Radioactive (35P)
detected in bacterial cells detected in baterial
but detected in cells but not in
supernatant supernatant
Conclusion : DNA is the genetic material.
Meselson and Stahls Experiment :
Meselson and Stahl performed the experiment in 1958 on [Link] to prove that
DNA replication is semiconservative.
[Link] was grown in 15NH 4Cl for many generations.
15N was incorporated into newly synthesised DNA.
This heavy DNA could be differentiated from normal DNA by centrifugation in
cesium chloride (CsCl) density gradient.

44 XII Biology
Then they transferred these [Link] into a medium with normal 14NH4Cl.
After 20 minutes, it was found that all the DNA molecules of daughter cells
were hybridFirst generation.
After 40 minutes, it was found that 50% DNA molecules were hybrid and 50%
were normal-second generation.
DNA Replication :
Origin of replication - it is the starting point when replication of DNA begins.
Replication fork - for long DNA molecules, since the two strands of DNA cannot
be seperated in its entire length, the replication occur within a small opening
of DNA helix, referred to as replication fork.
Continuous synthesis - DNA dependent DNA polymerase catalyses
polymerisation only in 53 direction, one strand (the template with polarity
35), the replication is continuous.
Discontinuous synthesis - In the template with 53 the replication is
disecontinuous and the fragments are joined by enzyme ligase.
Transcription in Prokaryotes : In prokaryotes the process of transcription is
completed in three steps:
Initiation : RNA polymerase binds with initiation factor (sigma factor) and then
binds to promotor site.
Elongation : RNA polymerase separates from sigma factor and adds nucleoside
triphosphate as substrate. RNA is formed during the process following the
rule of coplementarity and remains bound to enzyme RNA polymerase.
Termination : On reaching terminator region RNA polymerase binds with rho
factor (terminator factor). As a result nascent RNA separates.
Transcription in Eukaryotes :
In eukaryotes three types of RNA polymerases found in the nucleus (apart from
RNa polymerases are found in the organelles) are involved in transcription.

RNA Polymerase I : Transcribes rRNAs.


RNA Polymerase II : Transcribes hnRNA (which is precursor of mRNA).
RNA Polymerase III : Transcribes tRNA, 5 srRNA and snRNA.
The primary transcript has both exon and intron regions.
Introns which are non-coding regions removed by a process called splicing.

45 XII Biology
hnRNA undergoes two additional processes :
Capping : An unusual nucleotide (methylguanosine triphosphate) is added
to 5end of hnRNA.
Tailing : Adenylate residues (200-300) are added at 3end.
It is fully processed hnRNA, now called mRNA is transported out of the
nucleus
Lac Operon
The concept of operon was proposed by Jacob Monod. Operon is a unit of
prokaryotic gene expression.
The lac operon consists of one regulatory gene (the i-gene) and three
structural genes (z, y and a).
The i-gene codes for repressor of lac operon.
Lactose is an inducer.
Gene Z - Codes for -galactosidase
Gene Y - Codes for permease
Gene A - Codes for transacetylase.
In the absence of Inducer (lactose)
Repressor (i-gene) binds with operator (o)

Operator turns off

RNA polymerase stops the transcription

Structural genes (z, y and a) do not produce lac mRNA and enzymes
In the presence of Inducer (lactose)
Repressor binds to inducer (lactose)

Operator (o) turns ON

RNA polymerase starts the transcription

Structural genes (z, y and a) produce mRNA and enzymes (-
galactosidase, permease and transacetylase respectively)

46 XII Biology
Packaging of DNA Helix
The average distance between the two adjacent base pairs is 0.34 nm
9
(0.34x10 m or 3.4 A)
6
The number of base pairs in [Link] is 4.6x10 .
DNA Packaging in Prokaryates - DNA is not scattered throghout the cell.
DNA (negatively charged) is held by some proteins (has positive charges) in
a region termed as nucleoid. The DNA in nucleoid is organised in large
loops held by proteins.
DNA packaging in Eukayotes - There is a set of positively charged basic
proteins called histones. Histones are rich in the basic amine and residues
lysines and arginines.
Histones are organised to form a unit of eight molecules called histone
octamer.
The negatively charged DNA is wrapped around positively charged histone
octamer to form a structure called nucleosome
Nucleosomes constitute the repeating unit of a structure in nucleus called
chromatin
The beads-on-string structure in chromatin is packaged to form chromatin
fibres that are futher coiled and condensed at metaphase stage of cell
division to form chromosomes
The packaging of chromatin at higher level requires additional set of protein
that collectively are referred to as Non-histone chromosomal (NHC) proteins.
At places chromatin is density packed to form darkly staining
heterochromatin. At other places chromatin is loosely packed to form
euchromatin
Genetic Code
The codon is triplet 61 codons code for amino acids and 3 codons function as
stop codons (UAG, UGA, UAA)
One codon codes for only one amino acid, hence the codon is unambiguous and
specific.
Some amino acids are coded by maore than one cadon degenerate
The codon is read in mRNA in a contiguous fashion. There are no punctuations
The code is nearly universal
AUG has dual functions. It codes for Methionine (met) and it also acts as initiator
codon.
tRNAthe Adapter Molecule :
tRNA has an anticoden loop that has bases complementary to the code and
also has an amino acid accepter end through which it binds to amino

47 XII Biology
acids.
Translation :
Translation refers to the process of polymerisation of amino acids to form a
polypeptide. The order and requence of amino acids are defined by the
sequence of bases in the mRNA.
First step is - charging of tRNA or aminoacylation of tRNA-here amino acids
are activated in the presence of ATP and linked to specific tRNA.
Initiation - Ribosome binds to mRNA at the start codon (AUG) that is
recognised by the initiator tRNA.
Elongation phase - Here complexes composed of an amino acid linked to
tRNA, sequentially bind to the appropriate codon in mRNA by forming
complementary base pairs with tRNA codon. The ribosomes move from
codon to codon along with the mRNA. Amino acids are added one by one,
translated into polypeptide sequences.
Termination - Release factors binds to the stop codon, terminating translation
and releasing the complete polypetide from the ribosome.
Human Genome Project was a 13 year project coordinated by the U.S.
Department of energy and National Institute of Health, It was completed in
2003.
Important goals of HGP
Identify all the apponimately 20,000-25,000 genes in human DNA.
Determine the sequences of the 3 million chemical base pairs that make up
human DNA.
Store this information in database.
Transfer related technologies to other sectors, such as industries.
Address the ethical, legal and social issues (ELSI) that may arise from the
project.

Salient Features of Human Genome - Refer Pg - 120, NCERT Class XII)

48 XII Biology
DNA Fingerprinting - is a technique of determining nucleotide sequences of
certain areas of DNA which are unique to each individual
Principle of DNA Fingerprinting - Short nucleotide repeats in the DNA are very
specific in each individual and vary in number from person to person but are
inherited. These are Variable Number Tandem Repeats (VNTRs). Each
individual inherits these repeats from his/her parents which is used as genetic
markers. One half of VNTR alleles of the child resembles that of the mother and
other half the father.
Steps/procedure in DNA fingerprinting
Extraction of DNA - using high speed refrigerated centrifuge.
Amplification - many copies are made using PCR
Restriction Digestion - using restriction enzymes DNA is cut into fragments.
Separation of DNA fragments - using electrophoresis-agarose polymer gel.
Southern Blotting : Separated DNA sequences are transferred onto
nitrocellulose or nylon membrane.
Hybridisation : The nylon memberane exposed to radio active probes.
Autoradiography : The dark bands develop at the probe site.
Applications of DNA Fingerprinting
identify criminals in forensic labs.
determine paternety
verify whether a hopeful immigrant is really close relative of an already
established resident.
identify racial graps to rewrite biological evolution.

QUESTIONS

VSA (1 MARK)

Name the factors for RNA polymerase enzyme which recognises the start and
termination signals on DNA for transcription process in Bacteria.
Mention the function of non-histone protein.
During translation what role is performed by tRNA
RNA viruses mutate and evolve faster than other viruses. Why?

49 XII Biology
Name the parts X and Y of the transcription unit given below.

Mention the dual functions of AUG .


Write the segment of RNA transcribed from the given DNA
3 A T G C A G T A C G T C G T A 5 Template Strand 5 T A C
G T C A T G C A G C A T 3 Coding Strand.

SA-II (2 MARKS

The process of termination during transcription in a prokaryotic cell is being


represented here. Name the label a, b, c and d.

(a)

Complete the blanks a, b, c and d on the basis of Frederick Griffith Experiment.


S Strain inject into mice (a) R
strain inject into mice (b)
S strain (heat killed) inject into mice (c)
S strain (heat killed) + R strain (live) inject into mice (d)
Give two reasons why both the strands of DNA are not copied during
transcription.
Mention any two applications of DNA fingerprinting.
State the 4 criteria which a molecule must fulfill to act as a genetic material.

50 XII Biology
SA-I (3 MARKS)

Give six points of difference between DNA and RNA in their structure/ chemistry
and function.
Explain how does the hnRNA becomes the mRNA.
OR
Explain the process of splicing, capping and tailing which occur during
transcription in Eukaryotes.
Name the three major types of RNAs, specifying the function of each in the
synthesis of polypeptide.
Enlist the goals of Human genome project.
A tRNA is charged with the amino acid methionine.
Give the anti-codon of this tRNA.
Write the Codon for methionine.
Name the enzyme responsible for binding of amino acid to tRNA.
Illustrate schematically the process of initiation, elongation and termination during
transcription of a gene in a bacterium.

LA (5 MARKS)
What is meant by semi conservative replication? How did Meselson and Stahl
prove it experimentally?
What does the lac operon consist of? How is the operator switch turned on and
off in the expression of genes in this operon? Explain.
State salient features of genetic code.
Describe the process of transcription of mRNA is an eukaryotic cell.
Describe the various steps involved in the technique of DNA fingerprinting.

ANSWERS
VSA (1 MARK)
Sigma () factor and Rho(p) factor)
Packaging of chromatin
(i) Structural role
Transfer of amino acid.

51 XII Biology
OH group is present on RNA, which is a reactive group so it is unstable and
mutate faster.
X Template strand, Y Terminator.
(i) Acts as initiation codon for protein synthesis
It codes for methionine.
5 U A C G U C A U G C A G C A U 3 (In RNA T is replaced by U)

SA-II (2 MARKS)
8. (a) DNA molecule (b) mRNA transcript
(c) RNA polymers (d) Rho factor
9. (a) Mice die (b) mice live
(c) mice live (d) mice die

(a) If both the strands of DNA are copied, two different RNAs (complementary to
each other) and hence two different polypeptides will produce; If a
segment of DNA produces two polypeptides, the genetic information
machinery becomes complicated.
The two complementary RNA molecules (produced simultaneously) would
form a doublestranded RNA rather than getting translated into
polypeptides.
RNA polymerase carries out polymerisation in 5 3 direction and hence the
DNA strand with 3 5 polarity acts as the template strand. (Any two)
(i) To identify criminals in the forensic laboratory.
To determine the real or biological parents in case of disputes.
To identify racial groups to rewrite the biological evolution. (Any two)
(i) It should be able to generate its replica.
Should be chemically and structurally stable.
Should be able to express itself in the form of Mendelian characters.
Should provide the scope for slow changes (mutations) that are necessary
for evolution.

52 XII Biology
SA-I (3 MARKS)
13. DNA RNA
(i) Double stranded molecules (i) Single stranded molecules
(ii) Thymine as pyrimidine base (ii) Uracil as pyrimidine base
(iii) Pentose sugar is Deoxyribose (iii) Sugar is Ribose
(iv) Quite stable and not very (iv) 2-OH makes it reactive
reactive
(v) Dictates the synthesis of (v) Perform their functions in
Polypeptides protein synthesis.
(vi) Found in the nucleus. (vi) They are transported into
the cytoplasm.
hnRNA is precursor of mRNA. It undergoes
Splicing : Introns are removed and exons are joined together.
Capping : an unusual nucleotide (methyl guanosine triphosphate is added
to the 5 end of hnRNA.
Adenylate residues (200-300) are added at 3 end of hnRNA.
OR
Refer fig. 6.11, page 110, NCERT book. Biology - XII
(i) mRNA-(Messenger RNA) : decides the sequence of amino acids.
tRNA-(Transfer RNA) : (a) Recognises the codon on mRNA (b) transport
the aminoacid to the site of protein synthesis.
rRNA (Ribosomal RNA) : Plays the structural and catalytic role during
translation.
Refer points given on page 118, NCERT, Biology XII.
(a) UAC (b) AUG (c) Amino-acyltRNA synthetase.
Refer figure 6.10, page 109, NCERT Biology XII.

LA (5 MARKS)
Meselson and Stahl, performed an experiment using [Link] to prove that DNA
replication is semi conservative.
15
They grew [Link] in a medium containing NH4Cl.
Then separated heavy DNA from normal (14N) by centrifugation in CsCl
density gradient.

53 XII Biology
The DNA extracted, after one generation of transfer from 15N medium to
14N medium, had an intermediate density.
The DNA extracted after two generations consisted of equal amounts of
light and hybrid DNA.
They proved that DNA replicates in a semiconservative manner. (Refer
figure 6.7, page 105, NCERT Biology XII).
Lac Operon consists of the following :
Structural genes : z, y, a which transcribe a polycistronic mRNA.
gene z codes for -galactosidase
gene y codes for permease.
gene a codes for transacetylase.
Promotor : The site where RNA polymerase binds for transcription.
Operator : acts as a switch for the operon
Repressor : It binds to the operator and prevents the RNA Polymerase
from transcribing.
Inducer : Lactose is the inducer that inactivates the repressor by binding
to it.
Allows an access for the RNA polymerase to the structural gene and
transcription.
Refer figure 6.14, page 117, NCERT, Biology XII.
Refer notes
Refer notes 35 and figure 6.11, page 110, NCERT Biology XII.
Refer points to remember Steps involved in DNA fingerprinting

54 XII Biology
CHAPTER 7

EVOLUTION

POINTS TO REMEMBER
Artificial Selection : It is the process carried out by man to select better breeds
of plants and aminals.
Bio-geography : The study of patterns of distribution of plants and aminals in
different parts of earth.
Founders Effect : A genetic drift in human population where a population in a
new settlement have different gene frequency from that of the parent population.
The original drifted population said to be founder.
Gene Pool : Sum total of all the genes in a population.
Genetic Drift : Chance elimination of genes of certain traits from a population
due to migration or death.
Panspermia : Units of life in the form of so called spores, which were transferred
to earth from outer space (as believed by some scientists).
Saltation : Single step large mutations.
Speciation : It is the formation of new species from the pre-existing ones.
Organic (Biological) Evolution : Changes in the characteristics/features of
organisms or groups of such populations over a number of generations.
Homologous organs : These have same basic structure and embryonic origin
but perform different functions in different species.
Analogous organs : These organs are different in their basic structure and
embryonic origin but perform similar functions.
Human Evolution : Ramapithecus Australopithecus Homo habilis
Homo erectus Homo sapiens Homo sapiens sapiens.
The Theories of Origin of Life
Theory of Special Creation : According to this theory God has created life within
6 days.

55 XII Biology
Theory of Spontaneous Generation : According to this theory life originated
from decaying and rotting matter like straw and mud.
Panspermiatic Theory : According to this theory life come from space in the
form of spores called Panspermia.
Modern Theory or Oparin-Haldane Theory : According to this theory life
originated upon earth spontaneously from non-living matter. First inorganic
compounds then organic compounds were formed in accordance with ever
changing environmental conditions. This is called chemical evolution. The
conditions on earth were high temperature, volcanic storms, reducing
atmosphere (without free oxygen) containing methane and ammonia.

Experimental Evidence for Abiogenesis (Millers Experiment) :


Stanley Miller in 1953 demonstrated in a laboratory that electric discharges
can produce complex organic compounds from a mixture of methane,
ammonia, water vapours and hydrogen. In his experiment he found that
simple organic compounds including some amino acids are formed. In
similar experiments others observed the formation of sugar, nitrogen bases,
fats and pigments.
Divergent evolution : It shows relationship of structures having same origin
but perform different functions. It is called homology. Examples : (i) Wings of
a bird, forelimbs of horse, flippers of whale. (ii) Thorns of Bougainvillea and
tendrils of cucurbita.
Convergent evolution : This shows the relationship of structures having
functional similarities but different origin. It is called analogy. Examples :
(i) Wings of insects and wings of bird. (ii) Sweet potato and potato.
Industrial melanism : It is an adaptation where moths living in the industrial
area developed melanin pigments to match their body colour to the tree-
trunk. Before Industralisation in England, it was observed that there were
more white-winged moths on trees than dark-winged moths (melanised
moths). After industrialisation (in 1920), there were more dark-winged moths
in some areas. After industrialisation, trees got covered by smoke. So white-
winged moth were picked up by the birds but dark-winged moths escaped
and survived. Thus, industrial melanism supports the evolution by natural
selection.
Adaptive radiation : The process of evolution of different species in a
geographical area starting from a point and literally radiating to other
habitats is called adaptive radiation. Examples : (i) Darwins finches found in
Galapagos island. (ii) Marsupials of Australia.

56 XII Biology
Evolution of Plants : Unicellular Multicellular Algae Rhynia type
plants Cycads Gnetales Dicot Monocot.
Hardy-Weinberg Principle : The allele frequencies in a population are
stable and is constant from generation to generation. Sum total of all the
allele frequencies is 1.
Factors Affecting Hardy-Weinberg Equilibrium : Gene migration, Genetic
drift, Mutations, Recombination, Natural Selection.
Some Facts :
The Universe is about twenty billions years old.
Earth was formed about 4.5 billion years ago.
Life started appearing about 4 billion years earlier.

QUESTIONS
VSA (1 MARK)
Name one fish like reptile that evolved from land reptile about 200 million years
ago?
For a long time, it was believed that life originated from decaying matter. What is
this theory known as? Name the scientist who experimentally disproved this
theory.
If abiotic origin of life is in progress on a planet other than earth, what should be
the conditions there?
Name the person who proposed that population tends to increase geometrically
while food production increases arithmetically.
Name the scientist who had also come to similar conclusion as that of Darwin
about natural selection as a mechanism of evolution. Which place did he visit
to come to conclusions?

SA-II (2 MARKS)

Explain Oparin-Haldane theory of chemical evolution of life.


Distinguish between convergent and divergent evolution giving one example of
each.
What is adaptive radiation? Explain with an example.
How did Louis Pasteur disprove spontaneous generation theory?

57 XII Biology
SA-1 (3 MARKS)

(i) State the Hardy-Weinberg principle.


When there is a disturbance in the Hardy-Weinberg equilibrium, what would
it result in?
According to this principle, what is the sum total of all allelic frequencies?
Classify the following as examples of homology and analogy
Hearts of fish and crocodile
Wings of butterfly and birds
Eyes of Octopus and Mammals
Tubers of potato and Sweet potato
Thorns of Bougainvillea and spines of Opuntia
Thorn of Bougainvillea and tendrils of cucurbits.
Stanley Miller and Harold Urey performed an experiment by recreating in the
laboratory the probable conditions of the atmosphere of the primitive earth.

What was the aim of the experiment?


In what forms was the energy supplied for chemical reactions to occur?
For how long was the experiment run continuously? Name two products
formed.
Industrial Melanism in peppered moth is an excellent example of Natural
selection. Justify the statement.
Fill up the blanks left in the table showing Era, period and organism.

Era Period Organisms


Cenozoic a Modern man, Mammals, Birds, rise
of monocot
b Tertiary Rise of first Primate, angiosperm
Mesozoic c Gingko, Gnetales
d Jurassic Conifers, cycads, Reptiles
Paleozoic e Early reptiles (extinct)
f Silurian Psilophyton

(i)In which part of the world, Neanderthal man lived? (ii)What


was his brains capacity?
(iii)Mention the advancement which Neanderthal man showed over Homo
erectus.

58 XII Biology
16. Figures given below are of Darwins finches?

Variety of beaks of Darwin's finches.


Mention the specific geographical area where these were found.
Name and explain the phenomenon that has resulted in the evolution of
such diverse species in the region.
How did Darwin visit the particular geographical area?
Give examples to show evolution by anthropogenic action.

LA (5 MARKS)

Is evolution a process or the end result of a process? Discuss. Describe various


factors that effect Hardy-Weinberg equilibrium.
How do Darwin and Hugo de Vries after regarding Mechanism of Evolution?
With the help of suitable diagram, represent the operation of natural selection on
different traits.

ANSWERS
VSA (1 MARK)
Ichthyosaurs.
Theory of Spontaneous generation; Louis Pasteur.

Very high temperature, volcanic storms, Reducing atmosphere containing CH 4,


NH3, H2 and water vapours.
Thomas Malthus.
Alfred Wallace, Malay Archipelago
The first life form could have come from the pre-existing, non-living organic
molecules (like RNA, Proteins, etc.) and the formation of life was preceded
by chemical evolution.
Refer page 130, 131, NCERT Text book, Biology - XII
Refer page 133, NCERT book, Biology - XII

59 XII Biology
Louis Pasteur showed that in pre-sterilized flasks, life did not come from killed
yeast while in another flask open to air, new organisms arose from killed
yeast.

SA-I (3 MARKS)

(i) The allele frequency in a population are stable and constant from generation to
generation.
Evolution.
One.
(i) Homology (ii) Analogy (iii) Analogy (iv) Analogy
Analogy (vi) Homology
(i) To prove Oparins theory of origin of life.
Electric discharge using electrodes.
One week; Amino acids and Sugar.
Refer Page 131, NCERT Text book of class XII.
(a) Quaternary (b) Coenozoic (c) Cretaceous
(d) Mesozoic (e) Carboniferous (f) Paleozoic
(i) Near Eastern and Central Asia
1400 c.c.
More brain capacity, use of hides to cover body and burial of dead.
(a) Galapagos Island.
Adaptive radiation Refer page 133, NCERT book.
Through sea voyage in a sail ship called H.M.S. Beagle.
Excess use of herbicides pesticides etc. has resulted in selection of resistent
varieties in a much lesser time scale. Same is true for antibiotic or drug
resistant microbes.

LA (5 MARKS)

Refer page 135, NCERT Text book, Biology - XII


Darwin : Darwinian variatious are gradual, small and directional
Hugo deVries : put forth idea of mutations, mutations are sudden random
and directional
Refer page No. 136, NCERT Text book of class XII.

60 XII Biology
CHAPTER 8

HUMAN HEALTH AND DISEASE

POINTS TO REMEMBER
Carcinogens : Cancer causing agents. e.g., gamma rays. UV rays, dyes and
lead.
Immunity : Resistance to infection or antigen.
Immuno Suppressant : The chemical which supress the immunity response to
antigen partially or completely.
Interferon : The glycoproteins produced by our body cells in response to a viral
infection.
Incubation Period : The time period between infection and the appearance of
symptoms.
Metastasis : The property in which the cancer cells spread to different sites
through blood and develop secondary tumors.
Oncogenes : Viral genome which causes cancer.
Retrovirus : A virus having RNA as genetic material and forms DNA by reverse
transcription and then replicate e.g., Human Immunodeficiency Virus (HIV).
Sporozoites : The infective stage of protozoa Plasmodium which is injected into
human blood through saliva of female Anopheles mosquito.
Syndrome : Collection of disease symptoms responsible for a disorder or a
disease.
Vaccination : Inoculation of a vaccine to stimulate production of antibodies and
provide immunity for one or more disease.

ABBREVIATIONS
PMNL : Polymorpho-Nuclear Leukocytes
CMI : Cell Mediated Immunity

61 XII Biology
ELISA : Enzyme Linked Immunosorbent Assay
HLA : Human Leukocyte Antigen
MALT : Mucosal Associated Lymphoid Tissue
SCID : Severe Combined Immuno Deficiency
NACO : National AIDS Control Organisation
MRI : Magnetic Resonance Imaging
Health The state of complete physical, mental and social well beings
Good health can be achieved by (i) awareness about disease and their effects
on different body functions. (ii) vaccination (iii) control of vectors (iv) proper
disposal of wastes (v) Maintenance of hygienic food and water resources.

Infectious Diseases (i) Viral Diseases eg. polio, common cold, measles, rabies
(ii) Bacterial diseases eg. Typhoid, pneumonia, Diptheria, Tetanus, (iii) Fungal
diseases - eg. Ring worm & Scabies (v) Helminthic diseases - eg Ascariasis,
Filariasis, Taeniasis
Disease Causative Agents Symptoms
1. Common cold Rhinoviruses Nasal congestion and
discharge, sore throat cough,
headache, tiredness and
hoarseness.
2. Typhoid Salmonella typhi sustained high fever, stomach
pain, loss of appetite,
constipation, headache.
3. Pneumonia Streptococcus fever, headache, cough, chills
pneumoniae and in severe cases finger nails
Haemophilus may turn grey to bluish in
influenzae colour.
4. Malaria Plasmodium yawning, tiredness, acute
P. malaria, headache, muscular pain,
[Link], feeling of chillness and
P. falciparum shivering, nausea and high
temperatures
5. Amoebic dysentry Entamoeba Abdominal pain, cramps, stool
histolytica with excess mucus and blood
clots, constipation

62 XII Biology
6. Ringworm Microsporum Dry scaly lesions on skin, nails
epidermophyton and scalp, itching
and trichophyton
7. Ascariasis Ascaris Anaemia, muscular pain,
lumbricoides internal bleeding, insomnia,
blockage of intestinal passage
8. Filariasis or Wuchereria fever, blockage of lymphatic
Elephantiasis bancrofti and vessels, enormous swelling of
W. malayi affected part viz. arm, foot, leg,
mamma or scrotum
Two types of immunities
Innate immunity in-herited by the organism from the parents and protects from
birth through out life.
Four types of barriers
Physical - eg skin, mucus coating epithelium of respiratory, gastro-intestinal and
urinogenital tracts.
Physiological - eg. acid of stomach, lysozymes of saliva and tears
Cellular eg. PMNL, monocytes, Neutrophils and macrophages
Cytokine - eg virus infected cells secrete proteins called interferons which
protect non-infected cells from further infection
Acquired Immunity Acquired by a person after birth by vaccination or
contacting the disease.

FACTORS AFFECTING HEALTH


Genetic : Child may inherit certain disorders from parents.
Life Style : Water/food intake, rest, exercise, personal hygiene.
Infection and Corresponding immunity.

63 XII Biology
It is based on the principle of memory and immunity.
The antigenic preparations of proteins of pathogens or a solution of inactivated
or weakened pathogens are introduced in the body.

The antigenic properties are recognised.


Cascade of reactions forms antibodies
History of reactions is stored as memory.
Subsequent exposures result in intensified response.

Drugs

Criteria Opiods Cannabinoids Coca alkaloids


Source Papaver sominiferum Cannabis sativa Erythroxylum coca
(Popply Plant) (Hemp Plant) (Coca plant)
Part of Plant Fruits (Unripen Inflorescence, leaves, Leaves and

Capsules) resin Young twigs


Product Opium, Morphine Charas, Ganja Hashish Cocaine (Coke/

Heroin/Smack Marijuana Crack)


Mode of Intake Snorting, Injection Oral, Inhalation Snorting
Effects (Property) Neuro depressant, Interact with cannabinoid Sense of euphoria

Slow down the functions receptors, Cardiovascular interferes with


of the body system effects neurotransmitters,
Hallucination

Acquired Immunity
May be Humoral (containing antibodies which circulate in body fluids).
mediated by Blymphocytes.
Cell-Mediated (CMI) - mediated by T-lymphocytes
Acquired immunity may be active or passive.
Vaccination and immunisation are based on the property called memory of the
immune systems.

64 XII Biology
Symptoms of Allergy Sneezing, watery eyes, rashes, running nose and
difficulty in breathing.
Auto Immunity When the immune system of body starts distroying self cells
and molecules, called auto immune diseases eg Rheumatoid arthritis,
multiple sclerosis and insulin-dependent diabetes.
Immune system in the body play an important role in organ transplantation,
allergic reactions and auto immune diseases
Immune system consists of lymphoid organe, bone marrow, thymus, spleen,
lymph nodes and MALT (Mucosal Associated Lymphoid Tissue)
AIDS - (Acquired Immuno Dificiency Syndrome)
caused by HIV (Human Immunodeficiency Virus) which belongs to retrovirus
category of viruses.
Modes of transmission
By sexual contact with infected person
By transfusion of contaminated blood and blood products
By sharing the infacted needles
From infected mother to child through placenta
Persons who are at high risk of getting infection include-
Individuals who have multiple sex partners
Drug addicts taking drugs intravenously
Individuals who require repeated blood transfusions
Children born to HIV infected mother
Prevention of AIDS
Using disposal syringes and needles, checking the blood of HIV, controlling
drug abuse, free distribution of condoms and advocating safe sex.
Main test for AIDS in ELISA (Enzyme Linked Immuno Sorbant Assay)
Cancer
Carcinogens induce the transformation of normal cells into cancerous cells eg.
UV rays, X-rays, -rays, anilene dyes and tumour viruses, cadmium oxide,
mustard gas, Ni & Cr compounds etc
Two types of tumors (a) Benign confined to the area of formation and
do not spread to other parts. (b) Malignant - show metastasis ie. cells

65 XII Biology
of these tumors can be carried by blood stream or lymph to other parts of
body and form secondaries in neighbouring organs.
Treatment through surgery, radiotherapy, chemotherapy, immunotherapy.

QUESTIONS

VSA (1 MARK)

Name the diagnostic test which confirms typhoid.


Name the two major groups of cells required to attain specific immunity.
You have heard of many incidences of Chickengunya in our country. Name the
vector of the disease.
Breast fed babies are more immune to diseases than the bottle fed babies. Why?
Name the pathogen which causes malignant malaria.
Which microorganism is used to produce hepatitis B Vaccine?
What is the reason of shivering in malarial patient?

SA-II (2 MARKS)

Where are B-cells and T-cells formed? How do they differ from each other?
Given below are the pathogens and the diseases caused by them. Which out of
these pairs is not correct matching pair and why?
(a) Wuchereria Filariasis
(b) Microsporum Ringworm
(c) Salmonella Common Cold
(d) Plasmodium Malaria

What would happen to the immune system, if thymus gland is removed from the
body of a person?
Lymph nodes are secondary lymphoid organs. Describe the role of lymph nodes
in our immune response.
What is the role of histamine in inflammatory response? Name few drugs which
reduce the symptoms of allergy.

66 XII Biology
SA-I (3 MARKS)

What are Cannabinoids? From which plant Cannabinoids are obtained? Which
part of the body is affected by consuming these substances?
In the figure, structure of an antibody molecule is shown. Observe it and Give the
answer of the following questions.
Label the parts A, B and C.
Which cells produce these chemicals?
State the function of these molecules.

Mention any three causes of drug abuse. Suggest some measures for the
prevention and control of drug abuse.
A person shows unwelcome immunogenic reactions while exposed to certain
substances.
Name this condition.
What common term is given to the substances responsible for this
condition?
Name the cells and the chemical substances released which cause such
reactions.

67 XII Biology
Fill in the blanks in the different columns of the table given below to identify the
nos 1 to 6.

Name of disease Causative organism Symptoms


1. Pneumonia Streptococcus (1)

2. Typhoid (2) High fever, weakness,


headache, stomach pain
3. (3) Rhinoviruses Nasal Congestion, and
discharge sorethroat
cough, headache
4. Ascariasis Ascaris (4)
5. Ringworm (5) Dry, Scaly lesions on
various body parts,
Intense itching, redness.
6. (6) Entamoeba histolytica Constipation, cramps,
abdominal pain, Stools
with excess mucous and
blood clots.

In the given flow diagram, the replication of retrovirus in a host cell is shown.
Examine it and answer the following questions
Why is virus called reterovirus? (b) Fill in (1) and (2)
Can infected cell survie while viruses are being replicated and released by
host cell?

68 XII Biology
What is innate immunity? List the four types of barriers which protect the body
from the entry of the foreign agents.

LA (5 MARKS)

Answer the following with respect to Caner.


How does a cancerous cell differ from a normal cell?
Benign tumor is less dangerous than malignant tumor. Why
Describe causes of cancer.
mention two methods of treatment of the disease.
The pathogen of a disease depends on RBCs of human for grwoth and
reproduction. The person with this pathogen suffers with chill and high fever.

Identify the disease.


Name the pathogen.
What is the cause of fever?
Represent the life cycle of the pathogen diagrammatically.
The immune system of a person is supressed. He was found positive for a
pathogen in the diagnostic test ELISA.
Name the disease, the patient is suffering from.
Which pathogen is identified by ELISA test?
Which cells of the body are attacked by the pathogen?
Suggest preventive measure of the infection.

ANSWERS
VSA (1 MARK)
Widal test
B-lymphocytes and T-lymphocytes.
Aedes mosquitoes.
The mothers milk consists of antibodies (Ig A) such antibodies are not available
to bottle fed babies.
Plasmodium falciparum.

69 XII Biology
Yeast.
After sparozoite infection, when RBC ruptures, a toxic substance haemozoin is
released which cause chilling and high fever.

SA-II (2 MARKS)

B-cells and T-cells are formed in bone marrow. B-cells produce antibodies but E-
cells do not produce antibodies but help B-cells to produce them.
Salmonella : Common cold is not a matching pair.
T-lymphocytes are developed and matured in thymus gland, Immune system will
become weak on removal of thymus gland.
Lymph nodes provide the sites for interaction of lymphocytes with the antigen.
When the microorganisms enter the lymph nodes, lymphocytes present
there are activated and cause the immune response.
Histamine acts as allergy-mediator which cause blood vessels to dilate. It is
released by mast cells. Antihistamine steroids and adrenaline quickly reduce
the symptoms of allergy.

