Reference Gene Selection and Validation for the Early
Responses to Downy Mildew Infection in Susceptible and
Resistant Vitis vinifera Cultivars
Filipa Monteiro*, Monica Sebastiana, Maria Salome Pais, Andreia Figueiredo*
Plant Systems Biology Lab, Center of Biodiversity, Functional & Integrative Genomics (BioFIG), Science Faculty of Lisbon University, Lisboa, Portugal
Abstract
The pivotal role of cultivated grapevine (Vitis vinifera L.) in many countries economy is compromised by its high
susceptibility to Plasmopara viticola, the causal agent of downy mildew disease. Recent research has identified a set of
genes related to resistance which may be used to track downy mildew infection. Quantification of the expression of these
resistance genes requires normalizing qPCR data using reference genes with stable expression in the system studied. In this
study, a set of eleven genes (VATP16, 60 S, UQCC, SMD3, EF1a, UBQ, SAND, GAPDH, ACT, PsaB, PTB2) was evaluated to identify
reference genes during the first hours of interaction (6, 12, 18 and 24 hpi) between two V. vinifera genotypes and P. viticola.
Two analyses were used for the selection of reference genes: direct comparison of susceptible, Trincadeira, and resistant,
Regent, V. vinifera cultivars at 0 h, 6, 12, 18 and 24 hours post inoculation with P. viticola (genotype effect); and comparison
of each genotype with mock inoculated samples during inoculation time-course (biotic stress effect). Three statistical
methods were used, GeNorm, NormFinder, and BestKeeper, allowing to identify UBQ, EF1a and GAPDH as the most stable
genes for the genotype effect. For the biotic stress effect, EF1a, SAND and SMD3 were the most constant for the susceptible
cultivar Trincadeira and EF1a, GAPDH, UBQ for the resistant cultivar Regent. In addition, the expression of three defenserelated transcripts, encoding for subtilisin-like protein, CYP and PR10, was analysed, for both datasets, during inoculation
time-course. Taken together, our results provide guidelines for reference gene(s) selection towards a more accurate and
widespread use of qPCR to study the first hours of interaction between different grapevine cultivars and P. viticola.
Citation: Monteiro F, Sebastiana M, Pais MS, Figueiredo A (2013) Reference Gene Selection and Validation for the Early Responses to Downy Mildew Infection in
Susceptible and Resistant Vitis vinifera Cultivars. PLoS ONE 8(9): e72998. doi:10.1371/[Link].0072998
Editor: Boris Alexander Vinatzer, Virginia Tech, United States of America
Received March 9, 2013; Accepted July 16, 2013; Published September 4, 2013
Copyright: 2013 Monteiro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by the Portuguese Foundation for Science and Technology within the frame of the project PTDC/AGR-GPC/119753/2010, with
the fellowship SFRH/BPD/25661/2005 to MS and SFRH/BPD/63641/2009 to AF and BIOFIG PEst-OE/BIA/UI4046/2011. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: aafigueiredo@[Link] (AF); fimonteiro@[Link] (FM)
ization of raw expression data, allowing the correction for variable
starting amounts of RNA and for differences in reverse transcription (RT) efficiency, since reference genes are exposed to the same
preparation steps as the genes of interest (GOI) [19,2123].
Reference genes must be validated for each experimental
condition [24] and the geometrical averaging of multiple internal
control genes should be used [25]. For grapevine, validation of
reference genes has been reported for berry development [26],
abiotic stress [27] and biotic stress [28,29]. For grapevine-downy
mildew pathosystem, reference genes have been validated for
susceptible V. vinifera cultivars from 1 to 7 days post- inoculation
with P. viticola, being V-type proton ATPase (VATP16), 60 S
ribosomal protein L18 (60 S), ubiquitin conjugating enzyme (UBQ)
and SAND family protein (SAND) reported as the most stable
[28,29]. For the first hours of interaction between grapevine and P.
viticola no reference genes have yet been validated. In this study, we
have tested 11 candidate genes for qPCR normalization of gene
expression during the first hours of interaction (0 h, 6, 12, 18 and
24 hpi) with P. viticola. Two grapevine cultivars with different
degrees of resistance towards P. viticola were used. Data was
analysed to study genotype and biotic stress effects. The best
combination of reference genes for each data set was used to assess
the expression of three GOIs, pathogenesis-related protein 10,
Introduction
Traditional premium cultivars of wine and table grapes are
highly susceptible to various diseases, particularly to downy
mildew. Grapevine downy mildew is caused by the biotrophic
oomycete Plasmopara viticola (Berk. et Curt.) Berl. et de Toni. In
Europe, disease management became one of the main tasks for
viticulture, being the current strategy for downy mildew disease
control the massive use of pesticides in each growing season. The
introgression of specific genetic traits, such as resistance to
pathogens in traditional crops by breeding programs is one of
the most promising methods to reduce such disease control
measures. The study of this pathosystem has been of great interest
and knowledge on resistance genes linked to downy mildew have
been inferred from several approaches, such as from transcriptional analysis [17] to quantitative trait loci (QTL) and linkage
map analysis [814], to loci linked to resistance [3,1517].
Quantitative real time polymerase chain reaction (qPCR) is
currently the most sensitive technique for gene expression analysis
due to its reproducibility and sensitivity [1820]. However, qPCR
is influenced by a number of variables that strongly interfere with
its accuracy and reliability [2022]. qPCR studies require one or
more reference genes (RG) as internal controls for the standardPLOS ONE | [Link]
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
[28]; Elongation factor 1a (EF1a) from Trouvelot et al. [34],
Ubiquitin-conjugating enzyme (UBQ) and SAND family protein
(SAND) from Reid et al. [26], glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from Selim et al. [29] and Actin (ACT) from
Figueiredo et al. [2]. The other two gene homologous to Arabidopis
polypyrimidine tract-binding protein 1 (AT3g01150) and D1
subunit of photosystem I and II reaction centers (ATCg00340)
[33], were retrieved from the grapevine TIGR database v. 8 as
PTB2 protein (TC109121) and PsaB (TC134081), respectively.
Grapevine specific primers were designed with Primer Express
software version 3.0 (Applied Biosystems, Sourceforge, USA) using
the following parameters: amplicon length between 75 and
250 bp; size: 2062 bp; melting temperature (Tm): 6062 uC;
GC content: 650%.
subtilisin-like protease and cyclophilin, known to be induced
during downy mildew inoculation [2].
Materials and Methods
Plant Material, Experimental Design and Plasmopora
viticola Inoculation
The grapevine cultivar Regent was selected at the JKI-Institute
for Grapevine Breeding Geilweilerhof. It was bred by multiple
introgressions from resistant wild genotypes [30], presenting a high
degree of resistance to both downy and powdery mildew [31].
