0% found this document useful (0 votes)
74 views84 pages

Quick BioJava Programming Guide

This document provides a tutorial and recipes for using BioJava to complete common bioinformatics tasks quickly without needing to fully understand the entire BioJava API. It introduces BioJava and explains that the page provides example code snippets linked to explanations of how to perform tasks like working with alphabets and sequences, performing translations, reading/writing sequence files, working with annotations and features, and more. The document is intended to help new users get up and running with BioJava quickly for typical tasks by copying and pasting example code.

Uploaded by

Raziwan
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
74 views84 pages

Quick BioJava Programming Guide

This document provides a tutorial and recipes for using BioJava to complete common bioinformatics tasks quickly without needing to fully understand the entire BioJava API. It introduces BioJava and explains that the page provides example code snippets linked to explanations of how to perform tasks like working with alphabets and sequences, performing translations, reading/writing sequence files, working with annotations and features, and more. The document is intended to help new users get up and running with BioJava quickly for typical tasks by copying and pasting example code.

Uploaded by

Raziwan
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

BioJava In Anger

BioJava In Anger

A Tutorial and Recipe Book for Those in a Hurry


Introduction:
BioJava can be both big and intimidating. For those of us who are in a hurry there really is a
whole lot there to get your head around. This document is designed to help you develop
BioJava programs that do 99% of common tasks without needing to read and understand 99%
of the BioJava API.
The page was inspired by various programming cookbooks and follows a "How do I...?" type
approach. Each How do I is linked to some example code that does what you want and
sometimes more. Basically if you find the code you want and copy and paste it into your
program you should be up and running quickly. I have endeavoured to over document the
code to make it more obvious what I am doing so some of the code might look a bit bloated.
'BioJava in Anger' is maintained by Mark Schreiber. If you have any suggestions, questions or
comments contact the biojava mailing list. To subscribe to this list go here

How Do I....?
Setup

Where do I get a Java installation?

How do I get and install BioJava?

Alphabets and Symbols

How do I get a DNA, RNA or Protein Alphabet?

How do I make a custom Alphabet from custom Symbols?

How do I make a CrossProductAlphabet such as a codon Alphabet?

How do I break Symbols from CrossProduct Alphabets into their component Symbols?

How can I tell if two Alphabets or Symbols are equal?

How can I make an ambiguous Symbol like Y or R?

Basic Sequence Manipulation

How do I make a Sequence from a String or make a Sequence Object back into a String?

[Link] (1 di 3) [31/03/2003 15.28.06]

BioJava In Anger

How do I get a subsection of a Sequence?

How do I transcribe a DNA Sequence to a RNA Sequence?

How do I reverse complement a DNA or RNA Sequence?

Sequences are immutable so how can I change it's name?

Translation

How do I translate a DNA or RNA Sequence or SymbolList to Protein?

How do I translate a single codon to a single amino acid?

How do I use a non standard translation table?

Sequence I/O

How do I write Sequences in Fasta format?

How do I read in a Fasta file?

How do I read a GenBank/EMBL/SwissProt file?

How do I extract GenBank/EMBL/Swissprot sequences and write them as Fasta?

How do I turn an ABI sequence trace into a BioJava Sequence?

Annotations

How do I list the Annotations in a Sequence?

How do I filter a Sequences based on their species (or another Annotation property)?

Locations and Features

How do I specify a PointLocation?

How do I specify a RangeLocation?

How do CircularLocations work?

How can I make a Feature?

How can I filter Features by type?

BLAST and FASTA

How do I set up a BLAST parser?

How do I set up a FASTA parser?

How do I extract information from parsed results?

Counts and Distributions

How do I count the residues in a Sequence?

How do I calculate the frequency of a Symbol in a Sequence?

[Link] (2 di 3) [31/03/2003 15.28.06]

BioJava In Anger

How can I turn a Count into a Distribution?

How can I generate a random sequence from a Distribution?

How can I find the amount of information or entropy in a Distribution?

What is an easy way to tell if two Distributions have equal weights?

How can I make an OrderNDistribution over a custom Alphabet?

How can I write a Distribution as XML?

Weight Matrices and Dynamic Programming

How do I use a WeightMatrix to find a motif?

How do I make a HMMER like profile HMM?

User Interfaces

How can I visualize Annotations and Features as a tree?

How can I display a Sequence in a GUI?

How do I display Sequence coordinates?

How can I display features?

Disclaimer:
This code is generously donated by people who probably have better things to do. Where
possible we test it but errors may have crept in. As such, all code and advice here in has no
warranty or guarantee of any sort. You didn't pay for it and if you use it we are not responsible
for anything that goes wrong. Be a good programmer and test it yourself before unleashing it
on your corporate database.
This code is open-source. A good definition of open-source can be found here. If you agree
with that definition then you can use it.

[Link] (3 di 3) [31/03/2003 15.28.06]

How do I get a DNA, RNA or Protein Alphabet?

How do I get a DNA, RNA


or Protein Alphabet?

In BioJava Alphabets are collections of Symbols. Common biological alphabets (DNA, RNA,
protein etc) are registered with the BioJava AlphabetManager at startup and can be accessed
by name. The DNA, RNA and protein alphabets can also be accessed using convenient static
methods from DNATools, RNATools and ProteinTools respectively.
Both of these approaches are shown in the example below
import [Link].*;
import [Link].*;
import [Link].*;
public class AlphabetExample {
public static void main(String[] args) {
Alphabet dna, rna, prot;
//get the DNA alphabet by name
dna = [Link]("DNA");
//get the RNA alphabet by name
rna = [Link]("RNA");
//get the Protein alphabet by name
prot = [Link]("PROTEIN");
//get the protein alphabet that includes the * termination Symbol
prot = [Link]("PROTEIN-TERM");
//get those same Alphabets from the Tools classes
dna = [Link]();
rna = [Link]();
prot = [Link]();
//or the one with the * symbol
prot = [Link]();
}
}

[Link] [31/03/2003 15.28.07]

How do I make a custom Alphabet from custom Symbols?

How do I make a custom


Alphabet from custom
Symbols?

This example demonstrates the creation of a 'binary' alphabet that will have two Symbols, zero and one.
The custom made Symbols and Alphabet can then be used to make SymbolLists, Sequences, Distributions
etc.
import [Link].*;
import [Link].*;
import [Link].*;
public class Binary {
public static void main(String[] args) {
//make the "zero" Symbol with no annotation
Symbol zero =
[Link]("zero", Annotation.EMPTY_ANNOTATION);
//make the "one" Symbol
Symbol one =
[Link]("one", Annotation.EMPTY_ANNOTATION);
//collect the Symbols in a Set
Set symbols = new HashSet();
[Link](zero); [Link](one);
//make the Binary Alphabet
FiniteAlphabet binary = new SimpleAlphabet(symbols, "Binary");
//iterate through the symbols to show everything works
for (Iterator i = [Link](); [Link](); ) {
Symbol sym = (Symbol)[Link]();
[Link]([Link]());
}
//it is usual to register newly creates Alphabets with the AlphabetManager
[Link]([Link](), binary);
/*
* The newly created Alphabet will have been registered with the
* AlphabetManager under the name "Binary". If you retreive an instance
* of it using this name it should be canonical with the previous instance
*/
Alphabet alpha = [Link]("Binary");
[Link] (1 di 2) [31/03/2003 15.28.08]

How do I make a custom Alphabet from custom Symbols?

//check canonical status


[Link](alpha == binary);
}
}

[Link] (2 di 2) [31/03/2003 15.28.08]

How do I make a CrossProductAlphabet such as a codon Alphabet

How do I make a
CrossProductAlphabet such as
a codon Alphabet

CrossProductAlphabets result from the multiplication of other Alphabets. CrossProductAlphabets are used
to wrap up 2 or more Symbols into a single "cross product" Symbol. For example using a 3 way cross of
the DNA alphabet you could wrap a codon as a Symbol. You could then count those codon Symbols in a
Count or you could used them in a Distribution.
CrossProductAlphabets can be created by name (if the component Alphabets are registered in the
AlphabetManager) or by making a list of the desired Alphabets and creating the Alphabet from the List.
Both approaches are shown in the example below.
import [Link].*;
import [Link].*;
import [Link].*;
public class CrossProduct {
public static void main(String[] args) {
//make a CrossProductAlphabet from a List
List l = [Link](3, [Link]());
Alphabet codon = [Link](l);
//get the same Alphabet by name
Alphabet codon2 =
[Link]("(DNA x DNA x DNA)");
//show that the two Alphabets are canonical
[Link](codon == codon2);
}
}

[Link] [31/03/2003 15.28.09]

How do I break Symbols from CrossProduct Alphabets into their component Symbols?

How do I break Symbols


from
CrossProductAlphabets into
their component Symbols?
CrossProductAlphabets are used to represent groups of Symbols as a single Symbol. This is
very useful for treating things like codons as single Symbols. Sometimes however, you might
want to covert the symbols back into their component Symbols. The following recipe
demonstrates how this can be done.
The Symbols from a CrossProductAlphabet are implementations of the AtomicSymbol interface.
The prefix 'Atomic' suggests that the Symbol cannot be divided so one might ask, 'how can an
indivisible Symbol be divided into it's component parts?'. The full definition of the
AtomicSymbol is that it cannot be divided into a simpler Symbol that is still part of the same
Alphabet. The component parts of an AtomicSymbol from a CrossProductAlphabet are not
members of the same Alphabet so the 'Atomic' definition still stands. A codon would be from
the (DNA x DNA x DNA) Alphabet whereas the components of the codon Symbol are from the
DNA alphabet.
Contrast this with the definition of a BasisSymbol. A BasisSymbol can be validly divided into
components that are still part of the same Alphabet. In this way a BasisSymbol can be
ambiguous. For further discussion of BasisSymbols follow this link.
package biojava_in_anger;
import [Link].*;
import [Link].*;
import [Link].*;
public class BreakingComponents {
public static void main(String[] args) {
//make the 'codon' alphabet
List l = [Link](3, [Link]());
Alphabet alpha = [Link](l);
//get the first symbol in the alphabet
Iterator iter = ((FiniteAlphabet)alpha).iterator();
AtomicSymbol codon = (AtomicSymbol)[Link]();

[Link] (1 di 2) [31/03/2003 15.28.09]

How do I break Symbols from CrossProduct Alphabets into their component Symbols?

[Link]([Link]()+" is made of: ");


//break it into a list its components
List symbols = [Link]();
for(int i = 0; i < [Link](); i++){
if(i != 0)
[Link](", ");
Symbol sym = (Symbol)[Link](i);
[Link]([Link]());
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.09]

How can I tell if two Symbols or Alphabets are equal?

How can I tell if two


Symbols or Alphabets are
equal?

