0% found this document useful (0 votes)
10 views8 pages

tmpCBB6 TMP

Water-deficiency effects on single leaf gas exchange and on C4 pathway enzymes of maize genotypes with differing abiotic stress tolerance. Responses studied using two maize inbred lines (B76 and B106) and a commercial maize hybrid (Zea mays L. Cv. Silver queen)

Uploaded by

Frontiers
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
10 views8 pages

tmpCBB6 TMP

Water-deficiency effects on single leaf gas exchange and on C4 pathway enzymes of maize genotypes with differing abiotic stress tolerance. Responses studied using two maize inbred lines (B76 and B106) and a commercial maize hybrid (Zea mays L. Cv. Silver queen)

Uploaded by

Frontiers
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

DOI: 10.

1007/s11099-015-0074-9

PHOTOSYNTHETICA 53 (1): 3-10, 2015

Water-deficiency effects on single leaf gas exchange and on C4 pathway


enzymes of maize genotypes with differing abiotic stress tolerance
R. SICHER*,+, J. BUNCE*, J. BARNABY*, and B. BAILEY**
Crop System and Global Change Laboratory, USDA-ARS, Building 001, Room 342, BARC-west,
10300 Baltimore Avenue, Beltsville, MD 20705 USA*
Sustainable Perennial Crops Laboratory, USDA-ARS, Building 001, Room 245, BARC-west,
10300 Baltimore Avenue, Beltsville, MD 20705 USA**

Abstract
Responses to drought were studied using two maize inbred lines (B76 and B106) and a commercial maize hybrid (Zea
mays L. cv. Silver Queen) with differing resistance to abiotic stress. Maize seedlings were grown in pots in controlled
environment chambers for 17 days and watering was withheld from one half the plants for an additional 11 days. On the
final treatment date, leaf water potentials did not differ among genotypes and were 0.84 and 1.49 MPa in the water
sufficient and insufficient treatments, respectively. Greater rates of CO2 assimilation were retained by the stress tolerant
maize inbred line, B76, in comparison to the other two genotypes 11 days after watering was withheld. Rates of CO2
assimilation for all three genotypes were unaffected by decreasing the measurement O2 concentration from 21 to 2%
(v/v). Activities of phosphoenolpyruvate carboxylase (PEPC), NADP-malic enzyme (NADP-ME), and NADP malate
dehydrogenase were inhibited from 25 to 49% by the water deficiency treatment. Genotypic differences also were
detected for the activities of NADP-ME and for PEPC. Changes of transcript abundance for the three C4 pathway
enzymes also varied among watering treatments and genotypes. However, examples where transcripts decreased due to
drought were associated with the two stress susceptible genotypes. The above results showed that enzymes in the C4
photosynthetic pathway were less inhibited by drought in stress tolerant compared to stress susceptible maize genotypes.
Additional key words: C4 photosynthesis; drought; enzyme activities; gene expression; phosphoenolpyruvate carboxylase.

Introduction
Maize is the third most important grain crop behind
wheat and rice and it is widely grown in many
agricultural areas of the world (Turrent and Serratos
2004, Campos et al. 2004). Maize is used as a human
staple, for animal feed, and for various industrial
applications, including the production of biofuels (Sicher
and Kim 2011). It is estimated that yields of the global
maize crop are diminished about 4% annually due to the
effects of excessive temperatures and drought (Lobell et
al. 2011). There is growing evidence that future climates
will be characterized by increased episodes of drought
and by abnormally high temperatures (Hatfield et al.
2008). Therefore, genotypic improvements of the maize
crop will be needed to insure high yields in future
environments. Chen et al. (2012) examined the responses
of several maize inbred lines to drought and demonstrated

that relative water content, as well as vegetative and


reproductive growth, was enhanced in drought tolerant
compared to susceptible lines. Many of the drought
tolerant inbred lines also demonstrated resistance to heat
stress. It occurred to us that these maize lines could
be useful tools for evaluating responses of maize to
water stress.
Maize is a C4 crop that possesses specialized anatomy
and a CO2 concentrating mechanism (Chollet and Ogren
1975). These two factors increase CO2 concentrations in
bundle sheath cells and this saturates rates of net
photosynthesis at ambient CO2 (Sage 2004). High rates of
photosynthesis have been also observed in C4 plants
when stomatal conductance was reduced by moderate
abiotic stress (Bunce 2004). Consequently, C4 plants
normally maintain greater water use efficiencies than

Received 17 December 2013, accepted 18 April 2014.