Trincadeira is a Portuguese traditional grapevine cultivar widely
used for quality wine production and highly sensitive to Plasmopara
viticola [1]. Both cultivars were propagated under identical
greenhouse conditions according to Figueiredo et al. [2]. Briefly,
wood cuttings from both grapevine genotypes were harvested at
Quinta da Plansel (Montemor-o-Novo, Portugal) and sent to the
JKI Institute for Grapevine Breeding (Geilweilerhof, Germany).
Wood cuttings were grown in 12 cm diameter pots in Fruhstorfer
Erde (soil) Type P at natural day/night rhythm in a temperature
range between 5uC and 28uC for 10 weeks. For plant inoculation,
P. viticola sporangia were collected after an overnight incubation of
symptomatic leaves from greenhouse infected plants in a moist
chamber at room temperature. Sporangia were carefully recovered by brushing, dried, stored at 225uC and checked for their
vitality by microscopy as described in Kortekamp et al. [3]. A
suspension containing 104 sporangia ml21 was used to spray the
abaxial leaf surface in order to challenge the plants. Mock
inoculations with water were also made. After inoculation, plants
were kept in a moist chamber (100% humidity) required for
optimal infection for 8 h and then under greenhouse conditions at
25uC during the inoculation time course. The third to fifth fully
expanded leaves beneath the shoot apex were harvested at 0 h, 6,
12, 18 and 24 hpi, immediately frozen in liquid nitrogen and
stored at 280uC. For each genotype, each biological replicate
comprehends a pool of three leaves from three different plants.
Three independent biological replicates were collected for each
cultivar and condition (inoculated and mock inoculated).
Quantitative Real time PCR
Quantitative RT-PCR (qPCR) experiments were carried out
using MaximaTM SYBR Green qPCR Master Mix (26) kit
(Fermentas, Ontario, Canada) in a StepOneTM Real-Time PCR
system (Applied Biosystems, Sourceforge, USA). A final concentration of 2.5 mM MgCl2 and 0.2 mM of each primer were used in
25 mL volume reactions, together with cDNA as template. The
amplification efficiency of each candidate/target gene was
determined using a pool representing all cDNA samples. The
pool was used to generate a five-point standard curve based on a
ten-fold dilution series. Each standard curve was amplified in two
independent qPCR runs and each dilution was run in triplicate.
Amplification efficiency (E) was calculated from the slope of the
standard curve (E = 10(21/a)) where a is the slope of the linear
regression model (y = a log(x)+ b) fitted over log-transformed data
of the input cDNA concentration (y) plotted against quantification
cycle (Cq) values (x).
To investigate candidate reference gene stability, cDNA samples
were 10-fold diluted. Thermal cycling for all genes started with a
denaturation step at 95uC for 10 min followed by 45 cycles of
denaturation at 95uC for 15 s and annealing temperatures
(Table 1) for 30 s. Each set of reactions included no template
control. Dissociation curves and agarose gel electrophoresis were
used to analyze non-specific PCR products. Three biological
replicates were used for each sample and the experiments were
done twice (two technical replicates).
RNA Extraction and cDNA Synthesis
Total RNA was isolated from leaves with the SpectrumTM Plant
Total RNA Kit (Sigma-Aldrich, USA) according to the manufacturers instructions. Residual genomic DNA was digested with
DNase I (On-Column DNase I Digestion Set, Sigma-Aldrich,
USA). RNA purity and concentration were measured at 260/
280 nm using a spectrophotometer (NanoDrop-1000, Thermo
Scientific) while RNA integrity was verified by agarose gel
electrophoresis. Genomic DNA (gDNA) contamination was
checked by qPCR analysis of a target on the crude RNA [32].
Complementary DNA (cDNA) was synthesized from 2.5 mg of
total RNA using RevertAidHH Minus Reverse Transcriptase
(Fermentas, Ontario, Canada) anchored with Oligo(dT)18 primer
(Fermentas, Ontario, Canada), according to manufacturers
instructions.
Determination of Reference Gene Expression Stability
using GeNorm, NormFinder and BestKeeper
Data analysis was performed in two groups: biotic stress effect
and genotype effect. With the biotic stress dataset, gene stability
was evaluated by comparing each genotype with mock inoculated
control samples at 6, 12, 18 and 24 hpi. With the genotype
dataset, gene stability was evaluated when comparing directly the
resistant cultivar Regent and the susceptible Trincadeira at 0 h, 6,
12, 18 and 24 hpi.
The stability of candidate reference genes for the different
comparison groups was evaluated with BestKeeper [35], GeNorm
v. 3.5 [25] and NormFinder [36] tools.
The GeNorm is based on the pairwise variation of a single
reference candidate gene relative to all other genes. The main
assumption of this approach relies on the expression ratio of the
two ideal reference genes being identical in all samples regardless
of the conditions tested. GeNorm calculates a gene expression
stability measure (M) based on the average pairwise (V) expression
ratio between a gene and each of the other genes being compared.
Moreover, it performs a stepwise exclusion of the least stable gene
and recalculates M until only the two most stably expressed genes
are left. A pairwise variation value (V) with a cut-off of 0.15 as
Candidate Gene: Selection and Primer Design
Eleven candidate genes were selected based on previous studies
in Arabidopsis [33] and grapevine [2,26,28,29,33,34]. Nine of these
genes were formerly described as reference genes for grapevine
downy mildew pathosystem in later inoculation time-points (17
days post-inoculation): V-type proton ATPase 16 kDa proteolipid
subunit (VATP16), 60 S ribosomal protein L18 (60 S), Ubiquinolcytochrome c reductase complex chaperone (UQCC), Small
nuclear ribonucleoprotein SMD3 (SMD3) from Gamm et al.
PLOS ONE | [Link]
September 2013 | Volume 8 | Issue 9 | e72998
PLOS ONE | [Link]
Translation
protein degradation.