SA-I (3 MARKS)

Cannabinoids are a group of chemicals which interact with Cannabinoid


receptors present
Principally in the brain Cannabinoids are obtained from the inflorescences
of the plant Cannabis sativa.
The substances affect the cardiovascular system adversely
(a) A-Antigen binding site B-Light chain
B-lymphocytes.
Heavy Chain
Antibodies provide acquired immune response.
Reasons to attract towards drug abuse : Curiosity, peer pressure, escape
from frustation and failure, family problems, false belief of enhanced
performance.

70 XII Biology
Preventive measures :
Avoid undue peer pressure
Education and Counselling
Seeking help from parents and peers.
Looking for danger signs
Seeking professional and medical help
(a) Allergy (b) Allergens
Mast Cells Histamine, Serotonin
(i) Alveoli filled with fluid, reduced breathing, fever, chills, cough and headache.
Salmonella typhi
Common Cold
Internal bleeding, muscular pain, anaemia, fever and blockage of the
intestinal passage.
Microsporum species/Trichophyton species/Epidermophyton Species.
Amoebiasis/amoebic dysentery
(a) HIV has RNA genome. It produces DNA by reverse transcription.
1 : Viral DNA is produced by reverse transcriptase. 2 : New
Viral RNA is produced by the infected cell.
Infected cell can survive.
Innate Immunity is non-specific type of defense that is present at the time of birth.
Physical Barriers : Skin, mucous-coated epithelium or respiratory, digestive
and urinogenital tract.
Physiological Barriers : Acidity of Stomach, lysozyme in saliva, tears,
sweat.
Cellular Barrier : Macrophages, neutorophils, monocytes and natural killer
lymphocytes..
Cytokine Barriers : Interferons produced by Viral infected cells, protect the
non-infected cells from further Viral infection.

71 XII Biology
(a) In normal cells, growth and differentiation is highly controlled and regulated
(contact inhibition). The cancerous cells have lost the property of
contact inhibition, hence continue to divide giving rise to masses of cells
(tumors).
The benign tumor remains confined in the organ affected as it is enclosed in
a connective tissue sheath and does not enter the metastatic stage.
Cancer may be caused due to carcinogens which are physical (radiations),
chemicals (Nicotine, Aflatoxin, Cadmium oxide, Asbestos) and
biological (viral oncogens).
Surgery, radiotherapy, Chemotherapy
(a) Malaria
Different species of Plasmodium viz P. vivax, P. Malariae and P. falciparum.
Malaria is caused by the toxins (haemozoin) produced in the human body by
the malarial parasite. This toxin is released by the rupturing of RBCs.
Life cycle of Plasmodium : Fig. 8.1 Page 148, NCERT book, Biology - XII
(i) AIDS (Acquired Immuno Deficiency Syndrome)
HIV (Human Immunodeficiency Virus)
Helper T-cells, macrophages, B-lymphocytes.
Preventive measures :
People should be educated about AIDS transmission.
Disposable needles and syringes should be used
Sexual habits should be changed immediately
High-risk groups should be discouraged from donating blood.
Routine screening may be done.

72 XII Biology
CHAPTER 9

STRATEGIES FOR ENHANCEMENT IN


FOOD PRODUCTION

POINTS TO REMEMBER
Apiculture : Rearing of honeybees for the production of honey, beewax, royal
jelly and bee Venom.
Artificial insemination : Introduction of semen of good quality of male into the
vagina of female.
Explant : A part of plant excised from its original location and used for tissue
culture.
Germplasm Collection : The entire collection having all the diverse alleles for all
the genes in the given organism.
Inbreeding depression : Continued close inbreeding decreases the fertility and
productivity.
Inbreeding : Inbreeding refers to the mating of more closely related individuals
within the same breed for 4-6 generations.
Out- breeding : Out-breeding is the breeding of the unrelated animals, which
may be between individuals of the same breed (but having no common
ancestors), or between different breeds (cross breeding or different species
(interspecific hybridisation).
Super Ovulation : Stimulation of good female animal by administering hormones
to produce more eggs.
Mutation breeding : Mutation in plants in induced artificially through use of
mutagens to obtain desirable characters. These plants (as a source) are used in
breeding.
Totipotency : The ability to generate a whole plant from any cell/explant.

ABBREVIATIONS
ET : Embryo Transfer
IARI : Indian Agricultural Research Institute
IRRI : International Rice Research Institute

73 XII Biology
ICAR : Indian Council of Agriculture Research
MOET : Multiple Ovulation Embryo Transfer
NDRI : National Dairy Research Institute
Animal Husbandry care and breeding of livestock, useful to human beings.

Poultry Farm Management- Chicken and ducks and some times turkey and
geese are included in poultry.
Bee-keeping (Apiculture) (Apis indica is the most common species of honey
bee.) Maintenance of honey bee for production of honey and wax. Honey is
a food of high nutritive value.
Management of fisheries
Fresh water fishes - Catla, Rohu, common carp etc.
Marine fishes - Hilsa, Sardines. Mackerel and Pomfrets etc.
Aquaculture and Pisciculture - The production of useful aquatic plants and
animals (both freshwater and marine) like fishes, prawns lobsters and
edible oysters is called aquaculture while the production of fishes only is
called pisciculture.
Blue-revolution is associated with fish production.
Out crossing - The practice of mating of animals of same breed but have no
common ancestor on either side of pedigree upto 4-6 generations. A single
outcross helps to overcome the inbreeding depression.
Cross breeding - The method of outbreeding in which superior males of one
breed are mated with the superior females of another breed of same
species.
Main steps in breeding a new genetic variety of crop
Germ-plam collection or collection of variability
Evaluation and selection of parents
Cross breeding or hybridisation of selected parents.
Selection and testing of superior recombinants
Testing, release and commercialisation of new cultivars.
High yielding varieties of (i) Wheat - Sonalika, kalyan sona
Rice - IR-8, Taichung Native-1, Jaya, Ratna, Padma etc.
Sugar Cane - A hybrid of Saccharum barberi and S. officinarum.
Disease of plants -
Viral - Tobacco mosaic, turnip mosaic
Bacterial - Black rot of crucifers, Blight of rice
Fungal - Rust of wheat, red rot of sugarcane, late blight of potato.

74 XII Biology
Germplasm - The sum total of all the alleles of the genes present in an individual
organism and its related species
Explant - A plant part excised from a specific location in a plant to be used for
initiating a culture.

75 XII Biology
QUESTIONS

VSA (1 MARK)

Why is inbreeding necessary in animal husbandary?


Name two fungal diseases of Crop plants.
Which product of Apiculture is used in cosmetics and polishes?
Semi-dwarf varieties of a crop plant were derived from IR-8. Name that crop.

Write two qualities of Saccharum officinarum (Sugarcane) grown in South India.

SA-II (2 MARKS)

A new breed of sheep was developed in Punjab by crossing two different breeds
of Sheep. Name the two breeds which were crossed and the new breed
developed.
Study the table given below and fill in the blanks marked A, B, C and D

[Link]. Crop Variety Resistant to Disease


1. Wheat Himgiri (A)
2. Brassica (B) White rust
3. (C) Pusa Komal Bacterial blight
4. Chilli (D) Chilly mosaic Virus, Tobacco
mosaic Virus and leaf curl

Why are proteins synthesized from Spirulina called Single celled Proteins? What
is the significance of such a protein?
Differentiate between inbreeding and outbreeding in animals.

76 XII Biology
Observe the process of Somatic hybridisation given below and fill in the blanks.
(i), (ii), (iii) and (iv)

SA I (3 MARKS)
What is micropropagation? Why are plants produced by this technique called
somaclones? Name any two food plants which are produced on commercial
scale using this method.
What is mutation? Explain the significance of mutation in plant breeding. Give an
example of a disease resistant variety of cultivated plant induced by
mutation.
How can we improve the success rate of fertilisation during artificial insemination
in aminal husbandary programmes?
Biofortification is the most practical means to improve public health. Justify the
statement with examples.
What is meant by germplasm Collection? Describe its significance in plant
breeding programmes.
To which product, following products are related (a) Blue revolution (b) white
revolution (c) Green revolution

77 XII Biology
LA-I (5 MARKS)

Does apiculture offer multiple advantages to farmers? List its advantages, if it is


located near a place of commercial flower cultivation. Name the most
common species of bee which is reared in India.
What is somatic hybridisation? Describe the various steps in producing somatic
hybrids from protoplasts. Mention any two uses of somatic hybridisation.

ANSWERS
VSA (1 MARK)
Inbreeding increases homozygosity.
Brown rust of wheat, Smut of wheat, red rot of Sugar cane, Late blight of potato.
Beewax.
Paddy crop (rice)
Thicker stem and higher sugar content.

SA-II (2 MARKS)

By crossing Bikaneri ewes and Marino rams, the new breed Hisardale was
developed.
A Leaf and Stripe rust, hill bunt. B
Pusa swarnim (Karan rai).
C Cowpea
D Pusa Sadabahar
The protein rich food produced by microbes is called as single called protein
(SCP) Spirulina is a microorganisms which has more protein. It is a quick
method of protein production because the growth rate of microbes is
enormous. Hence, it provides a protein rich diet for human beings.
When breeding is between animals of the same breed, it is called inbreeding,
while cross between different breeds in called out breeding.
(i) Isolation of protoplast of Tomato cell and Potato cell.
Somatic hybridisation.
Pomato
Somatic hybrid

78 XII Biology
SA-I (3 MARKS)

The method of producing many plants through tissue culture is called


micropropagation.
The plants produced through micropropagation will be genetically identical
to the original plant from which they were grown, hence are called
somaclones.
Tomato, banana, apple are produced on commercial scale using this
method.
Mutation : Sudden inheritable change in the characters of an organism due to
change in the sequence of bases in the gene(s).
Mutation results in a new character or trait, not found in the parental type

It can also be induced by using mutagens like gamma radiations.


Such plant materials are used as such or used for breeding new variaties.

Mung bean resistance to yellow mosaic virus and powdery mildew.


The Multiple Ovulation Embryo Transfer (MOET) technology can improve the
success rate of fertilisation.
In the procedure, a cow is given hormonal treatment (FSH), so that more
than one ova/eggs (6-8) are produced per cycle. After mating or artificial
insemination the embryos at 8-32 celled stage, are transferred to different
surrogate mother cows. This technology has been successfully used for
cattle sheep, rabbit, mares and buffalloes.
Biofortification is the plant breeding programme designed to increase Vitamins,
minerals, heigher proteins and healthier fat content in crops. This
programme improves the quality of food products. It is required to prevent
hidden hunger. Some of the examples of fortified crops are:
New hybrid of maize : has twice the amount of amino acid lysine and
tryptophan.
Wheat : Atlas 66, having a high protein content.
Rice : 5 times iron than the normal amount. IARI Delhi has released several
crops which are rich in vitamins and minerals. Consumption of such
biofortified food will vastly improve the public health.
The collection of all the diverse alleles of all the genes of crop plant is called
germ plasm collection.
In plant breeding programmes, the germplasm provides the entire of genes

79 XII Biology
and alleles, and the characterstics which they express. The plant breeders
select the most favourable characters of a particular gene and manipulate its
transfer to a desirable parent.
16. (a) Fish production (b) Milk production (c) Crop production

LA (5 MARKS)

Apiculture or Bee-Keeping is the maintenance of hives of honeybees for the


production of honey. Apiculture is beneficial for farmers in many ways.
Honey bee also produces beewax which is used in industries, such as in
preparation of cosmetics and polishes of various kinds. If Bee keeping is
practiced in any area the commercial flowers are cultivated, it will be
beneficial in the following ways.
Bees are pollinators of many crop species including flowering crops such as
sunflower.
It improves the honey yield, because honeybees collect the nectar from
flowers for making honey.
Apis indica is the msot common species whch is reared in India.
Somatic Hybridisation : The process of fusing protoplasts of Somatic cells
derived from different varieties or species of plants to produce a hybrid.

Steps :
Removal of cell wall of fusing cells by digestion with a combination of
pectinase and cellulase to form protoplasts.
Fusion between protoplasts of selected parents is induced by the use of poly
ethylene glycol (PEG).
The resulted product is cultured on a suitable medium to regenerate cell
walls.
The cells obtained begin to divide to produce plantlets called somatic
hybrids.
Uses/Applications :
Somaclonal variations can be created
Lines or varieties/species of plants which can not be sexually hybridised,
they can be hybridised.
Allopolyploids can be raised by the method.

80 XII Biology
CHAPTER 10

MICROBES IN HUMAN WELFARE

POINTS TO REMEMBER
Activated Sludge Process : Aerobic sewage treatment process using aerobic
micro-organisms present in sewage sludge to break down organic matter in
sewage.
Biofertilisers : Microorganisms which produce fertilisers and enrich the soil e.g.,
Bacteria, cyanobacteria and fungi.
Bioactive Molecules : Molecules produced for commercial use from microbes
and used for various purposes e.g., Trichoderma polysporum (fungus) is used to
obtain immunosuppressive agent cyclosporin A.
Biochemical Oxygen Demand (BOD) : Total amount of oxygen consumed by
bacteria for oxidation of organic matter present in one litre of water.
Baculovirus : Pathogens that attack insects and other arthropods. They are
used to kill harmful pests and arthropods e.g., Nucleopolyhedrovirus.
Biocontrol Agents : Use of biological methods for controlling plant diseases and
pests
Effluent : The product of primary treatment of sewage which is passed into large
aeration tanks for secondary treatment.
Fermentation : The process by which microorganisms turn organic materials
such as glucose into products like alcohol.
Fermentors : A very large vessel used in industry where microbes are grown on
an industrial scale.
Flocs : During secondary treatment of effluent, excessive growth of aerobic
bacteria and fungi form a mass of mesh like structure called flocs.
Immunosuppressive Agent : Chemical substances which suppress the
immunity against organ transplant.
Lactic Acid Bacteria (LAB) : Bacteria growing in milk and convert it into curd
e.g., Lactobacillus.

81 XII Biology
Organic Farming : Technique of farming, in which biofertilisers are used to
enrich the soil.
Prions The proteinaceious infectious plants.
Thermal vents - The sites deep inside the geysers/ hot springs, where the
average temp. is as high as 100C.
Methanogens - Bacteria producing large quantity of methane during
decomposition of organic matter.
DO : Dissolved Oxygen
GAP : Ganga Action Plan
KVIC : Khadi and Village Industries Commission
TMV : Tobacco Mosaic Virus
YAP : Yamuna Action Plan
IPM : Integrated Pest Management.
Microbes includes protozoa, bacteria, fungi, microscopic plants, viruses, viroids
and prions.
Microbes in household products :

Microbes in pruduction of Biogas


Some bacteria which grow anaerobically on cellulosic material produce large
amount of Methane (CH4), along with Carbondioxide and hydrogen. These
bacteria are called methanogens e.g., Methanobacterium.
Methanogens are naturally found in rumen of cattle and sewage.

82 XII Biology
Microbes as Biocontrol Agents

Microorganisms Catgory Action


(i) Trichoderma Species fungus Kills pathogen in the root
system
(ii) Bacillus thuringiensis bacteria Kills the insect pest (Bt-cotton)
(iii) Nucleopolyhedrovirus Virus Kills insects and other
(Baculoviruses) arthropods.

Microbes as Biofertilisers
Rhizobium, Azospirillum, Azotobacter (Bacteria) Anabaena, Nostoc,
Oscillatoria (Cyanobacteria) Genus Glomus (Mycorrhiza).
Microbes in Industries
Fermented Beverages : Saccharomyces cerevisae a yeast is used to make
bread, fermented fruit juice and alcohol.
Antibioitics : Penicillium notatum
Other chemicals /enzymes/Bioactive molecules Many organic acids, enzymes are
also produced by microorganisms
[Link]. Microbe Category Product
1. Aspergillus niger Fungus (Yeast) Citric Acid
2. Acetobacter Aceti bacterium Acetic acid (Vinegar)
3. Saccharomyces cerevisae Fungus Ethanol
4. Lactobacillus Bacteria Lactic acid
5. Streptococcus Batreria Streptokinase
6. Clostridium butylicum Bacteria Butyric acid
7. Monascus purpureus Fungus (Yeast) Statin (Blood cholesterol
lowering agent)
8. Trichoderma polysporum Fungus Cyclosporin A
(Immunosupressive
agent)

Microbes in sewage Treatment


Hetrotrophic microbes present in the sewage are involved in the treatment of
water. Some methanogenic bacteria are commonly found in the anaerobic sludge
during sewage treatment.

83 XII Biology
QUESTIONS
VSA (1 MARK)
How does a small amount of curd added to fresh milk convert it into curd?
Mention a nutritional quality that get added to the curd.
Why is secondary treatment of water in sewage treatment plant called biological
treatment?
An antibiotic called Wonder Drug was used to treat the wounded soldiers of
America during World War-II. Name the drug and the scientist who
discovered it.
You have observed that fruit juice in bottles bought from the market are clearer as
compared to those made at home. Give reason.
Alexander Fleming discovered Penicillin, but its full potential as an effective
antibiotic was established by other scientists. Name the two scientists.
Name the plant whose sap is used in making Toddy. Mention the process
involved in it.

SA II (2 MARKS)
Name two alcoholic drinks produced in each of the following ways.
by distillation and (ii) without distillation.
Lactic Acid Bacteria (LAB) is commonly used in the conversion of milk into curd.
Mention any two other functions of LAB that are useful to humans.
How do mycorrhizae function as biofertilisers? Explain with example.
Cyanobacteria (Nostoc, Anabaena) are used as biofertilisers in certain crop
fields. Name such one crop. Also, mention the names of two other
microorganisms which perform the same function.
Which Ministry of Govt. of India had initiated Ganga Action Plan and Yamuna
Action Plan? What are the objectives of these plans?
Fill in the blanks spaces a, b, c, d, e, and f, given in the following table:
S. No. Name of Organism Commercial Product Application
1. Penicillium notatum Penicillium (a)
2. (b) Lactic acid Making Curd.
3. Streptococcus Clot buster enzyme (c)
4. Trichoderma polysporum (d) Immuno
supressive agent
5. Saccharomyces cerevisiae Ethanol (e)
6. (f) Swiss cheese Food Product

84 XII Biology
What is biochemical oxygen demand (BOD) test? At what stage of Sewage
treatment this test is performed?
BOD level of three samples of water labelled as A, B and C are 30 mg/ L,
10mg/L and 500 mg/L respectively. Which sample of water is most polluted?

Given below is the Flow chart of Sewage treatment. Fill in the blank spaces
marked a to f.

What are biofertilisers? A farmer is advised to add a culture of bacterium in the


soil before sowing the crop. Name the bacterium in the culture. How is this
bacterium useful to the crop?
What are statins? Name the microorganism that produces this substance. How is
it medically important?

LA (5 MARKS)

How does primary sludge differ from activated sludge? What type of changes in
the sludge are carried out in anaerobic sludge digester? Give the
composition of biogas produced in the sewage treatment plant.

85 XII Biology
ANSWERS
VSA (1 MARK)
A large number of lactic acid bacteria are found in small amount of curd which
multiply and convert the milk into curd by producing the lactic acid. The
nutritional quality improves by increasing Vitamin B12.
In this treatment Organic wastes of sewage water are decomposed by certain
microorganisms in presence of water.
Penicillin, Alexander Fleming.
Bottle juices are clarified by the use of pectinase and proteases.
Ernest chain and Howard Florey.
Palm tree, by fermentation.
(i) Whisky, brandy, rum by distillation
Wine, beer without distillation
(i) LAB in human intestine synthesizes Vitamin B12.
LAB in human stomach checks the growth of harmful microbes.
Mycorrhiza are fungi associated with the roots of plants. Many members of genus
Glomus form mycorrhiza. These fungal symbiont absorbs water and
minerals like phosphorus from the soil and provide them to the plant.
Peddy (Rice Crop), Rhizobium and Azotobacter.
The Ministry of Environment and Forests.
The objective of Ganga Action Plan and Yamuna Action Plan is to save
these rivers from pollution. It was proposed to build a large number of
sewage treatment plants. So that only treated sewage may be
discharged into these rivers.

SA-I (3 MARKS)
(i) to kill disease causing bacteria
Lactobacillus
remove clots from blood vessels
Cyclosporin A
Beverage/medicines
(d) Propionibacterium sharmanii.

86 XII Biology
The BOD test measures the rate of uptake of oxygen by microorganisms in a
sample of water.
Biological treatment or Secondary treatment
Sample C is most polluted because it has highest BOD level among the
three samples of water.
(a) Primary treatment (b) Aeration
(c) Flocs (d) Biochemical Oxygen Demand (BOD)
Activated sludge (f) Water bodies like riverstream.

Biofertilisers are organisms that enrich the nutrient quality of the soil.
Azotobacter/Azospirillum (free living)
This bacterium fixes atmospheric nitrogen into organic forms, which is
used by the plants as nutrient.
Statins are cholesterol reducing agents.
They are produced by Monascus purpureus (Yeast)

They act by Competitively inhibiting the enzymes responsible for


synthesis of cholesterol and are used as blood cholesterol lowering
agents.

LA (5 MARKS)

Primary sludge is all solids like soil, small pebbles that settle down in settling tank
during primary treatment of sewage.
Activated sluge is the sediment of bacterial flocs in settling tank during
biological treatment. Flocs are masses of bacteria held together by slime and
fungal filaments. A part of activated sluge is used as inoculum in aeration
tank and remaining is passed into a large tank called anaerobic sluge
digester. In this tank, other kind of bacteria which grow anaerobically, digest
the bacteria, fungi and biomass in the sludge. Biogas that produced in
Sewage treatment plant is a mixture of metnane, hydrogen and Carbon
dioxide.

87 XII Biology
CHAPTER 11

BIOTECHNOLOGY :
PRINCIPLES AND PROCESSES

POINTS TO REMEMBER
Bacteriophage : A virus that infects bacteria.
Bioreactor : A large vessel in which raw materials are biologically converted into
specific products under optimal conditions such as temperature, pH, substrate,
salts, vitamins, oxygen. Stirring type bioreactors are commonly used.
Biotechnology : It deals with techniques of using live organisms (Microbes,
plants animals) or components for benefit to humans.
According to EFB (European Federation of Biotechnology) :
Biotechnology in the integration of natural science and organisms, cells, parts
thereof and molecular analogues for products and services.
Cloning Vectors : A small, self-replicating DNA molecule into which foreign DNA
is inserted. It replicates inside the host cell. The vectors that may be used in
genetic engineering are plasmids, bacteriophages, animal, plant, virus, YACS and
BACs and insome yeasts.
Features of cloning vector: Origin of replication (Ori), selectable marker and
cloning sites are the features that are required to facilitate cloning into a vector.
Origin of Replication (Ori) : This is a sequence from where replication starts
and any piece of DNA when linked to this sequence can be made to replicate
within the host cells. This sequence is also responsible for controlling the copy
number of the linked DNA.
Selectable Marker : It is a gene which helps in identifying and eliminating non-
transformants from transformants (having recombinant DNA) by selectively
permitting the growth of transformants. The process through which a piece of
DNA is introduced in a host bacterium is called transformation. The genes
encooling resistance to antibiotics are considered useful selectable marker for
[Link].

88 XII Biology
(c) Cloning Sites : A location on a cloning vector into where a foreign gene can
be introduced is called a cloning site. The vector must have very few (preferably
single) recognition sites. The presence of more than one recognition sites within
the vector will produce several fragments which will make the process of gene
cloning more complicated. Therefore, the foreign DNA is ligated at a restriction
site present in one of the two antibiotic resistance gene.
Complementary DNA (cDNA) : A DNA strand formed from mRNA by using the
enzyme reverse transcriptase.
Plasmid : Extra chromosomal, self replicating circular DNA molecule found in
certain bacteria and in some yeasts. It has a few genes. Plasmids are used as
cloning vectrors in genetic engineering.
Genetic Engineering : The techniques to alter the chemistry of genetic material
and introduction of it into organisms to change its phenotype.
Ligase : An enzyme used by a genetic engineer to join the cut ends of the double
stranded DNA.
Palindromic Sequence : Complementary DNA sequences that are the same
when each strand is read in the same direction (5 3). These sequences act as
recognition sites for restriction endonucleases.
5 GAATTC 3
3 CTTAAG 5
Restriction Enzymes : The enzyme that cuts out a piece of DNA at a specific
site. These are of two types : exonucleases and endonucleases.
Sticky ends : Single stranded portions of DNA which can form hydrogen bonds
with their complementary cut DNA segments. These ends can be joined by
enzyme ligase.
Taq polymerase : A heat stable DNA polymerase isolated from a thermophilic
bacterium Thermus aquaticus and is used in PCR.
Ti Plasmid : An extrachromosomal, double stranded and self replicating DNA
molecule found in Agrobacterium tumefaciens that causes tumor in plants.
Tools of Recombinant DNA Technology : Restriction enzymes, polymerase
enzymes, ligases, vectors, and host organisms.
Steps in Formation of rDNA by action of EcoRI : EcoRI cuts the DNA between
bases G and A only sticky ends of cut DNAs are formed DNA fragments join
at sticky ends Recombinant DNA is formed.

89 XII Biology
Recombinant DNA (rDNA) : The hybrid DNA formed by combining DNA
segment of two different organisms.
Process of Recombinant DNA Technology : Isolation of DNA Cutting of
DNA using restriction endonuclease Amplification of Gene using PCR
Making rDNA and insertion of it into host cell/organism obtaining the foreign
gene product Downstream processing.
Isolation of Genetic Material (DNA) :
DNA can be obtained from the cell by treating with enzymes like,
Lysozyme for bacteria, Cellulase for plant cell, Chitinase for fungus.
Histone protein and RNA can be removed by treating with proteases and
ribonuclease
Purified DNA ultimately precipitated by the addition of chilled ethanol. Fine
threads of DNA are obtained in the suspension.
Cutting of DNA at specific location : The purified DNA is cut by use of
restriction enzymes. Agarose gel electrophoresis used to check the
progression of restriction enzymes digestion.
Amplification of gene of interest using PCR : Amplification is the process of
making multiple copies of desired DNA segment in vitro. Polymerase chain
reaction involves three steps:
Denaturation : The target DNA is heated to high temperature (94C),
resulting the separation of two strands of DNA. Each strand acts as
template.
Annealing : Two oligonucleotide primers anneal to each of the single
stranded DNA template.
Extension of primers : DNA polymerase (Taq polymerase) extends the
primers using the nucleotides provided in the reaction.
Ligation : The cut out gene of interest from the source of DNA and cut vector
with appropriate space, are mixed and ligase enzyme is added. This results
recombinant DNA (r-DNA).
Transfer of recombinant DNA into the host : The ligated DNA is introduced
into the recipient cell. The recipient cell makes itself competent to receive
and take up DNA present in the surrounding.
Obtaining the foreign gene product : The cell containing the foreign gene is
cultured on suitable medium and the product can be extracted from the
medium.

90 XII Biology
Bioreactors are used for processing large volume of culture for obtaining
products of interest in sufficient quantities.
Downstream Processing : The products so obtained undergo a series of
processes before putting them in market as a finished product. The
processes include separation and purification.
The products are formulated with suitable preservation and subjected to
quality control testing and clinical trials. (in case of drugs)
Essential features required to facilitate cloning into vector : Ori, Selectable
marker, Recognition site, small size.
Some of the Biotechnological products and processes : rDNA vaccines,
Gene therapy, Test tube babies, Synthesis of a gene and introduction of it into a
target cell/organism.
Steps in creating GMO : Identification of gene of interest Introduction of rDNA
into host cell/organism Maintenance of introduced DNA in the host and transfer
of the DNA to its progeny.
Gel Electrophoresis : DNA fragments are regatively charged molecules. They
can be separated by forcing them to move towards anode under an electric field
through a medium. Agarose gel is used as medium. Ethidium bromide is used as
stain for DNA, which on exposure to UV-light appear as orange coloured bands.
Separated bands of DNA are cut out from agrose gel. This is called elution.
These DNA fragments are used in recombinant DNA by joining them with cloning
vectors.

QUESTIONS

VSA (1 MARK)

A restriction enzyme digests DNA into fragments. Name the technique used to
check the progression of this enzyme and separate DNA fragments.
Name two commonly used vectors in genetic engineering.
Some enzymes are considered as molecular scissors. in genetic engenrring.
What is the name assigned to such enzymes?
Write conventional nomenclature of EcoRI.
A linear DNA fragment and a plasmid has three restriction sites for EcoRI how
many fragments will be produced from linear DNA and plasmid respectively.

91 XII Biology
An extra chromosomal segment of circular DNA of a bacterium is used to carry
gene of interest into the host cell. What is the name given to it?
Identify the recognition sites in the given sequences at which [Link] will be cut
and make sticky ends.
5GAATTC3
3CTTAAG5

SA-II (2 MARKS)

Name two main steps which are collectively referred to as down streaming
process. Why is this process significant?
How does plasmid differ from chromosomal DNA?
A bacterial cell is shown in the figure given below. Label the part A and B. Also
mention the use of part A in rDNA technology.

Mention two classes of restriction enzymes. Suggest their respective roles.


In the given process of separation and isolation of DNA fragments, some of the
steps are missing, Complete the missing steps
A : Digestion of DNA fragments using restriction endonucleases

B : ..............................................................

C : Staining with ethidium bromide

D : Visualisation in U.V. light

E : .............................................................

F : Purification of DNA fragments.

92 XII Biology
SA-I (3 MARKS)

Since DNA is a hydrophillic moelcule, it cannot pass through cell membranes.


Name and explain the technique with which the DNA is forced into (ii) a
bacterial cell (ii) a plant cell (iii) an animal cell.
How will you otbain purified DNA from a cell?
In recombinant DNA technology, vectors are used to transfer a gene of interest in
the host cells. Mention any three features of vectors that are most suitable
for this purpose.
Why is Agrobacteriummediated genetic engineering transformation in plants
considered as natural genetic engineering?
Observe the given sequence of nitrogenous bases on a DNA fragment and
answer the following question
5 CAGAATTCTTA 3 3
GTCTTAAGAAT 5
Name a restriction enzme which can recognise this DNA sequence.
Write the sequence after digestion.
Why are the ends generated after digestion called sticky ends?
A selectable marker is used in the section of recombinants on the basis of their
ability to produce colour in presence of chromogenic substrate.
Mention the name of mechanism involved.
Which enzyme is involved in production of colour?
How is it advantageous over using antibiotic resistant gene as a selectable
marker?

LA (5 MARKS)

The development of bioreactors is required to produce large quantities of


products.
Give optimum growth conditions used in bioreactors.
Draw a well labelled diagram of simple stirred tank bioreactor.
How does a simple stirred tank bioreactor differ from sparged stirred
tank bioreactor?

93 XII Biology
In the given figure, one cycle of polymerase chain reaction (PCR) is shown

Name the steps A, B and C.


Give the purpose of each of these steps.
State the contribution of bacterium Thermus aquaticus in this process.
Study the figure of vector pBR322 given below in which foreign DNA is ligated at
the Bam H1 site of tetracyline resistance gene.

94 XII Biology
Answer the following questions :
Mention the function of rop.
What will be the selectable marker for this recombinant plasmid and why?
Explain transformation.

ANSWERS
VSA (1 MARK)
Gel electrophoresis
Plasmid and Bacteriophage.
Restriction Enzymes.
E. Escherichia; co coli; R Name of Strain; I order in which enzyme
isolated from strain of bacteria.
Number of fragments of linear DNA = 4
Number of fragments of plasmid = 3
Plasmid.

7.

SA-II (2 MARKS)

Separation and Purification


This process is essential because before reaching into market, the
product has to be subjected for clinical trial and quality control.
9.
Plasmid DNA Chromosomal DNA
(i) Circular DNA (i) Linear DNA
(ii) Occurs only in bacterial cells (ii) Occurs in nucleus of eukaryotic cells
and bacterial cell.
(iii) Used as Vector (iii) Not used as vector in rDNA
in rDNA technology technology.

10. A Plasmid, B Nucleoid


Plasmid is used as vector to transfer the gene of interest in the host cell.

95 XII Biology
Exonucleases and endonucleases

Exonucleases remove nucleotides from the ends of the DNA.

Endonucleases cut DNA at specific sites beween the ends of DNA.

B Gel Electrophoresis E
Elution

SA I (3 MARKS)
(i) Chemical treatment and exposure to cold and high temp. (42C) alternatively.
(Bacterial cell)
Biolistics or gene gun. (Plant cell)
Micro-injection. (animal cell)
Explanation Refer page 200, biology Text Book for class XII.

Cells are treated with appropriate enzymes to release DNA. Lysozyme


(bacteria), cellulase (plant cells), chitinase (fungus).

RNA and proteins are removed by treatment with ribonuclease and


protease enzymes respectively.
(ii) Have origin of replication(Ori)
Have a selectable marker
Have at least one recognition site.
Agrobacterium tumefaciens is a pathogen in many dicot plants. It is able to
deliver a piece of DNA (TDNA) to transform normal plant cell into a tumor
and directs these tumor cells to produce the chemicals required by
pathogen.
(a) EcoRI

(b)

These are named sticky ends, because they form hydrogen bonds with their
complementary cut parts.