+Corresponding author; phone: 301-504-6632, fax: 301-504-5823, e-mail: [Link]@[Link]
Abbreviations: gs(21) stomatal conductance at 21% O2; gs(2) stomatal conductance at 2% O2; NADP-MDH NADP-dependent
malate dehydrogenase; NADP-ME NADP-dependent malic enzyme; PEPC phosphoenolpyruvate carboxylase; PN(21) net
photosynthetic rates at 21% O2; PN(2) net photosynthetic rates at 2% O2; w leaf water potential.
Acknowledgments: The authors thank R. Erdman and M. Strem for valuable technical assistance. Dr. V.R. Reddy contributed by
helpful advice on an early draft of this manuscript.

R. SICHER et al.

their C3 counterparts and this should confer an adaptive


advantage to C4 plants grown in climates with diminished
soil moisture. However, C4 grasses are underrepresented
in arid environments (Paruelo and Lauenroth 1996) and it
has been suggested that the CO2 concentrating mechanism is preferentially inhibited by moderate to severe
drought (Ripley et al. 2007). Evidence for the inhibition
of the C4 photosynthetic pathway in response to water
stress is primarily based on gas exchange and on
chlorophyll a fluorescence analyses. Therefore, a specific
enzyme step in the CO2 concentrating pathway that is
impaired by water stress has yet to be identified. An
inhibition of the CO2 concentrating mechanism by water

stress would eliminate the apparent advantage of plants


having the C4 compared to C3 photosynthetic pathway
and this could adversely impact the success of maize and
related C4 crop species in future environments.
In the current study, we hypothesized that the
inhibition of the CO2 concentrating mechanism by water
stress would be more evident in drought susceptible
compared to drought resistant maize genotypes. Our approach was to compare changes of gas exchange and C4
pathway enzyme activities in response to drought using
maize genotypes differing in abiotic stress tolerance.
Lastly, we monitored changes of transcript abundance of
specific C4 pathway enzymes in response to water stress.

Materials and methods


Plants: Maize (Zea mays L.) genotypes used in this study
consisted of two inbred lines, B76 (PI 550483) and B106
(PI 59404), that were developed at Iowa State University
to resist European corn borer (Russell and Hallauer
1974). Chen et al. (2007) reported that B76 was more
heat tolerant than B106, and that B76 was also drought
tolerant. Experiments here were also performed using a
locally grown maize hybrid, cv. Silver Queen, which was
not selected for altered stress tolerance. Seeds of B76
(stress resistant) and B106 (stress susceptible) were
obtained from the U.S. Department of Agricultures
Germplasm
Resources
Information
Network
([Link] and the Silver Queen variety
was purchased locally.
Experiments were conducted in indoor controlled
environment chambers (model M-18, Environmental
Growth Chambers Corp., Chagrin Falls, OH, USA)
essentially as described previously (Sicher and Barnaby
2012, Qu et al. 2014). Plants were grown from seed in
pots filled with vermiculite and were irrigated once daily
with a complete mineral nutrient solution (Robinson et al.
1984). The growth chambers were programmed to
provide a 14 h day/10 h night diurnal cycle, a constant
air temperature of 27 1C, an irradiance of 900 30
mol(photon) m2 s1 and a chamber air CO2 concentration of 380 10 mol mol1. Irradiance was provided
by a mixture of high pressure sodium and metal halide
lamps located above an acrylic plastic barrier and
chamber air CO2 concentrations were regulated with an
infrared gas analyzer and set-point controller. Relative
humidity was uncontrolled but was determined to be
60 10% during the daytime. Three maize genotypes
were grown simultaneously in each of two matching
growth chambers under well watered conditions. Drought
was imposed on all plants in one randomly chosen
chamber after the seedlings were 17 d old. Water-stress
treatments were obtained by completely withholding
watering for 11 d. All measurements reported in this
study were performed on the final treatment date.

