0% found this document useful (0 votes)
19 views11 pages

GLP-1 and Exendin-4 Enhance GABA Currents

This study investigated the effects of glucagon-like peptide-1 (GLP-1) and exendin-4, a GLP-1 receptor agonist, on γ-aminobutyric acid (GABA) signaling in hippocampal CA3 pyramidal neurons. The study found that low concentrations of GLP-1 and clinically relevant concentrations of exendin-4 transiently enhanced both synaptic and tonic GABA currents. This potentiation was mediated through pre- and postsynaptic GLP-1 receptors and demonstrates that GLP-1 can regulate hippocampal function by enhancing GABA signaling.

Uploaded by

Teky Widyarini
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
19 views11 pages

GLP-1 and Exendin-4 Enhance GABA Currents

This study investigated the effects of glucagon-like peptide-1 (GLP-1) and exendin-4, a GLP-1 receptor agonist, on γ-aminobutyric acid (GABA) signaling in hippocampal CA3 pyramidal neurons. The study found that low concentrations of GLP-1 and clinically relevant concentrations of exendin-4 transiently enhanced both synaptic and tonic GABA currents. This potentiation was mediated through pre- and postsynaptic GLP-1 receptors and demonstrates that GLP-1 can regulate hippocampal function by enhancing GABA signaling.

Uploaded by

Teky Widyarini
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

GLP-1 and Exendin-4 Transiently Enhance GABAA Receptor

Mediated Synaptic and Tonic Currents in Rat Hippocampal CA3


Pyramidal Neurons
Abstract
1.8. In 0.1, 1 nmol/L GLP-1 or 10, 50, or 100 nmol/L exendin-4, only the
sIPSC frequency increased. The tonic current was enhanced by 0.011
nmol/L GLP-1 and by 0.5100 nmol/L exendin-4. When action potentials
were inhibited by tetrodotoxin (TTX), inhibitory postsynaptic currents
decreased and currents were no longer potentiated by GLP-1 or exendin-4.
In contrast, although the tonic current decreased in TTX, it was still
enhanced by GLP-1 or exendin-4. The results demonstrate GLP-1 receptor
regulation of hippocampal function and are consistent with GLP-1 receptor
agonists enhancing GABAGlucagon-like peptide-1 (GLP-1) is a hormone
that stimulates insulin secretion. Receptors for GLP-1 are also found in the
brain, including the hippocampus, the center for memory and learning.
Diabetes is a risk factor for decreased memory functions. We studied
effects of GLP-1 and exendin-4, a GLP-1 receptor agonist, on aminobutyric acid (GABA) signaling in hippocampal CA3 pyramidal
neurons. GABA is the main inhibitory neurotransmitter and decreases
neuronal excitability. GLP-1 (0.011 nmol/L) transiently enhanced synaptic
and tonic currents, and the effects were blocked by exendin (9-39). Ten
pmol/L GLP-1 increased both the spontaneous inhibitory postsynaptic
current (sIPSC) amplitudes and frequency by a factor of A signaling by preand postsynaptic mechanisms.

Introduction
In recent years, compelling evidence has emerged suggesting that
diabetes mellitus increases the risk for cognitive impairments in the
elderly (18). How this comes about is not resolved, but interestingly, the
brain contains receptors for many metabolic hormones, among those
receptors for insulin and the incretins. To date, with the exception of the
hypothalamus, we know relatively little about how metabolic hormones
affect neuronal activity and thereby brain function. The hippocampus is
central for cognitive functions and is the center for memory and learning
(9,10). It has prominent expression for receptors activated by metabolic
hormones (10). Furthermore, via neurons in the septum, the hippocampus
regulates the activity of a number of hypothalamic nuclei (11,12).
Glucagon-like peptide-1 (GLP-1) is a gut hormone that is secreted by