96 XII Biology
(a) Insertional inactivation

-galactosidase.

Selection of recombinants due to inactivation of antibiotics requires


simultaneous plating on two plates having different antibiotics. (Refer
page 200 NCERT Biology for class XII)

LA (5 MARKS

(i) Temperature, pH, susbtrates, salts, vitamins and oxygen.


Figure 11.7(a) simple stirredtank bioreactor Page No. 204 NCERT Text
book, Biology - XII
The stirrer facilitates even mixing and oxygen availability throughout simple
stirred tank bioreactor, whereas in case of sparged stirred-tank
bioreactor, air is bubbled throughout the reactor for proper mixing.
(A) Denaturation Heat denatures DNA to separate complementary strands.
Annealing : Primers hybridises to the denatured DNA strands.
Extension : Extension of primers resulting in synthesis of copies of target
DNA sequence. Enzyme Tag polymerase is isolated from the bacterium
Thermus aquaticus. This enzyme induces denaturation of double
stranded DNA at high temperature.
(a) rop codes for the proteins involved in the replication of plasmid
Selectable marker ampicillin resistance gene. It will help distinguishing
transformants from non-transformants after plating them on ampicillin
containing medium.
Transformation It is the phenomenon by which the DNA isolated from one
type of cell and introduced into another type and is able to bring about
some of the properties of former to the later.

97 XII Biology
CHAPTER 12

BIOTECHNOLOGY AND ITS APPLICATIONS

POINTS TO REMEMBER
Biopesticides : Biological agents that are used to control weeds, insects and
other pests.
Cry Gene : The Bt toxins are coded by a gene named Cry.
Cry Protein : The insecticidal protein which is produced by Bacillus
thuringiensis.
Green Revolution : Substantial increase in crop yields due to use of high
yielding varieties, use of fertilisers and pesticides, imrpoved agricultural practices
etc.
Genetically Modified Organisms (GMO) : The organisms which have altered
genes in them. These are also known as transgenic organisms.
Molecular Diagnosis : Refers to early detection of diseases using recombinant
DNA molecules and techniques like PCR and autoradiography.
RNA Interference (RNAi) : Process used to develop pest resistant plants. It
involves silencing of a specific mRNA due to complementary double stranded
RNA.
Sustainable Agriculture : It involves organic farming and other integrated
management practices which maintain soil fertility while increasing crop
productivity.
Uses of GM Plants : Tolerant to abiotic stress, Reduced dependence on
chemical pesticides, less post harvest-loss, Efficient use of minerals, enhanced
nutritional value.
Uses of Transgenic Animals : To study normal physiology and development, to
study diseases, to get biological products, to test vaccine and chemical safety
testing.
Gene Therapy : It is a technique of inserting genes into the cells and tissue of an
individual to treat a hereditary disease.

98 XII Biology
The first clinical gene therapy was given in 1990 to a four year old girl with
adenosine deaminase (ADA) deficiency. ADA enzyme is required for proper
functionng at immune system.
This disorder is caused due to the deletion of the gene for adenosine
deaminase enzyme.
In some children ADA deficiency can be cured by bone marrow plantation.
Lymphocytes from the blood of patient are grown in a culture. A functional
ADA cDNA is then introduced into these lymphocytes using retroviral vector.
The lymphocytes are transferred into the body of patients.
As these cells are not immortal, the patient required periodic infusion of such
genetically engineered lymphocytes.
If a functional gene is introduced into a bone marrow cells at early embryonic
stage, It could be a permanent cure of ADA deficiency.
Bt. Cotton : The soil bacterium Bacillus thuringiensis produced crystal protein
called cry protein that kills certain insects larvae such as tobacco budworm,
armyworm, beettles and flies.
Bt toxin protein exists as inactive protoxins, but once an insect ingest this
inactive toxin, it is converted into active form of toxin due to the alkaline pH
of the gut which solubilise the crystal. This causes swelling and lysis of
epithelial cells of midgut leading to death of insect larvae.
Bt toxin genes were isolated from Bacillus thuringiensis and incorporated
into the several crop plants such as cotton.
The proteins encoded by the genes :
crylAc and cryllAb control the cotton bollworms and crylAb control corn
borer.
Pest Resistant Plants : A nematode Meloidegyne incognitia infects
tobacco plants and reduces their yield.
Nematode specific genes were introduced into the host plant using
Agrobacterium as a vector.
The introduction of DNA was such that it produced both sense and anti-sense
RNA in the host cells.
These two RNAs being complementary to each other formed a double
stranded RNA (dsRNA) making it inactive.
This dsRNA molecule binds to and prevents translation of mRNA (silencing) of
the nucleotide by the process called RNA interference (RNAi).

99 XII Biology
The result was that the parasite could not survive in the transgenic host and
the transgenic plant got protected for the parasite.
Three Critical Research Areas of Biotechnology
Providing best catalyst in the form of improved organism usually a microbe.
Creating optimal conditions for a catalyst to act.
Downstreaming processing technologies to purify the desirable product.

QUESTIONS

VSA (1 MARK)

Name the technique based on the principle of antigen-antibody interaction used


in detection of a virus (HIV).
Development of a transgenic food crop may help in solving the problem of night
blindness in the developing countries, name this crop plant.
Which nematode infects the roots of tobacco plant and causes a great reduction
in yield?
The first transgenic cow, produced human protein enriched milk. Name the cow
and the protein found in milk.
The insulin produced using recombinant DNA technology is more advantageous
than the insulin extracted from pancreas of slaughtered cattle and pigs.
How?
Name two pest resistant plants produced by using recombinant DNA technology.

SA-II (2 MARKS)

What are the two methods for correcting ADA deficiency in a child?
Some crop plants are modified genetically by manipulating their genes. How are
they made beneficial?
GEAC is one of the organisation set up by Indian Government. Write its full form.
Give its two objectives.
Industrialised nations are exploiting the bioresources of under industrialised
nations. Justify the statement with a suitable example.

100 XII Biology


SA-I (3 MARKS)
Some multinational companies and other organisations are using bioresources
for commercial benefits, without proper authentication and compensation to
concerned authorities.
Give the term for this unauthorised act.
Suggest any two ways to get rid of this.
A bacterium Bacillus thuringiensis produces a toxic protein named cry protein
that is lethal to certain insects but not to bacterium
Why this toxin does not kill the bacteria?
What type of changes occur in the gut of insects on consuming this protein?
How man has exploited this protein for his benefit?
Given below is an incomplete flow chart showing the process of production of
nematode resistant tobacco plants based on RNAi technique.
Write the missing steps in proper sequence
(ii) At which level RNAi silences the gene?

101 XII Biology


LA (5 MARKS)
The clinical gene therapy is given to a 4 years old patient for an enzyme which is
crucial for the immune system to function.

Observe the therapeutical flow chart and give the answer of the following:
Complete the missing steps (B) and (D)
Identify the disease to be cured.
Why the above method is not a complete solution to the problem?
Scientists have developed a method to cure this disease permanently. How?
In the given figure, Agrobacterium is utilized for the production of a transgenic
crop. Explain the steps a, b, c, d and e shown in the figure.

102 XII Biology


In the given figure, Form (A) and Form (B) represents different forms of a
proteinaceous hormone secreted by pancreas in mammals.

What type of bonding is present between chains of this hormone?


What are these form (A) and form (B). How these forms differ from each
other?
Explain how was this hormone produced by Eli Lilly, an American company,
using rDNA technology.

ANSWERS
VAS (1 MARK)
ELISA (Enzyme linked immuno - sorbent Assay)
Golden Rice
Meloidegyne incognitia.
Rosie, alpha-lactalbumin
Insulin obtained from animal source causes allergy.
Bt Cotton, Bt Corn, Bt Brinjal.

SA-II (2 MARKS)
Bone marrow transplantation having functional ADA enzyme and Enzyme
replacement therapy.
More tolerant to abiotic stresses; pest resistant; reduction in post harvest losses;
increased nutritional value of food.
GEAC Genetic Engineering approval committee. Objectives of GEAC are
To make decisions regarding validity of GM research.
Safety of introducing GMO for public use.

103 XII Biology


Industrialised nations are collecting and patenting the genetic resources of
under industrialised country like India. An American Company got
patent rights on Basmati rice.
Valuable biomolecules obtained from bioresources are patented and used
for commercial purposes.

SA-I (3 MARKS)

(a) Biopiracy
(i) Benefits of bioresources should be shared between developed and
developing nations
Laws should be developed to prevent unauthorsied exploitation of them
bioresources.
(a) Produced in inactive form as Prototoxins.
Prototoxin becomes active toxin in alkaline pH of gut of insects. Toxins bind
to surface of midgut and cause perforation, swelling, lysis of cells
ultimately leading to death.
Specific Bt toxin genes isolated from Bacillus thuringiensis and
incorporated into several crop plants such as cotton and corn which
become pest resistant against certain insects.
13. (i) (b) Using Agrobacterium as a vector, introduced into tobacco
(d) dsRNA (double stranded RNA)

Silenced specific mRNA of the nematode


Parasite could not survive.
RNAi silences the gene at translation level

LA (5 MARKS)

14. (a) Step (B) : Lymphocytes are grown in culture medium.


Step (D) : Infusion of genetically engineered lymphocytes into patients.
Adenosine deaminase (ADA) deficiency.
As genetically engineered lymphocytes are not immortal, the patient requires
periodic infusion of cells.
If the gene isolated from bone marrow cells producing ADA is introduced into
cells at early embryonic stages, it could be a permanent cure.

104 XII Biology


15. Step (a) Plasmid is removed and cut open with restriction
endonuclease.
Step (b) Gene of interest is isolated from another organism and
amplified using PCR
Step (c) New gene is inserted into plasmid
Step (d) Plasmid is put back into Agrobacterium
Step (e) Agrobacterium based transformation.

(a) Disulphide bonds


Form (A) Proinsulin Form (B)
Mature insulin.
Proinsulin contains an extra stretch called C peptide which is absent
in mature insulin.
Eli Lilly company prepared two DNA sequences corresponding to A and B
peptide chains of human insulin and introduced them in plasmid E. coli
to produce insulin chains. Chains A and B were produced separately,
extracted and combined by creating disulphide bonds to form insulin.

105 XII Biology


CHAPTER 13

ORGANISMS AND POPULATIONS

POINTS TO REMEMBER
Adaptation : Any attributes of the organism (morphological, physiological,
behavioural) that enables the organism to survive and reproduce in its habitat.
Aestivation : Strategy to escape in time during summers (summer sleep). E.g.,
Snails and some fishes.
Allens Rule : Mammals from colder climates generally have shorter ears and
limbs to minimise heat loss.
Carrying Capacity : Maximum number of individuals of a population which can
be provided with all the necessary resources for their healthy living.
Commensalism : One organism is benefitted while the other is neither harmed
nor benefitted except to a negligible extent.
Competition : Rivalry between two organisms for obtaining the same resources.

Ectoparasite : Parasites which live on the surface of their host.


Emigration : Number of individuals of the population who have left the habitat
and gone elsewhere during a given time period.
Exponential Growth Curve : Shows that if food and space for a population are
unlimited and each species has the ability to grow, then the population grows in
exponential or geometric ratio.
Hibernation : Strategy to escape in time during winters (winter sleep). E.g., Polar
bears.
Homeostasis : Maintaining constancy of internal environment despite varying
external environmental conditions.
Immigration : Number of individuals of the same species that have come into the
habitat from elsewhere during a given time period.

106 XII Biology


Ecology : A branch of science that studies the reciprocal relationships between
organism and their physical environment. Ecology is basically concerned with
four levels of biological organisation organisms, populations, communities and
biomes.
Organisms : Organisms form the basic unit of study in ecology. Organisms with
similar features and the potential interbreed among themselves and produce
fertile offspring, constitute a species.
Populations : Population is a group of individuals of the same species, inhabiting
in a given area. Interspecific competition for basic needs operate among the
individuals of a population.
Biological Community : Biological community is constituted by an assemblage
of the populations of all different species that live in an area and interact with
each other. A biotic community has a distinct species composition and structure.
Biomes : Biome is a very large unit, constituting of a major vegetation type and
associate fauna found in a specified zone. Annual variations in the intensity,
duration of temperature and precipitation account for the formation of major
biomes like desert, rain forest and tundra.
Major Biomass of India : Tropical rain forest, deciduous forest, desert, sea
coast. Regional and local variations within each biome lead to the formation of a
wide variety of habitats.
Environment : Environment is a sum total of all biotic and abiotic factors that
surround and potentially influence an organism. Temperature, water, light and soil
are the major abiotic factors.
Response to Abiotic Factors :
Regulators : Some organisms are able to maintain homeostasis by physiological
(Some times behavioural) means which ensures body temperature, constant
osmotic concentration. All birds and mammals, a very few lower vertebrates
and invertebrates are regulators (Thermoregulation and osmoregulation).
For example, human beings maintain their body temperature by sweating in
summer and shivering during winter season. Plants do not have such
mechanisms to maintain internal temperatures.

Conformers : Majority of animals and nearly all plants cannot maintain a


constant internal environment. Their body temperature changes with the
ambient temperature. In aquatic animals the osmotic concentration of the
body fluids change with that of the ambient water and osmotic concentration.
Some species have evolved the ability to regulate, but only

107 XII Biology


over a limited range of environmental conditions, beyond which they simply
conform.
A diagrammatic representation of organismic response is shown below.

Partial regulators : Hair on the body Hair on body acts as heat insulator.
Surface area and volume ratio In smaller organisms the surface area is
large as compared to the volume. But in large animal this ratio is small. So,
the larger animals effectively controls the body temp erature.
Migration : The organisms can move away temporarily from the stressful habitat
to a more hospitable area and return when stressful period is over.
Suspend : The organisms may avoid the stress by escaping in time. Bears go
into hibernation winter, some snails and fish go into aestivation in summer.
Age Pyraminds of Populations : A population at any given time is composed of
individuals of different ages. If the age distribution is plotted for the population,
the resulting structure is called an age pyramid. The shape of the pyramids
reflects the growth status of the populations (a) Whether it is growing (expanding)
(b) Stable or (c) Declining. A pyramids for human population (males and females)
are represented below.

108 XII Biology


Population Growth : If N is the population density at time t, then its density at
time t + 1 is :
Nt+1 = Nt + [(B + I) (D + E)]

Where B = The number of births


I = The number of immigrants
D = The number of deaths
E = The number of Emigrants.
N = Population Density
r = Intrinsic rate of natural increase
t = Time period

= Carrying capacity (The maximum population size that an


environment can sustain)
Population Interactions :
Predation : Interaction between species involving killing and consumption of prey
is called predation. The species which eats the other is called the predator and
the one consumed is termed the prey. The predator keeps check on prey
population. The reduction in predator population may lead to increase in prey
population.
Competition In this fitness of one species is significantly lower in presence of
another species
Competitive release A species whose distribution is restricted to a small
geographical area because of a competitively superior species, is found to
expand its distributional range when the competing species is experimentally
removed

109 XII Biology


Competitive Exclusion Principle Two closely related species competing for
the same resources cannot co-exist indefinitely and the competitively inferior one
will be eliminated.
Resource partitioning If two species compete for the same reasource, they
could avoid competition by choosing different times for feeding.
Commensalism : This is the interactio in which one species benefits and the
other is neither harmed nor benefited under normal conditions.
Parasitism : Parasitism is a kind of relationship between two species in which
one derives its food from the other (host). Parasitism also involves shelter, in
addition to food obtained by a parasite. Parasites may be ectoparasites or
endoparasites.
Mutualism : In mutualism both the interacting species are benefited mutually. It is
also known as symbiosis.
Co-evolution 1) Fig species and wasp. Female wasp uses the fruit as an
qviposition (egg-laying) and also uses the developing seeds within the fruits for
nourishing its larvae. Wasp pollinates the fig inflorescence while searching for
egg laying site, in return big offers developing seeds as food for developing
larvae. 2) Mediternanean orchid Ophrys and bee.
Amensalism : Interaction between two different species, in which one species is
harmed and the other is neither benefited nor harmed.
Examples of Parasitism :
Cuscuta growing in shoe flower plant
Head louse and humans
Ascaris, Taenia, Plasmodium causing diseases in humans
Examples of Brood parasitism :
(i) Koel laying its eggs in crows nest.
Examples of Commensalism :
Clown fish living among tentacles of sea anemone
Pilot fish (Remora) accompanies sharks
Orchid growing on mango tree
Sea anemone on the shell of hermit crab
Barnacles on back of whales
Egret and grazing cattle

110 XII Biology


Examples of Mutualism
Mycorrhiza living in roots of higher plants
Rhizobium in root nodules of legumes
Algae and fungi in lichens
Orchid Ophyrs and bee for pollination (employs sexual deceit)
Example of Amensalism
Penicillium whose toxin kills many bacteria is neither benefitted nor harmed
Examples of Predation
Biological control methods to control pests
Carnivorous animals like tiger eating deers, snake eating frog
Insectivorous plants like Nepenthes, Drosera, Utricularia
Growth Models : The two growth models are :
Exponential growth model
rt
Exponential Growth Equation is Nt = N0e
Where
Nt = Population density after time t N0
= Population density at time zero r =
intrinsic rate of natural increase
e = the base of natural logarithms (2.71828)
Logistic growth model
Verhulst-Pearl Logistic Growth is described by the following equations :
dN/dt = rN (KN / N)
Where N = Population density at time t r =
Intrinsic rate of natural increase
K = Carrying capacity
(i) Exponential growth (J shape curve is obtained).
When responses are not limiting the growth.
Any species growth exponentially under unlimited resources conditions can
reach enormous population densities in a short time.
Growth is not so realistic.
Logistic Growth (Sigmoid curve is obtained)
When responses are limiting the Growth.
Resources for growth for most animal populations are finite and become
limiting.
The logistic growth model is a more realistic one.

111 XII Biology


QUESTIONS

VSA (1 MARK)

Which are the factor responsible for the wide variety of habitat formed within each
biome?
Fresh water animals are unable to survive for long in sea water. Give reason.
With which population growth model is the Verhulst Pearl equation associated?
Define diapause. Which organisms exhibit it?
Calculate the death rate if 6 individuals in a laboratory population of 60 fruit flies
died during a particular week.
In biological control method, one living organism is used against another to check
its uncontrolled growth. Which kind of population interaction is involved in
this?
An organism has to overcome stressful condition for a limited period of time.
Which strategies can it adopt to do so?
Write what do phytophagous insects feed on?

SA-II (2 MARKS)

What are the four levels of biological organisation with which ecology basically
deals?
Differentiate between stenohaline and euryhaline organisms.
List four features which enable the Xeric plants to survive in the desert conditions.
Mention the attributes which a population has but not an individual organism.

Differentiate between stenothermal and eurythermal organisms.


What are the four ways through which the living organisms respond to abiotic
factors?
Why do clown fish and sea anemone pair up? What is this relationship called?

112 XII Biology


SA-I (3 MARKS)

How does the shape of age pyramid reflect the growth status of a population?
Darwin showed that even a slow growing animal like elephant could reach
enormous number in absence of checks. With the help of your
understanding of growth models, explain when is this possible? Why is this
notion unrealistic?
How will you measure population density in following cases?
fish in a lake
tiger census in a national park
single huge banyan tree with large canopy.
Species facing competition might evolve mechanism that promotes co-existence
rather than exclusion. Justify this statement in light of Gauses competitive
exclusion principle, citing suitable examples.

LA (5 MARKS)
What is altitude sickness? What its causes and symptoms? How does human
body try to overcome altitude sickness?
Orchid flower, Ophrys co-evolves to maintain resembelance of its petal to female
bee. Explain how and why does it do so?

ANSWERS
VSA (1 MARK)
Regional and local variations
Due to osmotic problems.
Logistic Growth.
A stage of suspended development, zooplanktons.
6/60 =0.1 individuals per fruitfly per week.
Predation.
(i) Migration
Suspension of active life by hibernation/aestivation/spore formation.
Plant sap and other parts of plant.

113 XII Biology


SA-II (2 MARK)

Organisms, population, communities and biomes.


Euryhaline : Organisms tolerant in wide range of salinities. Stenohaline
: Organisms tolerant to narrow range of salinities.
(i) thick cuticle
Stomata in deep pits
Stomata closed during day time
leaves reduced to spines (CAM photosynthetic pathway).
Birth rate, Death rate, Sex ratio, age groups.
Eurythermal : Organisms that can tolerate and thrive in wide range of
temperatures
Stenothermal : Organisms restricted to a narrow range of temperature.
(i) Regulate (ii) Conform (iii) migrate (iv) Suspend
Clown fish lives in tentacles of sea Anemone and gets protection from predators.
Interaction commeasalisn.

SA-I (3 MARKS)

Shape of pyramids reflects growth statusof the population (a) growing (b) Stable
(c) declining.
Refer page 227, Fig. 13.4, NCERT book, Biology - XII
Possible if the growth model is Exponential, i.e., having unlimited resources. Its
an unrealistic situation because resources are limited. Hence, it follows
logistic growth model.
(a) fish caught per trap.
number per unit area
percentage cover in biomass.
State Gauses competitive exclusion principle. Mechanisms is resource
partitioning. E.g., experiment of Mac Arthur on Warblers (Refer page 325,
NCERT book, Biology - XII).

114 XII Biology


LA (5 MARKS)

Breathlessness at high attitudes.


Cause : Low atmospheric pressure at high altitudes due to which body does
not get enough oxygen.
Symptoms : Nausea, fatigue and heart palpitations.
Body adapts by :
increasing red blood cell production
decreasing binding affinity of haemoglobin
by increasing breathing rate.
employs Sexual deceit
one petal bears uncanny resemblance to female of the bee.
Male bee is attracted to what it perceives as a female pseudocopulates,
during which pollen dusted on male bees body.
Male bee transfers pollen to another flower when the same bee
pseudocopulates with another flower.
Ophrys does so because pollination success will be reduced unless it co-
evolves with female bee.

115 XII Biology


CHAPTER 14

ECOSYSTEM

POINTS TO REMEMBER
Startification : Vertical distribution of different species occupying different levels
in an ecosystem.
Primary Production : Amount of biomas or organic matter produced per unit
area over a time period by plants during photosynthesis.
Productivity : Rate of biomass production. Its unit is g/m2/year.
Gross Primary Productivity : Rate of production of organic matter during
photosynthesis.
Net Primary Productivity : Gross primary productivity minus the respiration
losses.
Ecosystem : Relationship between living organisms and their abiotic
surroundings.
Secondary Productivity : Rate of formation of new organic matter by
consumers.
Detritus : Dead leaves, twigs, animal remains etc. constitute detritus.
Detrivore : Organisms who break down detritus into smaller particles. e.g.,
earthworm.
Ecological succession : The successive and orderly replacement of one
community by the other community in an area, over a period of time.
Ecological Pyramids : The sequential graphic representation of an ecological
parameter (number/ biomass/energy) depicting different trophic levels in a food
chain.
Climax community : The stable and final biotic community that develops at the
end of ecological succession and is in perfect harmony with its physical
environment.
Pioneer species : The species that invade a bare area at the onset of ecological
succession.

116 XII Biology


Process of Decomposition : The decomposers break down complex organic
matter into inorganic substances like carbon dioxide, water and nutrients. This
process is called decomposition. Steps of decomposition are :
Fragmentation : Break down of detritus into smaller particles by detritivores
(earthworm).
Leaching : Water soluble inorganic nutrients go down into the soil horizon and
get precipitated as unavailable salts.
Catabolism : Bacterial and fungal enzymes degrade detritus into simple
inorganic substances.
Humification : Accumulation of a dark coloured amorphous substances called
humus.
Mineralisation : The humus is further degraded by some microbes and release
of inorganic nutrients occur.
Energy Flow : Energy flow is the key function in the ecosystem. The plants
(producers) capture only 2 10 percent of the photosynthetically active radiation
(PAR). Unidirection flow of energy is taken place from the sun to producers and
them to consumers. About 10% energy flows from one trophic level to another.

Grazing Food Chain : It begins with producers.

Detritus Food Chain : It begins with dead organic matter. It is made up of


decomposers (Fungi, Bacteria). They meet their energy and nutrient
requirements by degrading detretus. These are also known as saprotrophs.
Ecological Pyramids
Pyramid of Numbers : (Grass land system)

117 XII Biology


Pyramid of Energy : (Always upright in all Ecosystems)

Pyramid of Biomass :

Ecological Succession : The gradual and fairly predictable change in the species
composition of a given area is called ecological succession. The species that
invade a bare area is called pioneer species. The final community is an ecological
succeesion that is in near equilibrium with the environment is called climax
community
Secondary Succession begins in the area where natural biotic communities have
been destroyed (burned or cut forests, land that have been devastated by flood).

Succession on a Bare Rock (Xerarch)

Succession in Aquatic environment (Hydrarch)

118 XII Biology


Nutrient Cycling Movement of nutrient elements through the various
components of an ecosystem also called Biogeochemical cycles.

Carbon cycle occurs through atmosphere, ocean, and though living and dead
organisms. Considerable amount of carbon returns to atmosphere as CO 2
through respiratory activities, decomposers also contribute to Carbon di-oxide
pool, burning of wood, forest fire and combustion of organic matter, fossil fuels,
volcanic activity also release CO2 is atmosphere.
Phosphorous cycle Sedimentary cycle Rocks contain phosphorous in the
form of phosphates

Carbon Cycle Phosphorous Cycle


Amount of atmospheric Amount of atmospheric
inputs more in amount inputs less in amounts
Degree of exchanges between Degree of exchange between
organism and environment high organism and environment
negligible.

ABBREVIATIONS

PAR : Photosynthetically Active Radiation


GAP : Gross Primary Productivity
NPP : Net Primary Productivity
DFC : Detritus Food Chain GFC
: Grazing Food chain

119 XII Biology


QUESTIONS

VSA (1 MARK)

Decomposition is faster if deteritus is rich in nitrogen and water soluble substance


like sugars. When is the decomposition process slower?
If we count the number of insects on a tree and number of small birds depending
on those insects as also the number of larger birds eating the smaller, what
kind of pyramid of number would we get?
Differentiate between Sere and Seral communities.
Who are generally the pioneer species in a Xerarch succession and in a
Hyararch succession?
Which metabolic process causes a reduction in the Gross Primary Productivity?
What percentage of photosynthetically active radiation is captured by plants?

Name the pioners of primary succession in water.

SA-II (2 MARKS)

What is the shape of pyramid of biomass in sea? Why?


Give an example of an ecological pyramid which is always upright. Justify your
answer.
Differentiate between primary succession and secondary succession. Which one
occurs faster?
Gaseous nutrient cycle and sedimentary nutrient cycles have their reservoir.
Name them. Why is a reservoir necessary?
Fill up the missing links depicted as A, B, C and D in the given model of primary
succession.

120 XII Biology


In the model of phosphorus cycle given below, what does A, B, C and D refer to?

Differentiate between Hydrarch and a Xerarch succession.


What is the effect on decomposition rate if :
Detritus is rich in lignin and chitin
Detritus is rich is nitrogen and sugars
What are the limitations of ecological pyramids?
Name any four ecosystem services. Who gave the price tags on natures life
support services? Which is the most important ecosystem service provider?

Study the table given below and fill the blanks from A to F.
[Link] Component of Position of the Organism present in
the Ecosystem trophic level the Food chain
1. E Fourth trophic level F
2. Secondary D Bird, fish, wolf.
consumer
3. B Second trophic level C
4. Primary producer A Phytoplankton,
grass, tree.

In the pyramid of biomass drawn below, name the two crops (i) one which is
supported (ii) one which supports in which ecosystem is such a phyramid
found?

121 XII Biology


LA (5 MARKS)

Detrivores like earthworm are involved in the process of decomposition of dead


plants and animals. Describe the different steps involved in the process of
decomposition.

ANSWERS

VSA (1 MARK)

Its slower if detritus is rich in lignin and chitin.


Inverted Pyramid of Number.
Sere : Entire sequence of communities that successively change in a given area.
Seral community : Individual transitional community.
Pioneer species in Hydrarch succession are usually the small phytoplanktons and
that in Xerarch succession are usually lichens.
Respiration.
2 10%
Phytoplanktons

SA-II (2 MARKS)

Inverted, because biomass of fishes far exceeds that of phytoplankton.


Pyramid of energy is always upright and can never be inverted, because when
energy flows from a trophic level to the next trophic level some energy is
always lost as heat at each step.
Primary Succession : A process that starts where no living organisms are there.
Secondary succession : A process that starts in areas which have lost all
the living organisms that existed there.
Reservoir for Gaseous nutrient cycle : Atmosphere; for sedimentary nutrient cycle
: Earths crust. Reservoir is needed to meet with the deficit which occurs due
to imbalance in the rate of influx and efflux.

122 XII Biology


12. A = Submerged plant stage B = Reed Swamp Stage
C = Scrub stage D = Forest stage
13. A = Detritus B = Decomposition
C = Weathering D = Producers.

Hydrarch Succession : Starts in water proceeds from hydric (aquatic) to mesic


(neither dry nor wet) situations.
Xerarch succession : Starts on barren rock Proceeds from Xeric (dry)
conditons.
a) Decomposition rate is slower
Decomposition rate is faster.
(i) Does not take into account same species belonging to two or more trophic
levels.
Assumes simple food chain, does not accomodate food web.
Saprophytes have not been given any place in ecological pyramids.

Forest (ecosystem) purify water and air


Mitigate Droughts and floods
Nutrient cycling
Generate fertile soil

Provide habitat for wildlife


Pollinate flower
Maintain Biodiversity
Provide aesthetic, cultural & spiritual values

Robert Constanza gave price tags to ecosystem services. Most


important ecosystem services provider : Soil formation.
A = First trophic level B =
Primary consumer
C = Zooplankton, Cow, Grass hopper D
= Third trophic level
E = Tertiary consumer
F = Man, Lion

123 XII Biology


(i) Supported trophic level is founded by zooplanktons
Supporting trophic level is formed by phytoplanktons ecosystem It is
found in aquatic ecosystem.
The dead remains of plants and aminals called detritus undergo decomposition
and are converted into simpler substances. The steps of this process are :
Fragmentation : Breakdown of detritus into smaller pieces by detrivoures
like earthworm.
Leaching : Water soluble inorganic nutrients go down into soil horizon and
get precipitated as unavailable salts.
Catabolism : Bacterial and fungal enzymes degrade detritus into simpler
inorganic substances.
Humification : It leads to accumulation of dark coloured amorphous
substance called humus which is highly resistant to microbial action so
decomposes at slow rate and is rich in nutrients.
Mineralisation : Humus is further degraded by some microbes and release
of inorganic nutrients occurs.

124 XII Biology


CHAPTER 15

BIODIVERSITY AND CONSERVATION

POINTS TO REMEMBER
Biodiversity : Term used to describe diversity at all levels of biological
organisation. Term coined by socio-biologist Edward Wilson and was also used
by Walter G Rosen for the diversity of life forms. Biodiversity refers to totality of
genes in species and ecosytems of a region.
Three inter-related levels of Biodiversity : Genetic diversity, Species diversity,
Ecological diversity.
Genetic diversity : Diversity in the number and types of genes, as well as
chromosomes present in different species and the variations in the genes
and their alleles in the same species. It helps in speciation.
Species diversity : Varieties in the number and richness of the species of a
region.
Ecological diversity : Variety in the types of ecosystems.
IUCN : International Union for Conservation of Nature and Natural Resources. It
is situated in Morges, Switzerland.
India has : More than 50,000 genetically different varieties of rice; 1000 varieties
of mango;
India has 1,42,000 known species of plants and animals (Around 45,000
species of plants and rest of animals);
India has 8.1% of share of global biodiversity.
India is one of 12 Mega diversity countries of the world.
Latitudinal Gradients
In general, species diversity decreases as we move away from the equator
towards the poles.
With very few exceptions, tropics (latitudinal range of 23.5X N to 23.5XS)
harbour more species than temperate or polar areas.

125 XII Biology


Colombia located near the equator has nearly 1,4000 species of birds while
New York at 41X N has 105 species and Greenland at 71X N only 56
species.
India has more than 1,200 species of birds.
A forest in a tropical region like Equador has up to 10 times as many species of
vascular plants as a forest of equal area in a temperate region like the
Midwest of the USA.
The largely tropical Amazonian rain forest in South America has the greatest
biodiversity on earth.
Species-Area relationships
German naturalist and geographer Alexander von Humboldt observed that
within a region species richness increased with increasing explored area, but
only up to a limit.
The relation between species richness and area for a wide variety of taxa
(angiosperm plants, birds, bats, freshwater fishes) turns out to be a
rectangular hyperbola.
On a logarithmic scale, the relationship is a straight line decribed by the
equation
log S = log C + Z log A
Where S = Species richness, A = Area; Z = slope of the line (regression
coefficient)
C = Y intercept.
Value of Z lies in the range of 0.1 to 0.2, regardless of the taxonomic group or
the region.
The species-area relationships among very large areas like the entire
continents has much steeper slope of the line (Z values in the range of 0.6 to
1.2).

