Quick BioJava Programming Guide
Quick BioJava Programming Guide
BioJava In Anger
How Do I....?
Setup
How do I break Symbols from CrossProduct Alphabets into their component Symbols?
How do I make a Sequence from a String or make a Sequence Object back into a String?
BioJava In Anger
Translation
Sequence I/O
Annotations
How do I filter a Sequences based on their species (or another Annotation property)?
BioJava In Anger
User Interfaces
Disclaimer:
This code is generously donated by people who probably have better things to do. Where
possible we test it but errors may have crept in. As such, all code and advice here in has no
warranty or guarantee of any sort. You didn't pay for it and if you use it we are not responsible
for anything that goes wrong. Be a good programmer and test it yourself before unleashing it
on your corporate database.
This code is open-source. A good definition of open-source can be found here. If you agree
with that definition then you can use it.
In BioJava Alphabets are collections of Symbols. Common biological alphabets (DNA, RNA,
protein etc) are registered with the BioJava AlphabetManager at startup and can be accessed
by name. The DNA, RNA and protein alphabets can also be accessed using convenient static
methods from DNATools, RNATools and ProteinTools respectively.
Both of these approaches are shown in the example below
import [Link].*;
import [Link].*;
import [Link].*;
public class AlphabetExample {
public static void main(String[] args) {
Alphabet dna, rna, prot;
//get the DNA alphabet by name
dna = [Link]("DNA");
//get the RNA alphabet by name
rna = [Link]("RNA");
//get the Protein alphabet by name
prot = [Link]("PROTEIN");
//get the protein alphabet that includes the * termination Symbol
prot = [Link]("PROTEIN-TERM");
//get those same Alphabets from the Tools classes
dna = [Link]();
rna = [Link]();
prot = [Link]();
//or the one with the * symbol
prot = [Link]();
}
}
This example demonstrates the creation of a 'binary' alphabet that will have two Symbols, zero and one.
The custom made Symbols and Alphabet can then be used to make SymbolLists, Sequences, Distributions
etc.
import [Link].*;
import [Link].*;
import [Link].*;
public class Binary {
public static void main(String[] args) {
//make the "zero" Symbol with no annotation
Symbol zero =
[Link]("zero", Annotation.EMPTY_ANNOTATION);
//make the "one" Symbol
Symbol one =
[Link]("one", Annotation.EMPTY_ANNOTATION);
//collect the Symbols in a Set
Set symbols = new HashSet();
[Link](zero); [Link](one);
//make the Binary Alphabet
FiniteAlphabet binary = new SimpleAlphabet(symbols, "Binary");
//iterate through the symbols to show everything works
for (Iterator i = [Link](); [Link](); ) {
Symbol sym = (Symbol)[Link]();
[Link]([Link]());
}
//it is usual to register newly creates Alphabets with the AlphabetManager
[Link]([Link](), binary);
/*
* The newly created Alphabet will have been registered with the
* AlphabetManager under the name "Binary". If you retreive an instance
* of it using this name it should be canonical with the previous instance
*/
Alphabet alpha = [Link]("Binary");
[Link] (1 di 2) [31/03/2003 15.28.08]
How do I make a
CrossProductAlphabet such as
a codon Alphabet
CrossProductAlphabets result from the multiplication of other Alphabets. CrossProductAlphabets are used
to wrap up 2 or more Symbols into a single "cross product" Symbol. For example using a 3 way cross of
the DNA alphabet you could wrap a codon as a Symbol. You could then count those codon Symbols in a
Count or you could used them in a Distribution.
CrossProductAlphabets can be created by name (if the component Alphabets are registered in the
AlphabetManager) or by making a list of the desired Alphabets and creating the Alphabet from the List.
Both approaches are shown in the example below.
import [Link].*;
import [Link].*;
import [Link].*;
public class CrossProduct {
public static void main(String[] args) {
//make a CrossProductAlphabet from a List
List l = [Link](3, [Link]());
Alphabet codon = [Link](l);
//get the same Alphabet by name
Alphabet codon2 =
[Link]("(DNA x DNA x DNA)");
//show that the two Alphabets are canonical
[Link](codon == codon2);
}
}
How do I break Symbols from CrossProduct Alphabets into their component Symbols?
How do I break Symbols from CrossProduct Alphabets into their component Symbols?
In Biojava the same Alphabets and the same Symbols are canonical no matter how they where
constructed or where they came from. This means that if two DNA alphabets (or Symbols from
those alphabets) are instantiated at different times are equal via both the .equals() and ==
functions. Also Symbols from the PROTEIN and the PROTEIN-TERM alphabets are canonical as
are Symbols from the IntegerAlphabet and the SubIntegerAlphabets.
This is even true of Alphabets and Symbols on different virtual machines (thanks to some
Serialization magic) which means BioJava works across RMI.
import [Link].*;
import [Link].*;
public class Canonical {
public static void main(String[] args) {
//get the DNA alphabet two ways
Alphabet a1 = [Link]();
Alphabet a2 = [Link]("DNA");
//are they equal
[Link]("equal: "+ [Link](a2));
//are they canonical
[Link]("canonical: "+ (a1 == a2));
}
}
}
}
}
How do I make a Sequence from a String or make a Sequence Object back into a String?