intestinal L cells in response to food intake, and the GLP-1 receptor is


expressed in the hippocampus (10,13). GLP-1 crosses the blood-brain
barrier, but it is also a neurotransmitter produced by neurons with cell
bodies in the brainstem (1215). The best known effects of GLP-1 are to
stimulate insulin and inhibit glucagon secretion in a glucose-dependent
manner in the pancreatic islets to regulate glucose homeostasis after a
meal (13). Although the GLP-1 receptor is expressed in the hippocampus
(10,16,17) and GLP-1 and its mimetics, e.g., exendin-4, liraglutide, might
potentially be used to treat cognitive declines related to diabetes (6,7), to
date not much is known about the effects of GLP-1 on neuronal signaling
and, hence, how GLP-1 affects cognition and hippocampal regulation of
metabolic homeostasis.
The GLP-1 is a 30amino acidlong peptide and is derived from
posttranslational processing of the preproglucagon gene (18). Initially, the
peptide GLP-1 (1-37) was identified from this processing, but later it was
shown that there were two shorter peptides, GLP-1 (7-37) and GLP-1 (736)amide, that were the active species in vivo. The half-life of the peptides
in plasma is very short, only about 12 min (13,19), due to degradation by
the enzyme dipeptidyl peptidase-4 (13). In the pancreatic islets, the GLP-1
receptor is internalized after GLP-1induced activation (2023) and passes
through recycling endosomes before it appears in the plasma membrane
again (23). The GLP-1 receptor is widely distributed in the brain
(10,16,24), including in the hippocampal CA3 pyramidal neurons (16,25),
and GLP-1 and other agonists at the GLP-1 receptor have been reported to
regulate food intake (26), be neuroprotective (27), anti-inflammatory (28),
and modulate synaptic plasticity and memory formation (2832).
-Aminobutyric acid (GABA), the major inhibitory neurotransmitter in the
central nervous system, activates synaptic and extrasynaptic
GABAAreceptors that mediate synaptic and tonic currents, respectively,
regulating activity of neurons and neuronal circuits (33). Metabolic
hormones are emerging as modulators of GABA signaling in hippocampal
neurons. Already in 1984, Palovcik et al. (34) demonstrated that insulin
inhibits pyramidal neurons in hippocampal slices. Later, insulin was shown
to enhance miniature inhibitory postsynaptic currents (mIPSCs) in cultured
hippocampal neurons (35), and recently we demonstrated that insulin
turns on high-affinity GABAA receptors that generate tonic currents in
hippocampal CA1 pyramidal neurons in rat brain slices (36). In the current
study, we examined the effects of GLP-1 and exendin-4 on GABA Asignaling
in hippocampal CA3 pyramidal neurons in rat brain slices. We found that
low physiological GLP-1 concentrations (pico- to nanomoles per liter) and

clinically relevant exendin-4 concentrations transiently potentiate synaptic


and tonic GABA-activated currents.
Previous SectionNext Section
Research Design and Methods
Hippocampal Slice Preparation
Brain slices were dissected for electrophysiological recordings from 16- to
22-day-old Wistar rats. All animal procedures were conducted in
accordance with the local ethics guidelines and approved animal care
protocols by the Uppsala djurfrsksetiska nmnd, Uppsala, Sweden
(Uppsala Animal Ethical Board). Hippocampal slices were prepared as
previously described (37). Briefly, the animal was decapitated and the
brain rapidly removed and immersed into the ice-cold artificial
cerebrospinal fluid (ACSF) containing (in millimoles per liter): 124 NaCl, 3
KCl, 2.5 CaCl2, 1.3 MgSO4, 26 NaHCO3, 2.5 Na2HPO4, and 10 glucose with
pH 7.37.4 when bubbled with 95% O 2 and 5% CO2. Sagittal or coronal
hippocampal slices 400 m thick were prepared with a vibratome (Leica
VT1200S) in the ice-cold ACSF gassed with 95% O 2 and 5% CO2. Slices
were incubated in the same ACSF at 37C for 1 h and kept at room
temperature (2022C) during experiments.
Electrophysiological Recording and Analysis
All patch-clamp recordings were performed at room temperature (20
22C). Drugs were in general purchased from Sigma-Aldrich (Germany) or
Anaspec [GLP-1, exendin-4, and exendin (9-39)]. Bicuculline methiodide
from Santa Cruz Biotechnology (Heidelberg, Germany) or Sigma-Aldrich
(Schnelldorf, Germany) was used. The pipette solution contained (in
millimoles per liter): 140 CsCl, 1 CaCl2, 3 EGTA, 0.5 KCl, 1 MgCl2, 2 ATP-Mg,
0.3 GTP-Na, 5 QX-314 bromide, and 10 TES, pH of 7.25 with CsOH. In some
experiments, an inhibitor of the GABA B receptor, CGP52432 (5 mol/L),
was used, but it did not change the results. The recording pipettes were
made from borosilicate glass capillaries (Harvard Apparatus UK) with DMZUniversal Puller (Zeitz Instruments; Martinsried, Germany) and had
resistance of 24 M when filled with the pipette solution. The holding
potential (Vh) was set to 60 mV and used in all experiments. ACSF,
containing kynurenic acid (3 mmol/L) and other drugs, was continuously
perfused (3 mL/min) through the recording chamber during experiments.
Patch-clamp recordings were done using an Axopatch 200B amplifier
(Molecular Devices), filtered at 2 kHz, sampled at 10 kHz by analog-todigital converter Digidata 1322A (Molecular Devices), and stored in a
computer. The recordings were analyzed with pClamp 10 (Molecular