126 XII Biology


Causes of Biodiversity Losses
Habitat loss and fragmentation : This is most important cause of plants and
animals extinction. For example : Tropical rain forest being destroyed fast.
The Amazonian rain forest is called the lungs of the planet. It is being cut for
cultivating soyabeans.
Overexploitation : Many species extinctions are due to over exploitation by
humans. eg :- extinction of stellers cow, passenger pigeon is last 500 years.
Alien Species Invasions : When alien species are introduced some of them turn
invasive and cause decline or extinction of indigenous species. eg. :- Carrot
grass (Parthenium), Lantana and water hyacinth (Eichornia) posed threat to
native species.
Co-extinctions : When a species becomes extinct, the plant and animal species
associated with it in an obligating way also become extinct. eg.:-When a host
fish species becomes extinct, its assemblage of parasites also becomes
extinct.
Reasons for Conservation of Biodiversity
Narrowly utilitarian : Humans derive countless direct economic benefit from
nature food (cereals, pulses, fruits), firewood, fibre, construction material,
industrial products (tannins, lubricants, dyes, resins, perfumes) and products
of medicinal importance.
Broadly utilitarian : Biodiversity plays a major role in many ecosystem services
that nature provides.
Ethical : every species has an intrinsic value, even if it may not be of any current
economic value to us. We have a moral duty to care for their well-being and
pass on our biological legacy in good order to future generations.

Types of Conservation Strategies


In-situ conservation : Conservation and protection of the whole ecosystem and
its biodiversity at all levels in order to protect the threatened species. Endangered
species protected in natural conditions.
Sacred Groves : Tracts of forest are set aside and all the trees and wildlife
within are venerated and given total protection. E.g., some forest in Khasi
and Jaintia hills in Meghalaya, Aravalli hills of Rajasthan.

127 XII Biology


Hot Spots : Areas with high density of biodiversity or mega diversity. E.g., Out
of 34 hot spots in world, 3 occur in India. i.e., Western Ghats and Sri Lanka,
Indo-Burma (North-East India) and Himalaya.
Protected Areas : Ecological or Biogeographical areas where biological
diversity with natural and cultural resources are protected. E.g., National
parks, sanctuaries and Biosphere reserves.
Ex-situ conservation : Conservation and protection of selected rare plants or
animals in places outside their natural homes.
Offsite collections : Live collections of wild and domesticated species in
Botanical gardens, Zoological parks etc.
Gene Banks : Institutes which maintain stock of viable seeds, live growing
plants, tissue culture and frozen germplasm with the whole range of genetic
variability.
Cryopreservation : Preservation of seeds, embryos etc. at V196XC in liquid
nitrogen.
Co-extinction : Extinction of a species can cause extinction of plants and
species associated with it.
National Parks : Areas reserved for wild life where they are able to obtain all the
required natural resources and proper habitats. India has 89 national parks at
present.
Sanctuaries : Tracts of land with or without lake where animals are protected
from all types of exploitation and habitat disturbance. India has 492 sanctuaries
at present.
Biosphere Reserves : Large tracts of protected land with multiple use
preserving the genetic diversity of the representative ecosystem by protecting
wild life, traditional life styles of the tribals and varied plant and animal genetic
resources. India has 14 biosphere reserves.
Red Data Book : Record of threatened species of plants and animals maintained
by IUCN.
Important Wild Life Projects in India :
Project tiger : Started in 1973 to check depletion in population of tiger. Jim
Corbett National Park.
Biodiversity Hotspots : Regions of high endemism and high level of species
richness.

128 XII Biology


Endemic Species : Species which are confined to a particular region and not
found anywhere else.
Exotic or Alien Species : New species which enter a geographical regions.
Bio prospecting : Exploration of molecular, genetic and species level diversity
for products of economic importance.
International Efforts for Biodiversity Conservation :
World Conservation Union (formerly IUCN) : provides leadership, common
approach and expertise in the area of conservation.
The Earth Summit : Historical convention on Biological diversity held in 1992 at
Rio de Janerio, Brazil.
The World Summit on Sustainable Development : Held in 2002 in
Johannesburg, South Africa to pledge to reduce biodiversity losses at global
and local levels.

QUESTIONS

VSA (1 MARK)

Habitat loss and fragmentation has caused severe damage to a particular type of
ecosystem. Name it.
What trend is observed in respect of species diversity when we move from
equator to poles?
Which region is considered as the one with highest biodiversity on earth? What is
the name given to such [Link]?
Ecologists have discovered that value of Z lies in range of 0.1 to 0.2
regardless of taxonomic group or region. When will the slope of line steeper
in species area relationship?
Define cryopreservation. Why is it useful in conserving biodiversity?
What is the reason for genetic variation shown by medicinal plant Rauwolfia
vomitoria?
How many species of plants and animals have been described by IUCN in 2004?
What is global species diversity according to Robert May?
Explain co-extinction with a suitable example.

129 XII Biology


Study the pie-diagram and answer the questions which follows : What do
A, B, C and D represent in these diagrams.

SA-I (3 MARKS)

Hot spots are the regions of exceptionally high biodiversity. But they have
become regions of accidental habitat loss too. Name the three hot spots of
our country. Why are they called Hot spot?
Study the diagram of the earth given below. Give the name of the pattern of
biodiversity therein. Suggest any two reasons for this type of occurance.

What is so special about tropics that might account for their greater biological
diversity?
Why is the sobriquet The Evil Quartet used in context of biodiversity? Name the
members of this quartet. Why do we grieve for the genes when a species is
lost?

130 XII Biology


Describe at least two approaches each for ex-situ conservation and in situ
conservation as a strategy for biodiversity conservation.

ANSWERS
VSA (1 MARK)
Tropical Rain Forest.
In general, species diversity decreases as we move away from the equator
towards poles.
Amazonian rain forests. They are also called the Lungs of the planet.
Slope of line is much steeper if one analyses the speciesVarea relationship
among very large areas like entire continents.
Preserving a material in liquid nitrogen at 196C. It can be done to preserve
threatened species in viable and fertile condition for long period.
Genetic variation might be in terms of potency and concentration of the active
chemical reserpine produced by plant.

SA-II (2 MARKS)
IUCN (2004) has described slightly more than 1.5 million species of plants and
animals.
According to Robert Mays estimates the global species diversity is about 7
million.
Coextinction refers to the disappearance of species with extinction of another
species of plant or animal with which it was associated in an obligatory way.
e.g., Plant-pollinator mutualism.
9. A Crustaceans B Insects
C Mosses D Fungi

SA-I (3 MARKS)
Westerm Ghats and Sri lanka; Indo-Burma; Himalaya called biodiversity hot
spots as they show
High level of species richness
High degree of endemism
Latitudinal gradients
More solar energy available in tropics, more productivity.
Tropical environments are less seasonal, so more predictable.

131 XII Biology


a) Speciation is a function of time, unlike temperate regions subjected to frequent
glaciations in the past, tropical latitude have remained relatively
undisturbed for million of years and thus had long evolutionary time for
species diversification
Tropical environment are less seasonal, more constant and predictable

More solar energy awailable in the tropics contributing to high productivity


leading to greater diversity.

LA (5 MARKS)
The Evil Quartet is used as a sobriquet to refer to the cause of loss of
biodiversity :
Habitat loss and fragmentation : When large habitats are broken up into
smaller fragments due to various human activities, the animals requiring
large territories (elephants, birds etc.) are badly affected and their
populations decline.
Over-exploitation : When need of a resource becomes greed. e.g., over
exploitation of passenger pigeon led to its extinction. Also marine fish is
at brink of being endangered due to over exploitations.
Alien species invasion : Intentional or non-Intentional introduction of a
species to a nearby area may disturb the harmony of existing species.
e.g., Eichhornia after introduction posed a big threat to the native
species.
Co-extinction : Extinction of one species invariably leads to extinction of
another when they are associated with each other in an obligatory way.
e.g., when host species is extinct, obligate parasites dependent on it
also die.
We grieve for the loss of genes, because the wild forms are hardy and more
resistant to pathogen attack and can be beneficial in crop breeding
programmes.
In situ conservation :
Identification and maximum protection of hot spots
Legal protection to ecologically rich areas.
Biosphere reserves, national parks and sanctuaries
Sacred groves.
Ex situ Conservation :
Creation of zoological parks, botanical garden, wild life sanctuary
Cryopreservation
Seed bank.

132 XII Biology


CHAPTER 16

ENVIRONMENTAL ISSUES

POINTS TO REMEMBER
Pollution : Undesirable physical/chemical/biological characteristics of air/water/
land which cause damage to the animals/plants/humans and architectural
structures.
Pollutants : Agents which cause pollution.
Slash and Burn Agriculture (Jhum Cultivation) : Farmers cut down trees and
burn the plant remains. Ash is used as a fertiliser and the land is then used for
farming or cattle grazing.
Reforestation : Process of restoring a forest that was removed at some point of
time in the past.
Effluents : Something flowing over a large body of water (may be sewage or
industrial effluents).
CPCB : Central Pollution Control Board
BOD : Biological Oxygen Demand CNG :
Compressed Natural Gas FOAM :
Friends of Arcata Marsh
JFM : Joint Forest Management.
Biochemical Oxygen Demand (BOD)
BOD refer to the amount of oxygen that would be consumed if all the organic
matter is one litre of water were oxidized by bacteria. The BOD test
measures the rate of uptake of oxygen by micro-organisms in a sample of
water.
Indirectly BOD is a measure of the organic matter present in the water. The
greater the BOD of waste water, more is its polluting potential.
In the given figure the effect of sewage on some imporant characteristic of a
river is shown:

133 XII Biology


Algal Bloom : Presence of large amounts of nutrients in water causes excessive
growth of algae, called an algal bloom.
Harmful effect of algal bloom are :
Fish mortality
Deterioration of water quality
Toxic to animals and human beings.
Biomagnification
It refers to increase in concentration of toxic substances at successive trophic
levels.
Biomagnification of DDT in an aquatic food chain

Harmful Effect : High concentration of DDT disturbs calcium metabolism in birds,


which causes thinning of egg shell and their premature breaking, causing decline
in birds population.
Eutrophication : It the process of nutrient enrichment of water and subsequent
loss of species diversity like fishes. Excess nutrients causes algal bloom which
may cover the whole surface of water body and release toxins. It causes oxygen
deficiency in water that leads to the death of aquatic animals like fishes.
Global Warming : Increase in the level of greenhouse gases is mainly
responsible for global warming. (Increase in mean global temperature due to
trapping of infrared radiation). Carbon dioxide, Methane, CFCs, N2O are the

134 XII Biology


main gases that causes greenhouse effect.

Harmful effects of global warming :


Melting of glaciers
Over many years, this will result in a rise in sea level that can flood the coastal
plains.
Measures of Control Global Warming
Minimise the use of fossil fuel.
Improving efficiency of energy usage.
Reducing deforestration.
Planting trees.
Ozone Depletion :
Ozone gas is continuously formed by the action of UV-rays on molecular
oxygen and also degraded into molecular oxygen in stratosphere.
The thickness of the ozone-layer in a column of air from the ground to the top
of the atmosphere is measured in tems of Dobson units (DU).
Ozone layer absorbs the harmful UV-rays. These rays cause the skin cancer,
damages genes, causes inflammation of cornea.
Chlorofluro Carbons deplete the ozone layer. The part of atmosphere with
lesser concentration of ozone is called ozone hole.
Steps leading to ozone depletion

UV-rays split CFCs and release atomic chlorine (Cl)


UV-rays also split ozone into oxygen.
Chlorine atoms trap oxygen atoms and ozone is not formed again from oxygen.
This leads to depletion of ozone in the stratosphere.

135 XII Biology


Ozone Hole : Large area of thinned ozone layer over Antartica.
Control of Vehicular Air Pollution in Delhi : All the buses of Delhi were
converted to run on CNG by the end of the 2002. Other steps to reduce air
pollution in Delhi include.
Phasing out of old vehicles.
Use of unleaded petrol and low sulphur petrol and diesel.
Use of catalytic converters in vehicles.
Application of Euro-IV norms for vehicles from April, 1, 2010.
Auto Fuel Policy : The Government of India has laid out a road map to cut down
the vehicular air pollution in many cities of India. The goal of this policy is to
reduce Sulphur to 50 ppm in petrol and diesel and reduce levels of aromatic
hydrocarbons to 35% of the fuel. The Bharat Stage II will be applicable to all
automobiles in all cities April, 1, 2005. The cities (like Delhi, Mumbai, Chennai,
Kolkata etc.) will have to meet Euro III emission norms from April 1, 2005 and
Euro IV Emission norms from April 1, 2010.

QUESTIONS

VSA (1 MARK)

Why should the velocity of air between the plates of an electrostatic precipitator
be low?
PM2.5 is responsible for causing greatest harm to human health. What is it? How
is it harmful?
What is the noise level that can cause permanent impairment of hearing ability of
human beings?
Why was the Montreal Protocol signed?
Jhum cultivation has been in practice from earlier days, but its considered more
problematic these days. Why?
A radiation causes ageing of skin, skin cancer, and inflamation of cornea called
snow blindness. It also damages DNA. Name the radiation.

136 XII Biology


SA-II (2 MARKS)

Landfills are not much a solution for getting rid of solid wastes. Why?
Electrostatic precipitator can remove over 99% particulate matter present in
exhaust from a thermal power plant. How?
Why is a scrubber used? Which spray is used on exhaust gases passing through
a scrubber?
There is a sharp decline in dissolved oxygen downstream from the point of
sewage discharge. Why? What are its adverse effects?
Catalytic converters use expensive metals as catalysts.
Name the metals generally used.
What precaution should be observed while using catalytic converter.
What are e-wastes? Why are they creating more problem in developing countries
in comparision to developed countries?
Water logging and salinity are some of the problems that have come in the wake
of Green revolution. How does water logging create problems of salinity?
What is the relationship between BOD, mcro-organisms and amount of bio-
degradable matter?

SA-1 (3 MARKS)

Deforestation is creating a lot of problems in the environment. List the


consequences of deforestation.
Enlist four harmful effects caused to the humans living in areas having polluted
air. Suggest two measures to reduce air pollution.
People have been actively participating in the efforts for the conservation of
forests.
Name the award instituted in respect of Amrita Devi to promote such efforts.
Name the movement launched to protect the trees by hugging them.
Name the step Government of India has undertaken in 1980s to work
closely with the local communities for protecting and managing forests.

137 XII Biology


LA-(5 MARKS)

Pollutant released due to human activities (like effluents from industries and
homes) can radically accelerate the ageing process of the water body.
Explain how does this process occurs during natural ageing of lake.
Give the term used for accelerated ageing of water bodies. Also give the
term used for the natural ageing of lake.
In Arcata, the towns people have created an integrated waste water treatment
process within a natural system. A citizen group called FOAM helps in
upkeep of this project.
What are the main steps in waste water management done in this way?
Ecosan in Kerala and Sri Lanka is also an intiative for water conservation.
How?
What are the contribution of Ahmed Khan in Bangalore and Ramesh Chandra
Dagar in Sonipat?

ANSWERS

VAS (I MARK)

To allow the dust to fall.


PM2.5 stands for particulate matter of size 2.5 micrometers or less in diameter.
Its responsible for causing greatest harm to human health as it can be
inhaled deep into lungs and cause breathing problems.
150 dB or more
To control emission of ozone depleting substances.
Enough time gap is not being given for the natural process of recovery of land
from the effect of cultivation.
Ultraviolet B rays (UV-B rays)

SA-II (2 MARKS)

Landfill sites are getting filled very fast due to large amount of garbage
generation. Also underground water resources may get polluted due to
seepage of chemicals.

138 XII Biology


Electrode wire at thousand volts, produce corona to release electrons, electrons
attach to dust particules giving them net negative charge, charged dust
particules attracted/collected by collecting plates which are grounded.

To remove gases like sulphur dioxide. Spray of water or lime is used.


Following discharge of sewage into river, micro organisms involved in
biodegradation of organic matter present in sewage consume more oxygen.
This cause mortality of fish and other aquatic creatures.
(a) Catalysts : platinum - palladium and Rhodium
Motor vehicles equipped with catalytic converters should use unleaded
petrol as lead inactivates the catalysts.
(a) Irrepairable computers and other electronic wastes.
Recycling in developing countries involves manual participation thus
exposing workers to toxic substances. In developed countries its
mechanised so less dangerous.
Water logging draws salt to surface of soil. Salt deposited on land surface as a
thin crust or at the roots of the plants.
Increase in amount of biodegradable matter leads to rapid multiplication of micro
organisms to degrade it, thereby increasing BOD level of the water body.

SAI (3 MARKS)
Enhanced CO2 concentration in atmosphere Loss
of biodiversity
Soil erosion
Desertification
Disturbed hydrological cycles.
Breathing problems, irritation and inflammation, Damage to lungs, Premature
death.
Reduce emission from automobile exhaust
Growing more trees.
(i) Amrita Devi Bishnoi Wildlife Protection Award.
Chipko movement
Joint Forest Management (JFM).

139 XII Biology


(a) The phenomeon is eutrophication. More nutrients in water, aquatic life
increases organic remains deposited on lake bottom, lake grows
shallower and warmer, gradually transforms into land due to deposition
of silt and organic debris.
Cultural or Accelerated eutrophication
Natural ageing is Eutrophication.
(a) Conventional sedimentation, filtering and chlorine treatment. Absorption and
assimilation of pollutants by algae fungi and bacteria.
Ecosan derived from ecological sanitation. Handling human excreta using
dry composting toilets. Its practical, hygienic and cost effective method.
Refer page No. 279-280, ncert Text of Biology Class XII (the benefits of polyblend
and organic farming.)

140 XII Biology


CLASS-XII

MODEL PAPER-1 (Unsolved)

BIOLOGY (THEORY)
Times : 3 Hours Maximum Marks : 70
General Instruction :
All questions are compulsory.
This question paper consists of four sections A, B, C and D. Section A contains
questions of 1 mark each. Section B is of 10 questions of 2 marks each.
Section C has 9 questions of 3 marks each, whereas section D is of 3
questions of 5 marks each.
There is no overall choice. However an internal choice has been provided in one
question of 2 marks, one question of 3 marks and all the three questions of 5
marks weightage. A student has to attempt only one of the alternative in
such questions.
Wherever necessary, the diagrams drawn should be neat and properly labelled.

SECTION-A

State competitive exclusion principle (Gausses principle).


Asexual reproduction does not produce the genetic variability. Why?
Name the insecticidal protein which is produced by Bacillus thuringiensis.
Thorns of Bougainvillea and tendrils of Cucurbita are considered as homologous
organs. Give reason.
Expand IUD and MTP.
Which category of adaptive immunity is provided by vaccination?
Why is male Drosophila fly referred to as heterogametic?
What is meant by juvenile phase of an organism?

141 XII Biology


SECTION-B

Observe the following pie-chart showing contribution of green house gases to


global warming. Name the gases denoted as A and B.

Mention two strategies evolved by flowers to prevent self pollination.


What would happen to the successive trophic level in the pyramid of energy, if the
rate of reproduction of phytoplankton slows down? Suggest two factors
which could cause such a reduction is phytoplankton reproduction.

Frederick Griffith carried out his experiments on Diplococcus pnoumoniae using


R-Strains and SStrains. What is meant by R-strains and S-Strains? What did
he prove from these experiments?
List any four factors which may lead to loss of biodiversity.
Differentiate between convergent and divergent evolution.
What is single cell protein? What is the significance of such a protein?
Name the endocrine structure found in empty Graafian follicle. What role does it
play during pregnancy?
What does S-Shaped pattern of population growth represent? How is J-shaped
pattern different from it and why?
OR
What type of conservation measures, in situ or ex situ will help the larger
number of species to survive? Explain.

142 XII Biology


18. Fill in the blanks A, B, C and D in the following tables

S. No. Methods of birth Control Contraceptive/device


1. Natural A
2. B Vasectomy
3. C Saheli
4. Implants D

SECTION-C
The following figure represents rDNA technology. Observe the figure and give
answer of th questions given below :
Identify A, B, C and D (b) Write two applications of this technique.

In snapdragon (Antirrhinum majus) a plant with red flowers was crossed with a
plant with white flowers. Work out all the possible genotypes and phenotypes
of F1 and F2 generations. Comment on the pattern of inheritance in this
case.

143 XII Biology


Describe various steps involved in the treatment of sewage before it is
discharged into a water body like a river.
With the help of a labelled diagram, explain the typical structure of female
gametophyte of an angiosperm.
What is an operon? Who first proposed this concept? Describe the major steps
involved in lac operon.
A sperm has just fertilised a human egg in the fallopian tube. Trace the events
that the fertilised egg will undergo upto the implantation of the blastocyst in
the uterus.
OR
Briefly describe the stages of spermatogenesis in humans.
Describe how nematode resistant transgenic plants have been produced.
How did Urey and Miller prove the abiotic synthesis of organic molecules that
must have been formed on the primitive earth? Name any two such
molecules obtained?
Represent diagrammatically the E. Coli cloning vector pBR 322.

SECTION-D
(i) What are allergens? Give an example.
Write two common symptoms of allergy.
Write the full name of the organism that causes AIDS. Mention the category
of people who are at high risk of getting this disease.
OR
What is a protoplast?
Name the two enzymes used in producing protoplasts.
Describe the steps in producing somatic hybrids from protoplasts.
Mention the usefulness of somatic hybridisation.
(i) Represent the change of base (point mutation) that causes sickle cell
anaemia. Represent diagrammatically the HbA and Hbs polypeptides.
Write two symptoms exhibited by Turners syndrome sufferer. Explain the
cause of this disorder.
OR
Describe in detail the steps involved in th technique of DNA fingerprinting.

144 XII Biology


30. (i) Define decomposition and describe the process of decomposition.
Draw schematically the phosphorus cycle in nature.
OR
Describe in detail the species area relationship regarding biodiversity.
The Amazonian rain forest in South America has the greatest biodiversity on
earth sustainable with numbers of different species of organisms. Give
reasons.

145 XII Biology


CLASS-XII

MODEL PAPER-1 (Solved)

BIOLOGY (THEORY)
Times : 3 Hours Maximum Marks : 70
General Instruction :
All questions are compulsory.
This question paper consists of four sections A, B, C and D. Section A contains
questions of 1 mark each. Section B is of 10 questions of 2 marks each.
Section C has 9 questions of 3 marks each, whereas section D is of 3
questions of 5 marks each.
There is no overall choice. However an internal choice has been provided in one
question of 2 marks, one question of 3 marks and all the three questions of 5
marks weightage. A student has to attempt only one of the alternative in
such questions.
Wherever necessary, the diagrams drawn should be neat and properly labelled.

SECTION-A

When does an oocyte complete oogenesis? When does oogenesis begin in a


human female?
Which organisms are usually the pioneer species in a (i) Hydrarch and (ii)
Xerarch succession?
Give an example to show how the same species can occupy more than one
trophic level in the same ecosystem.
Cucurbits and coconut bear unisexual flowers but are monoecious. Why?
Define allelomorphs.
DNA in chromosomes also replicates semi-conservatively. How did Taylor and
colleagues prove it?

146 XII Biology


Besides converting the milk to curd, which are the two other roles played by
LAB?
What are baculoviruses?

SECTION-B

(i) Very small animals like shrews and humming birds are rarely found in Polar
Regions. Why?
Define Diapause.
Read the graph given below and correlate the uterine events that take place
according to the hormonal levels on
6-15 days
16-25 days
26-28 days (if ovum is not fertilized)

Draw the structure of initiator t-RNA molecule. Why is t-RNA called as an adapter
molecule?
OR
Lactose plays a dual role in the lac-operon. How? Why is lac-operon said to
be under negative regulation?
(a) The graph below represents the growth patterns of two types of aquatic
organisms over a brief period of time in a water body surrounded by an
agricultural land extensively supplied with fertilisers. Identify the
organisms that would represent (i) A and (ii) B.

147 XII Biology


State the reason for such a change in the water body and also write the term
given toit.

How do Cu 7 or Multiload 375 and Progestasert or LNG-20 differ in their


contraceptive action?
Inbreeding is necessary and useful in some cases. How? Name the problem
which can be caused due to close inbreeding and the way to get rid of the
problem.
-Interferons are helpful in controlling a very fetal disease. Name the disease and
ways to detect it. How do the -interferons help in such cases?
How is a divalent cation like Calcium useful in making the host cell competent for
transformation with rDNA? What is biolistics?
Approval of which organization is needed for getting a clearance for mass
production of a genetically modified organism? What can be the any two
possible reasons for the need of such organization?
IgE antibodies are usually produced in response to certain substances. What are
such substances called? What is the condition caused due to such
substance and mention the cell and its chemical which causes such
condition?
SECTION-C
An ecologist wants to explore an area with a higher biodiversity. Suggest whether
he/she should explore a tropical region or a temperate region? Why?
Million of gamete mother cells have been formed in the fetal ovary of a human
female. Trace the events which will follow till the formation of mature female
gamete (Ovum).
Explain with a suitable example the phenomenon of incomplete dominance.
Draw the schematic structure of a transcription unit. What is the convention in
defining the two strands of DNA in such case? What will

148 XII Biology


be the bases in the coding strand if template strand reads 3-
ATGCATGCATGCATGCATGCATGC-5?
Using algebraic equations prove that the frequency of occurrence of alleles of a
gene or a locus is fixed and remain same for generations in a given
population. Who proposed this? What factors effect it?
Explain the working of Sewage treatment plants and define primary sludge, flocs
and activated sludge.
With the help of a flow chart show the multiplication of a retrovirus which can
cause a deficiency of immune system which is acquired during life time of an
organism.
Write the missing steps in the following flowchart :

OR
What are the features of cloning vectors? How will you distinguish
recombinants from nonrecombinants?

149 XII Biology


Explain with reference to PCR
A specific enzyme helps in amplification in PCR. Name the bacterium from
which it is isolated and state how its thermostable nature is helpful.
Explain its use in molecular diagnosis
SECTION-D
28. Domestic and sewage effluents can cause algal bloom, biomagnification,
eutrophication. How? What effect does it have on BOD? What is cultural
eutrophication?
OR
How is the sixth episode of extinction of species on earth, now currently in
progress, different from the five earlier episodes? What is it due to? Explain
the various causes that have brought about this difference.
(a) Explain the process of megasporogenesis.
Name any three outbreeding devices. What is self incompatibility?
OR
Show diagrammatically the stages of embryonic development from zygote
upto implantation in humans.
(a) Show diagrammatically the results of dihybrid cross carried out by T.H.
Morgan to show linkage.
What is pedigree analysis and its use? What will be the genotype of each of
the individuals in the following pedigree chart :

OR
Explain the technique in which VNTRs can be used in ascertaining the
genetic diversities.
What are the differences between prokaryotic and eukaryotic transcription?

150 XII Biology


CLASS-XII

SAMPLE PAPER-1 (Solved)

ANSWERS

SECTION-A

Oogenesis completed when sperm comes in contact with zona pellucida of ovum.
Oogenesis is initiated during embryonic development.
Hydrarch Succession : Usually small phytoplanktons.
Xerarch Succession : Usually lichens.
Sparrow is primary consumer when eats seeds and secondary consumer when it
eats worms.
They are Monoecious as both male and female flowers occur on same plant.

Allelomorphs : Various or slightly different forms of a gene having same position


on chromosome.
Used radioactive thymidine on DNA of chromosomes in Vicia faba.
(i) Improves nutritional quality by increasing vitamin B12
Check disease causing microbes.
Baculoviruses : Pathogens that attack insects and arthropods.
SECTION-B
They have large surface area relative to their volume so lose body heat very fast
in colder regions. Hence, occur rarely in polar region.
Diapause : A stage of suspended development shown by many
zooplanktons in lakes and ponds.
(i) Regeneration of endometrium.
Uterus gets high vascularised, ready for embryo implantation.
Disintegration of endometrium.

151 XII Biology


11.

Adapter molecule because


on one hands reads the code,
on the other hand binds to specific amino acid.
OR
Lactose plays as inducer as well as subsrate in the lac-operon. Lac-operon
is under negative regulation as the presence of repressor prevents the
transcription in the operon.
12. a (i) Water hyacinth/algal growth
Fish/Aquatic animals.
(i) Excessive growth of algae triggered by nitrates and phosphates from
agricultural land run off water.
algal bloom/eutrophication
Cu7 and Multiload 375 copper releasing IUDs
Progestasert, LNG - 20 hormone releasing IUDs
Both increase phagocytosis of sperm and affect sperm motility. Hormone
releasing also make uterus unsuitable for implantation and cervix hostite to
the sperms.
Inbreeding
increases homozygosity, so helps in creating pure lines,
exposes lethal genes.
Problem Caused : Inbreeding depression.
Remedy : Mating with unrelated superior animals of the same breed.
Disease : Cancer
Ways to Detect : Biopsy, MRI, Radiography, CT -interferons activate
immune system and helps in destroying the tumor.

152 XII Biology


Divalent cations increases efficiency with which DNA enters the bacterium
through pores in its cell wall.
Biolistics : Bombarding the cells with high velocity micro particles of gold or
tungsten coated DNA.
GEAC : Genetic Engineering Approval committee to
check validity of GM research,
to ensure safety of introducing GM organisms for public services.
IgE are produced against allergens.
Condition is called allergy.
Mast cells cause the allergic response by secreting histamine and serotonin.

SECTION-C

He should explore tropical region because tropical regions have higher diversity
due to :
More speciations as remained undisturbed for millions of year.
Less seasonal so more niche specialisation for species.
More solar energy so more productivity.
Refer figure 3.8(b), NCERT-Bio text book class XII on page no. 49.
Refer Page 76 NCERTBio Text Book

Convention : All reference point while defining a transcription unit is made


with respect to coding strand. Promoter region is towards 5 end of coding
strand. Coding Strand 5 TACGTACGTACGTACGTACG 3
Sum total of all allelic frequencies is one.
Let p and q represent the frequency of alleles A and alleles a respectively.
2 2
So p + q = 1. for a monohybrid cross, the frequency of AA is p and aa is q
and that of Aa is 2 pq.
2 2
Hence, p + 2pq + q = 1

153 XII Biology


2
This is a binomial expansion of (p + q) i.e.
it remains constant at 1.
This was proposed by Hardy and Weinberg.
Gene flow, genetic drift, mutation, genetic recombination and natural
selection effect it.
Refer page 184, NCERT - Biology Class XII.
Fefer fig 8.6, page 155, NCERT - Biology Class XII.
(a) Isolate nematode specific genes.
Produces sense and anti sense RNA in host cells.
Forms double stranded RNA (due to being complementary).
Silence the specific mRNA of the nematode.
Transgenic tobacco plant is protected against nematode.
Features of Cloning Vectors
(a) Ori site (b) Selectable marker (c) Cloning sites.
Recombinant and non-recombinants can be distinguished by using
insertional inactivation method in which recombinant DNA is inserted in
coding sequence of an enzyme -galactosidase.
This results into inactivation of the enzyme. Presence of chromogenic
substrate gives blue coloured colony if plasmid does not have an insert
but no colour is produced if insert there (as -galactosidase becomes
inactivated).
(a) Taq polymerase obtained from bacterium called as Thermus aquaticus.

Very low concentration of bacteria or virus can be detected by amplifications


of their nucleic acid by PCR.
Refer page 276, NCERT - Class XII, Biology. It
increases the BOD of water.
Human activities have accelerated the rate of eutrophication. This is
called cultural eutrophication.
OR
Its occuring at a faster rate.
Its due to human activities.
Causes are
Habitat loss and fragmentation

154 XII Biology


Over exploitation.
Alien species invasions.
Co-extinctions
Refer page 264, NCERT-Bio Class XII
Refer page 25-27, Class XII-NCERT (Biology). Three
outbreeding devices
Pollen release and stigma receptivity are not synchronised.
Anther and stigma are placed at different position.
Self-incompatibility.
Self-Incompatibility : Genetic mechanism which prevents self pollen from
fertilising the ovule by inhibiting pollen germination or pollen tube growth in
the pistil.
OR
Refer Fig 3.11, page 52, NCERT-Biology Class XII.
(a) Refer Fig. 5.11. page 84-Biology Class XII
Analysis of traits in several of generations of a family is pedigree analysis.
Use : To trace inheritance of a specific trait, abnormality or diseases.

The process/technique is DNA fingerprinting (Refer page No. 122, NCERT-


Biology Class XII).
Refer page No. 110-111, NCERT-Biology, Class XII.