In Biojava the same Alphabets and the same Symbols are canonical no matter how they where
constructed or where they came from. This means that if two DNA alphabets (or Symbols from
those alphabets) are instantiated at different times are equal via both the .equals() and ==
functions. Also Symbols from the PROTEIN and the PROTEIN-TERM alphabets are canonical as
are Symbols from the IntegerAlphabet and the SubIntegerAlphabets.
This is even true of Alphabets and Symbols on different virtual machines (thanks to some
Serialization magic) which means BioJava works across RMI.
import [Link].*;
import [Link].*;
public class Canonical {
public static void main(String[] args) {
//get the DNA alphabet two ways
Alphabet a1 = [Link]();
Alphabet a2 = [Link]("DNA");
//are they equal
[Link]("equal: "+ [Link](a2));
//are they canonical
[Link]("canonical: "+ (a1 == a2));
}
}

[Link] [31/03/2003 15.28.10]

How can I make an ambiguous Symbol like Y or R?

How can I make an ambiguous


Symbol like Y or R?
The IBU defines standard codes for symbols that are ambiguous such as Y to indicate C or T and R to
indicate G or C or N to indicate any nucleotide. BioJava represents these Symbols as BasisSymbols.
BasisSymbol objects can contain one or more component Symbols that are valid members of the same
Alphabet as the BasisSymbol and are therefore capable of being ambiguous.
Generally an ambiguity Symbol is retrieved by calling the getAmbiguity(Set symbols) method from the
Alphabet that the Symbol is intended to come from. In the case of making the Symbol Y the set 'symbols'
used as an argument will contain the DNA Alphabet Symbols 'C' and 'T'.
import [Link].*;
import [Link].*;
import [Link].*;
public class Ambiguity {
public static void main(String[] args) {
try {
//get the DNA Alphabet
Alphabet dna = [Link]();
//make the 'Y' symbol
Set symbolsThatMakeY = new HashSet();
[Link](DNATools.c());
[Link](DNATools.t());
Symbol y = [Link](symbolsThatMakeY);
//print information about 'Y' basis Symbol
[Link]("Formal name of 'Y' is: "+[Link]());
[Link]("Class type of 'Y' is: "+[Link]().getName());
//break the Y BasisSymbol into its component AtomicSymbols
Alphabet matches = [Link]();
[Link]("The 'Y' Symbol is made of: ");
//we know that there will be a finite set of matches so its ok to cast it
for(Iterator i = ((FiniteAlphabet)matches).iterator(); [Link]();){
Symbol sym = (Symbol)[Link]();
[Link]([Link]());
if([Link]())
[Link](", ");
}
}
catch (IllegalSymbolException ex) {
[Link]();

[Link] (1 di 2) [31/03/2003 15.28.11]

How can I make an ambiguous Symbol like Y or R?

}
}
}

[Link] (2 di 2) [31/03/2003 15.28.11]

How do I make a Sequence from a String or make a Sequence Object back into a String?

How do I make a Sequence


from a String or make a
Sequence Object back into
a String?
A lot of the time we see sequence represented as a String of characters eg
"atgccgtggcatcgaggcatatagc". It's a convenient method for viewing and succinctly representing
a more complex biological polymer. BioJava makes use of SymbolLists and Sequences to
represent these biological polyners as Objects. Sequences extend SymbolLists and provide
extra methods to store things like the name of the sequence and any features it might have
but you can think of a Sequence as a SymbolList.
Within Sequence and SymbolList the polymer is not stored as a String. BioJava differentiates
different polymer residues using Symbol objects that come from different Alphabets. In this
way it is easy to tell if a sequence is DNA or RNA or something else and the 'A' symbol from
DNA is not equal to the 'A' symbol from RNA. The details of Symbols, SymbolLists and
Alphabets are covered here. The crucial part is there needs to be a way for a programmer to
convert between the easily readable String and the BioJava Object and the reverse. To do this
BioJava has Tokenizers that can read a String of text and parse it into a BioJava Sequence or
SymbolList object. In the case of DNA, RNA and Protein you can do this with a single method
call. The call is made to a static method from either DNATools, RNATools or ProteinTools.

String to SymbolList
import [Link].*;
import [Link].*;
public class StringToSymbolList {
public static void main(String[] args) {
try {
//create a DNA SymbolList from a String
SymbolList dna = [Link]("atcggtcggctta");
//create a RNA SymbolList from a String
SymbolList rna = [Link]("auugccuacauaggc");
//create a Protein SymbolList from a String
SymbolList aa = [Link]("AGFAVENDSA");
}

[Link] (1 di 2) [31/03/2003 15.28.12]

How do I make a Sequence from a String or make a Sequence Object back into a String?

catch (IllegalSymbolException ex) {


//this will happen if you use a character in one of your strings that is
//not an accepted IUB Character for that Symbol.
[Link]();
}
}
}

String to Sequence
import [Link].*;
import [Link].*;
public class StringToSequence {
public static void main(String[] args) {
try {
//create a DNA sequence with the name dna_1
Sequence dna = [Link]("atgctg", "dna_1");
//create an RNA sequence with the name rna_1
Sequence rna = [Link]("augcug", "rna_1");
//create a Protein sequence with the name prot_1
Sequence prot = [Link]("AFHS", "prot_1");
}
catch (IllegalSymbolException ex) {
//an exception is thrown if you use a non IUB symbol
[Link]();
}
}
}

SymbolList to String
You can call the seqString() method on either a SymbolList or a Sequence to get it's Stringified
version.
import [Link].*;
public class SymbolListToString {
public static void main(String[] args) {
SymbolList sl = null;
//code here to instantiate sl
//convert sl into a String
String s = [Link]();
}
}

[Link] (2 di 2) [31/03/2003 15.28.12]

How do I get a subsection of a Sequence?

How do I get a subsection


of a Sequence?
Given a Sequence object we might only be interested in examining the first 10 bases or we
might want to get a region between two points. You might also want to print a subsequence to
an OutputStream like STDOUT how could you do this?
BioJava uses a biological coordinate system for identifying bases. The first base is numbered 1
and the last base index is equal to the length of the sequence. Note that this is different from
String indexing which starts at 0 and proceedes to length -1. If you attempt to access a region
outside of 1...length an IndexOutOfBoundsException will occur.

Getting a Sub - Sequence


SymbolList symL = null;
//code here to generate a SymbolList
//get the first Symbol
Symbol sym = [Link](1);
//get the first three bases
SymbolList symL2 = [Link](1,3);
//get the last three bases
SymbolList symL3 = [Link]([Link]() - 3, [Link]());

Printing a Sub - Sequence


//print the last three bases of a SymbolList or Sequence
String s = [Link]([Link]() - 3, [Link]());
[Link](s);

Complete Listing
import [Link].*;
import [Link].*;
public class SubSequencing {
public static void main(String[] args) {
SymbolList symL = null;
//generate an RNA SymbolList
try {
symL = [Link]("auggcaccguccagauu");
}
[Link] (1 di 2) [31/03/2003 15.28.13]

How do I get a subsection of a Sequence?

catch (IllegalSymbolException ex) {


[Link]();
}
//get the first Symbol
Symbol sym = [Link](1);
//get the first three bases
SymbolList symL2 = [Link](1,3);
//get the last three bases
SymbolList symL3 = [Link]([Link]() - 3, [Link]());
//print the last three bases
String s = [Link]([Link]() - 3, [Link]());
[Link](s);
}
}

[Link] (2 di 2) [31/03/2003 15.28.13]

How do I Transcribe a DNA Sequence to an RNA Sequence?

How do I Transcribe a DNA


Sequence to an RNA
Sequence?
In BioJava DNA and RNA Sequences and SymbolLists are made using different Alphabets you
can convert from DNA to RNA using the static method transcribe() in RNATools.
import [Link].*;
import [Link].*;
public class TranscribeDNAtoRNA {
public static void main(String[] args) {
try {
//make a DNA SymbolList
SymbolList symL = [Link]("atgccgaatcgtaa");
//transcribe it to RNA
symL = [Link](symL);
//just to prove it worked
[Link]([Link]());
}
catch (IllegalSymbolException ex) {
//this will happen if you try and make the DNA seq using non IUB symbols
[Link]();
}catch (IllegalAlphabetException ex) {
//this will happen if you try and transcribe a non DNA SymbolList
[Link]();
}
}
}

[Link] [31/03/2003 15.28.13]

How do I Reverse Complement a Sequence or SymbolList?

How do I Reverse
Complement a Sequence or
SymbolList?
To reverse complement a DNA SymbolList or Sequence simply use the
[Link](SymbolList sl) method. An equivalent method is found in
RNATools for performing the same operation on RNA based Sequences and SymbolLists.
import [Link].*;
import [Link].*;
public class ReverseComplement {
public static void main(String[] args) {
try {
//make a DNA SymbolList
SymbolList symL = [Link]("atgcacgggaactaa");
//reverse complement it
symL = [Link](symL);
//prove that it worked
[Link]([Link]());
}
catch (IllegalSymbolException ex) {
//this will happen if you try and make the DNA seq using non IUB symbols
[Link]();
}catch (IllegalAlphabetException ex) {
//this will happen if you try and reverse complement a non DNA sequence
using DNATools
[Link]();
}
}

[Link] [31/03/2003 15.28.14]

How can I change a Sequences name?

How can I change a


Sequence's name?

Mostly BioJava Sequence objects are immutable. This is really a safety feature to prevent changes
corrupting the integrity of the data. A consequence of this is that there is no setName() method in
Sequence. One way to change your "view" of a Sequence is to make a ViewSequence using the
original Sequence as an argument in the constructor. Behind the scenes the ViewSequence
wrapper intercepts some of the method calls to the underlying Sequence which gives the
possibility of changing the name.
The following program demonstrates this.
import [Link].*;

import [Link].*;
import [Link].*;
import [Link].*;
public class NameChange {
public static void main(String[] args) {
try {
Sequence seq =
[Link]("atgcgctaggctag","gi|12356|ABC123");
//create a veiw on the sequence and change its name
ViewSequence seq2 = new ViewSequence(seq, "ABC123");
//print to FASTA to prove the name has changed
[Link]([Link], seq2);
}
catch (IllegalSymbolException ex) {
//tried to make seq with non DNA symbol
[Link]();
}catch (IOException ex) {
//couldn't print seq2 to System out??
[Link]();
}
}
}

[Link] [31/03/2003 15.28.14]

How Do I Translate a SymbolList or Sequence?

How Do I Translate a
SymbolList or Sequence?

To translate a DNA sequence you need to do the following

Transcribe to RNA.

Get a triplet (codon) view on the SymbolList.

Translate to protein.

