Non-Coding Rna Prediction of Clinically Important Genomic Analysis
Non-Coding Rna Prediction of Clinically Important Genomic Analysis
Submitted by
Reg No: A242009
SCHOOL OF BIOTECHNOLOGY
MADURAI KAMARAJ UNIVERSITY
MADURAI 625 021
May 2004
To
THE
SMALL AND POWERFUL
Non-coding RNA
DECLARATION
I owe my gratitude to DR. Z.A. RAFI for his guidance and supervision in
this project. His care and concern has been the driving force for me all through this work.
I am thankful for his constant advice and encouragement. I am thankful to Prof.
[Link] for introducing me to the field of Bioinformatics.
My special thanks are due to my roommate and friend Santosh for his
constructive criticism for my mistakes. I acknowledge my special friend Ayushi who has
been my rich source of encouragement and entertainment during the last phase at MKU.
1. Briefing
2. Introduction
3. Review of Literature
4. Materials
5. Methods
6. Results
7. Discussion
8. References
BRIEFING
To search the ncRNAs that may play an important role in the life cycle of
pathogenic Mycoplasma, we used a well established computational strategy that
distinguish conserved RNA secondary structures from a background of other conserved
sequences using probabilistic models of expected mutational patterns in pairwise
sequence alignments.
We report here the complete genome screening for ncRNA done with this
method on the available completely sequenced six Mycoplasma genomes using
comparative sequence analysis. The screen resulted in several putative ncRNAs.
Majority of the predicted ncRNA sequences are in the range of 130-160 nucleotides and
the number of the ncRNAs predicted was in proportion to the length of their genome size
except for the one genome. Our candidate ncRNAs showed similarity with few of the
biochemically characterized ncRNAs in bacteria as well as eukaryotes. This suggests the
broadly conserved nature of the ncRNAs across the other kingdoms of life. This finding
places our putative ncRNAs as suitable candidates for the drug discovery and
developmental studies of the Mycoplasma.
1
INTRODUCTION
The above reviewed functions suggest that RNAs which are considered as
non functional RNAs are not only molecular fossils left from time immemorial. Analyses
of several sequenced genomes suggest that protein-coding genes alone are not enough to
account for the complexity of higher organisms. Genomic analysis showed that with an
increase of an organism’s complexity the protein coding contribution of the genome
decreases. It is estimated that about 98% of transcriptional output of eukaryotic and upto
10% of prokaryotic genomes in RNA does not encode for any protein.
2
In this context, ncRNA are defined as heterogeneous transcripts that have
a wide functional spectrum. Broadly, ncRNAs can be divided into two classes:
1. Housekeeping RNAs that are constitutively expressed and required for normal
functions and viability of the cell.
2. Regulatory ncRNAs, by contrast, include those that are expressed at certain stages
of an organism’s development or cell differentiation, or as a response to external
stimuli.
An attempt has been made in the present study to screen for the ncRNAs
of the completetly sequenced and clinically important Mycoplasm a* genomes by
co mparat ive sequence analysis.
3
LITERATURE
Generally the gene finding algorithms assumes that the target is a protein
coding gene that produces mRNA and they fail to scan or target towards ncRNAs.
However, a few computational strategies have recently emerged to detect these ncRNAs
which can be classified into the following four categories:
Sequence similarity analysis: This is simply searching a newly sequenced genome for
similarity against the known ncRNAs [Lowe et al., 1991; Lowe et al., 1999; Zwieb et al,
1999].
Transcriptional Signal analysis: It is based on the fact that ncRNAs are transcribed but
not translated. So, this is a systematic approach that searches for ncRNA genes that has
transcriptional signals but not translational signals [Argman et al., 2001; Olivas et al.,
1997]
Statistical analysis: This involves the analysis of base composition statistics of non-
coding regions in comparison to coding regions [Shattner, 2002]
The aim of the current study is to find ncRNAs that may play important
role in determining pathogenesis of clinically important Mycoplasma. The current study
was carried out using comparative genomic analysis approach. This selection was done
on the basis that this Mycoplasma shares the common characteristic disease causing
ability. So, a comparative genomic analysis is assumed to highlight the group of ncRNAs
that help in pathogenesis.