Single leaf gas-exchange measurements: Steady-state


rates of net photosynthesis (PN) and stomatal conductance
(gs) of individual maize leaves were measured with a
portable infrared gas analyzer (Li-Cor model 6400, LiCor, Inc., Lincoln Nebraska) essentially as described
previously (Sicher and Barnaby 2012, Qu et al. 2014).
Measurements were performed between 3 and 6 h after
the start of the photoperiod. Conditions within the cuvette
were controlled by the system and leaf temperature,
humidity, light, and CO2 concentrations were set to match
conditions used for plant growth. Gas-exchange measurements were performed on the most recently collared leaf
and employed three to four plants in each treatment.
Rates of PN and gs were determined at both 21% and 2%
O2. These were the PN(21), PN(2), gs(21), and gs(2) measurements, respectively. Gas-exchange values were
computed by the instrument using formulas described by
Farquhar and von Caemmerer (1982). Values of leaf
water potential (w) were determined on the same leaves
used for gas-exchange determinations. Measurements
were performed on excised leaf discs (0.33 cm2) using a
model HR-33T dewpoint microvoltmeter (Wescor, Logan
UT, USA) and after a 1-h equilibration period.
Enzyme assays: Single leaf discs from each plant
(1.7 cm2) were extracted with 0.7 cm3 ice cold extraction
buffer consisting of 50 mM Tris-HCl (pH 7.5), 10 mM
MgCl2, 1 mM EDTA, 1% (w/v) polyvinyl pyrollidone-40
(soluble PVP), 5 mM Na+-pyruvate, and 10% glycerol.
Immediately prior to extraction, the solution was supplemented with 1 mM leupeptin and 5 mM with dithiothreitol. Pyruvate was added to the extraction medium to
stabilize enzyme activities. Leaf material was extracted at
0C using a ground glass tissue homogenizer and homogenates were transferred to 1.5 ml plastic centrifuge tubes
on ice. The samples were spun in a microcentrifuge
(Model 5415C, Brinkmann, Westbury, NY, USA) for
180 s at 14,000 g and 0.23 cm3 of each supernatant was
immediately transferred to a clean 0.5 cm3 centrifuge tube

WATER STRESS AND MAIZE PHOTOSYNTHESIS

and kept on ice. Enzyme activities were determined


spectrophotometrically (model UV2101PC, Shimadzu
Corp., Columbia, MD, USA) at 25C essentially as
described by Maroco et al. (1999). Briefly, NADP-malate
dehydrogenase (NADP-MDH, EC [Link]) was
measured in 1 cm3 solution containing 50 mM Tris-HCl
(pH 8.0), 1 mM EDTA, 100 mM oxaloacetic acid
(adjusted to pH 6.0), 10 mM NADPH, and 0.025 cm3 of
the leaf extract. PEPC (EC [Link]) was measured in
1 cm3 solution containing 50 mM Tris-HCl (pH 8.0),
5 mM NaHCO3, 5 mM MgCl2, 0.2 mM NADH, 2.5 mM
phosphoenolpyruvate (tricyclohexamine salt), 16.7 nkat
of MDH, and 0.025 cm3 of the sample. NADP-ME (EC
[Link]) was measured in 1 cm3 solution containing
50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 5 mM malic
acid, 5 mM dithioerythritol, 0.5 mM NADP+, and
0.025 cm3 sample. Reactions were initiated by adding
22.5 mM MgCl2. All measurements were performed
using a spectrophotometer (Model 2101, Shimadzu
Scientific Instruments, Columbia, MD, USA) operated in
the kinetic mode. Enzyme activities were calculated on a
leaf area basis from the rate of change in optical density
at 340 nm.
Quantitative transcript measurements: Maize leaf