String to SymbolList
import [Link].*;
import [Link].*;
public class StringToSymbolList {
public static void main(String[] args) {
try {
//create a DNA SymbolList from a String
SymbolList dna = [Link]("atcggtcggctta");
//create a RNA SymbolList from a String
SymbolList rna = [Link]("auugccuacauaggc");
//create a Protein SymbolList from a String
SymbolList aa = [Link]("AGFAVENDSA");
}
How do I make a Sequence from a String or make a Sequence Object back into a String?
String to Sequence
import [Link].*;
import [Link].*;
public class StringToSequence {
public static void main(String[] args) {
try {
//create a DNA sequence with the name dna_1
Sequence dna = [Link]("atgctg", "dna_1");
//create an RNA sequence with the name rna_1
Sequence rna = [Link]("augcug", "rna_1");
//create a Protein sequence with the name prot_1
Sequence prot = [Link]("AFHS", "prot_1");
}
catch (IllegalSymbolException ex) {
//an exception is thrown if you use a non IUB symbol
[Link]();
}
}
}
SymbolList to String
You can call the seqString() method on either a SymbolList or a Sequence to get it's Stringified
version.
import [Link].*;
public class SymbolListToString {
public static void main(String[] args) {
SymbolList sl = null;
//code here to instantiate sl
//convert sl into a String
String s = [Link]();
}
}
Complete Listing
import [Link].*;
import [Link].*;
public class SubSequencing {
public static void main(String[] args) {
SymbolList symL = null;
//generate an RNA SymbolList
try {
symL = [Link]("auggcaccguccagauu");
}
[Link] (1 di 2) [31/03/2003 15.28.13]
How do I Reverse
Complement a Sequence or
SymbolList?
To reverse complement a DNA SymbolList or Sequence simply use the
[Link](SymbolList sl) method. An equivalent method is found in
RNATools for performing the same operation on RNA based Sequences and SymbolLists.
import [Link].*;
import [Link].*;
public class ReverseComplement {
public static void main(String[] args) {
try {
//make a DNA SymbolList
SymbolList symL = [Link]("atgcacgggaactaa");
//reverse complement it
symL = [Link](symL);
//prove that it worked
[Link]([Link]());
}
catch (IllegalSymbolException ex) {
//this will happen if you try and make the DNA seq using non IUB symbols
[Link]();
}catch (IllegalAlphabetException ex) {
//this will happen if you try and reverse complement a non DNA sequence
using DNATools
[Link]();
}
}
Mostly BioJava Sequence objects are immutable. This is really a safety feature to prevent changes
corrupting the integrity of the data. A consequence of this is that there is no setName() method in
Sequence. One way to change your "view" of a Sequence is to make a ViewSequence using the
original Sequence as an argument in the constructor. Behind the scenes the ViewSequence
wrapper intercepts some of the method calls to the underlying Sequence which gives the
possibility of changing the name.
The following program demonstrates this.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class NameChange {
public static void main(String[] args) {
try {
Sequence seq =
[Link]("atgcgctaggctag","gi|12356|ABC123");
//create a veiw on the sequence and change its name
ViewSequence seq2 = new ViewSequence(seq, "ABC123");
//print to FASTA to prove the name has changed
[Link]([Link], seq2);
}
catch (IllegalSymbolException ex) {
//tried to make seq with non DNA symbol
[Link]();
}catch (IOException ex) {
//couldn't print seq2 to System out??
[Link]();
}
}
}
How Do I Translate a
SymbolList or Sequence?
Transcribe to RNA.
Translate to protein.
Almost all of this can be achieved using static methods from BioJava tools classes. The
following block of code demonstrates the procedure. Obviously if you already have an RNA
sequence there is no need to transcribe it.
NOTE: if you try and create a 'triplet view' on a SymbolList or Sequence who's length is not
evenly divisible by three an IllegalArgumentException will be thrown. See 'how to get a
subsequence' for a description of how to get a portion of a Sequence for translation.
import [Link].*;
import [Link].*;
public class Translate {
public static void main(String[] args) {
try {
//create a DNA SymbolList
SymbolList symL = [Link]("atggccattgaatga");
//transcribe to RNA
symL = [Link](symL);
//translate to protein
symL = [Link](symL);
//prove that it worked
[Link]([Link]());
}
catch (IllegalAlphabetException ex) {
/*
* this will occur if you try and transcribe a non DNA sequence or translate
* a sequence that isn't a triplet view on a RNA sequence.
*/
[Link]();
}catch (IllegalSymbolException ex) {
// this will happen if non IUB characters are used to create the DNA
SymbolList
[Link]();
}
}
How do I translate a
single codon to a single amino
acid?
The general translation example shows how to use RNATools to translate a RNA SymbolList into a Protein
SymbolList but most of what goes on is hidden behind the convenience method translate(). If you only want to
translate a single codon into a single amino acid you get exposed to a bit more of the gory detail but you also
get a chance to figure out more of what is going on under the hood.