EF1a (EC959059)
UBQ (EC922622)
Cytoskeletal structural protein
Actin (TC81781**)
Defense
Defense/signalling
Subtilisin (HS977208)
Cyclophilin (CF609761)
R: TTCGCCACCAGTACCGTTTC
F: GCCTCTGCACTACAAGGGATCT
R: TACCTTTCCTTCCACCTTCAACA
F: GTGCTCCAGAGGGACTCGATAT
R:TGGTGTGGTACTTGCTGGTGTT
F: GTTTTGACTGACGGCGTTGA
R: TCCGGAAGTCCACAGAAAAAT
F: GGACCCCACTACTCGTCGTATT
R: GACCCCCTCCTACTAAAACT
F: ATTCCTCACCATCATCAGCA
R: CCAACAACGAACATAGGAGCA
F: TCAAGGTCAAGGACTCTAACACC
R: GCATTTGATCCACTTGCAGATAAG
F: CAACATCCTTTACCCATTGACAGA
R: GCCCTGCACTTACCATCTTTAAG
F: GAGGGTCGTCAGGATTTGGA
R: ACCAAAATATCCGGAGTAAAAGA
F: GAACTGGGTGCTTGATAGGC
R: GGAAGCAGTTTGTAGCATCAG
F: GCTCTGTTGTTGAAGATGGG
SD, standard deviation. * NCBI accession number or TC TIGR number. ** According to Polesani et al. (2010).
doi:10.1371/[Link].0072998.t001
Defense
PR10 (HS075818)
Target genes
(TC134081)
Similar to ATCg00340, involved in
chlorophyll binding
Glycolysis. gluconeogenesis
GAPDH (EF192466)
PsaB
unknown
SAND (CF405409)
post-translational modification
Pre-mRNA splicing
SMD3 (AM435088.2)
R: CAATCTTGTCCTCCTTTCCT
F: ATCTACCTCAAGCTCCTAGTC
structural constituent of ribosome/translation
F: CGATCCATAACTCGTGCCAAA
60 S (XM_002270599.1)
Similar to AT3g01150, involved in RNA binding,
nucleic acid and nucleotide binding
PTB2
F: CAAAGTATGAGGGTATCCGA
R: GTATTGCCCAAATTCAACACC
R: TGAACCCACCATGAACAACAA
unknown
UQCC (XM_002264785.1)
R: CCATAACAACTGGTACAATCGAC
F: CTTCTCCTGTATGGGAGCTG
Primer sequence
(TC109121)
Transport
Predicted function
VATP16 (XM_002269086.1)
Reference genes
Gene (Accession
Number)*
96
100
99
148
89
226
76
75
164
156
165
113
250
112
Amplicon
length (bp)
Table 1. Candidate reference genes and target genes primer sequences, amplicon length and qPCR analysis.
56
58
62
60
55
60
60
60
60
60
60
60
60
60
Ta (6C)
82.34
76.86
79.72
77.06
77.44
81.13
78.78
78.78
79.8
80.35
79.41
78.79
77.76
82.62
Tm (6C)
Regression
Coefficient (R2)
1.997/99.74
1.967/96.67
1.903/90.31
1.907/90.69
1.950/94.97
1.936/93.47
1.932/93.18
1.965/96.48
1.992/99.20
1.969/96.94
1.932/93.18
0.991
0.997
0.998
0.998
0.996
0.993
0.996
0.994
0.994
0.994
0.998
Discarded (low abundance transcript)
Discarded (unspecific amplification)
PCR efficiency
(E/%)
15.8661.76
18.6362.71
15.0761.38
16.1462.71
21.3461.30
17.1261.51
23.861.33
18.9561.19
17.3761.18
22.3561.13
20.2061.62
Average Cq
( SD)
Reference Genes in Grapevine-Downy Mildew System
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
Figure 1. Agarose gel (3%) electrophoresis showing amplicon size for eleven candidate reference genes. M- OGeneRulerTM 1 kb DNA
Ladder Plus (Fermentas), 1- UBQ, 2- SAND, 3- ACT, 4- NTC VATP16, 5- VATP16, 6- PTB2, 7- PSAB, 8- SMD3, 9- EF1a, 1060 S, 11- GAPDH, 12- NTC UQCC,
13- UQCC.
doi:10.1371/[Link].0072998.g001
(Table 1) was further analysed in both datasets (genotype and
biotic stress). Also, data described by Figueiredo et al. [2] on PR10,
CYP and Subtilisin expression at 6 and 12 hpi, allowed to validate
the selected RGs for the genotype effect dataset.
Statistical significance (p,0.05) between the two normalization
strategies was determined by the Mann-Whitney U test using
IBMH SPSSH Statistics version 20.0 (SPSS Inc., USA) software.
threshold is used to select the optimal number of RGs. After,
GeNorm estimates the normalization factor (NFn) using the
geometric mean of expression levels of n best reference genes
[25]. NormFinder is based on a variance estimation approach,
which calculates an expression stability value (SV) for each gene
analysed. It enables estimation of the overall variation of the
reference genes, taking into account intra and intergroup
variations of the sample set. According to this algorithm, genes
with lowest SV will be top ranked. BestKeeper tool calculates
standard deviation (SD) and the coefficient of variation (CV) based
on Cq values of all candidate reference genes [35]. The program
compares each reference gene to the BestKeeper Index (BKI) and
calculates a Pearsons correlation coefficient (r) and p-value.
Higher correlation coefficients suggest more stable expression.
Genes with SD less than 1 and with the highest coefficient of
correlation r have the highest stability.
A comprehensive ranking considering the 3 algorithms was
established by calculating the arithmetic mean ranking value of
each RG genes [37]. Each gene was ranked from 1 (most stable) to
8 (least stable) (Table S1).
Results
Selection of Candidate Reference Genes and
Amplification Specificity
Nowadays, data normalization using a set of reference genes is
considered to be the gold standard method for accurate
measurement of qPCR expression levels of target transcripts
[41]. RNA quality is one of the crucial parameters that must be
addressed in a gene expression profiling experiment [42]. In the
present study, all samples were analysed spectrophotometrically
and in agarose gels showing absorbance ratios at 260/280 and
260/230 nm above 1.8, well-defined bands corresponding to the
rRNA and absence of nucleic acid degradation. To confirm the
absence of contaminating gDNA, positive and no RT controls
were used for each candidate gene amplification. DNase treatment
(On-Column DNase I Digestion, Sigma-Aldrich) was followed by a
careful check for the absence of gDNA through qPCR analysis of a
target on the crude RNA [32].
In qPCR, when using a SYBR Green approach, amplification
specificity of several genes should be supported by both melting
curve and gel electrophoresis [20]. In our samples, single PCR
amplification products with the expected size for each gene were
found (Fig. 1). Melting curves of the genes tested were analysed to
detect the absence/presence of primer dimer or non-specific PCR
products (Fig. S1). For VATP16 and UQCC, melting curves profiles
revealed non-specific amplification and primer dimer formation
on the amplicon region (Fig. S1). Primers targeting PTB2PTB2
revealed high Cq values characteristic of low abundance
transcript, particularly on inoculated samples of both grapevine
genotypes. Thus, VATP16, UQCC and PTB2PTB2 were excluded
from analysis (Table 1). For all remaining genes, no-template
controls (NTCs) had no Cq values or the Cq values ranged
between 29 and 34 Cq. Since no amplicon peak was obtained
from melting curve analysis, the Cq values observed on NTCs
were attributed to primer dimer formation/hairpins, and thus
disregarded (Fig. S1).