Almost all of this can be achieved using static methods from BioJava tools classes. The
following block of code demonstrates the procedure. Obviously if you already have an RNA
sequence there is no need to transcribe it.
NOTE: if you try and create a 'triplet view' on a SymbolList or Sequence who's length is not
evenly divisible by three an IllegalArgumentException will be thrown. See 'how to get a
subsequence' for a description of how to get a portion of a Sequence for translation.
import [Link].*;
import [Link].*;
public class Translate {
public static void main(String[] args) {
try {
//create a DNA SymbolList
SymbolList symL = [Link]("atggccattgaatga");
//transcribe to RNA
symL = [Link](symL);
//translate to protein
symL = [Link](symL);
//prove that it worked
[Link]([Link]());
}
catch (IllegalAlphabetException ex) {
/*
* this will occur if you try and transcribe a non DNA sequence or translate
* a sequence that isn't a triplet view on a RNA sequence.
*/
[Link]();
}catch (IllegalSymbolException ex) {
// this will happen if non IUB characters are used to create the DNA
SymbolList
[Link]();

[Link] (1 di 2) [31/03/2003 15.28.15]

How Do I Translate a SymbolList or Sequence?

}
}

[Link] (2 di 2) [31/03/2003 15.28.15]

How do I translate a single codon to a single amino acid?

How do I translate a
single codon to a single amino
acid?

The general translation example shows how to use RNATools to translate a RNA SymbolList into a Protein
SymbolList but most of what goes on is hidden behind the convenience method translate(). If you only want to
translate a single codon into a single amino acid you get exposed to a bit more of the gory detail but you also
get a chance to figure out more of what is going on under the hood.
There are actually a number of ways to do this, below I have presented only one.
import [Link].*;
import [Link].*;
public class SingleTranslationDemo {
public static void main(String[] args) {
//make a compound alphabet where codons are Symbols
Alphabet a = [Link]("(RNA x RNA x RNA)");
//get our translation table using one of the static names from TranslationTable
TranslationTable table = [Link]([Link]);
try {
//make a 'codon'
SymbolList codon = [Link]("UUG");
//get the representation of that codon as a Symbol
Symbol sym = [Link]([Link]());
//translate to amino acid
Symbol aminoAcid = [Link](sym);
/*
* This bit is not required for the translation it just proves that the
* Symbol is from the right Alphabet. An Exception will be thrown if it
* isn't.
*/
[Link]().validate(aminoAcid);
}
catch (IllegalSymbolException ex) {
[Link]();
}
}
}

[Link] [31/03/2003 15.28.15]

New Page 0

How do I use a non standard


translation table?

The convenient translate() method in RNATools, used in the general translation example, is only useful if
you want to use the "Universal" translation table. This is not so good if you want to use one of those
weird Mitochondrial translation tables. Fortunately this can be done in BioJava. RNATools also has a static
method getGeneticCode(String name) that lets you get a TranslationTable by name.
The following TranslationTables are available:
FLATWORM_MITOCHONDRIAL
YEAST_MITOCHONDRIAL
ASCIDIAN_MITOCHONDRIAL
EUPLOTID_NUCLEAR
UNIVERSAL
INVERTEBRATE_MITOCHONDRIAL
BLEPHARISMA_MACRONUCLEAR
ALTERNATIVE_YEAST_NUCLEAR
BACTERIAL
VERTEBRATE_MITOCHONDRIAL
CILIATE_NUCLEAR
MOLD_MITOCHONDRIAL
ECHINODERM_MITOCHONDRIAL
These are also the valid names that can be used as an argument in the static
[Link](String name) method. These names are also available as static Strings in the
TranslationTools class.
The following program shows the use of the Euplotid Nuclear translation table (where UGA = Cys).
import [Link].*;
import [Link].*;
public class AlternateTranslation {
public static void main(String[] args) {
//get the Euplotoid translation table
TranslationTable eup = [Link](TranslationTable.EUPL_NUC);
try {
//make a DNA sequence including the 'tga' codon
SymbolList seq = [Link]("atgggcccatgaaaaggcttggagtaa");
//transcribe to RNA
seq = [Link](seq);
//veiw the RNA sequence as codons, this is done internally by
[Link]()

[Link] (1 di 2) [31/03/2003 15.28.16]

New Page 0

seq = [Link](seq, 3);


//translate
SymbolList protein = [Link](seq, eup);
//print out the protein
[Link]([Link]());
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.16]

How Do I Print A Sequence in Fasta Format?

How Do I Print A Sequence


in Fasta Format?
FASTA format is a fairly standard bioinformatics output that is convenient and easy to read.
BioJava has a tools class called SeqIOTools that provides static convenience methods to
perform a number of common bioinformatics IO tasks. The follwing snippets demonstrate how
to print a Sequence or even a whole SequenceDB in FASTA format to an OutputStream like
[Link]. All of the WriteXX methods from SeqIOTools take an OutputStream as an
argument. In this way you can pipe the newly formatted sequence to a file or another method
or STDOUT, STDERR etc.
SeqIOTools is in the package [Link]

Printing a SequenceDB
//make a instance of the SequenceDB interface
SequenceDB db = new HashSequenceDB();
//add the sequences to the DB
[Link](seq1);
[Link](seq2);
/*
* now print it to an output stream in FASTA format using a static method
* from the utility class SeqIOTools. In this case our output stream is
* STDOUT
*/
[Link]([Link], db);

Printing from a SequenceIterator


Many readXXX() methods from SeqIOTools return a SequenceIterator that iterates over all the
Sequences in a file. Most of teh writeXXX() methods from SeqIOTools have a version of the
methods that takes a SequenceIterator as and argument eg.
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
//and now write it all to FASTA, (you can write to any OutputStream, not
just [Link])
[Link]([Link], iter);

Printing a Single Sequence


[Link] (1 di 2) [31/03/2003 15.28.17]

How Do I Print A Sequence in Fasta Format?

/*
* SeqIOTools also has a method that takes a single sequence so you don't
* have to make a SequenceDB
*/
[Link]([Link], seq1);

[Link] (2 di 2) [31/03/2003 15.28.17]

New Page 0

How do I read Sequences


from a Fasta File?

One of the most frequent I/O tasks is the reading of a flat file representation of sequence into
memory. SeqIOTools provides some basic static methods to read files into BioJava. There is
actually more than one solution. The more specific is demonstrated first and the more general
second.

Solution 1
import [Link].*;
import [Link].*;
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class ReadFasta {


/**
* The programs takes two args the first is the file name of the Fasta file.
* The second is the name of the Alphabet. Acceptable names are DNA RNA or
PROTEIN.
*/
public static void main(String[] args) {
try {
//setup file input
String filename = args[0];
BufferedInputStream is =
new BufferedInputStream(new FileInputStream(filename));
//get the appropriate Alphabet
Alphabet alpha = [Link](args[1]);
//get a SequenceDB of all sequences in the file
SequenceDB db = [Link](is, alpha);
}
catch (BioException ex) {
//not in fasta format or wrong alphabet
[Link]();
}catch (NoSuchElementException ex) {
//no fasta sequences in the file
[Link]();
}catch (FileNotFoundException ex) {

[Link] (1 di 2) [31/03/2003 15.28.17]

New Page 0

//problem reading file


[Link]();
}
}

Solution 2
import [Link].*;
import [Link].*;
import [Link].*;
public class ReadFasta2 {
/**
* This program will read any file supported by SeqIOTools it takes two
* arguments, the first is the file name the second is the int constant
* for the file type in SeqIOTools. See SeqIOTools for possible file types.
* The constant for Fasta DNA is 1
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the int constant for Fasta file type
int fileType = [Link](args[1]);
/*
* get a Sequence Iterator over all the sequences in the file.
* [Link]() returns an Object. If the file read
* is an alignment format like MSF and Alignment object is returned
* otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (NumberFormatException ex) {
//args[1] is not an integer
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.17]

How do I read a GenBank/EMBL/SwissProt File?

How Do I read a GenBank,


SwissProt or EMBL file?

The SeqIOTools class contains methods for reading GenBank, SwissProt and EMBL files. Because any of
these files can contain more than one sequence entry SeqIOTools will return a SequenceIterator which can
be used to iterate through the individual sequences. One of the attractive features of this model is that the
Sequences are only parsed and created as needed so very large collections of sequences can be handled
with moderate resources.
Information in the file is store in the Sequence as Annotations or where there is location information as
Features.
Three specific solutions are presented (which are all very similar) followed by a generic solution (for
biojava1.3 pre1). A fourth solution revises the generic solution for the biojava1.3 API which is a bit
friendlier.

Reading GenBank
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class ReadGB {


public static void main(String[] args) {
BufferedReader br = null;
try {
//create a buffered reader to read the sequence file specified by args[0]
br = new BufferedReader(new FileReader(args[0]));
}
catch (FileNotFoundException ex) {
//can't find the file specified by args[0]
[Link]();
[Link](-1);
}
//read the GenBank File
SequenceIterator sequences = [Link](br);
//iterate through the sequences
while([Link]()){
try {

[Link] (1 di 6) [31/03/2003 15.28.19]

How do I read a GenBank/EMBL/SwissProt File?

Sequence seq = [Link]();


//do stuff with the sequence
}
catch (BioException ex) {
//not in GenBank format
[Link]();
}catch (NoSuchElementException ex) {
//request for more sequence when there isn't any
[Link]();
}
}
}
}

Reading SwissProt
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class ReadSwiss {


public static void main(String[] args) {
BufferedReader br = null;
try {
//create a buffered reader to read the sequence file specified by args[0]
br = new BufferedReader(new FileReader(args[0]));
}
catch (FileNotFoundException ex) {
//can't find the file specified by args[0]
[Link]();
[Link](-1);
}
//read the SwissProt File
SequenceIterator sequences = [Link](br);
//iterate through the sequences
while([Link]()){
try {
Sequence seq = [Link]();
//do stuff with the sequence

[Link] (2 di 6) [31/03/2003 15.28.19]

How do I read a GenBank/EMBL/SwissProt File?

}
catch (BioException ex) {
//not in SwissProt format
[Link]();
}catch (NoSuchElementException ex) {
//request for more sequence when there isn't any
[Link]();
}
}
}
}

Reading EMBL
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class ReadEMBL {


public static void main(String[] args) {
BufferedReader br = null;
try {
//create a buffered reader to read the sequence file specified by args[0]
br = new BufferedReader(new FileReader(args[0]));
}
catch (FileNotFoundException ex) {
//can't find the file specified by args[0]
[Link]();
[Link](-1);
}
//read the EMBL File
SequenceIterator sequences = [Link](br);
//iterate through the sequences
while([Link]()){
try {
Sequence seq = [Link]();
//do stuff with the sequence
}
catch (BioException ex) {
//not in EMBL format

[Link] (3 di 6) [31/03/2003 15.28.19]

How do I read a GenBank/EMBL/SwissProt File?