155 XII Biology


Contents
S Chapter PAGE NO
No

1 Reproduction in animal 16-19


2 Sexual reproduction in flowering plants 17-24
3 Human reproduction 24-29
4 Reproductive health 29-32
5 Principles of inheritance and variation 33-38
6 Molecular basis of inheritance 39-45
7 Evolution 45-49
8 Human health and diseases 50-53
9 Strategies for enhancement in food 53-55
production

10 Microbes in human welfare 55-56


11 Biotechnology :principles and processes 57-59
12 Biotechnology and its application 60-61
13 Organisms and populations 62-66
14 Ecosystem 67-70
15 Biodiversity and conservation 71-74
16 Environmental issues 75-79

5
Details of the concept to be mastered by every child of class XII with
concepts and exercises of NCERT Book.
Symbols used
* Important * * Very Important Questions
Questions
* * * Very-very Important Questions
CHAPTER Concepts Degree Ref. NCERT Common errors
of text book.:
imp. page nos
Reproduction Types of reproduction NCERT text fail to differentiate
In Organisms A) Asexual * book xii fig . asexual
reproduction 1.2(a) (b) fig. reproductive
B) Sexual reproduction, 1.3, 1.4 page structures-
phases and events in * * 5-8 zoospores,
sexual reproduction conidium, gemules
etc.
NCERT book
p 15 - 19 ex differentiation in
q monoecious &
2,6,9,13,15,18 diocious
Sexual 1. Pre fertilization:
Reproduction structures and events ***
In Flowering (i) stamens
Plants microsporangium & NCERT book no. of cells in
pollengrain fig 2.2. 2.3 , mature pollengrains
microsporogenesis ** 2.5 p 21
(ii) pistil megasporangium 23
( ovule) embryosac-
megasporogenesis no. of cells & nuclei
2) pollination ** in embryo sac , role
(i) autogamy , xenogamy, NCERT book of synergids
geitnogamy fig 2.7(d) 2.8
(ii) agents of pollination ** p 24 27 self incompatibility
(iii) out breeding devices
(iv) pollen pistil interaction ***
3. Double fertilization NCERT book
4. Post fertilization : *** p 27 28
structures & events
endosperm , embryo, seed *
5. Apomixis -
polyembryony ** NCERT book
p 31 33 triple fusion
free nuclear &

NCERT book cellular endosperm,


p 34 fig embryo of monocot
2.12. (c,d,e)

6
fig 2.13, fail to differentiate
2.14, 2.15 apomixes ,
p 35 parthenocarpy
NCERT
p 38
NCERT

Human 1 male reproductive system


Reproduction (i) diagram & description *
(ii) parts of male NCERT P
reproductive system * 43 , FIG 3.1
(structure) (B) Exact Location &
(iii) functions of parts of NCERT P Function Of Leydig
system *** 43-44 Cells & Sertoli
(iv) accessory ducts ** Cells
(v) accessory glands **
NCERT P
43-44

2. Female reproductive
system
(i) diagram & description ** NCERT P
(ii) parts of female 44- 46 , FIG
reproductive system * 3.3 (B)
(structure) -DO-
(iii) functions of parts of
system **
(iv) accessory ducts * NCERT P
(v) uterus & its layers ** 44-46
(vi) mammary glands * NCERT P
44
NCERT P
46
NCERT P
47
3 gametogenesis ** NCERT P Exact Stage Where
(i) spermatogenesis & * 47 FIG 3.2 Meiosis I & Ii
diagram & 3.5 , 3.8 (a) Occurs During
P 49 Gametogenesis As
Well As The Ploidy
(ii) stages of Of Cells At Each
spermatogenesis with names Stage Of
of cells & no of *** Page no 47 Gametogenesis
chromosomes
(iii) structure of sperm

7
(diagram) *** Fig 3.6, page
(iv) functons of each part of *** no 48
sperm & organelles page no 48
(v) composition of semen **
page no 48
4 oogenesis Fig 3.7 ,Fig Difficulty in
i)structure and description *** 3.8(b) relating different
ii) development of follicles ** Page no 48- stages of oogenesis
iii) stages with names of *** 49 with different life
cells and no. of stages.
chromosomes with events *** Page no48-49
iv) significance of polar
bodies Page no48-49

5 menstrual cycle Co-relation of levels


(i) menarche and * Page no 49, of pituitary
menopause ** 51 hormones and
(ii) phases of menstrual Fig 3.9 events during
cycle with diagram *** menstrual cycle
(iii) role of hormones in
cycle
6 fertilization and
implantation * Fig 3.1, Labelling of mature
(i) structure of ovum ** Page no 51 graafian follicle
(ii) cleavage- formation of Fig 3.11
morula and blastula *** Page no 52
(iii )implantation- meaning,
stage and site ** Page 53
(iv) sex determination in **
humans Page 52
(v) three germ layers Page 54
7 pregnancy and embryonic
development
(i) placenta as endocrine *** Page 53
gland ** Fig 3.12
(ii) embryo and extra- Page 53
embryonic layers
8 parturition
(i) meaning ** Page no 54 Hormones involved
(ii) foetal ejection reflex at the time of
(iii) Role of hormones parturition
9 lactation
Meaning, colostrum and its * Page no 54
importance
Reproductive 1. Reproductive health
Health (i) Problems & Strategies ** Page 57-58 Amniocentesis

8
2. Methods of birth control *** Page 59-61 Specific site for
transplantation of
3. Infertility Corrective ** Page 64 embryo in GIFT and
treatments ZIFT
4. Sexually transmitted *** Page 63
diseases

5methods of birth control ** Page66


(i) natural methods
(ii) barrier methods
(iii)IUDS
(iv)oral contraceptives
(v) injections and implants
(vi)surgical methods

Principles of 1. Mendels laws of


inheritance inheritance
and variations (i) Reasons for choosing * Page 11/7 of
garden pea Pradeeps
(ii) Seven contrasting traits ** Textbook
of pea plant Fig 5.1 page
(iii) Symbols and terms used ** 7071
in mendels experiment
(iv) Steps involved in * Page 71-73
mendels experiments
(v) Monohybrid cross *** Page 70-71
(vi) Test cross *** Gamete formation
(vii) Incomplete dominance *** Page 71-75 in dihybrid cross
(viii) Codominance and *** Fig 5.5 74-75
multiple alleles Fig 5.6 page
(ix) Dihybrid cross *** Table 5.3
2. Chromosomal theory of ** page 77-78
inheritance
3. Linkage and ** Fig 5.7 page
recombination *** 79
4. Sex determination in Table 5.3 fig Heterogametey in
animals ** 5.8-5.9 sex determination
5. Mutations
6. Genetics disorder ** Page 83-84
(i) Pedigree analysis *** Fig 5.12 page
(ii) Mendelian disorders 85-86
*** Use of symbols for
(iii) Chromosomal disorder Page 87 autosomal and sex
linked disorders
Page 87-88
fig 5.13, 5.14

9
Page 89-90

Page 90-91

Molecular 1. DNA **
basis of (i) structure and salient Page no. 96- Polarity of two
inheritance features 98 stands
(ii) packaging of DNAhelix **
Fig 6.4 page Histone and non
2. Search for genetic 99 histone
material *** chromosomal
(i) transforming principle *** protein
(ii) Hershey and Chase Page 100-101
experiment ** Fig 6.5 Page
(iii) properties of genetic 102 Differentiation
material between
3. Replication *** Page 103 transformation and
experimental proof transaction
4. Transcription Fig 6.7, 6.8

(i) transcription unit *** page 105-107


(ii) type of RNA and *** Leading and lagging
process of transcription strand direction
5. Genetic code ** Fig 6.9, page

(ii)Mutations and Genetic ** 107-108


Code 109-111
(iii) tRNA-The adapter *** Polycistronic,
Molecule monoistronic,
6. Translation **** page 112 capping, taling
7. Regulation of Gene Page 113
Expression
(i) Levels of Regulation * Fig. 6.12 Frame Shift and
(ii) The lac operon **** Page-114 Point mutation
8. Human Genome Project *** Charging of tRNA
Fig. 6.13
Page 115
9. DNA Finger printing ****
1
0
Page 115
Fig.
6.14,Page
116,117 Expresses Sequence
Page118-120 Tags Sequence
Annotation
BAC/YAC
Fig. 6.16
Page 121-122 Satellite
DNA,VNTR
Evolution 1. Origin of Life * Fig 7.1
2. Evidences of Evolution ** Fig. 7.3 Page
3. Adaptive Radiation **** 130-132 Branching Desent
4. Biological Evolution * Fig. and Natural
5. Mechanism of Evolution ** 7.5,7.6,7.7 Selection
6. Hardy-Weinburg *** Page 133 Darwinism versus
Principle Page 134 de-Vries- -Saltation
7. A Brief Account of Page 135 Hardy-Weinburg
Evolution * Fig. 7.8 Page Equlibrium,Founder
8. Origin and Evolution of 136-137 Effect
Man Fig. 7.9,7.10
Fig. 7.11

Page 140

Human Health [Link] Diseases in **


& Diseases human
2. Immunity Fig. 8.1 Page
(i) Innate immunity ** 146-149
(ii) Aquired immunity ***
(iii) Active and Passive
immunity
(iv) Vaccination and Page 150-154
immunity NCERT
(v) Allergy Fig. 8.4
(vi) Autoimmunity * Specific Role of
(vii) Immune System of ** histamines and
Body * serotonins
3. AIDS Mucosal associated
[Link] **** Fig 8.6 Text lymphoid Tissue
5. Drug and alcohol abuse *** 156 MALT
(i) Adolescence and drugs **** Text Page Contact Inhibition
156-158
Text Page
158-163

1
1
Strategies for 1. Animal husbandry
Enhancement (i) Management of farm *
in food and farm Animal
Production (ii) Animal Breeding ** Page 165-170
(iii) Bee Keeping ** Text
(iv) Fisheries *
2. Plant breeding
(i) Method **
(ii) For disease Resistance *** Page 170-176
(iii) For Pest Resistance *** Text
(iv) For Improved food **
quality
3. Single cell Protein *** Page176 Text
4. Tissue Culture ** Page 177
Text

Microbes in 1. Role of Microbes in:-


Human (i) House Hold * Text Page
Welfare (ii) Industrial Product *** 181
(iii) Sewage Treatment ** Page 182,183
(iv) Production of Bio Gas * Ex. Question
(v) As Biocontrol Agent *** 12
(vi) As Biofertlizers *** Page 184-185
Ex. Question
7,8,11
Page 185
Page 186-187
Page 188

Biotechnology 1. Principles of NCERT text


principles and biotechnology * book xii fig .
processes (i) techniques used in 1.2(a) (b) fig.
modern biotechnology 1.3, 1.4 page
(ii) genetic engineering ** 5-8
includes recombinant DNA,
gene cloning, gene transfer Pallindromic
(iii) meaning and use of NCERT book sequences
plasmid, restriction enzymes p 15 - 19 ex
(iv) basic steps for GMO q
2. Tools of Recombinant *** 2,6,9,13,15,18
DNA Technology Distinction between
3. Cloning Vectors *** transformants and
4. Processes of *** recombinants
Recombinant DNA
Technology Steps Diagram of pBR322
Fig. 11.1- Selectable marker

1
2
11.2-11.3
Page-195-
198
Fig. 11.4
Page-198-200
Fig. 11.6,11.7
Page 201-205

Biotechnology 1. Applications of Page 207-208


and its Biotechnology in agriculture *
applications (i) Advantages of GMO ** Page 208
(ii)Bt Cotton *** Page 208-209 Differentiation of
(iii) RNA interference *** Page 209-210 Cry and cry
2. Applications of nRNA silencing ,
Biotechnology in Medicines *** Page-210-211 nematode
(i) Genetically engineered *** Meloidegyne
insulin. ** Page 211 incognitia
(ii) Gene Therapy-ADA
(iii) Molecular Diagnosis of ** Page-212 Steps in production
diseases. * of insulin
3. Transgenic animals Page-213

4. Ethical issues , Biopiracy Page-214


Role of
Biotechnology in
molecular diagosis.
Organisms 1. Organisms and its
and Environment **
Populations (i) Major Abiotic Factors ** Page -221- Eurythermal &
(ii) Responses to Abiotic *** 223 NCERT stenothermal
Factors *** Fig. 13.3 Conformers,
(iii) Adaptations *** Page 223-225 Regulators
2. Populations:- * Page 225-226
(i) Population **
Attributes
(ii) Population Growth Fig. 13.4 Distinction between
(iii) Life History Page 226-228 Expanding, stable,
variation Fig. 13.5 declining
(iv) Population Page 228-231 population.
interactions Page 231-232 Distinction between
Table 13.1 Exponential and
Page 232-238 Logistic growth
curve.
Distinction between
commensalisms and
Amaensalism.

1
3
Ecosystem 1. Structure and Page 242
function Ex Q. 9
2. Productivity * Fig. 14.1
3. Decomposition Page 243-244 GPP,NPP
4. Energy Flow ** Ex. Q10
5. Ecological Pyramids Page 245,247
6. Ecological ** Ex. Q. 11
succession Fig. 14.4
7. Nutrient cycling * Page 248
Fig. 14.5
Page 250-251
Fig. 14.6
Page 253-255
Ex. Q. 12,13
Biodiversity 1. Patterns of *** Fig. 15.1 Text Graphical
and Biodiversity * page 259 Ex. representation ,
Conservation 2. Importance of Q3 species area
species diversity to *** Page 263 relationships
ecosystem.
3. Loss of Biodiversity
*** Page 264-265
4. Conservation of Ex. Q. 5 Cryopreservation
Biodiversity Page 265-267
Ex. Q. 7

1
4
Environmental 1. Air Pollution and its ** Fig. 16.1 Advantages of CNG
issues control *** Page 270-273 over Petrol or
(i) Case study of Delhi Page 272-273 diesel.
2. Water pollution and its ** Norms of Air
control Page-274 Pollution.
(i) Domestic Sewage & *** Fig.16.2,16.3 Types of impurities
Industrial effluents & their nature in
(ii) Algal Bloom domestic sewage.
(iii) BOD *** Page 275 Effect of Sewage
(iv) Eutrophication *** discharge on
(v) Biomagnification *** Page- 275 characteristics of
3. Solid waste Page-276 river
(i) Case study of *** Fig. 16.5
remedy for Page-276 Concentraion of
plastic waste. toxic substances at
(ii) Electronic waste Page-279 various trophic
4. Ago chemicals & their *** levels
effects * Page-280
(i) Case study of organic ** Page-280
farming Page-280-282 Types of e-wastes &
5. Radioactive wastes Fig. 16.6,16.7 the metals extracted.
[Link] effect and
Global Warming
(i) Green house gases & ***
their relative contribution to
total global warming ***
7. Ozone depletion in ** Page-282-283
Stratosphere Page-284-285
8. Deforestation:- Case Role of UV-B
study of conservation. radiations

15
Chapter 1 - REPRODUCTION IN ORGANISMS
CHAPTER Concepts Degree Ref. NCERT text book.: Common errors
of imp. page nos
Reproduction Types of reproduction NCERT text book xii fig . fail to differentiate
In Organisms C) Asexual * 1.2(a) (b) fig. 1.3, 1.4 asexual reproductive
reproduction page 5-8 structures- zoospores,
D) Sexual conidium, gemules etc.
reproduction, **
phases and events NCERT book p 15 - 19 differentiation in
in sexual ex q 2,6,9,13,15,18 monoecious & diocious
reproduction

Definitions:
CLONE :- Offspring from single parent, Morphology and genetically similar individuals.
CYST :- Hard covering around the organism protecting from anti environment.
DIOECIOUS :- It is the condition in which either male or female reproductive organs are found
in the same body of an organism.
EMBRYOGENESIS :- It is the process of development of embryo from the zygote..
FERTILIZATION :- The union of two opposite types of gametes, spermatozoa and ova to
produce single diploid zygote.
FISSION :- Division of nucleus with cytoplasm.
FRAGMENTATION :- Division of breaking into distinct pieces each of which can produce an
offspring.
GEMMULE :- The parent individual releases a specialized mass of cells enclosed in a common
opaque envelope called the gemmule.
HERMAPHRODITE :- Organisms which have both male and female reproductive organs in
the same individual.
HOMOGAMETES :- When the two gametes of male and female are so similar in appearance
that it is not possible to categorize them into male and female gametes.
JUVENILE PHASE :-Juvenile Phase represents the period of an organism from birth upto
reaching reproductive maturity.
LIFE SPAN :-The period from birth to the natural birth of an organism.
MEIOCYTE ;- The cell which undergoes meiosis is called a meiocyte .
MONOECIOUS :- It is the condition in which male and female reproductive organs are found
in the same body of an organism.
PARTHENOGENESIS :-The female gamete undergoes development to form new organisms
without fertilization.
REPRODUCTION :-Biological process in which an organism gives rise to young ones of its
own kind.
SYNGAMY :- Syngamy refers to the fusion of two (male and female) gametes. VEGETATIVE
PROPAGATION :-It is the process of formation or regeneration of new plants from a portion
of a vegetative part of the plant .

16
Differences

External fertilization Internal fertilization


1. This is fusion of gametes (syngamy) 1. It is the fusion of gametes inside the
outside the body body of mother.
2. The progeny formed are extremely 2. They are well protected hence the
vulnerable to predators. eg. bony fishes and chances of more survival of young ones.
amphibians eg. reptiles

Menstrual cycle Oestrous cycle


1. It is the cyclic change that takes [Link] operates in the non primate females
place in reproductive organs of primate 2. No menstruation take place at the end of
females cycle
2. Menstruation takes place at the end 3. Copulation takes place in heat period.
of cycle in the absence of fertilization. 4. Eg. cow, deer
3. Copulation takes place in any season.
4. Eg. humans

Seasonal breeders Continuous breeder


1. There are some animals/ mammals 1. These are the mammals which possess
which possess the changes in reproductive changes in their reproductive organs
organs only during favourable conditions. throughout their reproductive phase.
2. They reproduce only in a particular 2. They reproduce during any time of the
season of year eg. Dogs and rats year. Eg. Humans

Oviparous Viviparous animals


1. The animals which lay fertilized or 1. These animals give birth to young ones.
unfertilized eggs.
2. The development takes place outside the 2. The development takes place inside the
body eg. Reptiles and birds. body eg. Mammals.

ASSIGNMENTS

LEVEL-1
What is meiocyte?
Name the structure which gets transformed into seeds at maturity.
Show diagrammatically only reproduction in yeast.
Name two animals having external fertilization. Why are more gametes produced by such animals?

17
LEVEL 2
Why are the date palms referred to as dioecious?
Name any one animal in which self-fertilization occurs.
Differentiate between: External Fertilization / Internal fertilization, Zoospore / zygote,
Gametogenesis / Embryogenesis.
What is special in flowering bamboo?

Write the mode of asexual reproduction in the following organisms:

Penicillium, Spongilla, Paramoecium, Yeast, Chlamydomonas, Amoeba.


Why are the date palms referred to as dioecious ?

What do the following parts in a flower form after fertilization?

Zygote,
ovule,

ovary-wall,
Petal

LEVEL 3
What are the three major phases in the life cycle of organism? Define each phase
Discuss the similarities in pattern of sexual reproduction.
Name the kind of reproduction in bees by which drones are produced?
If the diploid number of chromosomes in an angiosperm plant is 28, what number would
you expect in the endosperm and embryo of that plant?
Give the scientific terms for the following
Morphologically and genetically similar individual derived through asexual
reproduction.
Cyclical changes shown by seasonal breeders.
What is the site of origin of new plantlets in the followings ?

Potato tuber,
rhizome of ginger,

leaves of bryophyllum,
stem cutting of sugar cane

18
7. Label S & P shown in the Figure and state one function each.

[Link] the following events in proper sequence:-


(a) Embryogenesis (b) fertilization (c) Gametogenesis (d) Zygote formation
Mention two processes taking place in embryogenesis?
What will happen if meiosis does not take place during gametogenesis?
SELF EVALUATION ASSIGNMENT
Single celled organisms are considered immortal. Justify the statement taking the example of
amoeba.
Which ability of plants like banana and bryophyllum is exploited by gardeners & farmers for
theit commercial propagation.
All papaya and date palm plants produce flowers yet only few papaya and datepalm are seen to
produce fruits. Suggest the possible reason for the rest not producing then.
in nature for both plants and animals hormones are responsible for transition between the three
phases of their life span. Which three phases are being refer to here. What regulates the
reproduction process and the associated behavioral expression in them?
Name the process of development of embryo from zygote. What are the two changes which the
zygote undergoes during this process.
i)Name a group of plants that has haploid body
ii)what are the specialized cells which undergo meiosis in the diploid organisms.
(i) In bisexual flowers why is transfer of pollen grains easier than in the unisexual
flowers?
(ii) Name the specialized event in unisexual flowers which helps in transfer
of pollen.
(iii)How are the non-motile male gametes carried to the female gamete in
seed plants?
8. Why Dogs and cats have oestrus cycle but human beings have menstrual cycle,
through all are mammals? Why some mammals are called seasonal breeders?
Arrange the following events in proper sequence:-
(a) Embryogenesis (b) fertilization (c) Gametogenesis (d) Zygote formation
Mention two processes taking place in embryogenesis?
What will happen if meiosis does not take place during gametogenesis?

19
Chapter 2
SEXUAL REPRODUCTION IN FLOWERING PLANTS

Sexual 3. Pre fertilization:


Reproduction structures and ***
In Flowering events
Plants (i) stamens NCERT book no. of cells in
microsporangium & fig 2.2. 2.3 , mature pollengrains
pollengrain ** 2.5 p 21
microsporogenesis 23
(ii) pistil
megasporangium no. of cells & nuclei
( ovule) embryosac- ** in embryo sac , role of
megasporogenesis NCERT book synergids
2) pollination fig 2.7(d) 2.8
(i) autogamy , ** p 24 27 self incompatibility
xenogamy, geitnogamy
(ii) agents of pollination ***
(iii) out breeding NCERT book
devices *** p 27 28
(iv) pollen pistil
interaction *
3. Double fertilization
4. Post fertilization : ** NCERT book
structures & events p 31 33 triple fusion
endosperm , embryo,
seed free nuclear &
5. Apomixis - NCERT book cellular endosperm,
polyembryony p 34 fig embryo of monocot
2.12. (c,d,e)
fig 2.13, fail to differentiate
2.14, 2.15 apomixes ,
p 35 parthenocarpy
NCERT
p 38
NCERT

Definitions

DOUBLE FERTILIZATION :- Fusion of one male gamete with egg and the other gamete with secondary nucleus
(forming 3n endosperm nucleus)
FISSION :- Fraction of nucleus with cytoplasm. GOOTEE :-
bark of healthy and woody branch for grafting.
HELOBIAL :- The mitosis is followed by cytokinesis forming two unequal cells. Subsequent divisions are free
nuclear making the endosperm cellular after cytokinesis.
INCOMPATIBILITY :- The inability of certain gametes, even from genetically similar plant species to fuse with
each other. This is also called intraspecific incompatibility, self sterality.

20
NUCELLUS:- The nucleus undergoes repeated divisions & nuclei so produced get arranged in the periphery
leaving a large central vacuole-cytokinesis begins from the periphery towards the centre making it cellular at
maturity. e.g. maize, wheat, sunflower.
PARTHENOCARPY :- Development of fruit in an unfertilized flower resulting in a seedless fruit. e.g. grapes,
banana, tomato.
REPRODUCTION :- The process of producing offsprings and a means of self perpetuation.
DIFFERENCES

Geitonogamy Autogamy
1. It refers to transfer of pollen grains 1. It refers to transfer of pollen grains from
from anther to stigmaof a different anther to stigma of same flower on the
flower on the same plant same plant.
2. It requires a pollinating agent 2. It does not requires a pollinating agent

Perisperm Pericarp
1. It is the remnant of the nucellus left in 1. It is the wall of fruit formed by the ovary
the seed wall.
2. It provides nutrition to the seed / 2. It provide protection and help in dispersal of
developing embryo seed

Microsporogenesis Megasporogenesis
1. It is the process of formation of 1. It is the process of formation of megaspore
microspore from microspore mother cell in from megaspore mother cell in an ovule.
anthers. 2. Only one of megaspore mother cell
2. A no. of microspore pollen mother cell undergoes this process inside a mega
undergoes this process inside a sporangium.
microsporangium c) All the microspores 3. Only one of the megaspores formed from
formed from MMC are functional. MMC is functional

Geitonogamy Xenogamy
1. It refers to transfer of pollen grains from anther 1. It refers to transfer of pollen grains from
to stigma of a different flower on the same plant. anther of one plant to stigma of another flower
2. It does not result in genetic variation on the different plant
2. It result in genetic variation

True fruit False fruit


1. They develop only from the ovary after 1. Those fruits which develop from the parts of
fertilization. a flower other than ovary.
2. eg. Mango tomato 2. Apple , strawberry

21
ASSIGNMENTS:

LEVEL I
Name the protective substance present on the pollen envelope to tide over adverse conditions.
Your friend would like to cross-pollinate the bisexual flower. How can you guide him to be
successful in his experiment?
3 What is selfincompatibility? Mention two strategies evolved to prevent self pollination in flowers.
LEVEL 2
1 Why are pollen grains produced in enormous quantities in anemophilous flowers?
2 T.S. of anther shows four layers in the wall-epidermis, endothelium, tapetum and middle layer.
Arrange them from outermost to innermost.
3. Complete the flow chart

4(i) What is the process shown in the diagram given below (ii) Name the structure at (a) of the figure

22
5. Both wind and water pollinated flowers are not very colourful and dont produce nector. What would
be the reason for this?
6. (i) What are the pollen/nectar robbers?
(ii) Why do flowers pollinated by flies and beetles secrete foul odor?
What is pollen pistil interection? Why is it called a dynamic process?
Why do you think that the zygote is dormant for some time in a fertilized ovule?

LEVEL 3
1. Non-albuminous seeds do not have endosperm, then from where do they take the food
during germination?

2 State the difference between the endosperm of gymnosperms and angiosperms.

If the number of chromosomes in the leaf cell of a flowering plant is 28, what number would you
except in the embryo and endosperm of the plant?
Mention the scientific term used for modified form of reproduction in which the seeds are formed
without fusion of gametes.
What will be the fate of ovule if the synergids are absent in the embryo sac?

(i)The microspore is haploid while microspore mother cell is diploid comment?


How many male gametes and female gametes are produced by
a) 5 Microspore mother cells
b) 5 megaspore mother cells

Cleistogamy inspite of producing assured seed-set even in the absence of pollinators is considered
disadvantages to the plant. Why?
What is the ploidy of the following?
(i) cells of nucellus, (ii) microspore mother cell, (iii) functional megaspore and (iv)
female gametophyte?
How do the flowers of maize and cannabis pollinated? What are the features found in these flowers
for such type of pollination?

How would you justify the absence of sporopollenin in exine of pollen grains at some places?
11.W hy does self pollination not lead to seed formation in self incompatible species?

12.(i) Generally nucellus does not persist in mature seeds. Cite two examples which show persistence
of nucellus in the seed

SELF EVALUATION

1. Name the two wall layers of pollen grain and state the chemical nature.
How many germ pores are there in pollengrain of monocots and dicots ? What is the function of
germ pore?

23
Name the seed in which endosperm is present? How does the endosperm of gymnosperms differ
from that of angiosperms?
Give the technical term and one example for each of the following :
A plant in which separate male and female flowers are borne on the same individual at
different positions
A species in which the individual plant is either male or female
What are the different devices developed by plants to discourage self-pollination and encourage
cross-pollination?
Show diagramatically the various events occuring in the development of female gametophyte in
angiosperms.
Differentiate between geitnogamy and allogamy.

Chapter 3
Human Reproduction
Human 1 male reproductive
Reproduction system *
(i) diagram & NCERT P
description * 43 , FIG 3.1
(ii) parts of male (B) Exact Location &
reproductive system NCERT P Function Of Leydig
(structure) *** 43-44 Cells & Sertoli Cells
(iii) functions of parts of **
system **
(iv) accessory ducts NCERT P
(v) accessory glands 43-44

2. Female reproductive
system
(i) diagram & ** NCERT P
description 44- 46 , FIG
(ii) parts of female * 3.3 (B)
reproductive system -DO-
(structure)
(iii) functions of parts of **
system * NCERT P
(iv) accessory ducts ** 44-46
(v) uterus & its layers * NCERT P
(vi) mammary glands 44
NCERT P
46
NCERT P
47
3 gametogenesis ** NCERT P Exact Stage Where
(i) spermatogenesis & * 47 FIG 3.2 Meiosis I & Ii Occurs
diagram & 3.5 , 3.8 (a) During Gametogenesis

2
4
P 49 As Well As The Ploidy
Of Cells At Each Stage
(ii) stages of Of Gametogenesis
spermatogenesis with
names of cells & no of *** Page no 47
chromosomes
(iii) structure of sperm
(diagram) *** Fig 3.6, page
(iv) functons of each *** no 48
part of sperm & page no 48
organelles **
(v) composition of page no 48
semen

4 oogenesis Fig 3.7 ,Fig Difficulty in relating


i)structure and *** 3.8(b) different stages of
description ** Page no 48- oogenesis with different
ii) development of *** 49 life stages.
follicles
iii) stages with names of *** Page no48-49
cells and no. of
chromosomes with Page no48-49
events
iv) significance of polar
bodies

5 menstrual cycle Co-relation of levels of


(i) menarche and * Page no 49, pituitary hormones and
menopause ** 51 events during menstrual
(ii) phases of menstrual Fig 3.9 cycle
cycle with diagram ***
(iii) role of hormones in
cycle
6 fertilization and
implantation * Fig 3.1, Labelling of mature
(i) structure of ovum ** Page no 51 graafian follicle
(ii) cleavage- formation Fig 3.11
of morula and blastula *** Page no 52
(iii )implantation-
meaning, stage and site ** Page 53
(iv) sex determination in **
humans Page 52
(v) three germ layers Page 54
7 pregnancy and
embryonic development
(i) placenta as endocrine *** Page 53

2
5
gland ** Fig 3.12
(ii) embryo and extra- Page 53
embryonic layers
8 parturition
(i) meaning ** Page no 54 Hormones involved at
(ii) foetal ejection reflex the time of parturition
(iii) Role of hormones
9 lactation
Meaning, colostrum and * Page no 54
its importance

DEFINITIONS:
CLOSOTRUM:- the first milk that comes out of the mammary gland of the mother immediately after child birth is
called colostrums.
FOLLICULAR ATRESIA:- It is the process of degeneration of number of primary follicle in ovary of human
female from birth to puberty.
GAMETOGENESIS :- It refers to the process of formation of gametes for sexual reproduction.
GRAFFIAN Follicle:- The mature follicle in the ovary is known as graffian follicle.
IMPLANTATION:- The process in which embryo become embedded / attached to the wall of uterus is called
implantation.
LECTATION:- Due to the effect of hPL and progesterone after pregnancy there is starting of secretion of milk is
called lactation.
L-H SURGE:- it refers to maximum level of L-H during middle of menstrual cycle.
MENARCHE:- The beginning of menstruation at puberty in primate females is called as
menarche. OOGENESIS:- it is the formation of ova in the ovary by meiosis is known as oogenesis.
PRIMARY SEX ORGANS:- The organs producing male and female gametes are known as primary sex organs.
SECONDARY Sex Organs:- The sex organs which perform important functions in the reproduction but do not form
gametes are called secondary sex organs.
SEMEN:- The mixture of seminal plasma and spermatozoa is called semen.
SPERMIATION:- It is the process of transformation of spermatids into spermatozoa is known as spermiation.
DIFFERENCES

Endometrium Myometrium
1. It is innermost glandular layer that lines the 1. It is the middle thick layer of smooth muscles
uterine cavity. of the uterine wall.
2. Implantation occurs in this layer 2. It is responsible for the uterine movement.
3. It undergo cyclic changes during the menstrual 3. It does not undergo any cyclic changes
cycle during the menstrual cycle.

Spermatogenesis Spermiogenesis.
1. It is the process of formation of mature 1. It is a process of transformation of
spermatozoa in the testis spermatids into spermatozoa.
[Link] involves meiotic and mitotic division 2. It does not involve any division.
3. It is controlled by hormone LH and androgen. 3. It is controlled by hormone LH only.

Blastula Morulla
1. It is a hollow sphere of 32 or more cells 1. It is a solid sphere of 8- 16 cells blastomeres
formed by the rearrangement of blastomeres. formed by cleavage of zygote.

2
6
2. Zona pellucida disintegrates with the 2. Zona pellucida is intact.
enlargement of blastocoel.

Menarche Menopause
1. It refers to beginning of menstruation at 1. It refers to stoppage of menstruation at the age
puberty in primates/ human females. of 45-50 in primates/ human females.
2. It marks the beginning of reproductive phase 2. It marks the end of reproductive phase

ASSIGNMENTS:

LEVEL 1
[Link] does failure of testes to descend into the scortum produce sterility?
Name the important mammary gland secretions that help developing resistance in the new born baby?
What are sertoli cells?
At what stage is the mammalian embryo implanted in the uterus?
What is spermiogenesis?
Name the ducts received by urethra in a human male?
At what stage is meiosis I suspended in primary oocyte?
When is meiosis II completed in the oogenesis of human female?
Define foetal ejection reflex?
Zygote undergoes mitosis to form 16 celled stage of embryo. What is it known as?

Fill in the boxes


Spermatogonia

Secondary spermatocytes

Spermatozoa
How do hormones secreted from anterior pituitary gland control and regulate the male reproductive
system?
Why does fertilization takes place in fallopian tube and not in uterus?
Draw and label the main parts of the human spermatozoa. Why is the middle piece considered as
power house of the human sperm?
LEVEL -2
15 What is acrosome? What is its significance?
Faillure of fertilization leads to menstruation. Explain.
What is the role of pituitary hormone in the regulation of menstrual cycle?
Mention the main changes taking place during implantation.

27
Name the hormonal secreted by placenta that play significant role in maintaining pregnancy?
State any two differences between Spermatogenesis and oogenesis.

During fertilization hundreds of sperm cells are in the vicinity of an egg cell. But only one sperm
enters the ovum. How is this achieved?
What are the main events / changes taking place after implantation that lead to formation of
Placenta?
Name the part of female reproductive system where the embryo is implanted. Mention the type of
tissue by which it is made up of and give their functions?
Label a, b, c in the following diagram.