PCR efficiency of each primer pair was calculated through the
standard curve method using the pool of all cDNA samples in a
ten-fold serial dilution. The amplification efficiency (E) of the
reactions ranged from 1.907 (90.69%) to 1.992 (99.20%), with
Data Analysis and Normalization of PR10, Subtilisin and
CYP
Reference gene selection was performed with the three
statistical algorithms (GeNorm, NormFinder and Bestkeeper). Cq
values from each candidate RG were log-transformed for GeNorm
v. 3.5 and NormFinder analysis, while raw Cq values were used for
Bestkeeper. After selecting RGs, two normalization strategies were
tested: (1) using the 3 top genes given by a comprehensive ranking
based on the three methods (GeNorm, NormFinder and BestKeeper); and (2) using the optimal number of RGs based on
GeNorm pairwise variation value (the 0.15 cut-off value was
followed).
For normalization, Cq values were converted into relative
quantities (RQ) by the delta-Ct method [38], incorporating the
calculated amplification efficiency (E) for each primer pair [39].
The formula RQ = EDCq, being the DCt calculated as Ct from
control samples minus Ct of treated samples was used for both RG
and GOI calculations. A normalization factor calculated as the
geometric mean of the relative expression of the RGs selected for
each normalization strategy was used to obtain the normalized
relative quantities (NRQ) [40]. Finally, to obtain GOIs fold
expression, the ratio between the RQ values of each gene of
interest with NRQ for each normalization strategy was performed.
The expression of three defense-related genes encoding for a
pathogenesis related protein 10 (PR10, HS075818), a subtilisin-like
protease (subtilisin, HS977208) and cyclophilin (CYP, CF609761)
PLOS ONE | [Link]
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
correlation coefficients R2 varying from 0.993 to 0.998 (Table 1).
To account that any variation between biological replicates was
not due to the treatments but intrinsic to the gene itself, data from
the biological replicates were analysed separately by statistical
algorithms [43,44]. The expression stability of the remaining eight
candidate genes was evaluated by three different statistical applets:
GeNorm, NormFinder and BestKeeper. The analysis was
performed for two comparison groups considering genotype and
biotic stress effects.
Table 3. Candidate reference genes for Biotic Stress effect in
V. vinifera cv Regent calculated by the GeNorm, NormFinder
and BestKeeper.
Candidate
genes
Regent
GeNorm
NormFinder
BestKeeper
SV
SD
Biotic Stress Effect
EF1a
0.920 (1)
0.812 (3)
0.87 (2)
0.91*
To study the biotic stress effect: each cultivar inoculated with P.
viticola was compared to a control sample (mock inoculated) at each
inoculation time-point (6, 12, 18 and 24 hpi). For V. vinifera cv.
Trincadeira inoculated with downy mildew, GeNorm ranked
SAND and EF1a (M = 0.881, Table 2) as the most stable genes.
NormFinder selected SMD3 (SV = 0.454) as the most stable gene
followed by EF1a and SAND (SV = 0.722 and SV = 0.727,
respectively). Likewise, SMD3 (SD = 0.66, r = 0.76, Table 2) was
identified as the most suitable gene for qPCR normalization by
BestKeeper analysis, while EF1 a (SD = 0.86, r = 0.87) and SAND
(SD = 0.92, r = 0.74) were ranked in the third and fifth positions,
respectively. Overall, EF1a, SAND and SMD3 were the most stable
set of genes for V. vinifera cv Trincadeira.
For V. vinifera cv Regent, UBQ and EF1a (M = 0.920, Table 3)
appeared as the most stable genes considering GeNorm analysis.
BestKeeper selected, GAPDH (SD = 0.66, r = 0.82) as the most
stable gene, followed by EF1a and UBQ (SD = 0.87 and SD 0.92,
respectively). Interestingly, GAPDH was also found to be the most
stable gene with NormFinder analysis. EF1a appeared in the third
position after SMD3 (Table 3), while UBQ was set in the fourth/
fifth position together with ACT (SV = 0.869). Considering the
three algorithms, EF1a, GAPDH and UBQ were selected as the
most suitable RGs for V. vinifera cv Regent.
UBQ
0.920 (2)
0.869 (4/5)
0.92 (3)
0.73*
SMD3
1.057 (3)
0.731 (2)
0.53(4)
0.50
GAPDH
1.153 (4)
0.579 (1)
0.66 (1)
0.82*
ACT
1.184 (5)
0.869 (4/5)
1.01 (6)
0.66*
SAND
1.260 (6)
1.476 (6)
1.13 (8)
0.76*
60 S
1.413 (7)
1.509 (7)
1.03 (7)
0.23
PsaB
1.711 (8)
2.529 (8)
0.87 (5)
0.36
SV. stability value; SD, standard deviation of Cq value; r. Pearson coefficient of
correlation;
*p#0.001. p- value associated with the Pearson coefficient of correlation.
Ranking order is presented in parenthesis.
doi:10.1371/[Link].0072998.t003
BestKeeper analysis ranked UBQ as the most stable gene
(SD = 0.77), followed by GAPDH (SD = 0.59) and EF1a
(SD = 0.93). ACT was excluded due to a low Pearson correlation
(r = 0.56, p.0.001, Table S3). The candidate genes SAND, 60 S,
and PsaB presented SD values higher than 1 (Table 4) and
therefore were considered unstable. NormFinder ranked UBQ
(SV = 0.581) as the most stable gene, while GAPDH (SV = 0.668)
and EF1a (SV = 0.775) were placed on the second and fourth
position, respectively. All three statistical algorithms pointed UBQ
as the best reference gene for normalizing qPCR genotype data
(Table 4).
Genotype Effect
In order to evaluate the genotype effect on RG stability both
cultivars were directly compared prior (0 h) and after inoculation
with P. viticola (6, 12, 18 and 24 hpi). GeNorm selected, EF1a and
UBQ (M = 0.775) as the two most stable genes (Table 4). The
Table 2. Candidate reference genes for Biotic Stress effect in
V. vinifera cv Trincadeira calculated by the GeNorm,
NormFinder and BestKeeper.
Table 4. Candidate reference genes for Genotype effect as
calculated by the GeNorm, NormFinder and BestKeeper
programs.