sections [approximately 0.5 g of fresh mass (FM)] from


either side of the midrib of the most recently expanded
leaf were ground to a liquid N powder in a sterile mortar
and pestle, and total RNA was extracted using TRIzol
reagent according to the manufacturers instructions
(Invitrogen, Carlsbad, CA, USA). The amount of total
RNA in each sample was quantified with a NanoDrop
spectrophotometer (model 2000c, Thermo-Fisher Scientific Inc., Waltham, MA, USA). First strand cDNA
was synthesized with 2 g of total RNA (OD260/OD280 >
1.95), oligo(dT)20 primers, and SuperScript III RNase H
reverse transcriptase from Invitrogen. The resultant
cDNA was diluted 10-fold and was used as a template for
real-time quantitative polymerase chain reaction (QPCR).
Amplifications were performed with a model Mx3005P
QPCR System plus Brilliant SYBR Green QPCR
Master Mix (Stratagene, La Jolla, CA). Details of the
QPCR procedures were described previously (Bae et al.
2009). Primer sequences for maize transcripts encoding
PEPC, NADP-MDH, and NADP-ME are listed in Table
1. Assays were performed with four biological samples
from each treatment, and measurements were replicated
twice. The maize actin1 gene was used as an expression
control and real-time QPCR efficiencies were calculated
according to Pfaffl (2001).

Table 1. Primer sequences for Zea mays transcripts. PCR efficiencies are shown in parentheses.
Name

Sequence

PCR efficiency [%]

Product length [bp]

NADPME-F
NADPME-R
NADPMDH-F
NADPMDH-R
PEPC-F
PEPC-R
Actin1-F
Actin1-R

AGGCTCTCTTCAGCCATTCA
TAGGCCTCTCGTTGAAGGAA
GGGAAGTCAGCATTGGCATAG
CAACAACTAAGACTTTCGCGT
GAGATCCAAGCAGCCTTCAG
CCACCCATCCAAGAAGAGAA
CTATGTTCCCTGGATTGCT
GGGCCCAAAGAATTAGAAGC

106.4 (109.4)

173

107.4 (88.6)

192

90.9 (96.6)

215

(87.4)

Statistical comparisons: Results of two completely


replicated experiments were combined and significant
differences were determined using a two-way analysis of
variance procedure (ANOVA, StatView 5.0, Mountain
View, CA, USA). Leaf measurements were independent

variables and genotypes and drought treatments were


dependent variables. This study used three genotypes and
two CO2 treatments and had a 3 2 design. A Fishers
Protected Least Significant Differences (PLSD) test was
used to perform post hoc ANOVA comparisons.

Results
Leaf water potential (w) and single leaf gas exchange:
Measurements of w of three maize genotypes differing
in water-stress tolerance are shown in Fig. 1A. As shown
in Table 2, the w measurements reported here differed
among water stress treatments but were similar among
the three genotypes. Mean w averaged over all three
maize genotypes was 0.84 0.01 MPa, when the plants
were well watered, and was 1.49 0.05, when plants
were water-deficient for 11 d.
The inhibition of PN by drought was 56, 67, and 95%

for the B76, B106, and Silver Queen maize genotypes,


respectively, when measurements of PN were averaged
over both O2 concentrations (Fig. 1B,C). Measurements
of PN for all three genotypes did not differ among high
and low O2 concentrations, either when measured
separately or when combined over the control and
drought treatments. Measurements of PN differed among
genotypes and rates of PN(21) and PN(2) of inbred line B76
differed from those of cultivars B106 and Silver Queen.
Conversely, measurements of PN performed at 21% and

R. SICHER et al.

Fig. 1. Effects of water insufficiency on leaf


water potential (w), net photosynthetic rate
(PN), and stomatal conductance (gs) of three
maize genotypes differing in abiotic stress
tolerance. Measurements were performed on
leaves of water-sufficient (black columns) or
water-insufficient (white columns) maize,
i.e., the Silver Queen (SQ) hybrid, and two
maize inbred lines, B76 and B106. PN(2) and
PN(21) PN with 2 and 21% O2, respectively;
gs(2) and gs(21) gs with 2 and 21% O2,
respectively. Values are means SE, n = 8.
Table 2. ANOVA table showing calculated probabilities (P) for the responses of three maize genotypes exposed to water-sufficient and
water-insufficient treatments. PN net photosynthetic rate; gs stomatal conductance; w leaf water potential; PEPC
phosphoenolpyruvate carboxylase; NADP-MDH NADP-dependent malate dehydrogenase; NADP-ME NADP-dependent malic
enzyme; PN(2) and PN(21) PN with 2 and 21% O2, respectively; gs(2) and gs(21) gs with 2 and 21% O2, respectively.
Parameter