[Link]();
}catch (NoSuchElementException ex) {
//request for more sequence when there isn't any
[Link]();
}
}
}
}

GeneralReader (biojava 1.3 pre 1)


import [Link].*;
import [Link].*;
import [Link].*;
public class GeneralReader {
/**
* This program will read any file supported by SeqIOTools it takes two
* arguments, the first is the file name the second is the int constant
* for the file type in SeqIOTools. See SeqIOTools for possible file types.
* The constants used are:
* UNKNOWN = 0;
* FASTADNA = 1;
* FASTAPROTEIN = 2;
* EMBL = 3;
* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
* MSFDNA = 7;
* FASTAALIGNDNA = 9;
* MSFPROTEIN = 10;
* FASTAALIGNPROTEIN = 11;
* MSF = 12;
//only appropriate for reading
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the int constant for the file type
int fileType = [Link](args[1]);
/*
*
*
*
*

get a Sequence Iterator over all the sequences in the file.


[Link]() returns an Object. If the file read
is an alignment format like MSF and Alignment object is returned
otherwise a SequenceIterator is returned.

[Link] (4 di 6) [31/03/2003 15.28.19]

How do I read a GenBank/EMBL/SwissProt File?

*/
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (NumberFormatException ex) {
//args[1] is not an integer
[Link]();
}
}
}

GeneralReader (biojava 1.3)


import [Link].*;

import [Link].*;
import [Link].*;
import [Link].*;
public class GeneralReader {
/**
* This program will read any file supported by SeqIOTools it takes three
* arguments, the first is the file name the second is the format type the
* third is the type of residue being read. Illegal combinations such as
* SwissProt and DNA will cause an exception.
*
* Allowed formats are: (case insensitive).
*
* FASTA
* EMBL
* GENBANK
* SWISSPROT (or swiss)
* GENPEPT
*
* Allowed sequence types are: (case insensititve).
*
* DNA
* AA (or Protein)
* RNA
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));

[Link] (5 di 6) [31/03/2003 15.28.19]

How do I read a GenBank/EMBL/SwissProt File?

//the flat file format


String format = args[1];
//the Alphabet
String alpha = args[2];
//get the int value for the format and alphabet

/*
* get a Sequence Iterator over all the sequences in the file.
* [Link]() returns an Object. If the file read
* is an alignment format like MSF and Alignment object is returned
* otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](format, alpha, br);
// do something with the sequences
[Link]([Link], iter);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (BioException ex) {
//invalid file format name
[Link]();
}catch (IOException ex){
//error writing to fasta
[Link]();
}
}
}

[Link] (6 di 6) [31/03/2003 15.28.19]

How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?

How do I extract Sequences


from GenBank/ EMBL/ SwissProt
etc and write them as Fasta?
To perform this task we are going to extend the general reader from the previous demo and include in it the
ability to write sequence data in fasta format. Two examples are provided, one uses the slightly earlier
biojava1.3 pre1 and the second uses the more up to date biojava 1.3

(Using Biojava 1.3 pre 1)


import [Link].*;
import [Link].*;
import [Link].*;
public class WriteToFasta {
/**
* This program will read any file supported by SeqIOTools it takes two
* arguments, the first is the file name the second is the int constant
* for the file type in SeqIOTools. See SeqIOTools for possible file types.
* The constants used are:
* UNKNOWN = 0;
* FASTADNA = 1;
* FASTAPROTEIN = 2;
* EMBL = 3;
* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
* MSFDNA = 7;
* FASTAALIGNDNA = 9;
* MSFPROTEIN = 10;
* FASTAALIGNPROTEIN = 11;
* MSF = 12;
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the int constant for the file type
int fileType = [Link](args[1]);
/*
* get a Sequence Iterator over all the sequences in the file.
* [Link]() returns an Object. If the file read

[Link] (1 di 3) [31/03/2003 15.28.20]

How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?

* is an alignment format like MSF and Alignment object is returned


* otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
//and now write it all to FASTA, (you can write to any OutputStream, not just
[Link])
[Link]([Link], iter);
}
catch (Exception ex) {
[Link]();
}
}
}

(Using Biojava 1.3)


import [Link].*;

import [Link].*;
import [Link].*;
import [Link].*;
public class GeneralReader {
/**
* This program will read any file supported by SeqIOTools it takes three
* arguments, the first is the file name the second is the format type the
* third is the type of residue being read. Illegal combinations such as
* SwissProt and DNA will cause an exception.
*
* Allowed formats are: (case insensitive).
*
* FASTA
* EMBL
* GENBANK
* SWISSPROT (or swiss)
* GENPEPT
*
* Allowed sequence types are: (case insensititve).
*
* DNA
* AA (or Protein)
* RNA
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));

[Link] (2 di 3) [31/03/2003 15.28.20]

How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?

//the flat file format


String format = args[1];
//the Alphabet
String alpha = args[2];
//get the int value for the format and alphabet

/*
get a Sequence Iterator over all the sequences in the file.
[Link]() returns an Object. If the file read
is an alignment format like MSF and Alignment object is returned
otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](format, alpha, br);
*
*
*
*

// do something with the sequences


[Link]([Link], iter);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (BioException ex) {
//invalid file format name
[Link]();
}catch (IOException ex){
//error writing to fasta
[Link]();
}
}
}

[Link] (3 di 3) [31/03/2003 15.28.20]

How can I turn an ABI trace into a BioJava Sequence?

How can I turn an ABI


trace into a BioJava
Sequence?

A lot of Bioinformatics begins with the reading of a piece of DNA (or several pieces) using a
DNA sequencer. A typical output is an ABI trace. BioJava contains a Class called ABITrace that
will parse either an ABITrace file or URL or a byte[] and store its values for programmatic
retrieval.
The following program is modified from a version kindly supplied by Matthew Pocock. It
demonstrates the creation of a BioJava Sequence from an ABI trace file.
import [Link].*;
import
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class Trace2Seq {


public static void main(String[] args)
throws Exception {
File traceFile = new File(args[0]);
//the name of the sequence
String name = [Link]();
//read the trace
ABITrace trace = new ABITrace(traceFile);
//extract the Symbols
SymbolList symbols = [Link]();
//make a fully fledged sequence
Sequence seq = new SimpleSequence(symbols, name, name,
Annotation.EMPTY_ANNOTATION);
//write it to STDOUT
[Link]([Link], seq);

[Link] (1 di 2) [31/03/2003 15.28.21]

How can I turn an ABI trace into a BioJava Sequence?

}
}

[Link] (2 di 2) [31/03/2003 15.28.21]

How do I List the Annotations in a Sequence?

How do I List the


Annotations in a Sequence?
When you read in a annotates sequence file such as GenBank or EMBL there is a lot more
detailed information in there than just the raw sequence. If the information has a sensible
location then it ends up as a Feature. If it is more generic such as the species name then the
information ends up as Annotations.
BioJava Annotation objects are a bit like Map objects and they contian key value mappings.
Below is the initial portion of an EMBL file
ID
XX
AC
XX
SV
XX
DT
DT
XX
DE
XX
KW
XX
OS
OC
OC
XX
RN
RP
RA
RA
RA
RT
RL
RL
RL
XX
CC
CC
CC

AY130859

standard; DNA; HUM; 44226 BP.

AY130859;
AY130859.1
25-JUL-2002 (Rel. 72, Created)
25-JUL-2002 (Rel. 72, Last updated, Version 1)
Homo sapiens cyclin-dependent kinase 7 (CDK7) gene, complete cds.
.
Homo sapiens (human)
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
Eutheria; Primates; Catarrhini; Hominidae; Homo.
[1]
1-44226
Rieder M.J., Livingston R.J., Braun A.C., Montoya M.A., Chung M.-W.,
Miyamoto K.E., Nguyen C.P., Nguyen D.A., Poel C.L., Robertson P.D.,
Schackwitz W.S., Sherwood J.K., Witrak L.A., Nickerson D.A.;
;
Submitted (11-JUL-2002) to the EMBL/GenBank/DDBJ databases.
Genome Sciences, University of Washington, 1705 NE Pacific, Seattle, WA
98195, USA
To cite this work please use: NIEHS-SNPs, Environmental Genome
Project, NIEHS ES15478, Department of Genome Sciences, Seattle, WA
(URL: [Link]

The following program reads an EMBL file and lists its Annotation properties. The output of this
program on the above file is listed below the program.
import [Link].*;
import [Link].*;
[Link] (1 di 3) [31/03/2003 15.28.22]

How do I List the Annotations in a Sequence?

import [Link].*;
import [Link].*;
import [Link].*;
public class ListAnnotations {
public static void main(String[] args) {
try {
//read in an EMBL Record
BufferedReader br = new BufferedReader(new FileReader(args[0]));
SequenceIterator seqs = [Link](br);
//for each sequence list the annotations
while([Link]()){
Annotation anno = [Link]().getAnnotation();
//print each key value pair
for (Iterator i = [Link]().iterator(); [Link](); ) {
Object key = [Link]();
[Link](key +" : "+ [Link](key));
}
}
}
catch (Exception ex) {
[Link]();
}
}
}

Program Output
RN : [1]
KW : .
RL : [Submitted (11-JUL-2002) to the EMBL/GenBank/DDBJ databases., Genome
Sciences, University of Washington, 1705 NE Pacific, Seattle, WA, 98195, USA]
embl_accessions : [AY130859]
DE : Homo sapiens cyclin-dependent kinase 7 (CDK7) gene, complete cds.
SV : AY130859.1
AC : AY130859;
FH : Key Location/Qualifiers
XX :
OC : [Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;,
Eutheria; Primates; Catarrhini; Hominidae; Homo.]
RA : [Rieder M.J., Livingston R.J., Braun A.C., Montoya M.A., Chung M.-W.,,
Miyamoto K.E., Nguyen C.P., Nguyen D.A., Poel C.L., Robertson P.D.,, Schackwitz
W.S., Sherwood J.K., Witrak L.A., Nickerson D.A.;]
ID : AY130859 standard; DNA; HUM; 44226 BP.
DT : [25-JUL-2002 (Rel. 72, Created), 25-JUL-2002 (Rel. 72, Last updated, Version

[Link] (2 di 3) [31/03/2003 15.28.22]

How do I List the Annotations in a Sequence?

1)]
CC : [To cite this work please use: NIEHS-SNPs, Environmental Genome, Project,
NIEHS ES15478, Department of Genome Sciences, Seattle, WA, (URL:
[Link]
RT : ;
OS : Homo sapiens (human)
RP : 1-44226

[Link] (3 di 3) [31/03/2003 15.28.22]

How do I filter sequences based on their species?