There are actually a number of ways to do this, below I have presented only one.
import [Link].*;
import [Link].*;
public class SingleTranslationDemo {
public static void main(String[] args) {
//make a compound alphabet where codons are Symbols
Alphabet a = [Link]("(RNA x RNA x RNA)");
//get our translation table using one of the static names from TranslationTable
TranslationTable table = [Link]([Link]);
try {
//make a 'codon'
SymbolList codon = [Link]("UUG");
//get the representation of that codon as a Symbol
Symbol sym = [Link]([Link]());
//translate to amino acid
Symbol aminoAcid = [Link](sym);
/*
* This bit is not required for the translation it just proves that the
* Symbol is from the right Alphabet. An Exception will be thrown if it
* isn't.
*/
[Link]().validate(aminoAcid);
}
catch (IllegalSymbolException ex) {
[Link]();
}
}
}
New Page 0
The convenient translate() method in RNATools, used in the general translation example, is only useful if
you want to use the "Universal" translation table. This is not so good if you want to use one of those
weird Mitochondrial translation tables. Fortunately this can be done in BioJava. RNATools also has a static
method getGeneticCode(String name) that lets you get a TranslationTable by name.
The following TranslationTables are available:
FLATWORM_MITOCHONDRIAL
YEAST_MITOCHONDRIAL
ASCIDIAN_MITOCHONDRIAL
EUPLOTID_NUCLEAR
UNIVERSAL
INVERTEBRATE_MITOCHONDRIAL
BLEPHARISMA_MACRONUCLEAR
ALTERNATIVE_YEAST_NUCLEAR
BACTERIAL
VERTEBRATE_MITOCHONDRIAL
CILIATE_NUCLEAR
MOLD_MITOCHONDRIAL
ECHINODERM_MITOCHONDRIAL
These are also the valid names that can be used as an argument in the static
[Link](String name) method. These names are also available as static Strings in the
TranslationTools class.
The following program shows the use of the Euplotid Nuclear translation table (where UGA = Cys).
import [Link].*;
import [Link].*;
public class AlternateTranslation {
public static void main(String[] args) {
//get the Euplotoid translation table
TranslationTable eup = [Link](TranslationTable.EUPL_NUC);
try {
//make a DNA sequence including the 'tga' codon
SymbolList seq = [Link]("atgggcccatgaaaaggcttggagtaa");
//transcribe to RNA
seq = [Link](seq);
//veiw the RNA sequence as codons, this is done internally by
[Link]()
New Page 0
Printing a SequenceDB
//make a instance of the SequenceDB interface
SequenceDB db = new HashSequenceDB();
//add the sequences to the DB
[Link](seq1);
[Link](seq2);
/*
* now print it to an output stream in FASTA format using a static method
* from the utility class SeqIOTools. In this case our output stream is
* STDOUT
*/
[Link]([Link], db);
/*
* SeqIOTools also has a method that takes a single sequence so you don't
* have to make a SequenceDB
*/
[Link]([Link], seq1);
New Page 0
One of the most frequent I/O tasks is the reading of a flat file representation of sequence into
memory. SeqIOTools provides some basic static methods to read files into BioJava. There is
actually more than one solution. The more specific is demonstrated first and the more general
second.
Solution 1
import [Link].*;
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
New Page 0
Solution 2
import [Link].*;
import [Link].*;
import [Link].*;
public class ReadFasta2 {
/**
* This program will read any file supported by SeqIOTools it takes two
* arguments, the first is the file name the second is the int constant
* for the file type in SeqIOTools. See SeqIOTools for possible file types.
* The constant for Fasta DNA is 1
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the int constant for Fasta file type
int fileType = [Link](args[1]);
/*
* get a Sequence Iterator over all the sequences in the file.
* [Link]() returns an Object. If the file read
* is an alignment format like MSF and Alignment object is returned
* otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (NumberFormatException ex) {
//args[1] is not an integer
[Link]();
}
}
}
The SeqIOTools class contains methods for reading GenBank, SwissProt and EMBL files. Because any of
these files can contain more than one sequence entry SeqIOTools will return a SequenceIterator which can
be used to iterate through the individual sequences. One of the attractive features of this model is that the
Sequences are only parsed and created as needed so very large collections of sequences can be handled
with moderate resources.
Information in the file is store in the Sequence as Annotations or where there is location information as
Features.
Three specific solutions are presented (which are all very similar) followed by a generic solution (for
biojava1.3 pre1). A fourth solution revises the generic solution for the biojava1.3 API which is a bit
friendlier.
Reading GenBank
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
Reading SwissProt
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
}
catch (BioException ex) {
//not in SwissProt format
[Link]();
}catch (NoSuchElementException ex) {
//request for more sequence when there isn't any
[Link]();
}
}
}
}
Reading EMBL
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link]();
}catch (NoSuchElementException ex) {
//request for more sequence when there isn't any
[Link]();
}
}
}
}
*/
SequenceIterator iter =
(SequenceIterator)[Link](fileType, br);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (NumberFormatException ex) {
//args[1] is not an integer
[Link]();
}
}
}
import [Link].*;
import [Link].*;
import [Link].*;
public class GeneralReader {
/**
* This program will read any file supported by SeqIOTools it takes three
* arguments, the first is the file name the second is the format type the
* third is the type of residue being read. Illegal combinations such as
* SwissProt and DNA will cause an exception.
*
* Allowed formats are: (case insensitive).