Devices) and MiniAnalysis 6 (Synaptosoft, Inc.) software. The amplitude of


the tonic current was defined as the difference between the baseline
current levels before and after the drug application (38) and the frequency
of the spontaneous IPSCs (sIPSCs) immediately before first drug
application was defined as control. The maximal drug effect on the sIPSC
frequency was calculated and normalized to its control value in the same
cell. The average value of the baseline current during the transient
change in the current value during GLP-1 application was fitted with a
double exponential function: y = y0 + A1 exp(t/rise) A2
exp(t/decay), where y0 and A1,2 are arbitrary constants and the rise/decay are
time constants for the rise and the decay phase of the transient current,
respectively.

Total RNA Isolation and RT-PCR


Total RNA was isolated from rat hippocampal slices by using a GenElute
Mammalian Total RNA Miniprep kit (Sigma-Aldrich) and quantified with
Nanodrop (Nanodrop Technologies). Rat hippocampal total RNA (100 ng)
was reverse transcribed into cDNA in a 20-L reaction mixture using
Superscript III reverse transcriptase (Invitrogen). Negative control was
performed by omitting reverse transcriptase in the reaction in order to
confirm no genomic DNA contamination in the isolated RNA. Human
hippocampal cDNA was purchased from USBiological. PCRs were done in a
10-L reaction mixture containing 4 L cDNA (4 ng), 1 PCR buffer, 3
mmol/L MgCl2, 0.3 mmol/L deoxyribonucleotide triphosphate, 1 carboxyX-rhodamine reference dye, 0.7 units JumpStart Taq DNA polymerase
(Sigma-Aldrich), 0.5 SYBR Green I (Invitrogen), and 0.4 mol/L each of
forward and reverse primers. The primer pairs were synthesized by SigmaAldrich:
rat Glp1r (forward,
GGCATTGTCAAGTATCTCTAC;
reverse,
GATGAAGACAAGGAAGTTGAC;
amplicon
size,
123
bp)
and
human GLP1R(forward,
ACATCAAATGCAGACTTGCC;
reverse,
TCACAAAGGCAAAGATGACC; amplicon size, 81 bp). Amplification was
performed in 384-well optical plates using the ABI PRISM 7900HT
Sequence Detection System (Applied Biosystems) with an initial
denaturation of 5 min at 95C, followed by 45 cycles of 95C for 15 s,
60C for 30 s, and 72C for 30 s. A melting curve was determined at the
end of cycling to ensure the amplification of a single PCR product. Five
microliters of each individual PCR were then electrophorized on a 2%
agarose gel stained with SYBR Gold (Invitrogen, Carlsbad, CA).

Statistical Analysis
Statistical analysis was carried out using SigmaPlot 11 (Systat Software),
MiniAnalysis 6 (Synaptosoft), or GraphPad Prism 6 software. Results are
presented as means SEM. Paired Student t test was used for data sets
normally distributed. The Tukey method was used to detect the outliers.
Statistical analysis was performed after excluding the outliers.
Nonparametric Mann-Whitney test was used for data sets that were not
normally distributed. One-way ANOVA Bonferroni post hoc test was used
for multiple comparisons with normally distributed data.