25. What is pregnancy hormone? Why it is so called? Name two sources of this hormone in a
human female?
LEVEL-3
26. Give reasons:-
i). zona pellucida layer block the entry of additional sperms?
ii). sperm cannot reach ovum without seminal plasma?
iii). all copulations do not lead to fertilization and pregnancy?
Furnish the technical term for the following:-
the middle thick layer/wall of uterus
semen without sperm
mechanism responsible for parturition
Women are often blamed for giving birth to girl child in our society. What is your View?
What are following known as:-
cushion of fatty tissue covered by skin and pubic hair in female external genitalia.
the finger like projections which collect ovum after ovulation
the finger like projections appearing in the trophoblast after implantation?
What is the fate of inner cell mass in the blastocyst? Mention their significance.

(i) What is the number of chromosomes in the following cells of human male? a.
spermatogonial cells b. spermatids c. primary spermatocyte d. sertoli cells.
How many sperms are present in an ejaculate of human male? What proportion of them should
have normal size and shape and what proportion should have vigorous motility for normal
fertility?
(A) Differentiate between menarche and menopause

28
(B) (a) Read the graph given below. Correct the ovarian events that take place in the human female
according to the pituitary hormones during the following days:
(i) 10-14 days (ii) 14-15 days
(iii) 16-23 days (iv) 25-29 days (if the ovum is not fertilised)

th
(C) What are the uterine events that follow beyond 29 day if the ovum is not fertilised?

SELF EVALUATION

Name the important mammary gland secretions that help developing resistance in the new born
baby?
Define foetal ejection reflex?
Faillure of fertilization leads to menstruation. Explain.
Draw and label the main parts of the human spermatozoa. Why is the middle piece considered as
power house of the human sperm?
5. . Give reasons:-
i). zona pellucida layer block the entry of additional sperms?
ii). sperm cannot reach ovum without seminal plasma?
iii). all copulations do not lead to fertilization and pregnancy?
Women are often blamed for giving birth to girl child in our society. What is your View?
What is the fate of inner cell mass in the blastocyst? Mention their significance.

Chapter-4
:REPRODUCTIVE HEALTH

Reproductive 1. Reproductive health


Health (i) Problems & ** Page 57-58 Amniocentesis
Strategies *** Page 59-61 Specific site for
2. Methods of birth transplantation of
control ** Page 64 embryo in GIFT and
ZIFT
3. Infertility *** Page 63
Corrective treatments
4. Sexually transmitted

29
diseases
5methods of birth ** Page66 control

natural methods
barrier methods
(iii)IUDS
(iv)oral contraceptives
injections and
implants (vi)surgical
methods

DEFINITIONS:
IN- VITRO FERTILIZATION :- In- Vitro fertilization refersto thr fusion of gametes in the laboratory conditions.
INFERTILITY:- The inability of couple/ person to produce new young one inspite of unprotective sexual act.
INTRA-UTERINE DEVICES(IUDS):- These are the devices inserted in uterus to achieve contraception.
LACTATIONAL AMENORRHEA:- It refers to the absence of menstruation during the period of intense
lactation following parturition.
MEDICAL TERMINATION OF PREGNANCY( MTP):- voluntary termination of pregnancy before full term is
called MTP or induced abortion.
POPULATION EXPLOSION:- An enormous increase in the size of the population in the short span of time is
called population explosion.
REPRODUCTIVE HEALTH :- It is total well being in physical, emotional, behavioural and social aspect of
reproduction.
SEXUALLY TRANSMITTED DISEASES(STDs):- Diseases or infections that are transmitted through sexual act
are called STDs or reproductive track infections (RTIs).
TUBECTOMY:- Sterilization process in female by cutting of fallopian tubes is called tubectomy.
VASECTOMY:- Sterilization procedure in male by cutting and tying of vas deference is called vasectomy.
DIFFERENCES

Tubectomy Vasectomy
1. Method of sterilisaion in females 1. Method of sterilization in males
2. Fallopian tubes of both sides are cut and tied. 2. Vas deference is cut and tied.
3. It prevents ova to reach the place of 3. It prevents sperms to reach the place of
fertilization fertilization.

GIFT ICSI
1. called as gamete intra fallopian 1. intra cytoplasmic sperm transfer
transfer(b).transfer of ovum from a donor this is a special technique to prepare
female to embryo in lab .
provide suitable environment . 2. The sperm is directly injected to ovum .
2. sperm is not directly injected to ovum 3. artificial insemination is done for infertile
3. no artificial insemination is done couple

30
ASSIGNMENTS:
LEVEL 1
A large number of couples are said to be infertile. These couple could be assisted to have
children through certain special techniques. Name one such technique.
Condoms are the barrier that prevents the ovum and sperms from coming closer. Suggest one
more benefit of condoms
Differentiate between ZIFT and GIFT.
Give reasons why family planning techniques are not adopted by all in our country?
What are action plans/programmes initiated In India at the national level to attain total
reproductive health?
Label the diagram and mark A in it.

3 Name a STD caused by protozoan.


4 How do Intra-Uterine devices (IUDs) prevent conception? List any two ways?
5 Identify the given diagram. What is it used for?

6 (i)Name the principle on which natural methods of Birth control work?


What is periodic abstinence?
Is sex education necessary in school if so, why? Give any four reasons.

8 Enumerate the complications that untreated STDs can lead to?

31
9 Mention the different ways in which people are made aware of the significance of reproductive and a
reproductively healthy society?

LEVEL 3
1 At what stage zygote can be introduced in the fallopian tube in Zygote Intra Fallopian Transfer
(Z.I.F.T.)
2 A doctor has observed the chromosomal disorder in developing foetus and advised the couple to
undergo abortion. Suggest the technique by which doctor observed the chromosomal disorder.
3. A Womens husband is infertile. So the lady has decided to have baby by taking sperms from sperm
bank. Which technique will you suggest for her pregnancy?

4. Following table gives certain terms associated with ARTS


Fill the spaces a, b, c and d.

Sr. no. Column 1 Column 2


1 IVF and ET a
2 b Introduction of zygote or embryo with 8 blastomeres in
fallopian tube
3 c Introduction of Ova of a donor into fallopian tube
4. IUT d

Saheli is an example of oral contraceptive-


(i)Name the non-steroidal principle in it.
(ii)How does it provide contraception.
During lactation chances of conception are almost zero.
(i) Give the reason.
(ii) Give the term used to describe the phenomenon?

SELF EVALUATION

What precautions a lady can take to prevent unwanted pregnancy?


Name the barrier.
Mention the composition of it.

Mention any four possible ill-effects of contraceptives?


Give reasons why family planning techniques are not adopted by all in our country?
Mention any two probable reasons for repid rise of population in India from the time of
independence to date.
What is the lactational amenorrhea method of birth control.
A mother of one year old daughter wants to space her second child. Her doctor suggested
copperT. Explain its contra ceptive action.
Describe sexually transmitted diseases giving any two examples.

32
Chapter-5
Principles of Inheritance and Variations

Chapter Chapter Concepts Degree Ref. NCERT text Common errors


No. Name of imp. book.: page nos

5 Principles 1. Mendels laws of


of inheritance
inheritance (i) Reasons for choosing * Page 11/7 of
and garden pea ** Pradeeps Textbook
variations (ii) Seven contrasting traits of ** Fig 5.1 page 70
pea plant 71
(iii) Symbols and terms used * Page 71-73 Gamete
in mendels experiment formation in
(iv) Steps involved in *** Page 70-71 dihybrid cross
mendels experiments ***
(v) Monohybrid cross *** Page 71-75
(vi) Test cross *** Fig 5.5 74-75
(vii) Incomplete dominance Fig 5.6 page
(viii) Codominance and *** Table 5.3 page 77-
multiple alleles ** 78
(ix) Dihybrid cross Fig 5.7 page 79
2. Chromosomal theory of ** Heterogametey in
inheritance *** Table 5.3 fig 5.8- sex determination
3. Linkage and 5.9
recombination ** Page 83-84
4. Sex determination in **
animals *** Fig 5.12 page 85-86
5. Mutations *** Page 87 Use of symbols
6. Genetics disorder for autosomal and
(i) Pedigree analysis Page 87-88 fig sex linked
(ii) Mendelian disorders 5.13, 5.14 disorders
(iii) Chromosomal disorder Page 89-90
Page 90-91

Definitions
ALLELES :-Alternative forms of gene.

33
ANEUPLOIDY :- The phenomenon of gain or loss of one or more chromosome.
AUTOSOMES :- All the chromosomes of an individual that are not involved in the
determination of sex.
BACK CROSS:- When F1 progeny /heterozygous is crossed with either of the plant.
CO DOMINANCE :- When two alleles of a gene are equally dominant & express themselves
in the presence of other.
DIHYBRID :- The individual that is heterozygous for the alleles controlling two characters.
DIHYBRID CROSS :- A cross made between individuals of a species considering the
inheritance of contrasting pair of two traits.
DOMINANT ALLELE :- Allele that express itself in a hybrid/heterozygous condition.
EMASCULATION :- Removal of anthers from the bisexual flower before maturation of pollen
grains.
GENETICS :-The branch of science that deals with inheritance &
variations. GENOTYPE :-The genetic constitution of an organism.
HEREDITY ;-The process of transmission of characters from one generation to
another generation/parent to offspring.
HETROZYGOUS :- Organism having dissimilar pair of allele for a character.
HOMOZYGOUS :- Organism having similar pair of allele for a character.
INCOMPLETE DOMINANCE :- When neither of two alleles of a gene is completely
dominant over the other giving an intermediate character.
LINKAGE:- The phenomenon where two or more linked genes are always inherited
together/tendency of a gene (located on same chromosome) to move together into gametes.
LINKED GENES-All the genes present on a chromosome.
MONOHYBRID :- The individual that is heterozygous for the alleles controlling one character.
MONOHYBRID CROSS :- Cross made between two individuals of a species considering the
inheritance of the contrasting pair of a single character.
MONOSOMY :- The condition where a particular chromosome is present in a single copy in a
diploid cell.
MULTIPLE ALLELISM :- When a gene exists in more than two allelic forms.
MUTATION :- Sudden inheritable change in genetic material.
NON-DISJUNCTION :- Phenomenon in which the members of homologous chromosome
pair do not separate during meiosis.
OFFSPRING ;-Products of sexual reproduction.
PEDIGREE ANALYSIS :- It is an analysis of the distribution and movement of traits in a series
of generations of a family.
PHENOTYPE :- Observable or external characteristics of an organism. PLEIOTROPY:-
When a gene has the ability to have more than one phenotypic effect. RECESSIVE ALLELE
:- Allele that is not expressed in a hybrid/heterozygous condition. RECOMBINANTS-DNA
formed by combining DNA from two different organisms. RECOMBINATION :- Exchange
of gene segments between non-sisters chromatids of
homologous chromosome pair.
SEX CHRMOSOME :- Chromosomes that are involved in the determination of sex.
TEST CROSS :- When F1 progeny is crossed with homozygous recessive parent.

34
TRISOMY :- The condition where a particular chromosome is present in 3 copies in diploid
cell.
VARIATION :-Dissimilarities among the individuals of a species.
Differences
GENOTYPE PHENOTYPE
1. Genotype remains the same throughout the 1. Phenotype may change with time and
life of an individual. environment, e.g. infant.
2. Genotype cannot be studied directly .it can 2. Phenotype can be known through direct
be known through the study of ancestor, observation.
mating and offspring.
3. In a given environment or time, individual 3. Individuals with similar phenotypes may not
with similar genotype will produce similar belong to same genotype.
character.

DOMINANT RECESSIVE
1. The condition in which the dominant allele is 1. The condition in which recessive allele or factor
able to express itself even in the presence of its is unable to express its effect in the presence of the
recessive allele is known as dominance. dominant allele is known as recessive.
2. In dominance, the dominant allele or factor can 2. In recessive, the re4cessive allele forms an
form complete polypeptide or enzyme for incomplete defective polypeptide or enzyme so that
expressing its effects, e.g. red colour of flower in expressing consists of absence of the effect of
pea. dominant allele for e.g. white flower colour in pea.

INCOMPLETE DOMINANCE CODOMINANCE


1. Effect of one of two alleles is more 1. Effect of both the allele is equally conspicuous.
conspicuous. 2. There is no mixing of the effect of the two
2. It produces a fine mixture of the allele.
expression of two alleles. 3. Both the allele produce their effect
3. The effect in hybrid is intermediate of the independently
expression of the two allele.
Assignment Questions
LEVEL 1
1. Name the law that explains the expression of only one of the parental characters in the F1
generation of a monohybrid cross?
What is a linkage map?
How is the child affected if it has grown from the zygote formed by an XXegg fertilised by a Y-
carrying sperm? What do you call this abnormality?
Not all characters show true dominance. What are the two other possible type of dominance? Give an
example of each?
What proportional of individuals produced in the progeny of a cross between two individuals with
genotype TtSs will be TtSs and ttss respectively
A cross between two plants heterozygous for a single locus was made. The progeny contained the
following:
i) Round seeds, large starch grains: 1

35
ii) Round seeds, intermediate starch grains: 2
iii) Wrinkled seeds, small starch grains: 1
What phenomenon is exhibited by the above result? Show the genotype of the parents and
offspring using a punnet square.
7. (i)In an experiment3:3:1:1 phenotypic ratio was obtained on crossing a pea plant with
axial,violet flowers with another pea plant having axial, white flowers. Judge the accuracy of this
result using a punnet square.
(ii) Two plants (Snapdragon) with red flowers and white flowers are crossed and produced all
pink flowers in F1 generation
What phenomenon is responsible for it.
Write the genotype of F1.
Write the phenotype of F2 generation.
What would be the phenotype and genotype ratio of the F2 generation?

LEVEL 2
How many types of glycoproteins (oligosaccharides) that determine the ABO blood group are found
on the surface of RBCs in humans?
Pick out the possible combinations of blood groups of parents of a boy who has a blood group O?
(i) Mother O group, Father AB group
(ii) Mother O group, Father heterozygous A group (iii)
Both Mother and Father A group (heterozygous) (iv)
Both Mother and Father AB group
What was the most significant conclusion that Mendel drew from his experiment?
A haemophilic man marries a normal homozygous woman. What is the probability that their
daughter will be haemophilic? (a) 100%, (b) 75%, (c) 50%, (d) 0%.
A homozygous green seeded plant is crossed with yellow seeded plant. The progeny obtained was
half yellow seeded and half green seeded.
i) Write the genotype of yellow seeded progeny.
ii) Write the technical name of cross.
A man with blood group O and his wife with blood group AB claim a child with blood group AB as
their son. Justify whether it is possible or not with a punnet square.
(i) The egg of the animal contains 10 chromosomes of which one is X-chromosome. How many
autosomes would be there in the karyotype of this animal?
(ii) What is meant by aneuploidy?
[Link] the sex chromosome complement of each of the following;
(i) Male fowl (ii) Human female (iii) Male grasshopper (iv) Female grasshopper
When two genes (involved) in a dihybrid cross are situated on the same chromosome, the proportion
of parental gene combination was much higher than the non-parental combination. What is it due to?
Who discovered the phenomenon?
(i) Which of the two, sperms or ovum, determines the sex of the offspring in fowl? Why? (ii)
What is the type of sex determination known as?
In Lathyrus, blue flower colour and long pollen are dominant over red flower colour and round pollen.
In a cross between two plants, one with blue flowers and long pollen, both heterozygous and the other
with red flowers and round pollen, the progeny contained the following:
Blue flowers, long pollen : 42%

3
6
Blue flowers, round pollen : 08%
Red flowers, long pollen : 08%
Red flowers, round pollen : 42%
Explain the phenomenon responsible for such result?
12. Justify the situation that in human beings, sex of the child is determined by father, and not by
mother?

LEVEL 3
What percentage of gametes produced by an individual with genotype AaBb will be ab?
Why does deletion or insertion of a segment of DNA result in alteration of chromosomes (also called
chromosomal aberration)?
If the frequency of parental form is higher than 25% in a dihybrid test cross, what does that indicate
about the two genes involved?
Dominance is not an autonomous feature of a gene or the product it codes for; it depends on the gene
product and the production of a particular phenotype from the gene product. Justify with one example.
A colour blind man marries a woman with normal vision whose father was colour blind. Work out a
cross to show the genotype of the new couple and their prospective sons?
Answer the following questions with reference to the given pedigree.

Is the trait autosomal dominant, autosomal recessive or sex-linked? Why? Justify your answer.
Give the genotypes of the parents.
Give the genotype of the daughter in the first generation and the son and the daughters in the second
generations.
A male child was born with 47 chromosomes. Write any three possible combinations of chromosomal
abnormalities and write one important symptom of each?
.Given below is a diagrammatic sketch of the hand of a person.

37
Name or mention the genetic feature.
Make a pedigree of the character to mention its inheritance? What do the circles and
squares in the chart represent respectively?
Is it a sex linked character? Give reason in support of your answer.

Questions for Self Evaluation


The following table shows the genotypes for ABO blood grouping and their
phenotypes . Fill in the gaps left in the table..

A homozygous green seeded plant is crossed with yellow seeded plant. The
progeny obtained was half yellow seeded and half green seeded .
i) Write the genotype of yellow seeded progeny.
ii)Write the technical name of the cross.
Match the following with respective worker :

Assume that no new mutations have arisen in the family.


Answer each question with either Yes or No
Could this be inherited as recessive trait?
Could this be inherited as dominant trait?

38
Chapter-6
Molecular Basis of Inheritance

Chapter Chapter Concepts Degree Ref. NCERT text Common errors


No. Name of imp. book.: page nos
6 Molecular 1. DNA **
basis of (i) structure and salient Page no. 96-98 Polarity of two stands
inheritance features
(ii) packaging of DNA ** Fig 6.4 page 99 Histone and non
helix histone chromosomal
protein
2. Search for genetic *** Page 100-101
material *** Fig 6.5 Page 102
(i) transforming Differentiation
principle ** Page 103 between
(ii) Hershey and chase transformation and
experiment transaction
(iii) properties of *** Fig 6.7, 6.8 page
genetic material 105-107
3. Replication Leading and lagging

experimental proof *** strand direction


*** Fig 6.9, page
4. Transcription 107-108
(i) transcription unit 109-111
(ii) Type of RNA and **
process of transcription ** Polycistronic,
page 112 monoistronic,
5. Genetic code *** Page 113 capping, taling
(ii)Mutations and Frame Shift and Point
Genetic Code **** Fig. 6.12 Page- mutation
39
(iii) TRNA-The adapter 114 Charging of tRNA
Molecule
6. Translation * Fig. 6.13 Page
7. Regulation of Gene **** 115
Expression *** Expresses Sequence
(i) Levels of Tags Sequence
Regulation Page 115 Annotation
(ii) The lac operon **** Fig. 6.14,Page BAC/YAC
8. Human Genome 116,117
Project Page118-120 Satellite DNA,VNTR
9. DNA Finger printing Fi. 6.16 Page

121-122
Definitions
ANTICODON :- The sequence of nitrogenous bases on RNA that is complementary to the
codon for particular amino acid.
BACTERIOPHAGE :- A virus that infects a bacterium.
CODON :- It is a sequence of three nitrogenous bases on m-RNA that code for a
particular amino acid.
CONSTITUTIVE GENES :- Constitutive genes are those genes which are
constantly expressed & whose products are continuously needed for cellular activity.
DNA POLYMORPHORISM :- Refers to the variations at genetic level where an
inheritable mutation is observed in a population in a frequency greater than 0.01.
EXON :- The regions of a gene which become part of m-RNA & code for the different
regions of proteins.
FRAME SHIFT MUTATION :- A type of mutation where addition or deletion of one or
two bases changes the reading frame from the site of mutation, resulting in a protein with
a different set of amino acids.
GENE :- Segment of DNA that code for RNA/functional unit of heredity.
INTRONS :- The regions of a gene which do not form part of m-RNA and are removed.
NUCLEOSOME :- Structure formed when negatively charged DNA is wrapped around the
positively charged histone octamer.
OPERON :- All the genes controlling a metabolic process constitute an operon.
ORIGIN OF REPLICATION :- It is the definite region of DNA where replication
originates starts.
REPLICATION FORK :- The Y- shaped structure formed when the double standard DNA
is unwound up to a point during its replication.
SATELLITE DNA :- The repetitive DNA sequences which do not code for any protein, but
form a large portion of human genome; and show high degree of polymorphorism.
SILENT MUTATION :- Mutation which do not cause any change in protein.
SPLICING :- The process in eukaryotic genes by which the introns are removed are the
exons are joined together to form m-RNA.
TRANSCRIPTION :- It is the process of formation of RNA from DNA.

40
TRANSFORMATION :- It is the phenomenon by which the DNA isolated from one type of
cell, when introduced into another type is able to bestow some of the properties of the former
to later.
TRANSLATION :- It is the process of polymerization of amino acids to form a polypeptide
dictated by mRNA.

Differences
DNA RNA
1. It usually occurs inside nucleus and some cell 1. Very little RNA occurs inside nucleus. Most it
organelles. is found in the cytoplasm.
2. DNA is a genetic material. 2. RNA is not a genetic material except in certain
3. It is a double stranded with the exception of viruses, e.g., Reovirus.
some viruses (rabies, AIDS etc.) 3. It is a single stranded with the exception of
4. DNA contains over a million nucleotides. some viruses(e.g., double stranded in
2. It contains deoxyribose sugar. Reovirus)
3. Nitrogen bases thymine occurs in DNA along 4. Depending upon the type, RNA contains 70-
with three others- adenine, cytosine and three 12000 nucleotides.
guanine. 5. It contains ribose sugar.
6. Thymine is replaced by uracil in RNA. The
other are similar adenine, cytosine and
guanine.

PROCARYOTIC TRANSCRIPTION EUKARYOTIC TRANSCRIPTION


1. It occurs in contact with cytoplasm. 1. It occurs inside the cytoplasm.
2. Products of transcription become effective 2. Products of transcription come out of the
in situ. nucleus for functioning in cytoplasm.
3. There are three types of RNA polymerase.
3. There is only one RNA polymerase. 4. Transcription factors are involved in
recognition of promoter site.
4. RNA polymerase does not have separate 5. mRNA is generally monocistronic.
transcription factors. 6. In most of the cases splicing required for
removing intervening sequences.
5. mRNA is generally polycistronic.
6. Splicing is generally not required.

4
1
LEADING STRAND LAGGING STRAND
1. It is a replicated strand of DNA which grows 1. Lagging strand is a replicated strand of DNA
continuously without any gap. which is formed in short segment called
2. It does not require DNA ligase for its growth. discontinuous.
3. The direction of growth of the leading strand is 2. DNA ligase is required for joining Okazaki
53 fragments.
4. Only a single RNA primer is required. 3. The direction of growth of the lagging strand is
5. Its template opens in 35 direction. 35though in each Okazaki fragment it is
6. Formation of leading strand begins immediately 53.
at the beginning of replication. 4. Starting of each Okazaki fragment requires a
new RNA.
5. Its template opens in 53 direction
6. Formation of lagging strand begins a bit later
than that of leading strand.

TEMPLATE STRAND CODING STRAND


1. The DNA strand that has the polarity 35 1. The strand which has polarity of 53 is called
acts as template during transcription is called as as codon strand.
template strand.
2. It is also called as master strand or (-) or sense 2. It is called (+) because genetic code present in
strand. this strand is similar to genetic code (based on
mRNA) except that of uracil is replaced by
thymine.
3. This takes part in transcription. 3. This does not take part in transcription.

Assignment Questions
LEVEL 1

The two strands of DNA have antiparallel polarity. What does it mean?
DNA fingerprinting is a technique to find out variations at DNA level among individuals of
population. What is the principle on which it works?
What term is given to the flow of information from RNA to DNA in certain viruses?
A criminal case is 10 years old was registered for investigation. What samples they might have
tested?
Pick out the untransalated regions from the given mRNA.
5 ACG UCG AUG GCG CCC UUU UAG GAG GAA 3
Where are they normally located?
6. Illustrate below is a DNA segment which constitutes a gene.

42
Will the whole gene be transcribed in RNA primarily?
Name the shaded & unshaded part to the gene,
Explain how is gene expressed.
How is the gene different from prokaryotic gene in its expression?
Which of the two the coding strands or the template strands-will the RNA transcribed by the DNA,
resembles? Why? How will they yet differ from each other?
LEVEL 2
There are proteins which are positively charged and there are also negatively charged proteins. What
makes the protein get its charge
What is ESTs?
A particular human gene has the largest number of bases. Identify it.
Why is mRNA of eukaryotic cells said to monocistronic, while that of prokaryotic cell is
polycistronic?
A point mutation leads to adverse change in the function of hemoglobin (B-globin chain). Identify the
disease that may occur due to this mutation. Mention the change of amino acids in the polypeptide due
to mutation
Two persons filed a case against a lady claiming to be the father of her only daughter. How to find the
real biological father
If a nucleosome contains 200bps, how many nucleosome are there in a mammalian cell? What changes
occur to beads of strings of DNA during metaphase? 20. Given below schematic representation of two
interacting bacterial cells.
Write the mRNA transcribed from the DNA segment with the base sequence TAC TAG TCG ACT.
How many amino acids will there be in the oligopeptide translated by the mRNA? Why?
Lac operon is negatively regulated. What is meant by this? Why is lactose called the inducer of lac
operon in [Link]?
(i) Describe the two major approaches to sequencing of genomes? (ii)
Expand SNPs. What are they?
(iii) Explain VNTR as the basis of DNA fingerprinting?
would be the phenotype and genotype ratio of the F2 generation.

LEVEL 3
1. The accessibility of promoter region of prokaryotic DNA is often regulated by the interaction of a
protein with a certain sequence of DNA. What name is given to such a DNA sequence?
DNA is a polynucleotide characterized by two types of peaks. Which peak is known as satellite
DNA?
Mention the role of DNA polymerase other than polymerizing deoxyribonucleotides during DNA
synthesis.

43
DNA is unzipped twice in a cell. Mention the two events and the enzymes responsible for it.
i) Label the amino acids at A. write the name of RNA below
Why is this molecule called an adapter molecule?

6. One student has drawn mRNA but he made some mistake in codons.
UGAU AGA UUU AUG

5 | | | | ___ _ _ _ ____|_|_|___ 3

Identify the mistakes made by him in codons.


Correct the mistake?
A segment of DNA, TTC AGG GGG ATG was translated into an oligopeptide lysine-serine-proline-
tyrosine.
(i) Write the codons for the four amino acids.
(ii) If the first adenine in the DNA segment is substituted by guanine, what will be the sequence of
amino acids in the new oligopeptide?
(iii) Write the anticodons for these amino acids?
(i)Give two reasons why both the strands of DNA are not copied during transcription?
(ii) What are constitutive genes?

9. (i) A tRNA is charged with the amino acid phenylalanine.


At what end of the tRNA is the amino acid attached?
What is the mRNA codon that codes for phenyl alanine?
Name the enzyme responsible for this attachment?
Give the anticodon of this tRNA?
(ii) Explain the idea expressed in the following
representation: DNA=RNA=protein
Questions for Self Evaluation

Why the strand 5'-3' is called coding strand though it does not take part in
transcription?
Complete the following, label A,B and C and name the process(Dogma).

44
The diagram depicts a stage in transcription. Mention the stage and indicate
A

Amino acid Arginine if coded by CGU; how many codons can code for this
amino acid?
Write the anticodon of the given t-RNA

6) What is the difference between RNAs and RNase ?

Chapter-7
Evolution
Chapter Chapter Concepts Degree Ref. NCERT text Common errors
No. Name of imp. book.: page nos
7. Evolution 1. Origin of Life * Fig 7.1
2. Evidences of ** Fig. 7.3 Page
Evolution **** 130-132 Branching Desent and
3. Adaptive Radiation * Fig. 7.5,7.6,7.7 Natural Selection
4. Biological Evolution ** Page 133 Darwinism versus de-
5. Mechanism of *** Page 134 vries- -Saltation
Evolution Page 135 Hardy-Weinburg
6. Hardy-Weinburg Fig. 7.8 Page Equlibrium,Founder
Principle * 136-137 Effect
7. A Brief Account of Fig. 7.9,7.10
Evolution
8. Origin and Evolution Fig. 7.11 Page
of Man 140

45
Definitions
ABIOGENSIS :- The origin of life from non living.
ADAPTIVE RADIATION :- An evolutionary process in which a common stock / ancestor gives
rise to new species that are adapted to new habitats and ways of life.
ALLOPATRIC SPECIATION :- Origin of new species in geographically isolated populations.
ANALOGOUS ORGANS :- Organs which are similar in appearance and perform similar
functions but they are quite different in their origin and development.
ARTIFICIAL SELECTION :- The process carried out by a select better breed of plants and
animals, which are advantageous to human beings.
BIOGEOGRAPHICAL REALMS :- Six major land masses on earth which are characterized by
their own quota of life called flora and fauna.
BIOGEOGRAPHY :- Study of patterns of distribution of plants and animals in different parts of
the earth.
CONVERGENT EVOLUTION :- Independent development of similar forms and features by
unrelated organisms usually as an adaptation to a similar environment.
DIVERGENT EVOLUTION :- Origin of a variety of species from a common ancestral form.
FOSSILS :- The remains and / or impressions of organisms that lived in the remote part.
GENE POOL :- The sum total of different kinds of genes (alleles) polled by all the members of
a population, is called gene pool.
HOMOLOGOUS ORGANS :- Organs in different groups of organisms, which have similar basic
structural plan but superficially, look different and perform different functions.
NATURAL SELECTION :- The process occurring in nature that acts over a number of
generations and slowly increases the proportion of those individuals which are well
adapted to the environment due to their heritable characteristics.
ONTOGENY :- The stages of embryonic development of the organism.
ORIGIN OF LIFE :- The appearance of life for the first time on the earth is called origin of
life.
OUT BREEDING :- Mating of two unrelated individuals.
PALAEOBOTANY :- The study of fossil plants.
PALAEONTOLOGY :- Study of fossils.
PALAEOZOOLOGY :- The study of fossil animals.
PHYLOGENY :- The evolutionary history of the organism.
SPECIATION :- Origin of new species.
SPECIES :- A taxonomic category including closely related, morphologically
similar individuals which actually or potentially interbreed.
SYMPATRIC SPECIATION :- Origin of new species in the populations occupying the same
geographical area.
VESTIGIAL ORGANS :- Organs that have no apparent function supposed to be remnants of
organs once functional in the ancestors.
Differences

Homologous Organs Analogous organs

46
1. They differ phenotypic ally. 1. They show superficial resemblance.
2. They have similar internal structure. 2. Internal structure of analogous organs is
quiet different.
3. They arise from similar position over 3. They often arise from different positions
the body. over the body.
4. Stages in the development are the 4. Stages in development are different.
similar.
5. They perform different functions. 5. They have similar functions.
6. They show adaptive radiation. 6. Show convergent evolution.
7. They occur in related organisms. 7. Found in unrelated organisms.

Lamarkism Darwinism
1. The theory believes in the presence of 1. The theory does not believe in the
an internal vital force in all organisms. presence of any internal vital force in all
2. It considers perfecting principle to be organisms.
guiding principle for all organisms to 2. Nature selects only those individuals
achieve harmony with environment. which are adapted to the environment in
3. Modifications and even new organs can which they live.
develop due to new needs, desires and
conscious reaction.
4. Use and disuse of organs brings about 3. Modifications and development of new
their development and degeneration organs due to new needs, desires and
respectively. conscious reaction do not form part of
5. Change in environment produces the theory.
variations. 4. An organ can develop further or
degenerate only due to variations
6. It does not consider any struggle for appearing in that direction.
existence. 5. Variations are already present. Changing

47
environment selects some particular
variations suitable for it.
6. Struggle for existence is very important
ingredient of this theory.

Assignment Questions
LEVEL 1
What is fitness according to Darwin?
What is evolution according to Hardy-Weinberg?
What is common among the Australian marsupials like Koala, wombat, sugar glider etc.?
Can we call the human evolution as an example of adaptive radiation?
Why did the animals resembling horse, rabbit etc. of South America disappear, but the pouched
mammals of Australia survived and flourished after continental drift.
Each of the placental mammals living in Australia resembles a similar marsupial. What is it due to?
Give two examples of each
Name and explain the common evolutionary phenomenon shown by Australian marsupials and
Darwins finches
LEVEL 2
How does biochemistry provide evidence for organic evolution?
Give an example of evolution by anthropogenic activities?
Mention the two key concepts of Darwinism.
What is saltation
Name the group of extinct reptiles that was the ancestor of the present day reptiles and birds? Name
the period of the geological time scale in which it lived?

48
What type of selection is indicated? What happens in the process?
Hearts and brains of different classes of vertebrates are homologous or analogous? What do they
indicate about evolution?
Explain how the atmosphere of Earth was formed?

Fill in the blanks with the names of the mammals of Australia

Placental mammals Marsupial mammals


a Numbat
Lemur b
Bob Cat c
d Flying phalanger
LEVEL 3
What is genetic drift?
Identify the animal to which each of the following three skulls belong. Which two of them resemble
more closely than the others?