Candidate genes Trincadeira
Candidate Genes
GeNorm
NormFinder BestKeeper
SV
SD
SAND
0.881 (1/2)
0.727 (3)
0.92 (5)
0.74*
EF1a
0.881(1/2)
0.722 (2)
0.86 (3)
0.87*
SMD3
0.975 (3)
0.454 (1)
0.66 (1)
0.76*
ACT
1.038 (4)
0.849 (5)
0.92 (4)
0.75*
UBQ
1.088 (5)
1.231 (6)
1.00 (6)
0.58*
GAPDH
1.158 (6)
0.813 (4)
0.84 (2)
0.81*
60 S
1.305 (7)
1.511 (7)
1.09 (8)
0.25*
PsaB
1.470 (8)
1.799 (8)
1.41 (7)
0.74*
NormFinder
BestKeeper
SV
SD
UBQ
0.775 (1/2)
0.581 (1)
0.77 (1)
0.90*
EF1a
0.775 (1/2)
0.775 (4)
0.93 (3)
0.88*
SAND
0.939 (3)
1.023 (5)
1.19 (8)
0.85*
SMD3
1.077 (4)
0.669 (3)
0.66 (4)
0.56
GAPDH
1.118 (5)
0.668 (2)
0.59 (2)
0.74*
ACT
1.156 (6)
0.869 (5)
0.85 (5)
0.56
60 S
1.292 (7)
1.617 (7)
1.03 (6)
0.90*
PsaB
1.525 (8)
2.144 (8)
1.11 (7)
0.57
SV, stability value; SD, standard deviation of Cq value; r, Pearson coefficient of
correlation;
*p#0.001. p,value associated with the Pearson coefficient of correlation.
Ranking order is presented in parenthesis.
doi:10.1371/[Link].0072998.t004
SV. stability value; SD, standard deviation of Cq value; r. Pearson coefficient of
correlation; * p#0.001. p-value associated with the Pearson coefficient of
correlation. Ranking order is presented in parenthesis.
doi:10.1371/[Link].0072998.t002
PLOS ONE | [Link]
GeNorm
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
again. Subtilisin was upregulated in both genotypes, showing the
greater fold change in Regent at 6 hpi and in Trincadeira at
24 hpi. PR10 was equally over-expressed in both genotypes during
downy mildew infection time-course.
Genotype effect. UBQ, EF1a and GAPDH were selected as
RGs from a combined analysis using GeNorm, NormFinder and
BestKeeper. The GeNorm pairwise analysis (Fig. 2) selected UBQ,
EF1a, SAND, SMD3, GAPDH and ACT for normalization (Table 4).
Overall, the CYP, subtilisin and PR10 expression profile was similar
with the two normalization strategies tested, with the exception of
CYP at 0 h (Fig. 4). In the resistant cultivar there is an upregulation
of the expression of the three GOIs after P. viticola inoculation,
when compared to Trincadeira (Fig. 4). Interestingly, subtilisin is
constitutively more expressed in Regent than in Trincadeira (0 h,
Fig.4).
Determination of the Optimal Number of Reference
Genes for Normalization by GeNorm
It was suggested that normalization using multiple reference
genes gives more accurate results [32]. The GeNorm V value
determines the optimal number of RGs to be used, following a
0.15 cut-off value below which the inclusion of an additional
reference gene is not required [32].
The V values were determined for the experimental datasets:
biotic stress effect (TmTi: comparison between Trincadeira mock
and inoculated samples; RmRi: comparison between Regent mock
and inoculated samples) and genotype effect (Fig. 2). The optimal
number of reference genes to be used for normalization differed
between the analysed datasets. Considering biotic stress, for
Trincadeira, the V did not reach the cut-off value (TmTi, Fig. 2),
being five genes (V = 0.178) necessary for an accurate normalization, for Regent (RmRi, Fig. 2) four genes are necessary for qPCR
normalization (V4/5 and V5/6 = 0.199). Considering the genotype effect, six genes (V6/7 = 0.134) (Fig. 2) should be used to
accomplish an accurate qPCR normalization.
Discussion
Normalization is one of the key factors affecting the accuracy
and reliability of quantitative gene expression analysis. Here, we
describe an assessment of eleven reference genes for their use as
internal controls in gene expression studies for the first hours of
interaction between grapevine and Plasmopara viticola. Two datasets
were used representing two different experimental designs: the first
dataset compares each genotype with control samples (mock
inoculated) during inoculation time-course (biotic stress effect),
while the second dataset compares directly a resistant and a
susceptible cultivar prior and after P. viticola inoculation evaluating
the genotype effect on plant defence response.
Studies using a combination of GeNorm, BestKeeper, and
NormFinder for selecting reference genes have described minor to
substantial discrepancies in the results of the three programs,
which may be easily explained by the different mathematical
models associated with each approach [26,45]. In our study, no
substantial differences were obtained in the ranking of candidate
reference genes when using the three statistical algorithms. A
comprehensive ranking considering the three algorithms was
performed and results revealed to be consistent with those of
GeNorm analysis, only differing on the ranking orders of the most
stable genes (Table S1). Some of the candidates were repeatedly
ranked in the last positions, regardless the dataset under analysis:
PsaB and 60 S. PsaB, is the Vitis homolog of the Arabidopsis
ATCg00340 locus, which was previously reported as a potential
PR10, CYP and Subtilisin Expression
Two normalization strategies were followed to determine the
expression of 3 defense-related genes (PR10, CYP and subtilisin): (1)
using the 3 top RGs given by a comprehensive ranking from the
three methods (GeNorm, NormFinder and BestKeeper), and (2)
using the optimal number of reference genes selected by the
GeNorm V value for each condition studied (pairwise variation
analysis, Fig. 2).
Biotic stress. For V. vinifera cv Trincadeira, EF1a, SAND and
SMD3 were selected as the three top ranked genes for normalization by the combination of the three methods. Additionally, the
top five ranked EF1a, SAND, SMD3, ACT and UBQ genes from
GeNorm pairwise analysis were also tested for qPCR normalization (Fig. 3A).
In V. vinifera cv Regent, EF1a, GAPDH and UBQ were used as
the three top ranked genes, while EF1a, UBQ, SMD3 and GAPDH
genes retrieved from the pairwise analysis (V4/5) were tested as a
second normalization strategy (Fig. 3B). For both genotypes, the
expression profile of the different GOIs tested was similar using the
two normalization approaches (Fig. 3A, B). CYP appeared
downregulated until 24 hpi in Trincadeira, while in Regent it is
downregulated until 18 hpi and at 24 hpi the expression decreases
Figure 2. Pairwise variation (V) of candidate genes as predicted by GeNorm. The pairwise variation (Vn/Vn+1) was calculated between the
normalization factors NFn and NFn+1. Each pairwise variation value is compared with a recommended cut-off value 0.15, below which the inclusion
of an additional reference gene is not required.
doi:10.1371/[Link].0072998.g002
PLOS ONE | [Link]
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
Figure 3. CYP, subtilisin, PR10 expression in Biotic Stress effect when comparing independently Trincadeira (a) and Regent (b). Two
normalization strategies are presented. Fold Change: expression of inoculated leaves (6, 12, 18 and 24 hpi) divided by mock inoculated samples.