Results
The GABAA-mediated whole-cell currents were recorded from rat
hippocampal CA3 pyramidal neurons bathed in ACSF in the presence of
kynurenic acid. At the end of every experiment, bicuculline (100 mol/L), a
GABAA receptor antagonist, was applied to block GABA-evoked currents.
The sIPSCs were abolished by 100 mol/L bicuculline (Fig. 1) and the
holding current decreased, revealing the prominent tonic GABA-activated
current normally present in the hippocampal CA3 pyramidal neurons (24.7
1.5 pA, n = 19) (Fig. 1). We then proceeded and examined the effects of
GLP-1 on these GABAA receptormediated currents.

GLP-1 Transiently Modulates GABA-Activated Synaptic and Tonic


Currents in CA3 Pyramidal Neurons
We examined whether GLP-1 concentrations ranging from 10 pmol/L to 10
nmol/L affected the GABA-evoked currents, and representative results are
shown for three cells in Fig. 2AC. The GLP-1 receptor mRNA is expressed
in both human and rat hippocampus (Fig. 2D). GLP-1 in a concentrationdependent manner transiently enhanced the synaptic and tonic GABAactivated currents in the neurons. The 10 pmol/L GLP-1 concentration was
most effective and transiently increased the most frequent sIPSC
amplitude by a factor of 1.8 (Fig. 3A), and the average sIPSC frequency
was similarly increased (Fig. 3B) by a factor of 1.8 (n = 7) compared with
control. Higher GLP-1 concentrations (100 pmol/L, 1 nmol/L, and 10
nmol/L) (Fig. 3A) did not increase the most frequent sIPSC amplitude.
However, in 100 pmol/L and 1 nmol/L GLP-1, the average sIPSC frequency
still increased by a factor of 1.6 (n = 6) and 1.8 (n = 5), respectively,
compared with control (Fig. 3B). The tonic current in the CA3 pyramidal
neurons increased when exposed to 10 pmol/L to 1 nmol/L concentrations

of GLP-1 but was similar to control in 10 nmol/L GLP-1 (Fig. 3C) resulting in
a bell-shaped-like concentration-response relationship. When several GLP1 concentrations were sequentially applied to a neuron, then each new
application led to a transient increase of the tonic current, which
subsequently relaxed to the initial current level. Thus, the tonic current
amplitude changed transiently in a GLP-1 concentrationdependent
manner. Just applying the extracellular solution did not induce the
transient increase in the tonic current amplitude. The amplitude was not
related to whether the response was obtained after a single exposure to
GLP-1 (Fig. 3C) or whether the neuron had previously been exposed to
another concentration of GLP-1 (Fig. 3C).

The time course of the tonic current during the first minutes of the GLP-1
application was U shaped (Fig. 2AC and 4A and B) and could be fitted
with a double exponential function: y = y0 + A1 exp(t/rise) A2
exp(t/decay) where y0 is the initial baseline current value and A1,2 are
arbitrary constants but rise and decay are the time constants for the rise
and the decay phase of the transient current, respectively. At all GLP-1
concentrations, the current increased with a characteristic time constant
of ~2 min (rise), and after an additional 2 min (decay) (Fig. 4C) the current
had returned to approximately the initial current level. Both the sIPSCs
and the tonic currents in the presence of GLP-1 were blocked by 100
mol/L bicuculline (Fig. 2AC).
GLP-1 Receptor Antagonist Exendin (9-39) Inhibits GLP-1
Modulation of the GABA-Activated Currents
We examined whether the effects of GLP-1 on the GABA-activated
synaptic and tonic currents could be prevented by a GLP-1 receptor
antagonist. Exendin (9-39) (Ex9-39) is a competitive inhibitor of GLP-1 at
the GLP-1 receptor (23). Since GLP-1 once bound to the GLP-1 receptor
starts intracellular cascades leading to activation of various proteins, it is
essential to apply the inhibitor first and only then coapply GLP-1 together
with the inhibitor in order to prevent GLP-1 effects on neuronal function
such as modulation of the GABA signaling. In our experiments, we
therefore applied Ex9-39 first and then coapplied GLP-1 together with Ex939 to the brain slices. When Ex9-39 was applied to the hippocampal slices,
it inhibited the effects of 10 pmol/L GLP-1 on the GABA-activated currents
but had no effects when applied alone (Fig. 5). The amplitude and
frequency of the synaptic currents were now similar to control currents
(Fig. 5AC), and there was no increase in the amplitude of the tonic
current (Fig. 5A and D).