Genotype
P

Treatment

Interaction

Enzyme activity

PEPC
NADP-ME
NADP-MDH

0.01
0.98
0.01

0.01
0.01
0.01

0.17
0.03
0.37

Gene expression

PEPC
NADP-ME
NADP-MDH

0.01
0.01
0.01

0.66
0.17
0.01

0.01
0.01
0.47

0.35

0.01

0.46

w
PN

PN(21)
PN(2)

0.01
0.01

0.01
0.27

0.03
0.88

gs

gs(21)
gs(2)

0.01
0.01

0.01
0.01

0.27
0.24

2% O2 were similar for the two drought susceptible


cultivars (B106 and Silver Queen) based on a PLSD test.
Because rates of PN by inbred line B76 were less
susceptible to drought than the other two genotypes, a
significant genotype by treatment interaction was
detected for these measurements.
Measured values of gs were between 0.09 and
0.15 mmol m2 for all three genotypes in the well watered

treatment (Fig. 1D,E). Similar to findings for PN


discussed above, measurements of gs(21) and gs(2) differed
among genotypes and watering treatments but no
interactions were detected. Values of gs were not altered
when the O2 concentration was lowered from 21 to 2%
and gs decreased by 69, 72, and 93% for the B76, B106,
and Silver Queen genotypes, respectively, when averaged
across O2 concentrations. Again, the PLSD test indicated

WATER STRESS AND MAIZE PHOTOSYNTHESIS

that gs of the B76 cultivar differed from that of B106 and


Silver Queen, whereas gs of the latter two genotypes were
similar. Effects of water stress on gs and on evapotranspiration rates were similar in this study (data not shown).
C4 pathway enzymes: The activities of three C4 pathway
enzymes, NADP-MDH, NADP-ME, and PEPC, decreased
in response to water stress (Fig. 2). Measured PEPC
activity decreased 44, 46, and 50% in response to drought
treatment in the B106, B76, and Silver Queen genotypes,
respectively. Moreover, NADP-MDH activity decreased
44, 27, and 42%, and NADP-ME decreased 71, 38, and
38% in the same three genotypes in response to drought.
The 71% decrease in NADP-ME activity was the largest
change in enzyme activity measured in this study and it
was similar to the 67% mean decrease of PN determined
for this genotype. A genotype by treatment interaction

Fig. 3. Effects of water insufficiency on relative transcript


abundance of maize enzymes associated with the C4
photosynthetic pathway. Maize transcript abundance was
determined 11 d after water was withheld using quantitative
polymerase chain reaction (QPCR). The maize actin 1 gene
served as an expression control. Measurements were performed
on leaves of water-sufficient (black columns) or waterinsufficient (white columns) maize, i.e., the Silver Queen (SQ)
hybrid, and two maize inbred lines, B76 and B106. Columns
marked with ** differ at P0.01.

was detected for the NADP-ME measurements. Unlike


measurements of NADP-ME, activities of PEPC and
NADP-MDH were greater in Silver Queen than in the
other two genotypes. Therefore, genotypic differences
were observed for the latter two enzymes in this study.

Fig. 2. Effects of water insufficiency on the activities of maize


enzymes associated with the C4 photosynthetic pathway.
NADP-MDH NADP-dependent malate dehydrogenase;
NADP-ME NADP-dependent malic enzyme; PEPC
phosphoenolpyruvate carboxylase. Measurements were
performed on leaves of water-sufficient (black columns) or
water-insufficient (white columns) maize, i.e., the Silver Queen
(SQ) hybrid, and two maize inbred lines, B76 and B106.
Columns marked with * or ** differ at P0.05 and P0.01,
respectively.

Maize transcripts encoding C4 pathway enzymes:


Changes of maize leaf transcripts in response to drought
are shown in Fig. 3. Data are for the three C4 pathway
enzymes described above and expression ratios were
compared with that of the maize actin1 gene (Fig. 3).
Unlike the responses of maize enzyme activity measurements to water stress, the gene expression results in this
experiment varied among watering treatments and
genotypes. The expression of NADP-MDH increased in
response to water stress in both the Silver Queen hybrid
and the B106 inbred line. However, the expression of
NADP-MDH in the B76 inbred line was unaffected by
water stress. The expression of NADP-ME and of PEPC

R. SICHER et al.

decreased in the B106 and Silver Queen genotypes,


respectively, in the water insufficient compared to the
water sufficient treatments. Conversely, the expression of
NADP-ME and of PEPC was unchanged by water

deficiency in the Silver Queen hybrid and maize inbred


line B106, respectively. Therefore, a significant genotype
by treatment interaction was detected for the expression
of the latter two enzymes in maize leaves.