*
* FASTA
* EMBL
* GENBANK
* SWISSPROT (or swiss)
* GENPEPT
*
* Allowed sequence types are: (case insensititve).
*
* DNA
* AA (or Protein)
* RNA
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
/*
* get a Sequence Iterator over all the sequences in the file.
* [Link]() returns an Object. If the file read
* is an alignment format like MSF and Alignment object is returned
* otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](format, alpha, br);
// do something with the sequences
[Link]([Link], iter);
}
catch (FileNotFoundException ex) {
//can't find file specified by args[0]
[Link]();
}catch (BioException ex) {
//invalid file format name
[Link]();
}catch (IOException ex){
//error writing to fasta
[Link]();
}
}
}
How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?
How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?
import [Link].*;
import [Link].*;
import [Link].*;
public class GeneralReader {
/**
* This program will read any file supported by SeqIOTools it takes three
* arguments, the first is the file name the second is the format type the
* third is the type of residue being read. Illegal combinations such as
* SwissProt and DNA will cause an exception.
*
* Allowed formats are: (case insensitive).
*
* FASTA
* EMBL
* GENBANK
* SWISSPROT (or swiss)
* GENPEPT
*
* Allowed sequence types are: (case insensititve).
*
* DNA
* AA (or Protein)
* RNA
*
*/
public static void main(String[] args) {
try {
//prepare a BufferedReader for file io
BufferedReader br = new BufferedReader(new FileReader(args[0]));
How do I extract Sequences from GenBank/ EMBL/ SwissProt etc and write them as Fasta?
/*
get a Sequence Iterator over all the sequences in the file.
[Link]() returns an Object. If the file read
is an alignment format like MSF and Alignment object is returned
otherwise a SequenceIterator is returned.
*/
SequenceIterator iter =
(SequenceIterator)[Link](format, alpha, br);
*
*
*
*
A lot of Bioinformatics begins with the reading of a piece of DNA (or several pieces) using a
DNA sequencer. A typical output is an ABI trace. BioJava contains a Class called ABITrace that
will parse either an ABITrace file or URL or a byte[] and store its values for programmatic
retrieval.
The following program is modified from a version kindly supplied by Matthew Pocock. It
demonstrates the creation of a BioJava Sequence from an ABI trace file.
import [Link].*;
import
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
}
}
AY130859
AY130859;
AY130859.1
25-JUL-2002 (Rel. 72, Created)
25-JUL-2002 (Rel. 72, Last updated, Version 1)
Homo sapiens cyclin-dependent kinase 7 (CDK7) gene, complete cds.
.
Homo sapiens (human)
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
Eutheria; Primates; Catarrhini; Hominidae; Homo.
[1]
1-44226
Rieder M.J., Livingston R.J., Braun A.C., Montoya M.A., Chung M.-W.,
Miyamoto K.E., Nguyen C.P., Nguyen D.A., Poel C.L., Robertson P.D.,
Schackwitz W.S., Sherwood J.K., Witrak L.A., Nickerson D.A.;
;
Submitted (11-JUL-2002) to the EMBL/GenBank/DDBJ databases.
Genome Sciences, University of Washington, 1705 NE Pacific, Seattle, WA
98195, USA
To cite this work please use: NIEHS-SNPs, Environmental Genome
Project, NIEHS ES15478, Department of Genome Sciences, Seattle, WA
(URL: [Link]
The following program reads an EMBL file and lists its Annotation properties. The output of this
program on the above file is listed below the program.
import [Link].*;
import [Link].*;
[Link] (1 di 3) [31/03/2003 15.28.22]
import [Link].*;
import [Link].*;
import [Link].*;
public class ListAnnotations {
public static void main(String[] args) {
try {
//read in an EMBL Record
BufferedReader br = new BufferedReader(new FileReader(args[0]));
SequenceIterator seqs = [Link](br);
//for each sequence list the annotations
while([Link]()){
Annotation anno = [Link]().getAnnotation();
//print each key value pair
for (Iterator i = [Link]().iterator(); [Link](); ) {
Object key = [Link]();
[Link](key +" : "+ [Link](key));
}
}
}
catch (Exception ex) {
[Link]();
}
}
}
Program Output
RN : [1]
KW : .
RL : [Submitted (11-JUL-2002) to the EMBL/GenBank/DDBJ databases., Genome
Sciences, University of Washington, 1705 NE Pacific, Seattle, WA, 98195, USA]
embl_accessions : [AY130859]
DE : Homo sapiens cyclin-dependent kinase 7 (CDK7) gene, complete cds.
SV : AY130859.1
AC : AY130859;
FH : Key Location/Qualifiers
XX :
OC : [Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;,
Eutheria; Primates; Catarrhini; Hominidae; Homo.]
RA : [Rieder M.J., Livingston R.J., Braun A.C., Montoya M.A., Chung M.-W.,,
Miyamoto K.E., Nguyen C.P., Nguyen D.A., Poel C.L., Robertson P.D.,, Schackwitz
W.S., Sherwood J.K., Witrak L.A., Nickerson D.A.;]
ID : AY130859 standard; DNA; HUM; 44226 BP.