GLP-1 Enhances the Tonic but Not the Synaptic Currents in the
Presence of Tetrodotoxin
In order to examine whether the GLP-1 effects on the currents were due to
pre- or postsynaptic mechanisms or both, we studied the influence of GLP1 on the currents in the presence of the voltage-gated sodium channel
blocker tetrodotoxin (TTX) (1 mol/L). TTX inhibits action potential
dependent GABA release. The amplitudes of the synaptic currents were
similar in TTX and TTX plus 10 pmol/L GLP-1 (Fig. 6A and B). The results
further show that the frequency of the IPSCs decreased when the slices
were exposed to TTX from 16.8 1.2 to 2.3 0.4 Hz (nonparametric
Mann-Whitney test, P = 0.008, n = 5), respectively, and remained at a
similar level in the presence of 10 pmol/L GLP-1 plus TTX (Fig. 6A and C).
The results are consistent with GLP-1 potentiating the release of GABA
from presynaptic terminals. The tonic current also decreased in TTX
compared with control, but in contrast to the synaptic currents, the effect
of GLP-1 on the tonic current was maintained (Fig. 6A and D). The tonic
current transiently increased from 11.1 2 pA to 22.7 2.3 pA (n = 6)
when the slices were exposed to GLP-1 (10 pmol/L) in the presence of TTX
(Fig. 6A and D). These results demonstrate that GLP-1 signaling modulates
high-affinity, extrasynaptic GABAA receptors in the plasma membrane of
CA3 pyramidal neurons that generate the tonic current.

Exendin-4 Transiently Modulates GABA-Activated Synaptic and


Tonic Currents in CA3 Pyramidal Neurons
Exendin-4 is an agonist at the GLP-1 receptors. We therefore examined
whether exendin-4 had effects similar to those of GLP-1 on the synaptic
and tonic GABAA receptormediated currents in the hippocampal CA3
pyramidal neurons. Representative results for 10, 50, and 100 nmol/L
exendin-4 are shown for one cell in Fig. 7A. In a concentration-dependent
manner, exendin-4 transiently enhanced both the synaptic and tonic
GABA-activated currents in the neurons. Exendin-4 did not increase the
most frequent sIPSC amplitude (Fig. 7B), whereas the average sIPSC
frequency (Fig. 7C) was enhanced by a factor of 1.4 (n = 6), 1.5 (n = 6),
and 1.4 (n = 6) by 10, 50, and 100 nmol/L exendin-4, respectively, but did
not change in 0.5 nmol/L exendin-4. All exendin-4 concentrations tested
(0.5, 10, 50, and 100 nmol/L) transiently enhanced the tonic current in the
CA3 pyramidal neurons (Fig. 8A). The time course of the tonic current
enhancement by exendin-4 was U shaped. It was similar to what was
recorded in GLP-1 (Fig. 7A and 8B and C) and could be fitted by equation 1

[y = y0 + A1 exp(t/rise) A2 exp(t/decay)]. Similar to tonic currents


evoked by GLP-1, for all exendin-4 concentrations, the currents increased
with a characteristic time constant of ~2 min (rise) (Fig. 8D), and after an
additional 2 min (decay) (Fig. 8D), the current had returned to
approximately the initial current level. Both the sIPSCs and the tonic
currents in the presence of exendin-4 were inhibited by 100 mol/L
bicuculline (Fig. 7A).

Exendin-4 Enhances the Tonic Current but Not the Synaptic


Currents in the Presence of TTX
Similar to GLP-1, effects of exendin-4 on the GABA A receptoractivated
currents might be related to either pre- or postsynaptic mechanisms or
both. We therefore examined the effects of exendin-4 on the currents in
the presence of TTX (1 mol/L) that inhibits action potentialdependent
transmitter release (Fig. 9AD). The slices were first exposed to TTX to
block presynaptic GABA release and then exposed to 10 nmol/L exendin-4
(Fig. 9A). The amplitudes of the synaptic currents were similar in TTX
alone or TTX plus exendin-4 (Fig. 9B), but the frequency of the IPCSs
decreased to 2.2 0.4 Hz when the slices were exposed to TTX and
remained at a similar level in the presence of 10 nmol/L exendin-4 plus
TTX (n = 4) (Fig. 9C). At the same time, exendin-4 enhanced the tonic
current in the presence of TTX (Fig. 9D). The results are consistent with
exendin-4 enhancing GABA release from presynaptic terminals and
modulating tonic currents in the postsynaptic neurons and are similar to
the results obtained with GLP-1.