How do I filter sequences


based on their species?

The species field of a GenBank SwissProt or EMBL file ends up as an Annotation entry. Essentially all you
need to do is get the species property from a sequences Annotation and check to see if it is what you
want.
The species property name depends on the source: for EMBL or SwissProt it is "OS" for GenBank it is
"Organism".
The following program will read in Sequences from a file and filter them according to their species. The
same general recipe with a little modification could be used for any Annotation property.
import [Link].*;
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class FilterEMBLBySpecies {


public static void main(String[] args) {
try {
//read an EMBL file specified in args[0]
BufferedReader br = new BufferedReader(new FileReader(args[0]));
SequenceIterator iter = [Link](br);
//the species name to search for (specified by args[1]);
String species = args[1];
//A sequenceDB to store the filtered Seqs
SequenceDB db = new HashSequenceDB();
//As each sequence is read
while([Link]()){
Sequence seq = [Link]();
Annotation anno = [Link]();
//check the annotation for Embl organism field "OS"
if([Link]("OS")){
String property = (String)[Link]("OS");
//check the value of the property, could also do this with a regular
expression
if([Link](species)){
[Link] (1 di 2) [31/03/2003 15.28.23]

How do I filter sequences based on their species?

[Link](seq);
}
}
}
//write the sequences as FASTA
[Link]([Link], db);
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.23]

How do I specify a PointLocation?

How do I specify a
PointLocation?

In BioJava locations in a Sequence are specified by simple objects that implement the interface
Location.
A point location is the inclusive location of a single symbol in a SymbolList or Sequence.
PointLocations have public constructors and are easy to instantiate. The following example
demonstrates the creation of a PointLocation and it's specification of a single Symbol in a SymbolList.
Remember that BioJava uses the biological coordinate system thus the first PointLocation in a
Sequence will be 1 not 0.
import [Link].*;
import [Link].*;
public class SpecifyPoint {
public static void main(String[] args) {
try {
//make a PointLocation specifying the third residue
PointLocation point = new PointLocation(3);
//print the location
[Link]("Location: "+[Link]());
//make a SymbolList
SymbolList sl = [Link]("gcagcuaggcggaaggagc");
[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = [Link](sl);
//in this case the SymbolList will only have one base
[Link]("Symbol specified by Location: "+[Link]());
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}

[Link] [31/03/2003 15.28.23]

How do I specify a RangeLocation?

How do I specify a
RangeLocation?

In BioJava a RangeLocation is an object that holds the minimum and maximum bounds of a region on
a SymbolList or Sequence. The minimum and maximum are inclusive.
The following example demonstrates the use of a RangeLocation.
import [Link].*;
import [Link].*;
public class SpecifyRange {
public static void main(String[] args) {
try {
//make a RangeLocation specifying the residues 3-8
Location loc = [Link](3,8);
//print the location
[Link]("Location: "+[Link]());
//make a SymbolList
SymbolList sl = [Link]("gcagcuaggcggaaggagc");
[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = [Link](sl);
[Link]("Symbols specified by Location: "+[Link]());
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}

[Link] [31/03/2003 15.28.24]

How do CircularLocations work?

How do CircularLocations
work?

A number of interesting DNA molecules, such as plasmids and bacterial chromosomes are circular.
Locations on a circular molecule are specified relative to some arbitrary origin.
In BioJava circular SymbolLists don't really exist. The underlying Symbols are ultimately stored as an
array of pointers to Symbols. The circular effect can be faked using a CircularView object (which
implements SymbolListView).
In a standard SymbolList it is not possible to access a Symbol using a Location that lies outside the
SymbolList. Trying to get the Symbol at 0 or length+1 will throw an IndexOutOfBounds exception. In
the case of a CircularView it is perfectly sensible to ask for the Symbol at 0 or -5 and expect to get a
Symbol. Because BioJava uses the biological numbering system a Sequence is number from 0 to length.
No limits are placed on indexing a CircularView and a special convention is used for numbering. The
Symbol indexed by 1 is the first Symbol in the underlying SymbolList. The Symbol indexed by 0 is the
base immediately before the Symbol 1, which in this case is also the last base in the underlying
SymbolList.
CircularLocations are dealt with using the CircularLocation class. CircularLocations are best constructed
using the LocationTools class. This is demonstrated in the example below.
NOTE: due to bugs in earlier versions of BioJava this recipe will give strange results unless you are
working off a fairly recent version of BioJava. To get the most up to date version follow the "How do I
get and install BioJava" link on the main page and read the section on cvs. biojava-live BioJava version
1.3 (when released) will be adequate.
import [Link].*;
import [Link].*;
public class SpecifyCircular {
public static void main(String[] args) {
try {
Location[] locs = new Location[3];
//make a CircularLocation specifying the residues 3-8 on a 20mer
locs[0] = [Link](3,8,20);
//make a CircularLocation specifying the residues 0-4 on a 20mer
locs[1] = [Link](0,4,20);
//make a CircularLocation specifying the residues 18-24 on a 20mer
locs[2] = [Link](18,24,20);
for (int i = 0; i < [Link]; i++){
//print the location
[Link]("Location: "+locs[i].toString());
//make a SymbolList
SymbolList sl = [Link]("gcagctaggcggaaggagct");

[Link] (1 di 2) [31/03/2003 15.28.25]

How do CircularLocations work?

[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = locs[i].symbols(sl);
[Link]("Symbol specified by Location: "+[Link]());
}
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.25]

How can I make a Feature?

How can I make a Feature?

In BioJava Features are a bit like an Annotation with a Location. There are various types of Features that all
implement the Feature interface. All Feature implementations contain an inner class called 'Template'. The
Template class specifies the minimum information needed to create a Feature. A feature is realized when the
feature template is passed as an argument to the createFeature method of an implementation of the
FeatureHolder interface.
Conveniently Sequence is a sub interface of FeatureHolder so it can hold features. Note that a SymbolList cannot
hold Features. Interestingly the Feature interface is also a sub interface of FeatureHolder. Because of this a
Feature can hold sub features in a nested hierarchy. This allows a 'gene' feature to hold 'exon' features and 'exon'
features to hold 'snp' features etc. There is a built in safety check that will prevent a feature holding itself.
Feature templates can be created de novo or copied from an existing Feature. The following example shows both
options.
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class MakeAFeature {


public static void main(String[] args) {
//get the feature template for a StrandedFeature
[Link] templ = new [Link]();
//fill in the template
[Link] = Annotation.EMPTY_ANNOTATION;
[Link] = new RangeLocation(3,6);
[Link] = "my feature";
[Link] = [Link];
[Link] = "interesting motif";
try {
//the sequence the feature will go on
Sequence seq = [Link]("atgcgcttaag","seq1");
[Link]([Link]()+" contains "+[Link]()+" features");

[Link]("adding new feature...");


//realize the feature on the Sequence and get a pointer to it so we can make
another
Feature f = [Link](templ);
[Link]([Link]()+" contains "+[Link]()+" features");
//make an identical template to that used to make f
templ = ([Link])[Link]();
//give it a different location and type
[Link] = new PointLocation(4);
[Link] = "point mutation";

[Link]("adding nested feature...");


[Link] (1 di 2) [31/03/2003 15.28.26]

How can I make a Feature?

//realize the new feature as a nested feature of f


[Link](templ);
//notice how the countFeatures() method only counts top level features
[Link]([Link]()+" contains "+[Link]()+" features");
[Link]([Link]()+" contains "+[Link]()+" features");
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.26]

How can I filter Features by type?

How can I filter Features by


type?
If you have just parsed a detailed Genbank file you will end up with a Sequence that contains
several Features of different types. It may be that you are only interested in Features of the
type "CDS" for example. To filter the Features you would use a FeatureFilter which can be used
to generate a FeatureHolder containing only the Features that get past the FeatureFilter.
The following example shows the use of a "byType" FeatureFilter.
import [Link].*;
import [Link].*;
public class FilterByType {
public static void main(String[] args) {
Sequence seq = null;
/*
* code here to intitailize seq with numerous different features
* possibly by reading a Genbank or similar file.
*
*/
//make a Filter for "CDS" types
FeatureFilter ff = new [Link]("CDS");
//get the filtered Features
FeatureHolder fh = [Link](ff);
//iterate over the Features in fh
for (Iterator i = [Link](); [Link](); ) {
Feature f = (Feature)[Link]();
}
}
}

[Link] [31/03/2003 15.28.27]

How do I Parse a Blast File?

How Do I Parse A BLAST


Result?

Much of the credit for this example belongs to Keith James.


A frequent task in bioinformatics is the generation of BLAST search results. BioJava has the ability to parse
"Blast-like" output such as Blast and HMMER using a trick that makes the BLAST output into SAX events that
can be listened for by registered listeners.
The basic pipeline is as follows:
Blast_output -> Generate SAX events --> Convert SAX events --> Build result objects

--> Store them in a list.

InputStream--> BLASTLikeSAXParser --> SeqSimilartyAdapter --> BlastLikeSearchBuilder --> List


The API is very flexible however for most purposes the following simple recipe will get you what you want.
import [Link].*;
import [Link].*;

import
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class BlastParser {


/**
* args[0] is assumed to be the name of a Blast output file
*/
public static void main(String[] args) {
try {
//get the Blast input as a Stream
InputStream is = new FileInputStream(args[0]);
//make a BlastLikeSAXParser
BlastLikeSAXParser parser = new BlastLikeSAXParser();
//make the SAX event adapter that will pass events to a Handler.
SeqSimilarityAdapter adapter = new SeqSimilarityAdapter();
//set the parsers SAX event adapter
[Link](adapter);
//The list to hold the SeqSimilaritySearchResults
List results = new ArrayList();
//create the SearchContentHandler that will build SeqSimilaritySearchResults
//in the results List
SearchContentHandler builder = new BlastLikeSearchBuilder(results,
[Link] (1 di 2) [31/03/2003 15.28.28]

How do I Parse a Blast File?

new DummySequenceDB("queries"), new DummySequenceDBInstallation());


//register builder with adapter
[Link](builder);
//parse the file, after this the result List will be populated with
//SeqSimilaritySearchResults
[Link](new InputSource(is));
formatResults(results);
}
catch (SAXException ex) {
//XML problem
[Link]();
}catch (IOException ex) {
//IO problem, possibly file not found
[Link]();
}
}

[Link] (2 di 2) [31/03/2003 15.28.28]

How Do I Parse a FASTA Search Result

How Do I Parse a FASTA


Search Result?

The procedure for parsing FASTA results is very similar to the procedure for parsing BLAST
results. If you take the recipe for the BLAST parser and replace this line
XMLReader parser = new BlastLikeSAXParser();

with
XMLReader parser = new FastaSearchSAXParser();

You will have a functional FASTA parser.