Stanley Miller and Harold Urey performed an experiment by recreating in the laboratory the probable
conditions of the atmosphere of the primitive earth.
i) what was the purpose of the experiment .
ii) in what form was the energy supplied for the chemical reactions to occur?
Why do we consider the lobefins have evolved into amphibians? Give reason.
Study the figures (a) and (b) given below and answer the question given after the graph

49
Under the influence of which type of natural selection would graph (a) becomes like graph (b)
What could be the likely reasons of new variations arising in the population?
Who suggested natural selection as a mechanism of evolution?
6. In England, after industrialization it was observed that white winged moth did not survive.
What you think the cause may be?
What was the change and why it has happened?
Which organism is known as natural indicator to air pollution?
Questions for Self Evaluation
Why do the animals have certain functionless organs in their body?
Which of the following are homologous organs?
a Trunk of an Elephant and forelimbs of a Monkey
b) Wings of a bird and wings of butterfly
Which of the following are analogous organs? a)
Legs of Cockroach and legs of Cat.
b) Pectoral fin of fish and forelimb of a frog.
Wing of bat is homologous to
Arm of a human
Tail of a kangaroo
Wing of a butterfly
Name the common ancestors of Apes and Man.
Give the Scientific name of first human like ancestors.
What causes speciation according to Hugo deVries?
Which were the first organisms that began to release oxygen as a byproduct of
photosynthesis?
Name the extinct representative of modern man.
Consider a thorn in Bougainvillea and a tendril in cucurbita . Are these 2
organs homologous or analogous. Give reasons.

50
Chapter-8
Human Health & Diseases
Chapter Chapter Concepts Degree Ref. NCERT text Common errors
No. Name of imp. book.: page nos
8. Human [Link] Diseases in ** Fig. 8.1 Page
Health & human 146-149
Diseases 2. Immunity
(i) Innate immunity **
(ii) Aquired immunity ***
(iii) Active and Passive
immunity
(iv) Vaccination and Page 150-154
immunity NCERT
(v) Allergy Fig. 8.4
(vi) Autoimmunity *
(vii) Immune System of **
Body *
3. AIDS
[Link] *** Fig 8.6 Text 156
5. Drug and alcohol *** Text Page 156-
abuse *** 158
(i) Adolescence and Text Page 158-
drugs 163

Definitions
CIRRHOSIS :- A fatal disease of liver causes due to chronic use of alcohol.
CONTACT INHIBITION :- A property of normal cells due to which contact with other
cells inhibits their uncontrolled growth. Cancerous cells have lost the quality of contact
inhibition hence divide uncontrollably.
DIEASE :- A state when functioning of one or more organs or systems of the body is
adversely affected, characterized by various symptoms, we say that we have a
disease. HEALTH :- A state of complete physical, mental and social well being.
IMMUNITY :- The overall ability of organisms to fight the disease causing pathogens,
conferred by the immune system is called immunity.
VACCINE :- Weakened pathogen or antigenic proteins of the pathogen introduced / injected
into a healthy person to protect him from disease is called vaccine e.g. pulse polio.

5
1
Differences

Active Immunity Passive Immunity


1. Antibodies are developed 1. Antibodies are developed in other
2. By our own body cells in vertebrates in response to deliberate
3. Response to antigens. injection of antigens, are injected in our
4. It takes time to developed immunity. body.
5. It stays for longer period. 2. It is used when immune response has to be
faster.
2. It stays for short period.

Infectious Diseases Non infectious Disease

1. They are transmitted from one person to other. 1. They are not transmitted from one
person to other.
2. Caused by pathogens. 2. Caused due to habits deficiency,
disfunctioning of organs etc.
3. Typhoid , T.B., Flu etc 3. Heart attack , cancer etc.

INNATE IMMUNITY ACQUIRED IMUNITY


1. It includes all the defense elements with which 1. It acquired after birth either by
an individual is born. contacting the disease or by vaccination.
2. Non specific . 2. Specific.
3. It consist of Physical , Physiological , Cellular 3. It includes hummreal or antibody
and Cytokine barriers. mediated Immunity and cell mediated
immunity.

Assignment Questions
LEVEL 1
[Link] is advised to always complete the course of an anti biotic prescribed by the physician. Give
the scientific reason?
[Link] is the antibody mediated immunity called humoral immunity?
[Link] do children of metro cities of India suffer from allergies and asthma?
[Link] is the role of following in body defence against infections?
B-cells (ii) Histamine (iii) interferons
[Link] viruses can make DNA copy from RNA strand .Explain the mechanisms behind this processes
LEVEL 2

1A pathogen enters the small intestine through food and water contamination and migrates through
blood, the sustained high fever weakness, stomach pain are symptoms. Which test confirms this
disease.
2Once a person starts taking alcohol (or)drugs . how he may protect himself
[Link] female Anopheles mosquito acts as a vector? Why?

52
4. Name a plant other than coca plant that has hallucinogenic property?
5.A group of viruses infected only nose and the respiratory passages but not the lungs. Mention the
disease and its causative organism.
[Link] any two properties that distinguish the cancer cells from normal cells.
7.A person suddenly develops fever diarrhoea and weight loss. After test his blood was found low in
lymphocytes.
What could be the disease he is suffering from?
Name the confirmatory test to diagnose the disease.
(iii)Which particular part of the immune system is likely to get affected and in what manner?
[Link] chemicals are produced during allergic reactions? Also name the cells which produce these
chemicals?

LEVEL 3

[Link] the table


[Link] Effect on body Name of drug Source
1 poppy plant
2 sense of euphoria cocaine
3 cannabis
sativa
2.A person need to take immune-suppressive agents all through his/her life after an organ transplant.
Why?
[Link] the organism where antigenic polypeptide is produced by recombinant DNA technology
4.A persons nails and lips turn grey to bluish. Find out the disease he is suffering from. Name
the pathogen.
[Link] the missing organisms/disease in the table below:-
Organism Disease
Microsporum A
B Elephantiasis
C Amoebiasis
Plasmodium falciporam D
[Link] nodes are small solid structures located at different points along the lymphatic vessels. How
are they involved in our immune system?
7. A person claimed that he has seen sounds, heard colours and smelt light.
What could be the possible reasons?
Name two chemicals responsible for this condition.
Mention any one source for these chemicals.
Questions for Self Evaluation
Q 1 Name the type and give the effects of the following drugs
on humans-
A ) LSD B) Morphine C) Barbiturates.
Q2 What are the two chemical substances released into the blood by the mast cells ?
Specify the effect of each .
Q3 Why are some children diseases not appear for a second time ?
Q4 How does the skin serve as the first line of defence ?

53
Q5 A person was born without thymus gland but otherwise normal .Mention any four ways the person
is likely to suffer due to its absence .

Chapter-9
Strategies for Enhancement in Food Production
Chapter Chapter Concepts Degree Ref. NCERT text Common errors
No. Name of imp. book.: page nos
9. Strategies for 1. Animal husbandry * Page 165-170
Enhancement (i) Management of Text
in food farm and farm Animal **
Production (ii) Animal Breeding **
(iii) Bee Keeping *
(iv) Fisheries Page 170-176
2. Plant breeding ** Text Portion
(i) Method ***
(ii) For disease ***
Resistance ** Page176 Text
(iii) For Pest Portion
Resistance *** Page 177 Text
(iv) For Improved food ** Portion
quality
3. Single cell Protein
4. Tissue Culture

Definitions
ANIMAL BREEDING :- Mating or crossing of animals to improve the desirable qualities
and yield or produce.
ANIMAL HUSBANDRY :- The agricultural practice of breeding and raising livestock e.g.
buffaloes, cows, pigs, horses, sheep, camel etc including poultry and fisheries.
APICULTURE :- Bee keeping for production of honey.
BREED :- A group of animals related by descent and similar in most characters,
like appearance, features, size, configuration etc.
DAIRY FARM MANAGEMENT :- The management of animals for milk and its products for
human consumption.
FISHERIES :- An industry devoted of rearing, catching, processing or selling of fish,
shellfish or other aquatic animals.
GREEN REVOLUTION :- Dramatic increase in food production in mid 1960s as a result of
cultivation of high yielding disease resistant varieties of wheat, rice and maize etc
developed through breeding techniques is referred to as green revolution.
MUTATION BREEDING :- Obtaining crop plants with desirable characters by artificial or
induced mutations and using them a material in breeding programmes is called mutation
breeding.

54
PLANT BREEDING :- The purposeful manipulation of plant species (Crop) to create
desired plants best suited for cultivation, give better yields and are disease resistant. SCP
OR SINGLE CELL PROTEINS :- Industrially or commercially produced edible
proteins by culturing suitable micro organisms on large scale for nutrition for animals
and human beings.
SOMACLONES :- Genetically identical organisms or plants derived from single
organisms through micro propagation are called somatic hybrid e.g. Tomato protoplast and
potato protoplast.
TISSUE CULTURE :- Growing whole plant from a part of plant such as leaf, root, pollen
etc by growing these on an artificial nutrient medium under aseptic conditions is called
tissue culture.
TOTIPOTENCY :- The quality of isolated cells or tissue of an organism by virtue of which
it can generate the whole of organism is called totipotency.

Assignment Questions
LEVEL 1
[Link] a meristem culture some explants were kept in culture medium conrtaining more of
auxins than cytokinins. Which organ of the plant is expected to differentiate from the callus?
[Link] hybrids of selected parents are self pollinated till a state of
homozygosity? [Link] which product is blue revolution related?
[Link] are the steps in a particular process. Name the process and fill in the steps
that are given as blanks.

[Link] insemination is a better approach than natural mating. Justify?


LEVEL 2
[Link] are identical each other ?Is there any social implications of human cloning?
2.A technique by which cattle herd is increased in number in short period of [Link] and describe it.
Why do we use apical and axillary meristems for tissue culture?
If your family owned a dairy farm, what measure would you undertake to improve the quality and
quantity of milk production?
Biofortification can solve the problems of hidden hunger to a large extent. Prove it?

55
6. Insect/pest resistance in plants can be due to morphological, chemical or physiological features.
Give one example each of the features and the species n which it is found?
LEVEL 3
[Link] is reference material for comparison of any improved
variety? [Link] which amino acid maize is biofortified?
3. Some time the disease resistance gene is present in the wild relative of crop plant. Give an example
of crop plant where the resistance gene is present in its wild relative and name the wild relative
[Link] different plant of the same species, each with a different desirable trait are crossed to produce a
hybrid that will have both the desirable character of the two parents. But, what are the drawbacks in
the process of hybridisation of the selected parents?
Questions for Self Evaluation

Q1 What is interspecific hybridization ?


Q2 What should be done when inbreeding depression becomes a problem ?
Q3 Name any five hybreed varieties of crop plants which have been developed in India .
Q4 What are the commonly used growth regulators in plant tissue culture ? What for they are required
?
Q5 Define germplasm . How is it maintain ?

Chapter-10
Microbes in Human Welfare
Chapter Chapter Concepts Degree Ref. NCERT text Common errors
No. Name of imp. book.: page nos
10. Microbes 1. Role of Microbes
in Human in:- * Text Page 181
Welfare (i) House Hold *** Page 182,183 Ex.
(ii) Industrial Product ** Question 12
(iii) Sewage Treatment * Page 184-185 Ex.
(iv) Production of Bio *** Question 7,8,11
Gas *** Page 185
(v) As Biocontrol Page 186-187
Agent Page 188
(vi) As Biofertlizers

Definitions
BIOCHEMICAL OXYGEN DEMAND (BOD) :- The amount of the oxygen that would be
consumed if all the organic matter in 1 ltr. Of water were oxidized by bacteria.
BIOCONTROL :- The use of biological method for controlling plant disease & pests.
BIOFERTILISER :- The organisms that enrich the nutrient quality of the soil.
BIOGAS :- The mixture of gases {mainly CH4, CO2} produced by the microbial activity &
which can be used as fuel.
BT COTTON :- A variety of cotton which is incorporated with Bt gene and it is resistant for
insects & pests.

56
CLOT BUSTER :- The microbial product for removing clots from the blood vessels of
patients who have undergone myocardial infraction leading to heart attack.
FERMENTATION :- The process of Anaerobic respiration in which complex molecules
incompletely breaks into simple one by the microbial action.
FERMENTORS :- The large containers made up of stainless steel require to grow microbes
for industrial products.
METHANOGENS :- The anaerobic bacteria which produce large amount of CH4, CO2 &
H2 as they grow on cellulosic material.
MYCORRHIZA :- A symbiotic association between fungal hyphal & roots of trees (Higher
Plants)
PEST :- Organism that destroys crop or its product is known as pest.
SEWAGE :- The Municipal waste water containing large amount of organic matter &
microbes

Assignment Questions
LEVEL 1
[Link] associate with higher plant roots absorb phosphorus from the soil passes it to the plant. Mention
the association between them
2. What is the key difference between primary and secondary sewage
treatment? [Link] are the holes (spongy texture) produces in bread and cheese?
[Link] is Anaerobic Sludge digest?
LEVEL 2
[Link] you think microbes can also be used as energy convertors? If yes how?
2. Single cell protein is one of the alternative source proteins for animal and human nutrition. Justify
your answer.
[Link] juices are clearer compare to homemade juices. Give reason?
4. For the brain haemorrage of a patient, the doctor prescribed Streptokinase. Why? Mention the
source of industrial production of this biomolecule.
[Link] is cyclosporine A? Name the micro organism from which it is obtained. How it is used in human
welfare?
6.. Why is organic farming favoured these days? Describe the method employed in the process.
LEVEL 3
[Link] Microbes are used to control other microbes , elaborate with examples
Why are most of the antibiotics sold in combination with lactobacillus, these days?
The Yamuna action plan and the Ganga action plan have been initiated to reduce BOD of these rivers in
and around Delhi. What is understood by this statement?
[Link] like whisky and rum more intoxicating than wine. Why?
Questions for Self Evaluation
Q1 Which gas gives the puffed appearance to the dough ? Name the metabolic pathway taking place
Resulting in the formation of this gas .
Q2 What is the key difference in the primary and secondary treatment ?
Q3 Describe the bio gas plant structure . Give various steps involved in obtaining biogas .
Q4 Why are chemical pesticides not preferred by the farmers in controlling pests ?
Q5 What is the advantage of Legume Rhizobium symbiosis

57
Chapter-11
Biotechnology Principles and Processes
Chapter Chapter Name Concepts Degree Ref. NCERT text Common errors
No. of imp. book.: page nos
11. Biotechnology 1. Principles of NCERT text book Fail to differentiate
principles and biotechnology * xii fig . 1.2(a) (b) asexual reproductive
processes (i) techniques used in fig. 1.3, 1.4 page structures- zoospores,
modern biotechnology 5-8 conidium, gemules etc.
(ii) advantages of
sexual reproducton Differentiation in
over a sexual ** NCERT book p monoecious & diocious
reproduction 15 - 19 ex q
(iii) genetic 2,6,9,13,15,18
engineering includes
reconibinant dna,
genecloning a gene
transfer ***
(iv) meaning and use
of plasmid restriction *** Fig. 11.1-11.2-
enzymen 11.3
***
(v) basic steps for gmo Page-195- 198
2. Tools of Fig. 11.4 Page-
Recombinant DNA 198-200
Technology Fig. 11.6,11.7
3. Cloning Vectors Page 201-205
4. Processes of
Recombinant DNA
Technology Steps
Definitions

BIOTECHNOLOGY :- Technique of using living organism or enzymes from organism to


produce product & processes useful to Humans.
CLONING :- Producing exact copy or copies of a single parent.
DNA LIGASE :- An enzyme that can seal one DNA fragment with another DNA segment,
both having sticky ends.
ELUTION :- The process top separate bands of DNA which are cut out from the Agarose
gel & extracted from the gel piece.
ENDONUCLEASES :- The enzymes which make cut at specific position within the DNA.
GEL ELECTROPHORESIS :- The technique of separation of DNA fragments on a natural
polymer(gel).
GENETIC ENGINEERING :- The technique to after the chemistry of genetic material
DNA / RNA to introduce these into host organisms & thus change the phenotype of the host
organism.
GENOME :- Total DNA in the cell of an organism.
LIGASE :- An enzyme that joins the ends of two strands of Nucleic acid.

58
MICRO INJECTION :- Introduction of foreign genes into animal or plant cell by
injecting DNA directly.
PLASMID :- Autonomously replicating circular extra chromosomal DNA of bacteria is
known as plasmid.
TRANSFORMATION : - It is a process through which a piece of DNA is introduced in a
host.
Differences
Plasmid DNA Chromosomal DNA

1. It is extra nuclear DNA 1. It is nuclear DNA


2. It carries non vital genes. 2. It possesses vital genes
3. A bacterial cell may carry one to several 3. A bacterial cell carries only one
plasmid DNAs Chromosomal DNA

Exonucleases Endonucleases
1. It breaks DNA from the ends. 1. It cuts DNA from inside.
2. The separated fragments are small 2. The separated fragments are large nuceotides
nuceotides. 3. The desirable separated fragments are used in
3. The separated fragments can not be used genetic engineering.
in genetic engineering.

Blunt Ends Sticky Ends


1. Are cut in the centre of recognition 1. Are short, single stranded end which can join
sequence. single stranded ends of other DNA fragments
2. Are known as flush ends. having complementary sequences.
Example: 2. Are known as cohesive ends.

5 C C C G G G 3
Sma I
5 C C C 3+5 G G G Example:
EcoRI
5 G A A T T C 3 5 G 3+5 A A T T C 3
3

3 G G G C C C 5 3 G G G5+ 3C C C 3 C T T A A G 5 3 C T T A A 5+ 3 G 5
5

YAC BAC
1. Called Yeast Artificial Chromosomes. 1. Called Bacterial Artificial Chromosomes.
2. Used to clone DNA fragments of more than 1 2. Used to clone 300-350 kb of foreign DNA.
Mb in size. 3. Used in genome sequencing project.
3. Used in mapping large genomes e.g. human 4. Insert size is 50 300.
genome project
4. Insert size is 2500 1000.

59
Assignment Questions
LEVEL1
[Link] enzyme is called molecular
scissors? [Link] do you mean by Ori?
[Link] the polymerase which is generally used in PCR reactions.
[Link] is a host cell made competent in introducing rDNA?
[Link] the enzyme commonly used to dissolve the cell wall of bacterial cell?
LEVEL2
[Link] is a thermo stable DNA Polymerase needed in amplification/genetic engineering.
[Link] the isolation of the genetic material , cells are treated with cellulose or chitinase . Give reason for
it
[Link] the enzyme which cut the DNA molecules into fragments with sticky
ends? [Link] cloning vector was discovered first time?
[Link] the method in which foreign DNA is directly introduced into host
cell? [Link] a Natural genetic engineer of plants?
[Link] are the three basic steps involved in a single PCR amplification
cycle. [Link] the diagram of PBR322 vector showing restrictions site
[Link] is isolation of the genetic material done?
[Link] diagrammatic representation of rDNA technology
LEVEL3
[Link] Polymerase can not be used in PCR.A particular polymerase is used in [Link]
the source of that polymerase.
2. Each restriction enzyme cuts the DNA at a specific nucleotide sequence .Name such a sequence.
[Link] type of cut ends are formed when both are fonned when both stands of DNA molecule is
cleaved exactly at the same nucleotide position?
[Link] does a transgenic organism differ from the rest of its population? Cite any two examples of such
organism for human advantage
[Link] is the gene z (for B-galactosidase) used as marker?
[Link] better aeration and mixing properties what other advantages do stirred tank bioreactors
have over shake flasks ?
[Link] are bacteria made capable to take up recombinant DNA? Name the bacteria used for this process.
[Link] the principle underlying gel electrphoresis and mention two applications of this technique in
Biotechnology.
[Link] being hydrophilic cannot pass through the cell membrane of a cell. Explain how does
recombination DNA get introduced into the cell to transform the latter.
[Link] bacterial culture some of the colonies produce blue colour in the presence of a chromogenic
substrate and some did not due to the presence or absence of an insert (rDNA) in the coding sequence
of the beta- galactosidase.
Mention the mechanism and steps involved in the above experiments .
How is it better than the technique of plating on two plates having different antibiotics?
Questions for Self Evaluation
1 Differentiate between direct gene transfer and indirect gene transfer .
How is gene transfer in animals done ? Give the suitable example .
Name two recombinant proteins
Name atleast three therapeutically important products obtained through recombinant genetic
engineering .

60
5 At what stage of meiosis a recombinant DNA made ?
Chapter-12
Biotechnology and its applications
Chapter Chapter Name Concepts Degree Ref. NCERT text Common errors
No. of imp. book.: page nos
12. Biotechnology 1. Applications of * Page 207-208
and its Biotechnology in **
applications agriculture *** Page 208
(i) Advantages of *** Page 208-209 Differentiation of Cry
GMO Page 209-210 and cry
(ii)Bt Cotton *** nRNA silencing ,
(iii) RNA interference *** nematode
2. Applications of * Page-210-211 Meloidegyne incognitia
Biotechnology in **
Medicines ** Page 211 Steps in production of
(i) Genetically insulin
engineered insulin. Page-212
(ii) Gene Therapy-
ADA Page-213
(iii) Molecular Page-214 Role of Biotechnology
Diagnosis of diseases. in molecular diagnosis.
3. Transgenic animals

4. Ethical issues ,
Biopiracy
Definitions
BIO PATENT :- A right given to inventor to get the economic benefits of the product. It
also prevents the others to get benefit without permission.
BIOPIRACY :- The use of bio resources by multinationals companies & other organizations
with out proper authorization from the countries & people concerned without compensatory
payment.
ELISA :- It is a diagnostic technique based on the principle of antigen- antibody interaction.
GENE THERAPY :- A collection of methods that allow correction of agene defect that has
been diagnosed in a child / embryo.
GENETICALLY MODIFIED ORGANISM (GMO):- Plants, bacteria , fungi
&animals(organisms) whose genes have been altered by manipulations are called G.M.O.
GREEN REVOLUTION :- The process of increase in crop yields with the use of improved
crop varieties, better management practices& use of agrochemicals.
PROBE :- These are the detectable sequence of polynucleotide which are used to detect the
presence of complimentary DNA sequence.
TRANSGENIC ANIMALS :- Animals that had their DNA manipulated to possess &
express an extra (Foreign) gene are known as transgenic animals.
TRANSPOSONS :- these are the mobile genetic elements which replicate via an
RNA intermediate.

61
Assignment Questions
LEVEL1
1. Excessive use of fertilizers and chemicals has harmful effects on environment. Suggest a
possible solution to minimise this.
[Link] crops other than Bt cotton have been made pest resistance by genetic
engineering? [Link] GEAC. What is its function?
LEVEL2

[Link] cotton plants grown by farmers are known as 'Bt


cotton'. a) What does Bt stand for?.
b)What is the advantage of this cotton plant?
c)How did scientists achieve this?
[Link] the vector which was used to introduce nematode specific gene into tobacco plant.
[Link] cow Rosie was produced in 1997.
Name the protein present in its milk.
Advantage of protein enriched milk.
[Link] developed a vitamin A rich potato through his research on genetics.
a)What do you call such potato plants?
b)Who can approve the validity and safety of introducing potato for public uses.

LEVEL3
[Link] cryIAb differs from cryIIAb gene?
2. A method to present infestation of a nematode Meloidegyne incognitia on roots of tobacco is
silencing the specific mRNA. What is the scientific name of the technique? How is this
performed by ds-RNA?
3.A baby loses his mother in infancy .He was totally depended on breast feeding as cows milk creates
digestive problems. Name the first cow whose milk is nutritionally more balanced than normal
cows milk. Which extra nutritional element does it contain and how much magnitude?
4. Shahid a two years old baby is deficient in his immune system since birth. His father was told that
this was due to an enzyme deficiency which is crucial for the immune system to function. Name
the enzyme, the cause of its deficiency and the cure of the disease?
[Link] specific genes.
+
Agro bacterium

Host plant with nematode gene

62
i) What is this technique of pest control called?ii) Specify a, b & c in the chart given.
Questions for Self Evaluation
A four years old girl suffered from ADA deficiency. She was cured by inserting a correct gene into
her.a) what is this process called? b) In which cells are the genes introduced ?
What is the other name of mobile genetic elements?
Differentiate between insulin and pro insulin?
Explain down stream processes?
Differentiate exonuclease and endonuclease.
Expand the term PCR.
What is its importance in genetic engineering?
CHAPTER 13
Organisms and Populations
[Link] CHAPTER Concepts Degree Ref. NCERT text Common errors
of imp. book.: page nos
13. Organisms 1. Organisms and its Environment
and (i) Major Abiotic Factors **

Populations (ii) Responses to Abiotic Factors ** Page -221-223 NCERT Eurythermal &

(iii) Adaptations *** Fig. 13.3 Page 223-225 stenothermal

4. Populations:- *** Page 225-226 Conformers, Regulators

(v) Population Attributes ***

(vi) Population Growth *

(vii) Life History variation ** Fig. 13.4 Page 226-228

(viii) Population interactions Fig. 13.5 Page 228-231 Distinction between

Expanding, stable,
Page 231-232 declining population.
Distinction between
Table 13.1 Page 232- Exponential and Logistic
growth curve.
238 Distinction between
commensalisms and
Amaensalism.

DEFINITIONS
AMENSALISM :- Interaction in which one species is harmed whereas the other one
is unaffected.
CARRYING CAPACITY :- Maximum size of population that can be sustained by the
environment.

63
COMMENSALISM :- Interaction in which one species gets benefits and other is
neither harmed nor benefited.
CONFORMERS :- Majority of animals and nearly all plants which cannot
maintain constant internal environment.
EURYTHERMAL :- the organisms that can tolerate and thrive in a wider range of
temperature.
EXPONENTIAL GROWTH :- Unimpeded growth of a population in an environment with
abundant resources.
LOGISTIC GROWTH :- Growth of a population in an environment with limited resources
(initial lag phase, phase of acceleration and finally stationary phase).
MORTALITY :- The number of deaths in a population during a given period. NATAILITY
:- The number of births in a population during a given period. POPULATION DENSITY
:-The number of individuals of a species present in per unit area at given time.
REGULATORS :- The organisms which maintain homeostasis (constant body temperature
and osmotic concentration) by physiological means.
STENOTHERMAL :- The organisms that area restricted to narrow range of temperature.
ASSIGNMENTS
LEVEL 1
1 Why is thermoregulation more effectively achieved in larger animals than smaller
ones? 2 What are osmoconformers?
[Link] are the 2 forms of population growth?
[Link] type of interaction is shown by sparrow eating the seeds?
[Link] are eurythermal animals differ from stenothermal?
[Link] the four levels of organization that are studied in
ecology. [Link] any one example of brood parasitism.
[Link] an expression, which gives the change in population size after a given time.
LEVEL2
[Link] the adaptations the mammals of colder areas have.
[Link] does a population growth curve assume J-shape?
[Link] is Gauses Compitition Exclusion Principle? Give 1 example.
How is cactus adapted to survive?
Lichen and mycorrhiza are very important examples of mutualism.
Define mutualism.
Write the names of components of both.
What is the benefit of mutualism to both of them.
What type of morphological and physiological defences have been evolved by plants.

LEVEL3

Mr. Ram on a trip to Rohtang Pass Suddenly experienced heart Palpitations, Nausea, fatigue etc on
reaching the destination. Suggest the reasons for his sudden deterioration of health and also state
whether his body will withstand this problem if he stays there for long and how?

64
2. Observe the following equation :

i) Name the population growth curve.


ii)What does N, r and K represent?
iii).What type of growth status the following pyramid represents.

3. .Anand on a visit through an under the ocean aquarium found that many sea anemones are
attached to hermit crab shells, sucker fisher attached to the ventral surface of sharks and clown
fish living among the sea anemones. He wondered whether all these associations are of the same
type; can you help him to arrive at the correct conclusion.
Abingdon tortoise in Galapagos Island became extinct with in a decade after goats were introduced
on the island. Why? What could be principle behind this situation?
An orchid plant is growing on the branch of a mango tree. How do we describe this
interaction b/w orchid and mango tree?
Observe this diagram and answer the following question

What is the terminology for B& E.?


If B + I is more then D + E then what will happen to population density.

65
(c) What are the most important factors which influence a population density of an
area under normal condition ?
(d) If a habitat is being colonised recently then which factor contribute more to
the population growth
QUESTIONS FOR SELF EVALUATION

An orchid plant is growing on the branch of a mango tree. How do we describe this interaction
between orchid and mango tree?
The population of tigers in a forest becomes zero, due to uncontrolled hunting. What would be the
long term effects of this situation in the forest?
Identify the biome distribution with respect to annual temperature and
Precipitation from the following graph. Answer A, B, C & D.

The following graph represents the organismic0 response to certain environmental condition.
which one of these, A , B , C depicts conformers?
How do A , B differ from each other with reference to homeostasis?
What does C of graph depict?
Mention the category to which man belongs.

Men Study the given age profiles related to human population and answer the following
questions.

66
tion the names given to A , B , C kinds of age profiles.
Which one of these is ideal for a population?
How do such age profile studies help policy makers prepare for future planning?

Why small animals are rarely found in polar region?


How does the special photosynthetic pathway like CAM support desert plants?
Why do animals migrate from one region to the other region in the cold season?
What type of population interaction in A, B, C, D between the species A and B as per the tabular
column given below.

Which of the following A, B, C and D represent increase and decrease in population growth?

67
Chapter-14 Ecosystem
[Link] CHAPTER Concepts Degree Ref. NCERT text Common errors
of book.: page nos
imp.
14. Ecosystem 8. Structure and Page 242
function Ex Q. 9

*
9. Productivity Fig. 14.1 Page 243- GPP,NPP
**
10. Decomposition 244 Ex. Q10
**
11. Energy Flow Page 245,247 Ex. Q.
12. Ecological Pyramids 11

*
13. Ecological Fig. 14.4 Page 248
succession Fig. 14.5 Page 250-

14. Nutrient cycling 251

Fig. 14.6 Page 253-

255 Ex. Q. 12,13

BIOGEOCHEMICAL CYCLE :- The movement of nutrient elements through various


components of an ecosystem( between living organisms, soil, air and water). BIOMASS
:- The amount of organic matter present in an organism/ a trophic level / an ecosystem.
DETRITIVORES :- Organisms which feed on the detritus and break it down into smaller
particles.
DETRITUS :- Dead remains of plants and animals or their wastes.
ECOLOGICAL PYRAMIDS :- Representation of trophic structure ( Number, Biomass . or
Energy at various trophic levels) of a food chain.
ECOLOGICAL SUCCESSION :- Phenomenon in which structure and composition of a
community changes in an orderly and sequential manner leading to the climax community.
ECOSYSTEM: - Functional unit of nature where living organism interact among
themselves and also with physical environment.
ECOSYSTEM SERVICES: - The products of ecosystems processes are termed as
ecosystem services.
FOOD WEB: - A network formed by interconnected the food chain.

68
HUMIFICATION: - Process of changing Detritus into a dark coloured amorphous matter
called humus.
HYDRARCH: - Ecological succession in water bodies like lakes resulting in
climax community.
MINERALISATION :- Process of Degradation of Humus by some microbes into
Inorganic nutrients.
PIONEER SPECIES:-The species which invade a bare area and initiate the
ecological succession.
PRIMARY PRODUCTIVITY: - Amount of biomass or organic matter produced per unit
area over a time period by the plants.
PRIMARY SUCCESSSION: - Ecological succession on previously sterile area such as bare
rocks or lake forming climax community.
PRODUCTIVITY:-Rate of production of biomass.
SECONDARY PRODUCTIVITY:- The rate of assimilation and formation of new organic
matter by consumer.
SECONDARY SUCCESSION: - Ecological succession in an area where previously
established community is destroyed due to fire or floods etc.
SERE :- The sequence in which one community is replaced in an area by another resulting in
a climax community.
STANDING CROP :- The amount of living matter(biomass) present at a trophic level.
STANDING STATE :- The amount of nutrients present in the soil at any given time.
STRATIFICATION :-Vertical distribution of different species occupying different levels in
an ecosystems.
TROPHIC LEVEL :- Every step or link of a food chain.
XERARCH :- Ecological succession on bare rocks or sand resulting in climax
climax community.
ASSIGNMENTS

LEVEL1:-

Q1 ) What is biomass ?
Q2 ) Name the four important functional aspects of ecosystem

Q3) Name the two forms of reservoir of carbon that regulate the ecosystem carbon
cycle . Q4) Name the dominant producers in a deep aquatic ecosystem .
Q5) What is NPP?
Q6. What are the two basic catagories of ecosystem? Give
example [Link] is food chain? Give an example.
Q8. Describe the major components of ecosystem
LEVEL 2

Q1) What do you mean by transducers ?


Q2) What is meant by productivity of a trophic level ?
Q3) Which species is the pioneer species on a bare rock
[Link] are decomposers? Write their function.

69
[Link] is the difference between gaseous and sedimentary cycle?
[Link] two factors by which productivity is limited in an aquatic ecosystem.

[Link] PAR, How much PAR is used in gross primary productivity?


[Link] account of factors affecting the rate of decomposition.
Q9) What are ecological pyramids ? Mention its limitations .
Q11. Give an account of energy flow in an ecosystem.
LEVEL 3
Q1) Why the pyramid of energy is always upright ?

Q2) What is bioenergetics ?

[Link] is the length of a food chain in an ecosystem generally limited to 3-4 trophic levels?
[Link] are the differences between detritus and grazing food chains?
[Link] describe the process of decomposition
Q6 .Describe pond as an ecosystem .

[Link] is xerosere? Describe the process of succession on a bare rock


QUESTIONS FOR SELF EVALUATION
Which ecosystem has maximum stratification?
What is the approximate value of Net Primary Productivity of the biosphere?
Find out the consumer of top order/ top carnivore from the following food chains.
Phytoplankton - small fishes - large fishes - Hawk
Based on the following information, answer the A, B, C and D with reference to
Grass land ecosystem

5. . Longer food chains are not viable in the ecosystem from the energy point of view. Why?
Why food chains in the environment are operative in the form of food web?
i) Complete the steps of decomposition process by using a suitable terminology in a
& b.
List the factors which affect decomposition process.