Discussion
Because water stress affects plant survival and decreases
crop yields, the physiological and molecular responses of
C3 and C4 plant species to drought have received
considerable research attention (Lawlor and Cornic 2002,
Flexas et al. 2004, Ghannoum 2009). One of the earliest
responses of plants to drought is stomatal closure, which
inhibits PN by restricting the movement of CO2 from the
atmosphere into the leaf. The stomatal inhibition of PN
can normally be quickly and fully reversed by rehydrating the plant or by exposing leaves to very high CO2
concentrations (Ludlow and Wilson 1971). Prolonged
drought also induces a nonstomatal inhibition of PN,
which is only partially reversed when water stress is
alleviated (Lawlor 2002). The nonstomatal inhibition of
PN is likely due to changes of metabolism, including
decreased enzyme activities and impaired membrane
integrity (Flexas et al. 2004). Drought-tolerant maize
genotypes utilize adaptive advantages to minimize the
nonstomatal inhibition of PN and they have a greater
capacity to recover from drought after rewatering when
compared to stress susceptible genotypes (HayanoKanashiro et al. 2009).
In the current study, we examined drought responses
of two maize inbred lines differing in water-stress
tolerance with a commercial maize hybrid. After water
was withheld for 11 d, rates of PN were inhibited 56, 67,
and 95% for the B76, B106, and Silver Queen genotypes,
respectively, in comparison to the well watered, control
plants. For these calculations, rates of PN were averaged
over the 21 and 2% O2 concentrations that were used for
gas-exchange measurements. Note that mean w of all
three genotypes was about 1.5 MPa in the water stressed
treatment and this did not differ among genotypes.
Therefore, differences in rates of PN among the three
genotypes used here were not attributable to differences
of w. Also, the finding that the inhibition of PN by water
stress was not alleviated when the O2 concentration
decreased from 20 to 2% was consistent with results of
Lawlor and Fock (1978).
Stomatal conductance was clearly greater in B76 than
in B106 or Silver Queen and this was true in both well
watered and dry treatments. Conversely, gs measurements
for the two stress susceptible genotypes were similar in
both the well watered and water-insufficient treatments.
There was a close correlation between PN and gs in this
study. Therefore, it is likely that stomatal closure and
differences of gs contributed to the variation in the
inhibition of PN among the three genotypes in this study.
Note that the least effect of water stress on PN and gs was

observed for the inbred line previously identified as heatand drought-tolerant.


Prior investigators reported effects of water stress on
various maize enzyme activities. Becker and Fock (1986)
observed that Rubisco, PEPC, and NADP-ME decreased
from 20 to 33% when the w was 1.17 MPa and results
were expressed on a leaf area basis. Foyer et al. (1998)
reported that PEPC activity per chlorophyll unit increased
slightly in maize leaves when the w was 1.2 MPa.
However, the latter findings may have been affected by
drought dependent changes of leaf chlorophyll concentrations. Saccardy et al. (1996) observed that PEPC and
NADP-ME activity on a leaf area basis were unchanged
when the relative water content of the leaf was 50% and
Du et al. (1996), working with sugarcane, reported that
Rubisco, PEPC, NADP-ME, and phosphopyruvate
dikinase activities decreased 50 to 89% on a leaf area
basis when w was 1.61 MPa. Results of the current
study were in broad agreement with Becker and Fock
(1986) and with Du et al. (1996) and showed that maize
leaf NADP-MDH, NADP-ME, and PEPC activities
decreased 38, 49, and 25%, respectively, on a leaf area
basis when averaged across genotypes. Taken together
with prior findings discussed above, the activities of C4
pathway enzymes decreased in response to moderate or
severe water stress and PEPC was generally less affected
by drought than the other enzymes in the cycle.
This study also identified genotypic differences in
maize leaf enzyme activities. In both the water sufficient
and water insufficient treatments, the Silver Queen hybrid
possessed greater activities of PEPC and NADP-MDH
than the two inbred lines. In contrast, no genotypic
differences were observed for NADP-ME activity in
maize leaves. Although the overall ANOVA test result
was significant, we could not find differences due to
water stress of NADP-MDH activity in leaves of the B76
and B106 genotypes when using a PLSD test. Therefore,
the effects of drought on enzyme activity measurements
varied among specific enzymes and among genotypes.
Unlike maize enzyme activities, seven of nine transcript measurements in this study were unchanged or
increased in response to drought treatment. This was clear
evidence that the mechanisms controlling gene expression were functioning at the stage of drought used in this
study. This also suggested that in seven of nine instances
the decreased enzyme activities reported above were not
due to insufficient transcript levels and were likely due to
changes at the protein level. The two transcripts that
decreased in response to water stress were associated