[Link] [31/03/2003 15.28.28]

How Do I Extract Information From Search Results?

How Do I Extract Information


From Search Results?

The Blast parsing and Fasta parsing procedures already discussed once the file is parsed a List of
SeqSimilaritySearchResult objects. One of these is made per query. Each SeqSimilaritySearchResult
contains a List of SeqSimilaritySearchHit objects which detail the hit from the Query to the Subject. Each
SeqSimilaritySearchHit object contains a List of SeqSimilaritySearchSubHit objects. These are equivalent
to the HSPs reported by BLAST.
The result, hit and subhits contain useful getXXX() methods to retrieve the stored information.
The code snippet below shows a private method that would take a List produced by a BLAST or FASTA
parser and then extracts the hit id (subject id), its bit score and its e score.
private static void formatResults(List results){
//iterate through each SeqSimilaritySearchResult
for (Iterator i = [Link](); [Link](); ) {
SeqSimilaritySearchResult result = (SeqSimilaritySearchResult)[Link]();
//iterate through the hits
for (Iterator i2 = [Link]().iterator(); [Link](); ) {
SeqSimilaritySearchHit hit = (SeqSimilaritySearchHit)[Link]();
//output the hit ID, bit score and e score
[Link]("subject:\t"+[Link]() +
" bits:\t"+[Link]()+
" e:\t"+[Link]());
}
}
}

[Link] [31/03/2003 15.28.29]

How Do I Count the Residues in a Sequence?

How Do I Count the Residues in


a Sequence?

Counting the residues in a Sequence is a fairly standard bioinformatics task. Generally you would construct an
array of ints and use some arbitrary indexing system. Better yet you could use an AlphabetIndex to impose a
standardized index. You would get one from the AlphabetManager using one of its getAlphabetIndex() methods.
Because this type of activity is so standard BioJava conveniently wraps up all the indexing etc into a class called
IndexedCount which is an implementation of the Count interface.
The following program reads some type of sequence file and counts the residues, printing the results to STDOUT.
Note that this program will not cope with ambiguity symbols. If you want to count ambiguity symbols you need
add a partial count for each Symbol that makes up the ambiguity If this is the case you would use this solution.

Solution 1
import [Link].*;
import [Link].*;

import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class CountResidues {


/**
* Takes 2 arguments, first is a sequence filename the second is an int argument
* that is equal to one of the formats supported by SeqIOTools. Suitable file types
* are:
* FASTADNA = 1;
* FASTAPROTEIN = 2;
* EMBL = 3;
* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
*/
public static void main(String[] args) {
//reference to object to hold the counts
Count counts = null;
try {
//open sequence file
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get a SequenceIterator for the sequences in the file
SequenceIterator iter = (SequenceIterator)[Link](
[Link](args[1]), br);
//for each sequence
while([Link]()){
[Link] (1 di 3) [31/03/2003 15.28.30]

How Do I Count the Residues in a Sequence?

Sequence seq = [Link]();


//if needed initialize counts
if(counts == null){
counts = new IndexedCount((FiniteAlphabet)[Link]());
}
//iterate through the Symbols in seq
for (Iterator i = [Link](); [Link](); ) {
AtomicSymbol sym = (AtomicSymbol)[Link]();
[Link](sym,1.0);
}
}
//now print the results
for (Iterator i = ((FiniteAlphabet)[Link]()).iterator();
[Link](); ) {
AtomicSymbol sym = (AtomicSymbol)[Link]();
[Link]([Link]()+" : "+[Link](sym));
}
}
catch (Exception ex) {
[Link]();
}
}
}

Solution 2
import [Link].*;
import [Link].*;

import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class CountResidues2 {


/**
* Takes 2 arguments, first is a sequence filename the second is an int argument
* that is equal to one of the formats supported by SeqIOTools. Suitable file types
* are:
* FASTADNA = 1;
* FASTAPROTEIN = 2;
* EMBL = 3;
* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
*/
public static void main(String[] args) {
//reference to object to hold the counts
Count counts = null;
[Link] (2 di 3) [31/03/2003 15.28.30]

How Do I Count the Residues in a Sequence?

try {
//open sequence file
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get a SequenceIterator for the sequences in the file
SequenceIterator iter = (SequenceIterator)[Link](
[Link](args[1]), br);
//for each sequence
while([Link]()){
Sequence seq = [Link]();
//if needed initialize counts
if(counts == null){
counts = new IndexedCount((FiniteAlphabet)[Link]());
}
//iterate through the Symbols in seq
for (Iterator i = [Link](); [Link](); ) {
Symbol sym = (Symbol)[Link]();
/*
* The Symbol may be ambiguous so add a partial count for each Symbol
* that makes up the ambiguity Symbol. Eg the DNA ambiguity n is made
* of an Alphabet of four Symbols so add 0.25 of a count to each.
*/
FiniteAlphabet subSymbols = (FiniteAlphabet)[Link]();
for (Iterator i2 = [Link](); [Link](); ) {
AtomicSymbol sym2 = (AtomicSymbol)[Link]();
[Link](sym2, 1.0 / (double)[Link]());
}
}
}
//now print the results
for (Iterator i = ((FiniteAlphabet)[Link]()).iterator();
[Link](); ) {
AtomicSymbol sym = (AtomicSymbol)[Link]();
[Link]([Link]()+" : "+[Link](sym));
}
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] (3 di 3) [31/03/2003 15.28.30]

How do I calculate the frequency of a Symbol in a Sequence?

How do I calculate the


frequency of a Symbol in a
Sequence?

One of the most useful classes in BioJava is the Distribution. A Distribution is a map from a Symbol to a
frequency. Distributions are trained with observed Symbols using a DistributionTrainerContext. A
DistributionTrainerContext can train several registered Distributions and will handle any Symbol from any
Alphabet. Ambiguous Symbols are divided amongst the AtomicSymbols that make up the ambiguous
BasisSymbol.
The following program demonstrates the training of three Distributions with Sequences from three different
Alphabets.
import
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class Frequency {


public static void main(String[] args) {
try {
//make a DNA SymbolList
SymbolList dna = [Link]("atcgctagcgtyagcntatsggca");
//make a RNA SymbolList
SymbolList rna = [Link]("aucgcuaucccaggga");
//make a protein SymbolList
SymbolList protein = [Link]("asrvgchvhilmkapqrt");
SymbolList[] sla = {dna, rna, protein};
//get a DistributionTrainerContext
DistributionTrainerContext dtc = new SimpleDistributionTrainerContext();
//make three Distributions
Distribution dnaDist =
[Link]([Link]());
Distribution rnaDist =
[Link]([Link]());
Distribution proteinDist =
[Link]([Link]());

[Link] (1 di 2) [31/03/2003 15.28.31]

How do I calculate the frequency of a Symbol in a Sequence?

Distribution[] da = {dnaDist, rnaDist, proteinDist};


//register the Distributions with the trainer
[Link](dnaDist);
[Link](rnaDist);
[Link](proteinDist);
//for each Sequence
for (int i = 0; i < [Link]; i++) {
//count each Symbol to the appropriate Distribution
for(int j = 1; j <= sla[i].length(); j++){
[Link](da[i], sla[i].symbolAt(j), 1.0);
}
}
//train the Distributions
[Link]();
//print the weights of
for (int i = 0; i <
for (Iterator iter =
[Link]();

each Distribution
[Link]; i++) {
((FiniteAlphabet)da[i].getAlphabet()).iterator();
) {

Symbol sym = (Symbol)[Link]();


[Link]([Link]()+" : "+da[i].getWeight(sym));
}
[Link]("\n");
}
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.31]

How can I turn a Count into a Distribution?

How can I turn a Count


into a Distribution?

A Count can be simply converted into a Distribution by using the static countToDistribution()
method from the DistributionTools class.
import [Link].*;
import [Link].*;
import [Link].*;
public class count2Dist {
public static void main(String[] args) {
FiniteAlphabet alpha = [Link]();
AlphabetIndex index = [Link](alpha);
try {
//make a Count
Count c = new IndexedCount(alpha);
[Link](RNATools.a(),35.0);
[Link](RNATools.c(),44.0);
[Link](RNATools.g(),68.0);
[Link](RNATools.u(),34.0);
[Link]("COUNT");
for (int i = 0; i < [Link](); i++) {
AtomicSymbol s = (AtomicSymbol)[Link](i);
[Link]([Link]()+" : "+[Link](s));
}
//make it into a Distribution
Distribution d = [Link](c);
[Link]("\nDISTRIBUTION");
for (int i = 0; i < [Link](); i++) {
Symbol s = [Link](i);
[Link]([Link]()+" : "+[Link](s));
}
}
catch (Exception ex) {
[Link]();
}
}

[Link] (1 di 2) [31/03/2003 15.28.32]

How can I turn a Count into a Distribution?

[Link] (2 di 2) [31/03/2003 15.28.32]

How can I generate a random Sequence from a Distribution?

How can I generate a random


Sequence from a Distribution?

BioJava Distribution objects have a method for sampling Symbols. By successively sampling enough
Symbols you can build up a random sequence. Because this is a common task a static method is provided
in DistributionTools called generateSequence().
The following program generates a random Sequence using a uniform Distribution over the DNA Alphabet.
The emitted sequence will differ each time although its composition should be close to 25% of each
residue. Non uniform distributions can be used to generate biased sequences.
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class RandomSequence {


public static void main(String[] args) {
//make a uniform distribution over the DNA Alphabet
Distribution dist = new UniformDistribution([Link]());
//generate a 700bp random sequence
Sequence seq = [Link]("random seq", dist, 700);
try {
//print it to STDOUT
[Link]([Link], seq);
}
catch (IOException ex) {
//io error
[Link]();
}
}
}

[Link] [31/03/2003 15.28.33]

How can I find the amount of information or entropy in a Distribution?

How can I find the amount of


information or entropy in a
Distribution?
The amount of information or entropy in a Distribution is a reflection of the redundancy of the
Distribution. Shannon information and Entropy can be calculated using static methods from the
DistributionTools class.
Shannon information is returned as a double and reflects the total information content. The entropy is
returned as a HashMap between each Symbol and its corresponding entropy. The following program
calculates both for a very biased Distribution.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class Entropy {
public static void main(String[] args) {
Distribution dist = null;
try {
//create a biased distribution
dist =
[Link]([Link]());
//set the weight of a to 0.97
[Link](DNATools.a(), 0.97);
//set the others to 0.01
[Link](DNATools.c(), 0.01);
[Link](DNATools.g(), 0.01);
[Link](DNATools.t(), 0.01);
}
catch (Exception ex) {
[Link]();
[Link](-1);
}
//calculate the information content
double info = [Link](dist);
[Link]("information = "+info+" bits");
[Link]("\n");
[Link] (1 di 2) [31/03/2003 15.28.34]

How can I find the amount of information or entropy in a Distribution?