Asterisks indicate significant differences between each normalization strategy. RG, reference gene. Median and MAD (mean absolute deviation)
values of three biological replicates are presented.
doi:10.1371/[Link].0072998.g003
RG in biotic stress studies [33], revealed to be unsuitable for our
experiment. Also, 60 S was not stable for the first hours of
interaction between the susceptible V. vinifera cv. Trincadeira and
P. viticola, despite being previously reported as one of the most
stable genes for susceptible V. vinifera cv. Marselan leaves
inoculated with P. viticola from 1 to 7 days [28]. The early timepoints used in our study may account for this difference. In our
study and regardless the genotype, EF1a was selected as the most
stable gene for the first hours of grapevine-downy mildew
interaction. EF1a was also selected as the most stable gene for
late blight infection of potato [46]. However, recent studies with V.
vinifera cv Riesling inoculated with downy mildew pointed EF1a as
one of the least stable reference genes in a 15 dpi time-course
experiment [29]. These results reinforce the need for systematic
selection of stable reference genes for each experimental condition
tested.
Several studies have been performed on grapevine resistance
response towards P. viticola, transcripts as PR10, subtilisin-like
PLOS ONE | [Link]
protein and CYP have been pointed out as defense and signalling
candidate genes for downy mildew resistance [1,2,4,5,7]. Subtilisin-like proteins seem to be involved in pathogen recognition
leading to further induction of defense responses [4752].
Cyclophilins have been shown to accumulate upon fungal
infection [53,54] and to play an important role in signal
transduction under stressful conditions [55]. PR10 family is one
of the most important proteins in response to fungal invasion [56]
and on other biotic or abiotic stresses [57].
Considering the genotype effect, a recent study by Figueiredo
et al. [2] allowed us to validate the RGs selected at 6 and 12 hpi.
When comparing Regent to Trincadeira, PR10, subtilisin and CYP
are over-expressed in Regent at 6 and 12 hpi which is in
accordance with [2]. The expression of these three genes was also
accessed for the remaining time-points. During inoculation timecourse, for PR10, CYP and subtilisin expression, both normalization
strategies showed the same trend: upregulation in the resistant
cultivar (Fig. 4). Prior to inoculation (0 h), subtilisin expression is
7
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
Figure 4. Fold change variation when comparing Regent and Tricadeira prior and during inoculation time-course for subtilisin, CYP
and PR10. Two normalization strategies are presented. Fold Change: expression of Regent samples divided by Trincadeira samples. Asterisks indicate
significant differences between each normalization strategy. RG, reference gene. Median and MAD (mean absolute deviation) values of three
biological replicates are presented.
doi:10.1371/[Link].0072998.g004
expression studies for other grapevine genotypes with similar
response to downy mildew. Our results clearly showed that RGs
are genotype-dependent and that different RGs should be used for
normalization of qPCR studies in compatible and incompatible
interactions.
consistent to [1], however different expression was obtained with
the two normalization strategies for CYP expression, upregulation
using the three best genes and downregulation with the pairwise
analysis selected genes (Fig. 4). As CYP expression at 0 h using the
3 best RGs is consistent with [1], we may consider that, in our
study the normalization strategy using the 3 best RGs is more
accurate.
Considering the biotic stress effect, PR10 appeared upregulated
in both genotypes, when compared to mock inoculated samples,
during inoculation time-course, which is in accordance to previous
works [4,5]. Cyclophilin was downregulated in both genotypes at 6
and 12 hpi. At 18 hpi, a1.71-fold increase of CYP in Regent was
obtained (Fig. 3B), while in Trincadeira a 2.6-fold increase only
occurred at 24 hpi (Fig. 3A). As cyclophilins were shown to play a
role in signal transduction under stressful conditions [55], the
earlier expression peak (18 hpi) observed in the resistant genotype
(Regent) may be associated to a faster pathogen recognition and/
or defense response activation. Subtilisin-like protein was highly
transcribed in Regent at 6 hpi when compared to the control
samples, while in Trincadeira the increased in transcription only
occurred at 24 hpi. We may hypothesize, as suggested by
Figueiredo et al. [2], that subtilisin is participating in pathogen
recognition and on the activation of the defence response. As a
result, Regent could recognize the pathogen and thus reacts to its
invasion faster than Trincadeira, which may account for its
increased resistance towards this pathogen [2].
A nonparametric test was used to compare the two normalization strategies (Table S2) in order to determine significant
differences in the expression of the GOIs. As no statistically
differences were found, we may assume that for an accurate
normalization, in our experimental conditions, the top three RGs
selected by the combination of GeNorm, NormFinder and
BestKeeper are appropriate. In summary, UBQ, EF1a and
GAPDH should be used when directly comparing Regent to
Trincadeira prior and during inoculation time-course (genotype
effect), EF1a, SAND and SMD3 should be used for Trincadeira
data normalization and EF1a, GAPDH and UBQ for Regent data
normalization (Biotic stress effect). The proposed RGs are a
valuable genomic source to study the early kinetics of plantpathogen interaction and could be a good starting point for gene
PLOS ONE | [Link]
Supporting Information
Figure S1 Primer specificity test through dissociation
curve analysis collected from StepOneTM software ver.
2.2.2 (Applied Biosystems). UBQ (A), SAND (B), ACT (C),
VATP16 (D), PTB2 (E), PsaB (F), SMD3 (G), EF1a (H), 60 S (I),
GAPDH (J) and UQCC (K). Non-template control is indicated by a
black arrow.
(PDF)
Table S1 Comprehensive ranking of the candidate RGs
calculated as the arithmetic mean ranking value of each
gene using the three applets. Genes were ranked from the
most stable (1) to the least stable (8).
(XLS)
Test statistics and Ranks given by the MannWhitney U test on PR10, subtilisin and CYP expression,
comparing the two normalization strategies followed.
(XLSX)
Table S2
Table S3 Descriptive statistics of reference gene expression in all datasets analysed based on the BestKeeper approach.
(PDF)
Acknowledgments
The authors wish to acknowledge Dr. Eva Zyprian and Dr. Martina
Bonow-Rex from JKI, Institute for Grapevine Breeding, Geilweilerhof for
all the help provided in grapevine inoculation experiments and Dr. Lisete
Sousa from Department of Statistics and Operations Research, FCUL for
mathematical and statistical advices.