Discussion
The metabolic hormone GLP-1 and its mimetic exendin-4 both enhanced
GABA signaling in rat hippocampal CA3 pyramidal neurons. The CA3
pyramidal neurons are regulated by a number of inhibitory interneurons
and form an important part of the hippocampal neuronal circuit involved
in memory formation (9). The synaptic and tonic GABA-activated currents
in the CA3 pyramidal neurons were transiently enhanced by GLP-1 at
physiologically
relevant
concentrations
and
by
exendin-4
at
concentrations relevant when treating type 2 diabetes. The effects of GLP1 and exendin-4 on the GABA signaling can be attributed to both
presynaptic and postsynaptic mechanisms. The results are consistent with
GLP-1 modulating cognitive process in a hippocampal dependent manner.

There appears to be a number of ways GLP-1 and exendin-4 can enhance


GABA signaling in the CA3 pyramidal neurons. The most frequent sIPSC
amplitude was approximately doubled and the tonic current increased by
60% in 10 pmol/L GLP-1. These increases potentially can be attributed to a
number of processes such as increased release of GABA from the
presynaptic terminal, increased number of GABA A receptors in the
postsynaptic membrane, increased spillover of GABA from the synaptic
cleft, or insertion of new or modified GABA A receptors with higher affinity
in the postsynaptic membrane (33,35,36,39). TTX inhibits voltage-gated
sodium channels. In solutions containing TTX, action potential generation
is inhibited resulting in decreased transmitter release from presynaptic
terminals. We used TTX to differentiate between presynaptic and
postsynaptic effects of GLP-1 and exendin-4 on the GABA signaling. In the
presence of TTX, GLP-1 affected neither the amplitudes nor the frequency
of the synaptic currents, and similarly, exendin-4 in the presence of TTX
no longer modulated the frequency of the IPSCs. The enhancing effect of
GLP-1 or exendin-4 on the sIPSC frequency in the absence of TTX is,
therefore, related to increased release of GABA from presynaptic
terminals. The effects on the tonic current were more complex. In the
presence of TTX, the tonic current was reduced by ~50%. This is in
accordance with at least a part of the tonic current amplitude being
related to the magnitude of spillover of GABA from synapses (33,39).
However, the remaining tonic current recorded in TTX was still sensitive to
GLP-1 and approximately doubled in amplitude when the neurons were
exposed to 10 pmol/L GLP-1, and similar results were obtained with
exendin-4. These results are consistent with GLP-1 and exendin-4
modulating GABA signaling in the hippocampal CA3 neuron in a
postsynaptic manner. The GABAA receptors generating the tonic current
and modulated by GLP-1 receptor signaling in the postsynaptic neuron are
high-affinity, extrasynaptic GABAA receptors that are activated by the very
low, ambient GABA concentrations present around the neurons. Where the
GABA originates from is not clear, but mechanisms involving nonvesicular
release (4042) such as reversal of GABA transporters or release of GABA
from astrocytes have been proposed. That pre- and postsynaptic
mechanisms can regulate tonic GABA A receptormediated currents in
hippocampal neurons is in accordance with previous reports
(33,35,36,39). Interestingly, we previously reported that another
metabolic hormone, insulin, can modulate high-affinity GABA A receptors in
hippocampal CA1 pyramidal neurons (36). Axons from CA3 pyramidal
neurons, the Schaffer collaterals, project to the CA1 pyramidal neurons
where they synapse. Both the CA3 and the CA1 neurons have critical roles
in hippocampal-dependent memory and learning processes (43).