DT : [25-JUL-2002 (Rel. 72, Created), 25-JUL-2002 (Rel. 72, Last updated, Version
1)]
CC : [To cite this work please use: NIEHS-SNPs, Environmental Genome, Project,
NIEHS ES15478, Department of Genome Sciences, Seattle, WA, (URL:
[Link]
RT : ;
OS : Homo sapiens (human)
RP : 1-44226
The species field of a GenBank SwissProt or EMBL file ends up as an Annotation entry. Essentially all you
need to do is get the species property from a sequences Annotation and check to see if it is what you
want.
The species property name depends on the source: for EMBL or SwissProt it is "OS" for GenBank it is
"Organism".
The following program will read in Sequences from a file and filter them according to their species. The
same general recipe with a little modification could be used for any Annotation property.
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link](seq);
}
}
}
//write the sequences as FASTA
[Link]([Link], db);
}
catch (Exception ex) {
[Link]();
}
}
}
How do I specify a
PointLocation?
In BioJava locations in a Sequence are specified by simple objects that implement the interface
Location.
A point location is the inclusive location of a single symbol in a SymbolList or Sequence.
PointLocations have public constructors and are easy to instantiate. The following example
demonstrates the creation of a PointLocation and it's specification of a single Symbol in a SymbolList.
Remember that BioJava uses the biological coordinate system thus the first PointLocation in a
Sequence will be 1 not 0.
import [Link].*;
import [Link].*;
public class SpecifyPoint {
public static void main(String[] args) {
try {
//make a PointLocation specifying the third residue
PointLocation point = new PointLocation(3);
//print the location
[Link]("Location: "+[Link]());
//make a SymbolList
SymbolList sl = [Link]("gcagcuaggcggaaggagc");
[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = [Link](sl);
//in this case the SymbolList will only have one base
[Link]("Symbol specified by Location: "+[Link]());
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}
How do I specify a
RangeLocation?
In BioJava a RangeLocation is an object that holds the minimum and maximum bounds of a region on
a SymbolList or Sequence. The minimum and maximum are inclusive.
The following example demonstrates the use of a RangeLocation.
import [Link].*;
import [Link].*;
public class SpecifyRange {
public static void main(String[] args) {
try {
//make a RangeLocation specifying the residues 3-8
Location loc = [Link](3,8);
//print the location
[Link]("Location: "+[Link]());
//make a SymbolList
SymbolList sl = [Link]("gcagcuaggcggaaggagc");
[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = [Link](sl);
[Link]("Symbols specified by Location: "+[Link]());
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}
How do CircularLocations
work?
A number of interesting DNA molecules, such as plasmids and bacterial chromosomes are circular.
Locations on a circular molecule are specified relative to some arbitrary origin.
In BioJava circular SymbolLists don't really exist. The underlying Symbols are ultimately stored as an
array of pointers to Symbols. The circular effect can be faked using a CircularView object (which
implements SymbolListView).
In a standard SymbolList it is not possible to access a Symbol using a Location that lies outside the
SymbolList. Trying to get the Symbol at 0 or length+1 will throw an IndexOutOfBounds exception. In
the case of a CircularView it is perfectly sensible to ask for the Symbol at 0 or -5 and expect to get a
Symbol. Because BioJava uses the biological numbering system a Sequence is number from 0 to length.
No limits are placed on indexing a CircularView and a special convention is used for numbering. The
Symbol indexed by 1 is the first Symbol in the underlying SymbolList. The Symbol indexed by 0 is the
base immediately before the Symbol 1, which in this case is also the last base in the underlying
SymbolList.
CircularLocations are dealt with using the CircularLocation class. CircularLocations are best constructed
using the LocationTools class. This is demonstrated in the example below.
NOTE: due to bugs in earlier versions of BioJava this recipe will give strange results unless you are
working off a fairly recent version of BioJava. To get the most up to date version follow the "How do I
get and install BioJava" link on the main page and read the section on cvs. biojava-live BioJava version
1.3 (when released) will be adequate.
import [Link].*;
import [Link].*;
public class SpecifyCircular {
public static void main(String[] args) {
try {
Location[] locs = new Location[3];
//make a CircularLocation specifying the residues 3-8 on a 20mer
locs[0] = [Link](3,8,20);
//make a CircularLocation specifying the residues 0-4 on a 20mer
locs[1] = [Link](0,4,20);
//make a CircularLocation specifying the residues 18-24 on a 20mer
locs[2] = [Link](18,24,20);
for (int i = 0; i < [Link]; i++){
//print the location
[Link]("Location: "+locs[i].toString());
//make a SymbolList
SymbolList sl = [Link]("gcagctaggcggaaggagct");
[Link]("SymbolList: "+[Link]());
//get the SymbolList specified by the Location
SymbolList sym = locs[i].symbols(sl);
[Link]("Symbol specified by Location: "+[Link]());
}
}
catch (IllegalSymbolException ex) {
//illegal symbol used to make sl
[Link]();
}
}
}
In BioJava Features are a bit like an Annotation with a Location. There are various types of Features that all
implement the Feature interface. All Feature implementations contain an inner class called 'Template'. The
Template class specifies the minimum information needed to create a Feature. A feature is realized when the
feature template is passed as an argument to the createFeature method of an implementation of the
FeatureHolder interface.