WATER STRESS AND MAIZE PHOTOSYNTHESIS

with the two drought susceptible genotypes, i.e., Silver


Queen and B106. In our earlier paper (Sicher and
Barnaby 2012), we reported that three maize genes,
IVR2, HSP82, and Dhn2, showed increased expression
during early drought but not during the later stages of
drought treatment. The observation that the same gene
was increased by drought in one maize genotype and
decreased in another is novel and merits further research.
It also would be valuable to repeat these experiments and
measure changes of gene expression as a function of time
of drought treatment.
The three enzymes measured in this study were all
partially inhibited by water insufficiency. However, the

percent inhibition of PN and gs due to drought generally


exceeded the inhibition of enzyme activity. The possible
exception to this conclusion was that the decreases of
NADP-ME activity and of PN in genotype B106 were
similar. Although changes of C4 pathway enzyme
activities in response to drought were capable of
contributing to the observed inhibition of PN, there was
insufficient evidence to suggest that the three enzymes
measured here were impacted enough by water stress to
shut down the entire C4 pathway. Taken together, the
above evidence suggested that the C4 photosynthetic
pathway was more affected by drought in stress
susceptible than stress tolerant maize genotypes.

References
Bae H., Sicher R., Natarajan S., Bailey B.: In situ expression of
trehalose synthesizing genes, TPS1 and TPPB, in Arabidopsis
thaliana using the GUS reporter gene. Plant Cell Tiss. Org.
98: 311-319, 2009.
Becker T.W., Fock H.P.: Effects of water stress on the gas
exchange, the activities of some enzymes of carbon and
nitrogen metabolism, and on the pool sizes of some organic
acids in maize leaves. Photosynth. Res. 8: 175-181, 1986.
Bunce J.A.: Carbon dioxide effects on stomatal responses to the
environment and water use by crops under field conditions.
Oecologia 140: 1-10, 2004.
Campos H., Cooper A., Hebben J.E. et al.: Improving drought
tolerance in maize: A view from industry. Field Crop. Res.
90: 19-34, 2004.
Chen J., Xu J., Velten J.P. et al.: Characterization of maize
inbred lines for drought and heat tolerance. J. Soil Water
Conserv. 67: 354-364, 2012.
Chollet R., Ogren W.: Regulation of photorespiration in C3 and
C4 species. Bot. Rev. 41: 137-179, 1975.
Du Y.C., Kawamitsu Y., Nose A. et al.: Effects of water stress
on carbon exchange rate and activities of photosynthetic
enzyme in leaves of sugarcane (Saccharum sp.). Aust. J.
Plant Physiol. 23: 719-726, 1996.
Farquhar G.D., von Caemmerer S.: Modelling of photosynthetic
response to environmental conditions. In: Lange O.L.,
Nobel P.S., Osmond C.B., Ziegler H. (ed.): Physiological
Plant Ecology II. Water Relations and Carbon Assimilation.
Pp 549-587. Springer-Verlag, Berlin 1982.
Foyer C.H., Valadier M.H., Migge A., Becker T.W.: Drought
induced effects on nitrate reductase activity and mRNA and
on the coordination of nitrogen and carbon metabolism in
maize leaves. Plant Physiol. 117: 283-292, 1998.
Flexas J., Bota J., Loreta F. et al.: Diffusive and metabolic
limitations to photosynthesis under drought and salinity in C3
plants. Plant Biol. 6: 269-279, 2004.
Ghannoum O.: C4 photosynthesis and water stress. Ann. [Link] 103: 635-644, 2009.
Hatfield J.L., Boote K.J., Hahn L. et al.: Agriculture. In: The
Effects of Climate Change on Agriculture, Land Resources,
Water Resources and Biodiversity. A Report by the U.S.
Climate Change Science Program and the Subcommittee on
Global Climate Change Research. Pp. 21-74. U.S. Department
of Agriculture, Washington, D.C. 2008.
Hayano-Kanashiro C., Caldern-Vazquez A., Ibarra-Laclette E.
et al.: Analysis of gene expression and physiological