//calculate the Entropy (using the conventional log base of 2)


HashMap entropy = [Link](dist, 2.0);
//print the Entropy of each residue
[Link]("Symbol\tEntropy");
for (Iterator i = [Link]().iterator(); [Link](); ) {
Symbol sym = (Symbol)[Link]();
[Link]([Link]()+ "\t" +[Link](sym));
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.34]

What is an easy way to tell if two Distributions have equal weights?

What is an easy way to tell if


two Distributions have equal
weights?

Testing two distributions for equal weights is a good way of telling if a training procedure has converged or
if two Sequences are likely to come from the same organism. It is a bit tedious to loop through all the
residues, especially in a large Alphabet. Fortunately there is a static method called
areEmissionSpectraEqual() in DistributionTools that checks for you.
Using this method is demonstrated below.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class EqualDistributions {
public static void main(String[] args) {
FiniteAlphabet alpha = [Link]();
//make a uniform distribution
Distribution uniform = new UniformDistribution(alpha);
try {
//make another Distribution with uniform weights
Distribution dist = [Link](alpha);
[Link](DNATools.a(), 0.25);
[Link](DNATools.c(), 0.25);
[Link](DNATools.g(), 0.25);
[Link](DNATools.t(), 0.25);
//test to see if the weights are equal
boolean equal = [Link](uniform, dist);
[Link]("Are 'uniform' and 'dist' equal? "+ equal);
}
catch (Exception ex) {
[Link]();
}
}
}

[Link] [31/03/2003 15.28.35]

How do I make a custom Alphabet then take an OrderNDistribution over it?

How do I make a custom


Alphabet then take an
OrderNDistribution over it?

This example demonstrates the creation of a custom Alphabet that will have seven Symbols. The custom made
Symbols and Alphabet can then be used to make SymbolLists, Sequences, Distributions etc. When the
AlphabetManager creates the CrossProductAlphabet, it will infer that the order of the conditioning alphabet is
(order - 1) and the order of the conditioned alphabet is 1.
Contributed by Russell Smithies.

import [Link].*;
import [Link].*;
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class DistTest {


public static void main(String[] args) throws Exception {
//create a custom dwarf Alphabet
String[] dNames = {
"Grumpy", "Sleepy", "Dopey", "Doc", "Happy", "Sneezy", "Bashful"
};
Symbol[] dwarfs = new Symbol[7];
SimpleAlphabet dwarfAlphabet = new SimpleAlphabet();
//give the new Alphabet a name
[Link]("Dwarf");
for (int i = 1; i <= 7; i++) {
try {
dwarfs[i - 1] = [Link]((char) ('0' + i), "" + dNames[i
- 1],Annotation.EMPTY_ANNOTATION);
//add your new Symbols to the Alphabet
[Link](dwarfs[i - 1]);
}
catch (Exception e) {
throw new NestedError(e, "Can't create symbols to represent dwarf");
}
//it is usual (but not essential) to register newly creates Alphabets with the
AlphabetManager
[Link]([Link](), dwarfAlphabet);

[Link] (1 di 3) [31/03/2003 15.28.36]

How do I make a custom Alphabet then take an OrderNDistribution over it?

}
Create an OrderNDstribution using the newly built Dwarf Alphabet
//order of the distribution
int order = 3;
//create the cross-product Alphabet
Alphabet a = [Link]([Link](order,
dwarfAlphabet));
//use the OrderNDistributionFactory to create the Distribution
OrderNDistribution ond =
(OrderNDistribution)[Link](a);
//create the DistributionTrainer
DistributionTrainerContext dtc = new SimpleDistributionTrainerContext();
//register the Distribution with the trainer
[Link](ond);

This shows the creation of of a SymbolList from the Dwarf Alphabet so we can test our new OrderNDistribution.
This is done by making, a UniformDistribution which is randomly sampled and adding the Symbols to an
ArrayList. The ArrayList is then used to build the SymbolList.
//create a random symbolList of dwarves
UniformDistribution udist = new
UniformDistribution((FiniteAlphabet)dwarfAlphabet);
int size = 100;
List list = new ArrayList();
for (int i = 0; i < size; i++) {
[Link]([Link]());
}
//create a symbolList to test the Distribution
SymbolList symbl = new SimpleSymbolList(dwarfAlphabet, list);

The SymbolList is changed into an OrderNSymbolList to enable an OrderNDistribution to be made over it.
//make it into an orderNSymbolList
symbl = [Link](symbl, order);
//or you could have a windowed symbolList
//symbl = [Link](symbl, order);
//add counts to the distribution
for (Iterator i = [Link](); [Link](); ) {
try {

[Link] (2 di 3) [31/03/2003 15.28.36]

How do I make a custom Alphabet then take an OrderNDistribution over it?

[Link](ond, (Symbol) [Link](), 1.0);


}
catch (IllegalSymbolException ex) {
//you tried to add a Symbol not in your Alphabet
[Link]()}
}
// don't forget to train or none of your weights will be added
[Link]();
//write the distribution to XML
XMLDistributionWriter writer = new XMLDistributionWriter();
[Link](ond, new FileOutputStream("[Link]"));
}
}

[Link] (3 di 3) [31/03/2003 15.28.36]

How can I write a Distribution to XML?

How can I write a Distribution


to XML?
If you frequently construct Distributions from large training sets for later analysis it is desirable to be
able to store these Distributions for latter use. One possibility is to serialize the Distribution to binary.
Serialization, while ideal for short term storage or communication between Java VMs, is fragile and
likely to break between different versions of BioJava. It is also impossible to inspect by eye.
A better solution is write the Distribution to XML, providing a long term, human readable and language
independent solution. The following example shows how a Distribution can be written to XML and read
back again. The example requires a fairly recent version of BioJava as the XMLDistributionWriter and
XMLDistributionReader are fairly new features. The cvs version or version 1.3 (when released) will be
adequate.
import [Link].*;
import [Link].*;
import [Link].*;
public class Dist2XMLandBack {
public static void main(String[] args) {
XMLDistributionWriter writer = new XMLDistributionWriter();
XMLDistributionReader reader = new XMLDistributionReader();
try {
File temp = [Link]("xmltemp",".xml");
//create a Distribution to write
Distribution d =
[Link]([Link]());
//give the Distribution some random values
[Link](d);
//write it to 'temp'
[Link](d, new FileOutputStream(temp));
//read it back in
Distribution d2 = [Link](new FileInputStream(temp));
//check that the weights are reproduced
boolean b = [Link](d,d2);
[Link]("Are values reproduced? "+b);
}
catch (Exception ex) {
[Link]();

[Link] (1 di 2) [31/03/2003 15.28.36]

How can I write a Distribution to XML?

}
}
}

[Link] (2 di 2) [31/03/2003 15.28.36]

How do I use a WeightMatrix to find a motif?

How do I use a WeightMatrix


to find a motif?

A Weight Matrix is a useful way of representing an alignment or a motif. It can also be used as a scoring
matrix to detect a similar motif in a sequence. BioJava contains a class call WeightMatrix in the
[Link] package. There is also a WeightMatrixAnnotator which uses the WeightMatrix to add
Features to any portion of the sequence being searched which exceed the scoring threshold.
The following program generates a WeightMatrix from an aligment and uses that matrix to annotate a
Sequence with a threshold of 0.1
import [Link].*;

import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class WeightMatrixDemo {


public static void main(String[] args) throws Exception{
//make an Alignment of a motif.
Map map = new HashMap();
[Link]("seq0", [Link]("aggag"));
[Link]("seq1", [Link]("aggaa"));
[Link]("seq2", [Link]("aggag"));
[Link]("seq3", [Link]("aagag"));
Alignment align = new SimpleAlignment(map);
//make a Distribution[] of the motif
Distribution[] dists =
[Link](align, false, 0.01);
//make a Weight Matrix
WeightMatrix matrix = new SimpleWeightMatrix(dists);
//the sequence to score against
Sequence seq = [Link]("aaagcctaggaagaggagctgat","seq");
//annotate the sequence with the weight matrix using a low threshold (0.1)
WeightMatrixAnnotator wma = new WeightMatrixAnnotator(matrix, 0.1);
seq = [Link](seq);
//output match information
for (Iterator it = [Link](); [Link](); ) {
Feature f = (Feature)[Link]();
Location loc = [Link]();
[Link]("Match at " + [Link]()+"-"+[Link]());

[Link] (1 di 2) [31/03/2003 15.28.37]

How do I use a WeightMatrix to find a motif?

[Link]("\tscore : "+[Link]().getProperty("score"));
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.37]

How do I make a ProfileHMM?

How do I make a ProfileHMM?

Profile HMMs (such as those used in the program HMMER) are very sensitive tools for searching for motifs. A
profile HMM is typically trained from a set of input sequences that contain the motif of interest using the
Baum-Welch algorithm. This algorithm optimises the parameters of the model until some stopping criteria is
satisfied. Once a profile HMM has been constructed the Viterbi algorithm can be used to determine the state
path most likely to have generated an observed (test) sequence. If sufficient match states are observed the test
sequence can be deemed to contain the motif, alternatively some scoring metric can be used (such as log odds)
and a cutoff threshold defined. The following demonstrates the construction and use of a ProfileHMM in BioJava.
The first step is to create the profile HMM.
/*
* Make a profile HMM over the DNA Alphabet with 12 'columns' and default
* DistributionFactories to construct the transition and emmission
* Distributions
*/
ProfileHMM hmm = new ProfileHMM([Link](),
12,
[Link],
[Link],
"my profilehmm");
//create the Dynamic Programming matrix for the model.
dp = [Link](hmm);

At this point you would read in a set of sequences that make up the training set.
//Database to hold the training set
SequenceDB db = new HashSequenceDB();
//code here to load the training set

Now initialize all of the model parameters to a uniform value. Alternatively parameters could be set randomly or
set to represent a guess at what the best model might be. Then use the Baum-Welch Algorithm to optimise the
parameters.
//train the model to have uniform parameters
ModelTrainer mt = new SimpleModelTrainer();
//register the model to train
[Link](hmm);
//as no other counts are being used the null weight will cause everything to be
uniform
[Link](1.0);
[Link]();
//create a BW trainer for the dp matrix generated from the HMM
BaumWelchTrainer bwt = new BaumWelchTrainer(dp);
//anonymous implementation of the stopping criteria interface to stop after 20
iterations

[Link] (1 di 2) [31/03/2003 15.28.38]

How do I make a ProfileHMM?