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
Author Contributions
Conceived and designed the experiments: AF. Performed the experiments:
FM. Analyzed the data: FM MS AF. Contributed reagents/materials/
analysis tools: MSP AF. Wrote the paper: FM MS MSP AF.
References
25. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, et al. (2002)
Accurate normalization of real-time quantitative RT-PCR data by geometric
averaging of multiple internal control genes. Genome Biol 3(7): RESEARCH0034.
26. Reid K, Olsson N, Schlosser J, Peng F, Lund S (2006) An optimized grapevine
RNA isolation procedure and statistical determination of reference genes for
real-time RT-PCR during berry development. BMC Plant Biology 6: 27.
doi:10.1186/1471-2229-6-27.
27. Coito JL, Rocheta M, Carvalho L, Amancio S (2012) Microarray-based
uncovering reference genes for quantitative real time PCR in grapevine under
abiotic stress. BMC Res Notes 5: 220. doi:10.1186/1756-0500-5-220.
28. Gamm M, Heloir MC, Kelloniemi J, Poinssot B, Wendehenne D, et al. (2011)
Identification of reference genes suitable for qRT-PCR in grapevine and
application for the study of the expression of genes involved in pterostilbene
synthesis. Mol Genet Genomics 285: 273285.
29. Selim M, Legay S, Berkelmann-Lohnertz B, Langen G, Kogel KH, et al. (2012)
Identification of suitable reference genes for real-time RT-PCR normalization in
the grapevine-downy mildew pathosystem. Plant Cell Rep 31: 205216.
30. Akkurt M, Welter L, Maul E, Topfer R, Zyprian E (2007) Development of
SCAR markers linked to powdery mildew (Uncinula necator) resistance in
grapevine (Vitis vinifera L. and Vitis sp.). Mol Breed 19: 103111.
31. Anonymous (2000) Description list of varietiesgrapes 2000. Federal Office of
Plant Varieties (ed.), Hannover: Landburh Verlog.
32. Vandesompele J, De Paepe A, Speleman F (2002) Elimination of primer-dimer
artifacts and genomic coamplification using a two-step SYBR green I real-time
RT-PCR. Anal Biochem 303(1): 9598.
33. Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genomewide identification and testing of superior reference genes for transcript
normalization in Arabidopsis. Plant Physiol 139(1): 517.
34. Trouvelot S, Varnier AL, Allegre M, Mercier L, Baillieul F, et al. (2008) A beta1,3 glucan sulfate induces resistance in grapevine against Plasmopara viticola
through priming of defense responses, including HR-like cell death. Mol Plant
Microbe Interact 21: 232243.
35. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of
stable housekeeping genes, differentially regulated target genes and sample
integrity: BestKeeperExcel-based tool using pair-wise correlations. Biotechnol
Lett 26: 509515.
36. Andersen C, Jensen J, Orntoft T (2004) Normalization of real-time quantitative
reverse transcription-PCR data: A model-based variance estimation approach to
identify genes suited for normalization, applied to bladder and colon cancer data
sets. Cancer Res 64: 52455250.
37. Wang Q, Ishikawa T, Michiue T, Zhu BL, Guan DW, et al. (2012) Stability of
endogenous reference genes in postmortem human brains for. Int J Legal Med
126: 943952.
38. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods
25(4): 402408.
39. Pfaffl MW (2001) A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res 29: e45.
40. Hellemans J, Mortier G, De Paepe A, Speleman F, Vandesompele J (2007)
qBase relative quantification framework and software for management and
automated. Genome Biol 8: R19. doi:10.1186/gb-2007-8-2-r19.
41. Bustin SA (2010) Developments in real-time PCR research and molecular
diagnostics. Expert Rev Mol Diagn 10: 713715.
42. Bustin SA, Nolan T (2004) Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. J Biomol Tech 15(3): 155166.
43. Remans T, Smeets K, Opdenakker K, Mathijsen D, Vangronsveld J, et al.
(2008) Normalisation of real-time RT-PCR gene expression measurements in
Arabidopsis thaliana exposed to increased metal concentrations. Planta 227: 1343
1349.
44. Castro P, Roman B, Rubio J, Die J (2012) Selection of reference genes for
expression studies in Cicer arietinum L.: analysis of cyp81E3 gene expression against
Ascochyta rabiei. Mol Breed 29: 261274.
45. Liu D, Shi L, Han C, Yu J, Li D, et al. (2012) Validation of Reference Genes for
Gene Expression Studies in Virus-Infected Nicotiana benthamiana Using Quantitative Real-Time PCR. PLoS One 7(9): e46451. doi:10.1371/[Link].0046451.
46. Nicot N, Hausman JF, Hoffmann L, Evers D (2005) Housekeeping gene
selection for real-time RT-PCR normalization in potato during biotic and
abiotic stress. J Exp Bot 56(421): 29072914.
47. Tornero P, Conejero V, Vera P (1996) Primary structure and expression of a
pathogen-induced protease (PR-P69) in tomato plants: Similarity of functional
domains to subtilisin-like endoproteases. Proc Natl Acad Sci USA 93: 6332
6337.
1. Figueiredo A, Fortes A, Ferreira S, Sebastiana M, Choi Y, et al. (2008)
Transcriptional and metabolic profiling of grape (Vitis vinifera L.) leaves unravel
possible innate resistance against pathogenic fungi. J Exp Bot 59: 33713381.
2. Figueiredo A, Monteiro F, Fortes A, Bonow-Rex M, Zyprian E, et al. (2012)
Cultivar-specific kinetics of gene induction during downy mildew early infection
in grapevine. Funct Integr Genomics 12: 379386.
3. Kortekamp A, Welter L, Vogt S, Knoll A, Schwander F, et al. (2008)
Identification, isolation and characterization of a CC-NBS-LRR candidate
disease resistance gene family in grapevine. Mol Breed 22: 421432.
4. Polesani M, Desario F, Ferrarini A, Zamboni A, Pezzotti M, et al. (2008)
CDNA-AFLP analysis of plant and pathogen genes expressed in grapevine
infected with Plasmopara viticola. BMC Genomics 9: 142. doi: 10.1186/14712164-9-142.
5. Polesani M, Bortesi L, Ferrarini A, Zamboni A, Fasoli M, et al. (2010) General
and species-specific transcriptional responses to downy mildew infection in a
susceptible (Vitis vinifera) and a resistant (V. riparia) grapevine species. BMC
Genomics 11: 117. doi:10.1186/1471-2164-11-117.
6. Wu J, Zhang Y, Zhang H, Huang H, Folta K, et al. (2010) Whole genome wide
expression profiles of Vitis amurensis grape responding to downy mildew by using
Solexa sequencing technology. BMC Plant Biol 10: 234. doi:10.1186/14712229-10-234.