Conveniently Sequence is a sub interface of FeatureHolder so it can hold features. Note that a SymbolList cannot
hold Features. Interestingly the Feature interface is also a sub interface of FeatureHolder. Because of this a
Feature can hold sub features in a nested hierarchy. This allows a 'gene' feature to hold 'exon' features and 'exon'
features to hold 'snp' features etc. There is a built in safety check that will prevent a feature holding itself.
Feature templates can be created de novo or copied from an existing Feature. The following example shows both
options.
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
import
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
The procedure for parsing FASTA results is very similar to the procedure for parsing BLAST
results. If you take the recipe for the BLAST parser and replace this line
XMLReader parser = new BlastLikeSAXParser();
with
XMLReader parser = new FastaSearchSAXParser();
The Blast parsing and Fasta parsing procedures already discussed once the file is parsed a List of
SeqSimilaritySearchResult objects. One of these is made per query. Each SeqSimilaritySearchResult
contains a List of SeqSimilaritySearchHit objects which detail the hit from the Query to the Subject. Each
SeqSimilaritySearchHit object contains a List of SeqSimilaritySearchSubHit objects. These are equivalent
to the HSPs reported by BLAST.
The result, hit and subhits contain useful getXXX() methods to retrieve the stored information.
The code snippet below shows a private method that would take a List produced by a BLAST or FASTA
parser and then extracts the hit id (subject id), its bit score and its e score.
private static void formatResults(List results){
//iterate through each SeqSimilaritySearchResult
for (Iterator i = [Link](); [Link](); ) {
SeqSimilaritySearchResult result = (SeqSimilaritySearchResult)[Link]();
//iterate through the hits
for (Iterator i2 = [Link]().iterator(); [Link](); ) {
SeqSimilaritySearchHit hit = (SeqSimilaritySearchHit)[Link]();
//output the hit ID, bit score and e score
[Link]("subject:\t"+[Link]() +
" bits:\t"+[Link]()+
" e:\t"+[Link]());
}
}
}
Counting the residues in a Sequence is a fairly standard bioinformatics task. Generally you would construct an
array of ints and use some arbitrary indexing system. Better yet you could use an AlphabetIndex to impose a
standardized index. You would get one from the AlphabetManager using one of its getAlphabetIndex() methods.
Because this type of activity is so standard BioJava conveniently wraps up all the indexing etc into a class called
IndexedCount which is an implementation of the Count interface.
The following program reads some type of sequence file and counts the residues, printing the results to STDOUT.
Note that this program will not cope with ambiguity symbols. If you want to count ambiguity symbols you need
add a partial count for each Symbol that makes up the ambiguity If this is the case you would use this solution.
Solution 1
import [Link].*;
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
Solution 2
import [Link].*;
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
try {
//open sequence file
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get a SequenceIterator for the sequences in the file
SequenceIterator iter = (SequenceIterator)[Link](
[Link](args[1]), br);
//for each sequence
while([Link]()){
Sequence seq = [Link]();
//if needed initialize counts
if(counts == null){
counts = new IndexedCount((FiniteAlphabet)[Link]());
}
//iterate through the Symbols in seq
for (Iterator i = [Link](); [Link](); ) {
Symbol sym = (Symbol)[Link]();
/*
* The Symbol may be ambiguous so add a partial count for each Symbol
* that makes up the ambiguity Symbol. Eg the DNA ambiguity n is made
* of an Alphabet of four Symbols so add 0.25 of a count to each.
*/
FiniteAlphabet subSymbols = (FiniteAlphabet)[Link]();
for (Iterator i2 = [Link](); [Link](); ) {
AtomicSymbol sym2 = (AtomicSymbol)[Link]();
[Link](sym2, 1.0 / (double)[Link]());
}
}
}
//now print the results
for (Iterator i = ((FiniteAlphabet)[Link]()).iterator();
[Link](); ) {
AtomicSymbol sym = (AtomicSymbol)[Link]();
[Link]([Link]()+" : "+[Link](sym));
}
}
catch (Exception ex) {
[Link]();
}
}
}
One of the most useful classes in BioJava is the Distribution. A Distribution is a map from a Symbol to a
frequency. Distributions are trained with observed Symbols using a DistributionTrainerContext. A
DistributionTrainerContext can train several registered Distributions and will handle any Symbol from any
Alphabet. Ambiguous Symbols are divided amongst the AtomicSymbols that make up the ambiguous
BasisSymbol.
The following program demonstrates the training of three Distributions with Sequences from three different
Alphabets.
import
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link].*;
each Distribution
[Link]; i++) {
((FiniteAlphabet)da[i].getAlphabet()).iterator();
) {
A Count can be simply converted into a Distribution by using the static countToDistribution()
method from the DistributionTools class.
import [Link].*;
import [Link].*;
import [Link].*;
public class count2Dist {
public static void main(String[] args) {
FiniteAlphabet alpha = [Link]();
AlphabetIndex index = [Link](alpha);
try {
//make a Count
Count c = new IndexedCount(alpha);
[Link](RNATools.a(),35.0);
[Link](RNATools.c(),44.0);
[Link](RNATools.g(),68.0);
[Link](RNATools.u(),34.0);
[Link]("COUNT");
for (int i = 0; i < [Link](); i++) {
AtomicSymbol s = (AtomicSymbol)[Link](i);
[Link]([Link]()+" : "+[Link](s));
}
//make it into a Distribution
Distribution d = [Link](c);
[Link]("\nDISTRIBUTION");
for (int i = 0; i < [Link](); i++) {
Symbol s = [Link](i);
[Link]([Link]()+" : "+[Link](s));
}
}
catch (Exception ex) {
[Link]();
}
}
BioJava Distribution objects have a method for sampling Symbols. By successively sampling enough
Symbols you can build up a random sequence. Because this is a common task a static method is provided
in DistributionTools called generateSequence().