StoppingCriteria stopper = new StoppingCriteria(){


public boolean isTrainingComplete(TrainingAlgorithm ta){
return ([Link]() > 20);
}
};
/*
* optimize the dp matrix to reflect the training set in db using a null model
* weight of 1.0 and the Stopping criteria defined above.
*/
[Link](db,1.0,stopper);

Below is an example of scoring a sequence and outputting the state path.


SymbolList test = null;
//code here to initialize the test sequence
/*
* put the test sequence in an array, an array is used because for pairwise
* alignments using an HMM there would need to be two SymbolLists in the
* array
*/
SymbolList[] sla = {test};
//decode the most likely state path and produce an 'odds' score
StatePath path = [Link](sla, [Link]);
[Link]("Log Odds = "+[Link]());
//print state path
for(int i = 1; i <= [Link](); i++){
[Link]([Link]([Link], i).getName());
}

[Link] (2 di 2) [31/03/2003 15.28.38]

How can I view the Features and Annotations as a tree?

How can I view the Features


and Annotations as a tree?

Given that Sequences can hold Annotations, with their key value pairs, and Features, and that Features can
hold information, Annotations and nested Features, which can contain still more annotations, nested features
etc it would be useful to be able to view it all as a structured tree.
Fortunately the friendly BioJava team have made the FeatureTree class to let you see where all that structure
goes. The FeatureTree extends the JTree component and can easily be used in a GUI. The data used by the
tree is supplied in the form of a SequenceDB that can be made by reading a text file.
The following program demonstrates the use of a FeatureTree. It takes two arguments. The first is the name
of a file containing sequence data. The second is a number specifying the format of the data.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class TreeFrame extends JFrame {


private JPanel jPanel = new JPanel();
private JScrollPane jScrollPane1 = new JScrollPane();
private BorderLayout borderLayout = new BorderLayout();
private FeatureTree featureTree = new FeatureTree();
public TreeFrame() {
try {
init();
}
catch(Exception e) {
[Link]();
}
}
/**
* This program will read files supported by SeqIOTools and display its
* Sequence, Annotations and Features as a Tree. It takes two
* arguments, the first is the file name the second is the int constant
* for the file type in SeqIOTools. See SeqIOTools for possible file types.
* Valid constants for this program are:
*
* FASTADNA = 1;
* FASTAPROTEIN = 2;
* EMBL = 3;
[Link] (1 di 2) [31/03/2003 15.28.40]

How can I view the Features and Annotations as a tree?

* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
*
*/
public static void main(String[] args) throws Exception{
//read the sequence flat file
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the format type from the command line
int type = [Link](args[1]);
//read the sequences into a DB that will serve as the model for the tree
SequenceDB db = new HashSequenceDB();
SequenceIterator iter = (SequenceIterator)[Link](type, br);
while([Link]()){
[Link]([Link]());
}
[Link]([Link]());
TreeFrame treeFrame = new TreeFrame();
//set the SequenceDB to serve as the data model
[Link]().setSequenceDB(db);
[Link]();
[Link]();
}
private void init() throws Exception {
[Link](borderLayout);
[Link]("FeatureTree Demo");
[Link]().add(jPanel, [Link]);
[Link](jScrollPane1, [Link]);
[Link]().add(featureTree, null);
}
public FeatureTree getFeatureTree() {
return featureTree;
}
protected void processWindowEvent(WindowEvent we){
if([Link]() == WindowEvent.WINDOW_CLOSING){
[Link](0);
}else{
[Link](we);
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.40]

How can I display a Sequence in a GUI

How can I display a Sequence in a


GUI
When building a bioinformatics GUI you will probably want to display the sequence of residues in the Sequence you are displaying.
BioJava contains a number of GUI components that can render various aspects of a Sequence.
The basic unit of any Sequence based GUI is the SequenceRenderContext which holds the Sequence and sends instructions to a
SequenceRenderer which does the actual drawing of the Sequence. There are several SequenceRenderer implementations in
BioJava. The one to display the order of residues is the SymbolSequenceRenderer.
The following program demonstrates the use of a SequenceRenderContext and a SequenceRenderer to display the symbols in a
Sequence.
Below the program is a screen shot of the GUI.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class SeqView extends JFrame {
private Sequence seq;
private JPanel jPanel = new JPanel();
private SequencePanel seqPanel = new SequencePanel();
private SequenceRenderer symSeqRenderer = new SymbolSequenceRenderer();
public SeqView() {
try {
//create the sequence to display
seq = [Link]("accggcgcgagauuugcagcgcgcgcgcaucgcg"+
"gggcgcauuaccagacuucauucgacgacucagc"
,"rna1");
init();
}
catch(Exception e) {
[Link]();
}
}
public static void main(String[] args) {
SeqView seqView = new SeqView();
[Link]();
[Link]();
}
/**
* Set up the components to display the graphics
*/
private void init() throws Exception {
[Link]().setLayout(new BorderLayout());
[Link]().add(jPanel, [Link]);
[Link]("SeqView");
[Link](seqPanel, [Link]);
//set the sequence to display
[Link](seq);

[Link] (1 di 2) [31/03/2003 15.28.42]

How can I display a Sequence in a GUI

//set the object responsible for painting the sequence


[Link](symSeqRenderer);
//the amount of sequence to display
[Link](new RangeLocation(1,[Link]()));
}
/**
* Overide this to close the program when the window closes.
*/
protected void processWindowEvent(WindowEvent we){
if ([Link]() == WindowEvent.WINDOW_CLOSING) {
[Link](0);
}
else {
[Link](we);
}
}
}

[Link] (2 di 2) [31/03/2003 15.28.42]

How do I display Sequence coordinates?

How do I display Sequence


coordinates?

When displaying a sequence it is useful to display the coordinates of the sequence so you can tell where
you are up to. BioJava contains a SequenceRenderer implementation called a RulerRenderer that displays
Sequence coordinates.
Because a SequenceRenderContext can only use a single SequenceRenderer at a time you will need to use
a MultiLineRenderer. A MultiLineRenderer implements SequenceRenderer and can wrap up multiple
SequenceRenderers coordinating their displays as several tracks.
The use of a RulerRenderer and a MultiLineRenderer is demonstrated in the program below. A screen shot
of the GUI is displayed below the program.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class MultiView extends JFrame {
private JPanel jPanel = new JPanel();
private MultiLineRenderer mlr = new MultiLineRenderer();
private SequenceRenderer symR = new SymbolSequenceRenderer();
private RulerRenderer ruler = new RulerRenderer();
private SequencePanel seqPanel = new SequencePanel();
private Sequence seq;

public MultiView() {
try {
seq = [Link](
"agcgstyravlivtymaragrsecharlvahklchg",
"protein 1");
init();
}
catch(Exception e) {
[Link]();
}
}
public static void main(String[] args) {
MultiView multiView = new MultiView();
[Link]();
[Link]();
}
/**

[Link] (1 di 2) [31/03/2003 15.28.43]

How do I display Sequence coordinates?

* OverRide to allow termination of program.


*/
protected void processWindowEvent(WindowEvent we){
if ([Link]() == WindowEvent.WINDOW_CLOSING) {
[Link](0);
}
else {
[Link](we);
}
}
/**
* Set up GUI components
*/
private void init() throws Exception {
[Link]("MultiView");
[Link]().add(jPanel, [Link]);
[Link](seqPanel, [Link]);
//add the SymbolSequenceRenderer and RulerRenderer to the MultiLineRenderer
[Link](symR);
[Link](ruler);
//set the MultiLineRenderer as the main renderer
[Link](mlr);
//set the Sequence
[Link](seq);
//set the range to show
[Link](new RangeLocation(1,[Link]()));
}
}

[Link] (2 di 2) [31/03/2003 15.28.43]

How do I display features?

How do I display Features?

Features are displayed by implementations of the FeatureRenderer interface. FeatureRenderers work in


much the same way as SequenceRenderers and handle the drawing of the Features from a Sequence that is
held in a SequenceRenderContext.
A SequenceRenderContext has no way of interacting directly with a FeatureRenderer so a
FeatureBlockSequenceRenderer is used to wrap up the FeatureRenderer and act as a proxy.
The use of a FeatureBlockSequenceRenderer and a FeatureRenderer is demonstrated in the program below.
A screen shot follows the program.
import [Link].*;
import [Link].*;
import [Link].*;
import
import
import
import

[Link].*;
[Link].*;
[Link].*;
[Link].*;

public class FeatureView extends JFrame {


private Sequence seq;
private JPanel jPanel1 = new JPanel();
private MultiLineRenderer mlr = new MultiLineRenderer();
private FeatureRenderer featr = new BasicFeatureRenderer();
private SequenceRenderer seqR = new SymbolSequenceRenderer();
private SequencePanel seqPanel = new SequencePanel();
//the proxy between featr and seqPanel
private FeatureBlockSequenceRenderer fbr = new FeatureBlockSequenceRenderer();
public FeatureView() {
try {
seq = [Link](
"atcgcgcatgcgcgcgcgcgcgcgctttatagcgatagagatata",
"dna 1");
//create feature from 10 to 25
[Link] temp = new [Link]();
[Link] = Annotation.EMPTY_ANNOTATION;
[Link] = new RangeLocation(10,25);
[Link] = "";
[Link] = [Link];
[Link] = "";
//create another from 30 to 35
Feature f = [Link](temp);
temp = ([Link])[Link]();
[Link] = new RangeLocation(30,35);

[Link] (1 di 3) [31/03/2003 15.28.45]

How do I display features?

[Link] = [Link];
[Link](temp);
//setup GUI
init();
}
catch(Exception e) {
[Link]();
}
}
public static void main(String[] args) {
FeatureView featureView = new FeatureView();
[Link]();
[Link]();
}
/**
* initialize GUI components
*/
private void init() throws Exception {
[Link]("FeatureView");
[Link]().add(jPanel1, [Link]);
[Link](seqPanel, null);
//Register the FeatureRenderer with the FeatureBlockSequenceRenderer
[Link](featr);
//add Renderers to the MultiLineRenderer
[Link](fbr);
[Link](seqR);
//set the MultiLineRenderer as the SequencePanels renderer
[Link](mlr);
//set the Sequence to Render
[Link](seq);
//display the whole Sequence
[Link](new RangeLocation(1,[Link]()));
}
/**
* Overridden so program terminates when window closes
*/
protected void processWindowEvent(WindowEvent we){
if ([Link]() == WindowEvent.WINDOW_CLOSING) {
[Link](0);
}
else {
[Link](we);
}
[Link] (2 di 3) [31/03/2003 15.28.45]

How do I display features?

}
}

[Link] (3 di 3) [31/03/2003 15.28.45]

You might also like