70
Complete the following simplified schematic diagram of Phosphorous cycle by
writing the correct answer for A, B, X and Y.

Why are all the pyramids upright in most of the ecosystems?


Primary productivity of tropical rain forest is highest among terrestrial ecosystems while
that of desert is lowest. Which factors are responsible for this difference?

71
Chapter-15 Biodiversity And Conservation
[Link] CHAPTER Concepts Degree Ref. NCERT text Common errors
of imp. book.: page nos
15. Biodiversity 5. Patterns of Biodiversity *** Fig. 15.1 Text page Graphical representation ,
and 6. Importance of species 259 Ex. Q 3 species area relationships
Conservation diversity to ecosystem. * Page 263

7. Loss of Biodiversity ***


8. Conservation of Page 264-265 Ex. Q. Crypreservation
Biodiversity *** 5

Page 265-267 Ex. Q.

BIODIVERSITY :- It is the term used to describe the combine diversity at all the levels of
biological organization.
ECOLOGICAL DIVERSITY :- The diversity at the ecosystem level . ENDEMISM
:- It is the condition when species confined to that region and not found anywhere
else.
GENETIC DIVERSITY :- The High diversity shown by a single species at the genetic
level(distributional level .)
SPECIES AREA RELATIONSHIPS :- The relation between species richness and area.

DIFFERENCES

Alpha Diversity Beta Diversity


1. It refers to the diversity of the 1. It refers to the diversity of the organism in
organism sharing the same habitat or different communities in a habitat.
community.
2. It is within community diversity. 2. It is between community diversity.

Ex-situ Conservation In-situ conservation


[Link] is called off-site conservation. [Link] is called on-site conservation.
[Link] botanical garden, zoos, gene [Link] includes wildlife sanctuaries, national parks,
bank, seedlings etc. as well as pro0tected areas to protect endangered
species in natural habitats.

72
ASSIGNMENTS
LEVEL1

What is the approximate no of plant and animal species described so far by IUCN (2004) report?

Which type of graph curve is obtained when species richness is plotted against area?

Name a few weeds that have invaded our crop fields as alien species. Why these have become
uncontrollable

Categorize the following into in-situ and ex-situ approaches of biodiversity conservation.

i) Botanical gardens ii) Wild life sanctuaries iii) Gene bank


iv) Biosphere reserves v) Sacred forests/lakes vi) Pollen banks
vii) Tissue culture viii) Cryo-preservation
LEVEL2
Reserpine is obtained from a plant found in Himalayan ranges. Name the plant.

Western Ghats have greater amphibian species diversity than Eastern Ghats. Why?

Who proposed rivet popper hypothesis? Describe this hypothesis briefly.

Which type of organism are prone to co extinction and why?

LEVEL3

What do you mean by bioprospecting?

What is depicted by the following representation of species diversity? Why these estimates do not
give any figure-for prokaryotes.

3. The invasion of alien species is responsible for extinction of the indigenous species. Give 2
examples to support this statement.

4. If a speices of fish becomes extinct, all those parasites, specific to that fish also face extinction.
Which of the major cause describe as the evil Quartets is being accounted?

73
Categorize the followings statement into narrowly utilitarian, broadly utilitarian and ethical reason:-

i) Every species in biodiversity has an intrinsic value even if it not of value to us.
ii) Human beings device a number of economic benefits like food, fiber etc from
biodiversity.
iii) Biodiversity provides ecosystem services which can not be given price tag. Justify your
categorization also.
Since the origin of life on earth and evolution there have been 5 episodes of mass
extinction, but the current rate of extinction is 100-1000 times. What are the main causes of high
extinction rate and how is it going to harm human beings

QUESTIONS FOR SELF EVALUATION


1 What is IUCN Red list ? Give any two uses of this list .
2Name any 2 threatened animal species of India .
3Which are the biodiversity HOT Spots in India ?
4Name two alien species introduced in India .
5What is the importance of sacred forests and sacred
lakes ? 6What is cryo preservation ?Give its one use .
7What are the major causes of species losses in geographic regions ?

74
Chapter-16 Environmental Issues
S. CHA Concepts Degr Ref. Common errors
N PTER ee of NCERT text
O imp. book.: page
nos
16. Environ 5. Air Pollution and its ** Fig. 16.1 Advantages of CNG over Petrol or diesel.
mental
issues control *** Page 270- Norms of Air Pollution.
(ii) Case study of 273 Types of impurities & their nature in domestic
Delhi ** Page 272- sewage.

6. Water pollution and its 273 Effect of Sewage discharge on characteristies

control *** of river

(i) Domestic *** Page-274

Sewage & *** Fig.16.2,16. Concentraion of toxic substances at

Industrial *** 3 various trophic levels

effluents

(ii) Algal Bloom Page 275

(iii) BOD *** Page- 275 Types of e-wastes & the metals extracted.

(iv) Eutrophication *** Page-276

(v) Biomagnificatio * Fig. 16.5

n ** Page-276

7. Solid waste

(i) Case study of

remedy for Page-279

plastic waste. Page-279

(ii) Electronic *** Page-279 Role of UV-B radiations

7
5
waste Page-280
8. Ago chemicals & their *** Page-280

effects ** Page-280-

(i) Case study of organic 282 Fig.

farming 16.6,16.7

5. Radioactive wastes

[Link] effect and

Global Warming

(i) Green house gases &

their relative contribution Page-282-

to total global warming 283

7. Ozone depletion in Page-284-

Stratosphere 285

8. Deforestation:- Case

study of conservation.

ACCELERATED EUTROPHICATION :- The acceleration of aging process of water by


humans activities like effluents from the industries and homes.
AGRO-CHEMICALS :- The chemicals used in agriculture such as inorganic
fertilizers, pesticides, herbicides, fungicides etc. are called agro-chemicals.
ALGAL BLOOM :- Presence of large amount of nutrients in water that cause excessive growth
of free floating algae.
Biochemical Oxygen Demand (BOD) :- The amount of the oxygen that would be consumed
if all the organic matter in one liter of water were oxidized by bacteria.
BIOMAGNIFICATION :- The increase in concentration of the toxicant at successive trophic
levels.
DESERTIFICATION :- When large barren patches of land extend and meet over time, a desert
is created.
EUTROPHICATION :-The natural aging of a lake by Biological Enrichment of its water.

76
E-WASTE :- Irreparable computers and other electronic wastes
GREEN HOUSE EFFECT :- The naturally occurring phenomenon that is responsible for
heating of Earths surface and atmosphere.
INTEGRATED ORGANIC FARMING :-A Cyclical, zero waste procedure, where waste
products from one process are cycled in as nutrients for other processes.
MUNICIPAL SOLID WASTES :- The wastes from homes offices, stores, schools, hospital etc.
that are collected and disposed by municipality.
NOISE :- The undesired high level of sound.
POLLUTANTS :- Agents that bring about undesirable change in air, water land or soil are
called pollutants.
POLLUTION :- Any undesirable change in physical, chemical or biological characteristics of
air, land, water or soil.
POLYBLEND :- A fine powder of recycled modified plastic.
REFORESTATION :- The process of restoring a forest that once existed but was removed at
same point of time in the past.
SANITARY LANDFILLS :- The process in which wastes are dumped in a depression or trench
after compaction and covered with dirt everyday.
SNOW-BLINDNESS CATARACT :- High dose of UV-B causes inflammation of cornea.
SOIL EROSION :- Removal of fertile top soil due to human activities over cultivation,
deforestation etc.
WATER LOGGING :-The stagnation of water in the field due to irrigation without proper
drainage of water.

DIFERENCES

Primary pollutants Secondary pollutants


[Link] enter our atmosphere directly from [Link] are formed during chemical reaction
different sources and these may be solid ,liquid b/w primary and other atmospheric
and gas. pollutants
[Link],CO2,SO2,N2O [Link], brown air.

Deforestation Desertification
[Link] is called the cutting and clearing of [Link] is the conversion of grassland into desert.
forests.
[Link] due to cattle grazing and soil erosion.
[Link] due cattle grazing, urbanization
and industrialisation.

77
ASSIGNMENTS

LEVEL 1

Define eutrophication.
What is biomagnification?
What is BOD?
[Link] is the worlds most problematic weed, also known as terror of Benga
Differentiate between biodegradable and non-biodegradable wastes.
Describe Chipko Movement.
Mention harmful effects of noise pollution on human health

LEVEL 2
1. What is meant by algal blooms? What is its significance?
What is Jhum cultivation?

What is snow blindness?

4. Mention the harm caused by fine particulate matter to human beings?

[Link] are the advantages of Organic farming?


How do radioactive wastes cause damage to living organism?
What measures should be taken to reduce global warming?
Write a short note on ozone depletion.

LEVEL 3

What is the effect of DDT in birds?

Why are nuclear wastes called potent pollutants?

Mention two problems that have arisen due to green revolution.


What is ecological sanitation? What are its advantages?
How can we reduce automobile pollution?
[Link] the adverse effects agrochemicals
7..Mention the Supreme Court directions to the Government to reduce pollution.
8. a) Explain the functioning of electrostatic precipitator with the help of a diagram.
b) Mention the consequence if the electrostatic precipitator does not work in a
power plant.
QUESTIONS FOR SELF EVALUATION

1What do you mean by point source pollution ?


2What is the cause of minimata disease ? Write its symptoms .
3Which type of UV radiations can be lethal to the organisms ?
4 Expand the term PAN ?
5 Write constituents of smog ?

78
6BOD of two samples of water A and B were 120 mg./L and 400 mg./L .respectively .Which sample is
more polluted ?
7How do human activities cause deforestation ?
8 DISCUSS e wastes.
9 Write a note on acid rain .
10 Discuss the causes and effects of global warming .

79
Preface

Central Board of Secondary Education (CBSE), whose educational process


is inclusive of co-scholastic areas of life skills, attitude and values, sports
and games as well as co-curricular activities, is aiming to strengthen its
education system in the area of value education. For the same, the board
will be introducing value-based questions in the papers of final
examinations in all major subjects for classes XI and XII from the
academic session 2012-13.

The Board has decided to assess students for 5 percent weight age in
classes XI and XII through questions which will be integrated with the
content of the subject and analyzed on the basis of the values it reflects.
The questions will be 3-4 marks in a question paper of 70-90 marks.

The sample value based questions deal with the life skills and values
attained by students like Self Awareness, Empathy, Critical thinking,
Creative Thinking, Decision Making, Problem Solving, effective
Communication, Interpersonal Relationships, Coping with Stress and
Coping with Anger, and Dealing With Emotions.
UNIT VI- REPRODUCTION

Your younger sister has seen a banana tree in backyard of a house. She could
see the fruits but no seeds. She wants to know how a new plant of banana
will be produced without seed. What will you explain to your sister?

A popular TV programme shows in some village, girls are killed soon after their
birth. Do you approve such practice? What impact does it have on
population?

Sunitas bhabhi is not allowed to enter the kitchen during the days of her
menstrual cycle. Sunitas mother thinks that she is impure and dirty and the
food prepared by her is also unhygienic. Give your opinion about such
traditional belief.

Monika is a sex worker. You are a NGO worker. You are given the responsibility to
educate the sex worker about sexually transmitted diseases. Specify any two
ways of prevention from such diseases.

Neeru and Narim have a three year old daughter. During her second pregnancy
she wants to go for sex determination test and if needed medical termination
of pregnancy. Do you think her decision is right? Justify your answer.
Nidhi is a class VI student visits a field and finds that all the flowers of some
plant are closed.
She thinks such flowers will not open and due to no pollination seeds will not
be formed. Such plants will be propagated vegetative. Do you agree with
Nidhis findings? Explain.

Poojas grandmother blames her mother for giving birth to three daughters and
wants another marriage of her son. Is it right to blame a female for sex
determination? Justify your answer.

Maya saw a farmer spraying some chemical on flowers, on asking she came to
know that this act will lead to the formation of fruits without fertilization.
Maya thinks that fruits such developed are not good to eat as chemicals are
sprayed on it. Explain the difference between such spray and usual pesticide
spray.

Rahul and his friends are having discussion about a recently released movie in
which hero is a sperm donor. His friends say that sperm donation is a means
to earn money. Rahul explains that sperm donation can help infertile couples.
Whom do you think is right? In which type of infertile cases such sperm
donation is helpful. Draw a neat and labeled diagram of a sperm.
UNIT VII - GENETICS AND
EVOLUTION
Swati is dark skinned and children of her class tease her. Renu tries to help and
explains her classmates that skin color is an inherited character, so they
should stop teasing Swati. Name the type of inheritance involved in skin
coloration of humans.

Alok was rejected for driving license as it was found that he could not distinguish
between red and green color. What would be the impact of his color blindness
on his driving on road?

A couple fights frequently for the paternity of their child. The husband thinks that
he is not the father of this child. Name the technique you will suggest to solve
the problem of paternity.

You must have read in the news paper that some children suffering from
Thalesemia became HIV positive due to negligence of a hospital. What
negligence has been made on part of hospital authorities in your opinion?

Rohit meets an accident. Iqbal his schoolmate takes him to hospital where Rohit
(AB blood group) needs blood transfusion. Iqbal also has AB blood group and
is willing to donate his blood but Rohits mother object by saying Iqbal
belongs to different community so has different type of blood. In your
opinion Rohits mother is wrong or right? Give your opinion by explaining the
allelic composition of blood group AB.

Mohit had severe pain in his last molar tooth. Doctor advised the tooth to be
removed. Mohits sister objected saying that this was wisdom tooth and is
responsible for his IQ. Mohit followed doctors advice and got his tooth
extracted. Do you think Mohit will fail in his final examinations? Justify your
answer by naming the type of structures the wisdom tooth is?

Kavitas parents suffer from high blood pressure and are obess. Kavita is also
worried about her health. Do you think kavita can inherit these characteristic
from parent. Suggest two measures kavita can adopt to avoid high blood
pressure and obesity.
Roshan a 5yr child in neighborhood is suffering from Downs syndrome. Other
children in your locality do not interact with him.

Is it right not to interact with Roshan


What is the cause of Downs Syndrome

Write any two Symptoms.

The day next to heavy rains, many insects/moths can be seen near light sources.
Some people believe that these insects develop from mud. Do you agree with
this belief? What is theory of origin of life known as? How will you explain the
development of these insects from mud?

According to the human Genome Project, almost 99.9% nucleotide bases are
exactly the same in all people.

Do you think the discrimination of people on the basis of color,


creed, caste, religion is correct? Why?

What percentage of the human genome codes for proteins?

Which chromosome has most genes on it?

UNIT VIII- Biology in Human Welfare

After a rainy day Rahul found many dragon flies flying over stagnant water. He
thinks these flies come to drink water. Is Rahuls explanation correct? Give
your views.

Nowadays capsules of Spirulina are used as food supplements. Do you


recommend the use of these capsules? Why?

Sunita finds that after few periods of teaching classroom is littered with many
small pieces of papers. Next day she delivered a speech in assembly-if a
paper is torn a branch of tree is being destroyed. Do you agree with Sunita?
Give reasons.

Anita believes that breastfeeding her new born child would spoil her figure and
also make her weak. Do you think Anita is right? If not, how would you
convince her?
Delhi govt. has recently decided to ban the sale of Gutka (this fetches them a
lot of monetary gain) in the state. Do you support the decision and Why?

You go to a super market to buy rice. Two types of products are available- one
is organically grown and second is conventionally grown. The organically
grown crops are costlier so your mother does not want to purchase it.
Convince your mother by telling her the advantages of organic foods.

Municipal Corporation has deputed personnel to check for mosquito breeding in


your school.

Which are the places they should check for mosquitoes and there larvae?

Name to diseases which are spread by mosquitoes.

Name any two biological agents which can be used to control mosquitoes

Prabha has seen huge garbage dumps outside your school which are not being
regularly disposed of by MCD. Prabha discusses the problems with school
mates and decide to organize rally to spread awareness among local
people about public hygiene.

Prepare two slogans for rally

Name any two infectious diseases which may spread due to


such unhygienic conditions at public place

Anand a 14yr old boy thinks smoking makes him more energetic and feel like
adult and thus more responsible citizen. He tries to smoke when he is with
his peer group. As a friend you have to educate him

Why he feels more energetic while smoking?

Effects of CO in smoke

Other ill effects on body

Ram is managing a dairy firm. He has been advised to use artificial


insemination to overcome several problems in developing better breeds of
cow. Govind has advised him MOET for herd improvement. Ram is ignorant
and is not able to decide. How will you help Ram regarding
Which technique should he adopt

Procedure of new technique

What is advantage of this technique

UNIT IX - BIOTECHNOLOGY

A newspaper has reported that an American company has patented turmeric.


Indian government is fighting against this patent. What will you call this act of
American company?

Sangeeta has developed a transgenic crop. She wants to grow this crop directly
into the field. Will you allow her to do so? What will you suggest her?

Arvind s mother has developed Diabetes. Doctor suggests her to take Insulin
injections. But his mother declines as she presumes injections are prepared
by slaughtering of animals .How will you solve his mothers problem with your
knowledge of biotechnology?

Inspector Dubey could find only few hair strands from crime scene. He wants to
proceed for DNA fingerprinting but the amount of DNA is very less. In your
opinion what could be the solution to this problem? Write the basic steps of
this technique?

Sunils uncle is very worried as his crop is destroyed by insects. He suggests his
uncle to use Bt crops. His uncle says that such crops produce toxins which
can harm the consumers of this crop. Whom do you support and why?

UNIT X- ECOLOGY
The city government is planning to bring metro rail to your area. But this will
require around 10,000 trees to be cut. Do you think govt. should go ahead
with the project? Justify your answer?
You find that a lake in your neighboring area has been covered by Water
hyacinth. You have contacted your friends to remove this weed. Nobody
agrees to support you .How will you explain the necessity of this?

Now a days we see that people use CDs and DVDs for storing information,
movies and songs.
Do you think these things create pollution?

Government of India has launched clean Ganga programme by the name Ganga
Action Plan. Do you want to be a part of it? How?

You have read the newspaper reports that lots of cows die because of polythene
bags getting
entangled in their intestine. You go to market and see vegetable vender
selling vegetables in plastic bags. What will be your suggestion to - (i) buyer
and (ii) seller?

One of your friends Rakesh has gone to jungle safari with his family. On returning
from that safari he is sharing experiences with you and tells that his father
who is a businessman hunted a deer with his gun. What will you tell your
friend after knowing about their expedition?

Pankhuri watched a TV program based on life in polar region. She observed that
all the animals in polar region possess larger size and smaller animals are not
found in that region. She asked about this surprising fact to her friends. Being
her friend, how can you satisfy her curiosity?

Ajay a notorious boy often involved in destruction of surrounding plants and


killing small animals. You are given a responsibility to make him understand
about importance of each and every organism present in world. How can you
explain him about it and which hypothesis you will use for it?
A well known personality killed a back buck during hunting in sacred groves of
Aravali Hills in Rajasthan. Local people caught him and lodged a case in court
against him. He argued that court that killing a human being is a crime but
killing a animal is not crime.
Do you favor his argument? Why?

What is the role of scared groves? Mention any two names of such
places other than Aravali Hills.

Anil and Sunil are partners and established a factory. After a few months
electrostatic precipitator became out of order. Sunil wanted to replace it but
Anil expressed the view that they have no effect of it on productivity as well
as income; therefore they should not waste money to replace it.

(a)Out of these partners whom do you support and why?

Suggest any two measures to stop such negligence.

A team of research workers observed that the population of fish eating birds is
declining every year after the establishment of a pesticide factory nearby five
years ago.

What may be the possible reason in your opinion? Explain?

Can you suggest alternative to pesticide so that factory may be stopped.

A few months ago the people of Ramgarh started a bad practice of disposing
their waste in the pond of village which was earlier source of drinking water.
It resulted in deterioration of quality of water and fish mortality.

What changes do you think have taken place in pond? Name such condition.
What measure will you take to stop villagers for such practices as well as to improve
the condition?
UNIT-6 Reproduction
Answers & Values

In banana the vegetative propagation is with the help of rhizome

Values

Awareness

Observation

No, I do not approve such practice as girls are equally important in the
society. Otherwise the sex ratio will decrease.

Values

Sensitivity to words others

Awareness

Menstrual cycle is a normal process in the body of female which helps in


reproduction.

Values
Self awareness about body.

Compassion for others.

4. a) Always use condom during coitus

b) in case of doubt of any disease consult doctor

Values

Services to society

Compassion

Awareness of STD

5. No

Sex determination and MTP is not legal

Values

Should be ethical

Awareness

6. No the flowers which do not open can have self pollination and produce
seed. They can be propagated through seed.

Values

Concern about plants

Observation

Critical thinking

7. No. Female produces all eggs with X chromosomes while male is


heterogametic and produce two types of gametes X and Y. It is the fusion
of his gamete (X or Y) with egg of X type which determine the sex of baby
Values

Understanding.

Respect for female.

8. The chemical sprayed by farmer is growth hormone which will induce


parthenocarpy. This is not causing any harm to fruit or to the health of
consumer. Pesticides are harmful to human health.

Values

Sensitivity and awareness about use of chemicals.

observation

a) Rahul is right . As it helps infertile couples. It is helpful in following cases

I) Inability of male partner to inseminate.

II) Very low sperm count.

Values

Courage

Believing that other can make a world of difference

Compassion for others


Unit-7 Genetics and Evolution
Answers & Values

Quantitative /Polygenic inheritance

Values

Sensitivity towards fellow beings.

Compassion.

Understanding

He will not be able to distinguish between red and green signal on road.
This may lead to an accident

Values
Responsibility

Awareness

DNA Fingerprinting

Values

Compassion.

Empathy.

During transfusion of blood to thalesemic patient.

Blood might have been contaminated.

Sterile needles/ injection were not used

Values

Critical thinking

Awareness about health

Empathy.

Wrong.

Blood Group AB has two alleles A and B in the people of all


communities

Values

Sensitivity towards fellow beings.

Compassion for others

Responsibility.
No. Wisdom tooth Has nothing to do with IQ or performance of any
person. It is vestigial organ which can be remove

Values

Awareness.

1) No, these are life style related diseases

Any two measures- changing in food habits, exercises, leading active


life, meditation.

Values

Awareness about health.

Understanding.

1) No.

2) Genetic disorder due to trisomy.

3) Any two symptoms.

Values

Empathy.

Concern.

No

Spontaneous generation theory

Values
Awareness about environment.

Understanding.

Unit-8 Biology in Human Welfare

Answers & Values

No, dragon flies eat mosquito larva and act as bio control agents.

Values

Awareness about environment

Critical thinking.

Yes

Any one reason these are rich in proteins and can be produced in
large quantities in less time.

Values

Awareness.

Problem solving.

Yes, wood is used in manufacturing of paper.

Values

Sense of responsibility.

Awareness.
No, Her figure will not be spoilt

By telling the advantages of breast feeding.

Values

Self awareness.

Sense of responsibility.

Yes Gutka increases the changes of cancer

Values

Awareness of Govt. Policies.

Consciousness to words health

Advantages of organic farming like biofertilisers and bio


pesticides are used in organic farming which is not harmful to
health.

Values

Sensitivity and awareness about use of harmful chemicals

Decision making.

A) water tanks , flowerpots, stagnant water

Dengue, Malaria

Gambusia, dragonfly

Values

Observation

Sensitivity towards health.


1) Any slogans.

Diseases like typhoid and amoebiasis.

Values

Responsibility.

Sensitivity towards public. Hygiene

Problem solving.

i) He fells energetic because nicotine raises blood pressure and


increases heart beat. This is not good for his health.

CO binds to hemoglobin and reduces concentration of oxygen

Any one effort cancer of lung, throat, emphysema.

Values

Awareness about health

Consciousness.

Critical thinking.

I)MOET as success rate of this technique is more

II) Cow is administered hormones, with FSH like activity, to induce


follicular maturation and super ovulation-(6-8 eggs). The animal is
mated. Fertilized eggs are recovered and transferred to surrogate
mother.

III) Herd size is increased in short time.

Genetic mother is available for another round of super ovulation.


Values

Critical thinking

Problem
solving.
Unit IX
Biotechnology

Answers & Values

Biopiracy.

Values

Awareness

Justice for country.

Insulin can also be synthesized in laboratory with r DNA

Values

Empathy.

Awareness

Concern.

No, as GMO may pose some threat to environment or living


organism I will ask her to approach GEAC.

Values
Sense of responsibility.

Understanding.

He can amplify DNA with the help of PCR technique Basic steps of PCR ----

Denaturation

Annealing

Extension

Values

Critical thinking

Awareness.

I support him.

Bt crops produce protoxin which changes into active form only in the
intestine of insects in alkaline pH. It is completely safe for other
animals and human beings

Values

Empathy.

Awareness.
Unit-X Ecology

Answers & Values

Yes. But the track of metro should be so changed that minimum no


of trees are cut. Track can be made underground and more trees
can be planted after the project is over.

Values

Sensitivity towards environment

Decision making.

Friends should be explained the process of natural ageing of a


lake by mineral enrichment of water. (eutrophication) which is
harmful to aquatic life .

Values

Problem solving

Critical thinking.

Responsibility

Yes. Because all this material contain heavy metals and toxics
substances and known as e-wastes.

Values

Concern about environment.

Awareness.
Yes I will start awareness programmes like Nukkad Nataks, rallies and
slogans making to keep the river clean.

Values

Innovation

Service to society

I) Use cloth or jute bag to save environment and thus life of cow

Use paper bags, polythene are non biodegradable and toxic.

Values

Sensitivity to words environment

Concern.

It is unethical and leads to loss of biodiversity and result in imbalance in


Eco system.

Values

Concern about animal.

Empathy.

Because smaller animals have larger surface area relative their


volume so they lose body heat very fast when it is cold outside.
They have to expense lot of energy to generate body heat.

Vales

Critical thinking

Awareness.
Explanation through Rivet popper hypothesis.

Values

Social responsibility

Concerns about eco system.

A) No because each living organism has its own role in balanced eco
system.

b) Sacred groves are culturally protected area where large no of


rare and Threatened wild life is given total protection.

[Any other two sacred groves]

Values

Awareness

Responsibility.

A) I will support Sunil because his approach is eco friendly.

By imposing fine and punishment

Cancellation of registration of such industries

Values

Decision making

Concern about environment

A) Pesticide entering in food chain and resulting in biomagnifications

Bio controlling agent to remove pest

Values

Problem solving

Critical thinking.
A) Eutrophication Brief explanation.

Any two means of spreading awareness of disposal of waste


and keeping the pond clean.

Values

Service to society

Concern about environment.

Common questions

Powered by AI

Plasmids serve as effective vectors in genetic engineering due to their ability to autonomously replicate within bacterial cells and carry foreign DNA. Plasmids are small, circular DNA molecules found outside the chromosomal DNA in bacteria, enabling them to serve as vehicles for gene transfer . Incorporating essential features like an origin of replication (Ori) ensures that the plasmid replicates along with introduced foreign DNA within the host, which is crucial for maintaining the introduced genetic material in progeny cells . Additionally, plasmids can be engineered with selectable markers such as antibiotic resistance genes, allowing for the identification of successfully transformed cells . The process of transformation, where these recombinant plasmids are introduced into the competent host cells, is critical for the uptake of foreign DNA and can be achieved through methods such as chemical treatments or electroporation . By using plasmids as vectors, recombinant DNA technology can efficiently introduce and express foreign genes in bacterial hosts, facilitating the study and production of specific proteins and other gene products ."}]}

Restriction endonucleases and ligases play crucial roles in the creation of recombinant DNA. Restriction endonucleases act as molecular scissors that cut DNA at specific recognition sites, which are often palindromic sequences. Palindromic sequences are important because they provide the specific sites where restriction enzymes recognize and cut the DNA. For example, EcoRI recognizes the sequence 5'–GAATTC–3' and cuts between G and A, creating sticky ends with single-stranded overhangs . These sticky ends can easily form hydrogen bonds with their complementary sequences on another DNA molecule cut by the same restriction enzyme, facilitating the assembly of DNA fragments . Ligase enzymes then join these fragments by forming covalent bonds between the sugar-phosphate backbones, sealing the nicks and creating a stable piece of recombinant DNA . This process allows the insertion of a gene of interest into a vector, which can then be introduced into a host cell, enabling gene cloning and the production of desired genetic products .

The ethical implications of producing genetically modified organisms (GMOs) involve concerns about safety, environmental impact, and ethical treatment of living organisms. Critics argue that GMOs can lead to the development of "superweeds" through unintentional cross-breeding with non-GMO plants, potentially harming biodiversity . Additionally, there are fears about GMOs being controlled by a few large companies, which could impact food sovereignty and rights of farmers . Regulatory requirements for GMO production vary by country but generally include safety assessments, environmental impact studies, and labeling regulations to ensure consumer awareness. For example, in products like biofortified rice, regulatory measures are implemented to assess nutritional benefits and potential health risks before approval for human consumption . Furthermore, processes like tetracycline resistance gene markers are used in identifying GMOs, aiding regulatory compliance in distinguishing GMOs from non-GMOs . Standards for assessing and managing risks associated with GMO release into the environment are critical components of the regulatory landscape .

Biotic factors, such as the organisms used as host cells in recombinant DNA technology, can significantly impact gene expression efficiency. For example, bacteria like E. coli are commonly used due to their rapid growth and ability to express foreign genes, but they might require specific conditions for optimal gene expression . Relating to abiotic factors, conditions such as temperature and pH in bioreactors can affect the expression levels of genes in host organisms. Optimal conditions need to be maintained to ensure efficient gene replication and protein production, as bioreactors control these variables during the culturing process . Additionally, the chemical composition of the culture medium, including solvents, nutrients, and oxygen levels, also plays a critical role in the successful expression of genes in host organisms . Both biotic and abiotic factors must be meticulously managed to ensure high efficiency in gene expression for producing desired products through genetic engineering.

Bioreactors support the cultivation and extraction of biotechnological products by providing better aeration and mixing properties compared to shake flasks. This ensures that the culture medium is homogenous and that all cells receive adequate nutrients and oxygen, enhancing cell growth and product yield . Additionally, stirred tank bioreactors are designed to facilitate large-scale production, allowing for controlled, sterile, and automated conditions which are essential for industrial biotechnology processes . Bioreactors are crucial for downstream processing technologies, which include the purification of the desired product from the culture, a critical step in biotechnology for obtaining high-quality end products .

Gel electrophoresis is a vital technique in biotechnology for ensuring the quality of biotechnological products as it separates DNA fragments based on size, allowing for the analysis and verification of DNA integrity and composition in products . Additionally, it helps in confirming the presence and size of DNA inserts in genetic engineering . Downstream processing further contributes to quality assurance by refining biotechnological products to achieve the desired purity and concentration. This includes various stages like separation, purification, and formulation which are crucial in creating products that meet industry standards and regulatory requirements . Both these processes are essential to ensure the reliability and effectiveness of biotechnological applications in medicine, agriculture, and other fields .

PCR (Polymerase Chain Reaction) is used in recombinant DNA technology to amplify a specific DNA segment by creating multiple copies of the desired gene in vitro. The process involves three main steps: denaturation of the double-stranded DNA to separate the strands, annealing where primers bind to the single-stranded DNA, and extension where Taq polymerase synthesizes a new DNA strand by adding nucleotides . Amplifying the DNA segment is necessary because it increases the amount of DNA available, enabling further manipulations such as cloning into vectors, sequencing, or transformation into host cells. This ensures that there is enough material to facilitate these subsequent steps . The use of thermal stable Taq polymerase is crucial, as it allows the reaction to be repeatedly cycled through high temperatures required for denaturation without inactivating the enzyme ."}

Sticky ends are single-stranded portions of DNA that result from the action of restriction enzymes, which cut DNA at specific palindromic sequences, creating overhangs that can easily pair with complementary sequences on another DNA fragment . These ends are significant in recombinant DNA technology because they facilitate the joining of DNA fragments from different sources by forming hydrogen bonds, enabling the creation of recombinant DNA through the use of DNA ligase, which seals these connections . The formation of sticky ends is crucial in the cloning process as it allows for the insertion of foreign DNA into vectors, making the construction of recombinant DNA possible ."}

Cloning vectors must possess several key features essential for successful gene cloning. These characteristics include an origin of replication, which allows the vector to replicate independently within a host cell, ensuring that the inserted gene is copied. They often contain a selectable marker gene, such as antibiotic resistance, which helps identify host cells that have taken up the vector by allowing only those cells to grow in a selective medium. Additionally, they have multiple cloning sites (MCS), a series of restriction sites that facilitate the insertion of foreign DNA fragments. Finally, efficient cloning vectors often contain elements that enable expression of the cloned gene suitably if expression is desired, such as promoters or gene regulatory elements . These elements are crucial as they ensure that the gene of interest is successfully replicated and expressed in host cells, allowing for further study or application in biotechnology .

Taq polymerase plays a crucial role in PCR by synthesizing new strands of DNA by adding nucleotides to primers on each original strand during the extension phase. Its thermostability is critical because PCR involves repeated cycles of heating and cooling, where the DNA is denatured at high temperatures. Taq polymerase, isolated from the thermophilic bacterium Thermus aquaticus, remains active at these high temperatures, allowing the DNA polymerization process to proceed efficiently without the enzyme denaturing .

You might also like