7. Malacarne G, Vrhovsek U, Zulini L, Cestaro A, Stefanini M, et al. (2011)
Resistance to Plasmopara viticola in a grapevine segregating population is
associated with stilbenoid accumulation and with specific host transcriptional
responses. BMC Plant Biol 11: 114. doi: 10.1186/1471222911114.
8. Dalbo M, Ye G, Weeden N, Steinkellner H, Sefc K, et al. (2000) A gene
controlling sex in grapevines placed on a molecular marker-based genetic map.
Genome 43: 333340.
9. Kortekamp A, Zyprian E (2003) Characterization of Plasmopara-resistance in
grapevine using in vitro plants. J Plant Physiol 160: 13931400.
10. Merdinoglu D, Wiedemann-Merdinoglu S, Coste P, Dumas V, Haetty S, et al.
(2003) Genetic analysis of downy mildew resistance derived from Muscadinia
rotundifolia. Acta Hortic 451456.
11. Fischer B, Salakhutdinov I, Akkurt M, Eibach R, Edwards K, et al. (2004)
Quantitative trait locus analysis of fungal disease resistance factors on a
molecular map of grapevine. Theor Appl Genet 108: 501515.
12. Welter L, Gokturk-Baydar N, Akkurt M, Maul E, Eibach R, et al. (2007) Genetic
mapping and localization of quantitative trait loci affecting fungal disease
resistance and leaf morphology in grapevine (Vitis vinifera L). Mol Breed 20: 359
374.
13. Jurges G, Kassemeyer H, Durrenberger M, Duggelin M, Nick P (2009) The
mode of interaction between Vitis and Plasmopara viticola Berk. & Curt. Ex de
Bary depends on the host species. Plant Biol 11: 886898.
14. Peressotti E, Wiedemann-Merdinoglu S, Delmotte F, Bellin D, Di Gaspero G, et
al. (2010) Breakdown of resistance to grapevine downy mildew upon limited
deployment of a resistant variety. BMC Plant Biol 10:147. doi:10.1186/14712229-10-147.
15. Bellin D, Peressotti E, Merdinoglu D, Wiedemann-Merdinoglu S, AdamBlondon A, et al. (2009) Resistance to Plasmopara viticola in grapevine Bianca is
controlled by a major dominant gene causing localised necrosis at the infection
site. Theor Appl Genet 120: 163176.
16. Blasi P, Blanc S, Wiedemann-Merdinoglu S, Prado E, Ruhl E, et al. (2011)
Construction of a reference linkage map of Vitis amurensis and genetic mapping of
Rpv8, a locus conferring resistance to grapevine downy mildew. Theor Appl
Genet 123: 4353.
17. Schwander F, Eibach R, Fechter I, Hausmann L, Zyprian E, et al. (2012) Rpv10:
a new locus from the Asian Vitis gene pool for pyramiding downy mildew
resistance loci in grapevine. Theor Appl Genet 124: 163176.
18. Bustin S (2000) Absolute quantification of mRNA using real-time reverse
transcription polymerase chain reaction assays. J Mol Endocrinol 25: 169193.
19. Bustin S (2002) Quantification of mRNA using real-time reverse transcription
PCR (RT-PCR): trends and problems. J Mol Endocrinol 29: 2339.
20. Derveaux S, Vandesompele J, Hellemans J (2010) How to do successful gene
expression analysis using real-time PCR. Methods 50: 227230.
21. Bustin S, Benes V, Nolan T, Pfaffl M (2005) Quantitative real-time RT-PCR - a
perspective. J Mol Endocrinol 34: 597601.
22. Huggett J, Dheda K, Bustin S, Zumla A (2005) Real-time RT-PCR
normalisation; strategies and considerations. Genes Immun 6: 279284.
23. Fleige S, Walf V, Huch S, Prgomet C, Sehm J, et al. (2006) Comparison of
relative mRNA quantification models and the impact of RNA integrity in
quantitative real-time RT-PCR. Biotechnol Lett 28: 16011613.
24. Schmittgen T, Zakrajsek B (2000) Effect of experimental treatment on
housekeeping gene expression: validation by real-time, quantitative RT-PCR.
J Bioch Biophys Methods 46: 6981.
PLOS ONE | [Link]
September 2013 | Volume 8 | Issue 9 | e72998
Reference Genes in Grapevine-Downy Mildew System
53. Godoy A, Lazzaro A, Casalongue C, San Segundo B (2000) Expression of a
Solanum tuberosum cyclophilin gene is regulated by fungal infection and abiotic
stress conditions. Plant Sci 152: 123134.
54. Lee J, Park S, Kim J, Lee S, Park Y, et al. (2007) Molecular and functional
characterization of a cyclophilin with antifungal activity from Chinese cabbage.
Biochem Bioph Res Commun 353(3): 672678.
55. Kong HY, Lee SC, BK H (2001) Expression of pepper cyclophilin gene is
differentially regulated during the pathogen infection and abiotic stress
conditions. Physiol Mol Plant Pathol 59: 189199.
56. Xie YR, Chen ZY, Brown RL, Bhatnagar D (2010) Expression and functional
characterization of two pathogenesis-related protein 10 genes from Zea mays.
J Plant Physiol 67(2): 121130.
57. Liu J, Ekramoddoullah A (2006) The family 10 of plant pathogenesis-related
proteins: Their structure, regulation, and function in response to biotic and
abiotic stresses. Physiol Mol Plant Pathol 68: 313.
48. Tornero P, Conejero V, Vera P (1997) Identification of a new pathogen-induced
member of the subtilisin-like processing protease family from plants. J Biol Chem
272: 1441214419.
49. Jorda L, Conejero V, Vera P (2000) Characterization of P69E and P69F, two
differentially regulated genes encoding new members of the subtilisin-like
proteinase family from tomato plants. Plant Physiol 122: 6774.
50. Golldack D, Vera P, Dietz KJ (2003) Expression of subtilisin-like serine proteases
in Arabidopsis thaliana is cell-specific and responds to jasmonic acid and heavy
metals with developmental differences. Physiol Plant 118(1): 6473.
51. Coffeen WC, Wolpert TJ (2004) Purification and characterization of serine
proteases that exhibit caspase-like activity and are associated with programmed
cell death in Avena sativa. The Plant Cell 16(4): 857873.
52. van der Hoorn RA, Jones JD (2004) The plant proteolytic machinery and its role
in defence. Curr Opin Plant Biol 7(4): 400407.
PLOS ONE | [Link]
10
September 2013 | Volume 8 | Issue 9 | e72998