responses in three Mexican maize landraces under drought


stress and recovery irrigation. PLOS One: 4: e7531, 2009.
Lawlor D.W.: Limitation to photosynthesis in water-stressed
leaves: Stomata vs. metabolism and the role of ATP. Ann.
Bot.-London 89: 871-885, 2002.
Lawlor D.W., Cornic G.: Photosynthetic carbon assimilation
and associated metabolism in relation to water deficits in
higher plants. Plant Cell Environ. 25: 275-294, 2002.
Lawlor D.W., Fock H.: Photosynthesis, respiration and carbon
assimilation in water-stressed maize at two oxygen
concentrations. J. Exp. Bot. 29: 579-593, 1978.
Lobell D.B., Schlenker W., Costa-Roberts J.: Climate trends
and global crop production since 1980. Science 333: 616620, 2011.
Ludlow M.M., Wilson G.L.: Photosynthesis of tropical pasture
plants. I. Illuminance, carbon dioxide concentration, leaf
temperature, and leaf-air vapour pressure difference. Aust.
J. Biol. Sci. 24: 449-470, 1971.
Maroco J.P., Edwards G.E., Ku M.S.B.: Photosynthetic
acclimation of maize to growth under elevated carbon
dioxide. Planta 210:115-125, 1999.
Paruelo J.M., Lauenroth W.K.: Relative abundance of plant
functional types in grasslands and shrublands of North
America. Ecol. Appl. 6: 1212-1224, 1996.
Pfaffl M.W.: A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29: e45,
2001.
Qu M., Bunce J.A., Shi Z.: Does elevated CO2 modify water
status and mitigate photosynthetic damage of juvenile maize
leaves caused by short-term heat stress? Photosynthetica 52:
211-216, 2014.
Ripley B.S., Gilbert M.E., Ibrahim D.G., Osborne C.P.: Drought
restraints on C4 photosynthesis: stomatal and metabolic
limitations in C3 and C4 subspecies of Allopteris semialata.
J. Exp. Bot. 58: 1351-1363, 2007.
Robinson J.M.: Photosynthetic carbon metabolism in leaves and
isolated chloroplasts from spinach plants grown under short
and intermediate photosynthetic periods. Plant Physiol. 75:
397-409, 1984.
Russell W.A., Hallauer A.R.: Registration of B76 and B77
parental lines of maize. Crop Sci. 14: 778, 1974.
Saccardy K., Cornic G., Brulfert J., Reyss A.: Effect of drought
stress on net CO2 uptake by Zea leaves. Planta 199: 589595, 1996.
Sage R.F.: The evolution of C-4 photosynthesis. New Phytol.

R. SICHER et al.
161: 341-370, 2004.
Sicher R.C., Barnaby J.Y.: Impact of carbon dioxide enrichment
on responses of maize leaf transcripts and metabolites to
water stress. Physiol. Plantarum 144: 238-253, 2012.
Sicher R.C., Kim S.H.: Photosynthesis, growth and maize yield
in the context of global change. In: Prioul J.L., Thvenot C.,
Molnar T. (ed.): Advances in Maize, Essential Reviews in

10

Experimental Biology, Vol. 3. Pp. 379-392. Society for


Experimental Biology, London. 2011.
Turrent A., Serratos J.A. Context and background on maize and
its wild relatives in Mexico. In: Maize and Biodiversity: The
effects of transgenic maize in Mexico. Pp. 1-36, Council for
Environmental Cooperation [[Link]/files/PDF// Maizeand-Biodiversity_en.pdf]. 2004.

You might also like