The following program generates a random Sequence using a uniform Distribution over the DNA Alphabet.
The emitted sequence will differ each time although its composition should be close to 25% of each
residue. Non uniform distributions can be used to generate biased sequences.
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
Testing two distributions for equal weights is a good way of telling if a training procedure has converged or
if two Sequences are likely to come from the same organism. It is a bit tedious to loop through all the
residues, especially in a large Alphabet. Fortunately there is a static method called
areEmissionSpectraEqual() in DistributionTools that checks for you.
Using this method is demonstrated below.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class EqualDistributions {
public static void main(String[] args) {
FiniteAlphabet alpha = [Link]();
//make a uniform distribution
Distribution uniform = new UniformDistribution(alpha);
try {
//make another Distribution with uniform weights
Distribution dist = [Link](alpha);
[Link](DNATools.a(), 0.25);
[Link](DNATools.c(), 0.25);
[Link](DNATools.g(), 0.25);
[Link](DNATools.t(), 0.25);
//test to see if the weights are equal
boolean equal = [Link](uniform, dist);
[Link]("Are 'uniform' and 'dist' equal? "+ equal);
}
catch (Exception ex) {
[Link]();
}
}
}
This example demonstrates the creation of a custom Alphabet that will have seven Symbols. The custom made
Symbols and Alphabet can then be used to make SymbolLists, Sequences, Distributions etc. When the
AlphabetManager creates the CrossProductAlphabet, it will infer that the order of the conditioning alphabet is
(order - 1) and the order of the conditioned alphabet is 1.
Contributed by Russell Smithies.
import [Link].*;
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
}
Create an OrderNDstribution using the newly built Dwarf Alphabet
//order of the distribution
int order = 3;
//create the cross-product Alphabet
Alphabet a = [Link]([Link](order,
dwarfAlphabet));
//use the OrderNDistributionFactory to create the Distribution
OrderNDistribution ond =
(OrderNDistribution)[Link](a);
//create the DistributionTrainer
DistributionTrainerContext dtc = new SimpleDistributionTrainerContext();
//register the Distribution with the trainer
[Link](ond);
This shows the creation of of a SymbolList from the Dwarf Alphabet so we can test our new OrderNDistribution.
This is done by making, a UniformDistribution which is randomly sampled and adding the Symbols to an
ArrayList. The ArrayList is then used to build the SymbolList.
//create a random symbolList of dwarves
UniformDistribution udist = new
UniformDistribution((FiniteAlphabet)dwarfAlphabet);
int size = 100;
List list = new ArrayList();
for (int i = 0; i < size; i++) {
[Link]([Link]());
}
//create a symbolList to test the Distribution
SymbolList symbl = new SimpleSymbolList(dwarfAlphabet, list);
The SymbolList is changed into an OrderNSymbolList to enable an OrderNDistribution to be made over it.
//make it into an orderNSymbolList
symbl = [Link](symbl, order);
//or you could have a windowed symbolList
//symbl = [Link](symbl, order);
//add counts to the distribution
for (Iterator i = [Link](); [Link](); ) {
try {
}
}
}
A Weight Matrix is a useful way of representing an alignment or a motif. It can also be used as a scoring
matrix to detect a similar motif in a sequence. BioJava contains a class call WeightMatrix in the
[Link] package. There is also a WeightMatrixAnnotator which uses the WeightMatrix to add
Features to any portion of the sequence being searched which exceed the scoring threshold.
The following program generates a WeightMatrix from an aligment and uses that matrix to annotate a
Sequence with a threshold of 0.1
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link]("\tscore : "+[Link]().getProperty("score"));
}
}
}
Profile HMMs (such as those used in the program HMMER) are very sensitive tools for searching for motifs. A
profile HMM is typically trained from a set of input sequences that contain the motif of interest using the
Baum-Welch algorithm. This algorithm optimises the parameters of the model until some stopping criteria is
satisfied. Once a profile HMM has been constructed the Viterbi algorithm can be used to determine the state
path most likely to have generated an observed (test) sequence. If sufficient match states are observed the test
sequence can be deemed to contain the motif, alternatively some scoring metric can be used (such as log odds)
and a cutoff threshold defined. The following demonstrates the construction and use of a ProfileHMM in BioJava.
The first step is to create the profile HMM.
/*
* Make a profile HMM over the DNA Alphabet with 12 'columns' and default
* DistributionFactories to construct the transition and emmission
* Distributions
*/
ProfileHMM hmm = new ProfileHMM([Link](),
12,
[Link],
[Link],
"my profilehmm");
//create the Dynamic Programming matrix for the model.
dp = [Link](hmm);
At this point you would read in a set of sequences that make up the training set.