Metabolic hormones are emerging as important regulators of hippocampal


function (28,4447). GLP-1 has previously been shown to decrease
glutamate-generated currents in cultured hippocampal neurons (48) and
decrease hippocampal wave duration in rats (30), and there is an
impairment of synaptic plasticity and memory formation in GLP-1 receptor
knockout mice (49). The hippocampus is well-known for its role in memory
encoding, but less focus has been on its function in governing body
physiology (10,11). The hippocampus contains receptors for molecules
regulating many physiological processes including receptors for the
metabolic hormones (10). Furthermore, via neurons in the septum, the
hippocampus maps in a topographical manner onto the hypothalamus and
generally results in inhibition of hypothalamic activity (10,11). In
hippocampal CA1 neurons, insulin enhances IPSCs (35) and insulin also
turns on high-affinity GABAA receptors generating tonic currents in these
neurons (36), which normally express very small or no tonic currents (33).
GLP-1 is made in the brain stem and by L cells in the intestine and crosses
the blood-brain barrier (13). In plasma, the half-life of GLP-1 is 12 min,
and the maximal concentration after a meal is <40 pmol/L (13).
Interestingly, in our experiments, 10 pmol/L GLP-1 and exendin-4
effectively enhanced the GABA-activated current response with a similar
time constant of activation (2 min), an apparent synchrony with the
lifetime of GLP-1 in plasma. Recently, Roed et al. (23) determined the halfmaximal concentration for activation (EC 50) of the GLP-1 receptor
expressed in human embryonic kidney cells to be 9.8 1.0 pmol/L. They
further determined the EC50 of GLP-1 for inducing GLP-1 receptors
internalization to be 12 5 nmol/L and showed that maximal
internalization level occurred with supersaturating concentrations (1
mol/L) within 1520 min. In the CA3 neurons in the presence of an
inhibitor of the GLP-1 receptors, Ex9-39, no effects of GLP-1 on the
synaptic or tonic GABA-activated currents were recorded. The activation
and decay phase time constants of 2 min for the tonic current were
concentration independentsimilar for the two agonists and much faster
than the reported rate for GLP-1 receptors internalization. The time
constant of the tonic currents rising phase reflects the activation of GLP-1
receptors by the agonists, GLP-1 or exendin-4, transduction of the signal
inside the neuron, and as a result, increased current through the
extrasynaptic GABAA receptors in the postsynaptic plasma membrane.
What the decay time constant of the tonic current represents is unclear.
However, as the effect of both GLP-1 and exendin-4 on the synaptic
currents was transient, it is possible that the decay of the responses is
related to desensitization of the GLP-1 receptors (50).

Midlife type 2 diabetes increases the likelihood for cognitive decline and
brain atrophy (1,2). A number of studies published to date indicate that
diabetes and poor glycemic control are significant risk factors for
decreased memory functions later in life (18). GLP-1 receptor agonists,
e.g., exendin-4, liraglutide, are reported to be neuroprotective and
possible rescue cognition in models of Alzheimer, Parkinson, and
Huntington disease (7,51). Cognitive decline appears to be a significant
complication associated with diabetes, and it is therefore of major interest
to characterize the effects of molecules activating the GLP-1 receptor in
hippocampal brain tissue, as these compounds may potentially reverse or
slow down the decline. Our results show that exendin-4 application
effectively mimics the GLP-1 effects on the GABA A signaling in the CA3
pyramidal neurons, but the modulation varies somewhat between the two
GLP-1 receptor agonists, e.g., the sIPSC amplitudes were not enhanced by
any of exendin-4 concentrations that we used in this study, whereas the
sIPSC amplitudes were enhanced by 10 pmol/L GLP-1.
In conclusion, the results demonstrate that both GLP-1 and exendin-4
effectively potentiate GABAergic signaling in hippocampal CA3 pyramidal
neurons. Figure 9E shows a cartoon with pre- and postsynaptic neuronal
terminals and the synapse and identifies the location of the different
receptors. It also shows where the GABA-evoked currents that are
modified by the GLP-1 receptor agonists are generated. At physiological
GLP-1 concentrations, both synaptic and tonic GABA-activated currents
were transiently enhanced, and the effects were blocked by Ex9-39. The
results demonstrate that GLP-1 and exendin-4 modulate GABA signaling in
hippocampal neurons in both pre- and postsynaptic manners. The results
imply that in order to combat diabetes-associated cognitive dysfunction
with GLP-1 or medicines that mimic GLP-1 actions, e.g., exendin-4, a good
understanding of GLP-1 receptor agonist effects on hippocampal neuronal
functions is desirable. Furthermore, hippocampal-dependent learning and
memory mechanisms may potentially contribute directly to control of
energy homeostasis by regulating hypothalamic function. In order to
elucidate the interplay between cognitive function and diabetes, more
studies of regulation of hippocampal function by metabolic hormones are
required.

You might also like