//Database to hold the training set
SequenceDB db = new HashSequenceDB();
//code here to load the training set
Now initialize all of the model parameters to a uniform value. Alternatively parameters could be set randomly or
set to represent a guess at what the best model might be. Then use the Baum-Welch Algorithm to optimise the
parameters.
//train the model to have uniform parameters
ModelTrainer mt = new SimpleModelTrainer();
//register the model to train
[Link](hmm);
//as no other counts are being used the null weight will cause everything to be
uniform
[Link](1.0);
[Link]();
//create a BW trainer for the dp matrix generated from the HMM
BaumWelchTrainer bwt = new BaumWelchTrainer(dp);
//anonymous implementation of the stopping criteria interface to stop after 20
iterations
Given that Sequences can hold Annotations, with their key value pairs, and Features, and that Features can
hold information, Annotations and nested Features, which can contain still more annotations, nested features
etc it would be useful to be able to view it all as a structured tree.
Fortunately the friendly BioJava team have made the FeatureTree class to let you see where all that structure
goes. The FeatureTree extends the JTree component and can easily be used in a GUI. The data used by the
tree is supplied in the form of a SequenceDB that can be made by reading a text file.
The following program demonstrates the use of a FeatureTree. It takes two arguments. The first is the name
of a file containing sequence data. The second is a number specifying the format of the data.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import
import
import
import
[Link].*;
[Link].*;
[Link].*;
[Link].*;
* GENBANK = 4;
* SWISSPROT = 5;
* GENPEPT = 6;
*
*/
public static void main(String[] args) throws Exception{
//read the sequence flat file
BufferedReader br = new BufferedReader(new FileReader(args[0]));
//get the format type from the command line
int type = [Link](args[1]);
//read the sequences into a DB that will serve as the model for the tree
SequenceDB db = new HashSequenceDB();
SequenceIterator iter = (SequenceIterator)[Link](type, br);
while([Link]()){
[Link]([Link]());
}
[Link]([Link]());
TreeFrame treeFrame = new TreeFrame();
//set the SequenceDB to serve as the data model
[Link]().setSequenceDB(db);
[Link]();
[Link]();
}
private void init() throws Exception {
[Link](borderLayout);
[Link]("FeatureTree Demo");
[Link]().add(jPanel, [Link]);
[Link](jScrollPane1, [Link]);
[Link]().add(featureTree, null);
}
public FeatureTree getFeatureTree() {
return featureTree;
}
protected void processWindowEvent(WindowEvent we){
if([Link]() == WindowEvent.WINDOW_CLOSING){
[Link](0);
}else{
[Link](we);
}
}
}
When displaying a sequence it is useful to display the coordinates of the sequence so you can tell where
you are up to. BioJava contains a SequenceRenderer implementation called a RulerRenderer that displays
Sequence coordinates.
Because a SequenceRenderContext can only use a single SequenceRenderer at a time you will need to use
a MultiLineRenderer. A MultiLineRenderer implements SequenceRenderer and can wrap up multiple
SequenceRenderers coordinating their displays as several tracks.
The use of a RulerRenderer and a MultiLineRenderer is demonstrated in the program below. A screen shot
of the GUI is displayed below the program.
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
import [Link].*;
public class MultiView extends JFrame {
private JPanel jPanel = new JPanel();
private MultiLineRenderer mlr = new MultiLineRenderer();
private SequenceRenderer symR = new SymbolSequenceRenderer();
private RulerRenderer ruler = new RulerRenderer();
private SequencePanel seqPanel = new SequencePanel();
private Sequence seq;
public MultiView() {
try {
seq = [Link](
"agcgstyravlivtymaragrsecharlvahklchg",
"protein 1");
init();
}
catch(Exception e) {
[Link]();
}
}
public static void main(String[] args) {
MultiView multiView = new MultiView();
[Link]();
[Link]();
}
/**
[Link].*;
[Link].*;
[Link].*;
[Link].*;
[Link] = [Link];
[Link](temp);
//setup GUI
init();
}
catch(Exception e) {
[Link]();
}
}
public static void main(String[] args) {
FeatureView featureView = new FeatureView();
[Link]();
[Link]();
}
/**
* initialize GUI components
*/
private void init() throws Exception {
[Link]("FeatureView");
[Link]().add(jPanel1, [Link]);
[Link](seqPanel, null);
//Register the FeatureRenderer with the FeatureBlockSequenceRenderer
[Link](featr);
//add Renderers to the MultiLineRenderer
[Link](fbr);
[Link](seqR);
//set the MultiLineRenderer as the SequencePanels renderer
[Link](mlr);
//set the Sequence to Render
[Link](seq);
//display the whole Sequence
[Link](new RangeLocation(1,[Link]()));
}
/**
* Overridden so program terminates when window closes
*/
protected void processWindowEvent(WindowEvent we){
if ([Link]() == WindowEvent.WINDOW_CLOSING) {
[Link](0);
}
else {
[Link](we);
}
[Link] (2 di 3) [31/03/2003 15.28.45]
}
}