4
In our approach to predict ncRNAs by comparative genomics we used a
computational tool – QRNA [Elena Rivas 2001], the heart of our project. The following
information details about its evolution and how it works.
There had been some earlier explored RNA gene finding approaches but
with limited success [Elena Rivas 2000]. Early hypothesis in this regard was that
biologically functional RNA structures may have more stable predicted secondary
structures than would be expected for a random sequence of the same base composition
[Chen JH et al., 1990; Le SY et al., 1988; 1990]. Although to a certain extent the above
hypothesis is true, it has been reported that stable predicted secondary structures alone
cannot give positive expected signal, since the predicted stability of structural RNAs is
not sufficiently distinguishable from the predicted stability of random sequence to use as
the basis for a reliable ncRNA gene finding algorithm [Elena Rivas 2000]. Nonetheless,
conserved RNA secondary structure remained a best hope for an exploitable statistical
signal in ncRNA genes. Hence, the above approaches were coupled to comparative
sequence analysis for determination of additional statistical signals [Elena Rivas 2001].
The comparative sequence analysis for ncRNA genes has its basis from
the work which used BLASTN programme to locate genomic regions with significant
sequence similarity between two related bacterial species. A computational tool
CRITICA analyzed the pattern of mutation in these ungapped, aligned conserved regions
for evidence of coding structure [Badger 1999]. For example mutations to synonymous
codons get positive scores, while aligned triplets that translate to dissimilar amino acids
get negative scores. The programme then subsequently extends any coding assigned
ungapped seed alignments into complete ORFs.
5
QRNA is an extension of CRITICA to identify structural RNA regions. The
extensions include:
1. using fully probabilistic models;
2. adding a third model of pairwise alignments constrained by structural RNA
evolution;
3. allowing gapped alignments; and
4. allowing for the possibility that only part of the pairwise alignment may represent
a coding region or structural RNA, because a primary sequence alignment may
extend into flanking non-coding or nonstructural conserved sequence.
These extensions add complexity to the approach. It also uses probabilistic modeling
methods and formal languages to guide our construction. Further pair – Hidden Markov
Models and pair – Stochastic Context Free Grammar were used to produce three
evolutionary models for coding, structural RNA or something else. Given three
probabilistic models and a pairwise sequence alignment to be tested, QRNA can calculate
the Bayesian posterior probability that an alignment should be classified as coding,
structural or something else.
6
MATERIALS
System configuration
Hardware specification:
Mycoplasma penetrans
Mycoplasma mycoides
Mycoplasma gallisepticum
Mycoplasma pulmonis
Mycoplasma pneumoniae
Mycoplasma genetalium
7
METHODS
Downloading the genomes of Mycoplasma:
Folder containing various formats of genomes was downloaded from
NCBI ftp site [Link] for each of the
organisms selected. The formats should include fasta format of the whole genome
nucleotide sequence (accession_number.fna file), protein table format that constitute the
coordinates of the starting and ending regions of the protein coding regions
(accession_number.ptt file).
8
Making Genome databases:
A database formatting programme obtained within the WU BLAST 2.0
suite was used to make databases. Each database constituted five genomes excluding the
genome with which the database is subjected to BLAST.
Syntax: xdformat –n –o database_name
Similarity search:
Similarity search for the intergenic regions of each genome was done by
blastn programme with default parameters from WU BLAST 2.0 suite against a database
that doesn’t contain the organism’s genome.
Syntax: blastn database_name nucleotide_query >output_file_name
9
Extraction of loci identified as ncRNA:
Perl script phase_count_fast.pl was used to prune the QRNA output to get
the actual independent genomic regions that are identified as RNAs using default
parameters. The nucleotide sequence of the predicted ncRNA was extracted by the same
procedure used for extracting the intergenic regions.
Syntax: phase_count_fast.pl file_name query_org database_org
10
RESULTS
Intergenic regions were rich source for the presence of ncRNAs. As a first
step, the contribution of the intergenic region to the genome of the organism was
calculated. Graph 1 show the length of the selected genomes and Graph 2 displays the
percentage of the intergenic regions in the genome. From the graph it was clear that the
intergenic sequences were very low compared to the protein coding regions. This agrees
with the common feature of the prokaryotes which processes only small percentage of
intergenic regions [Mattick 2001].
The number of intergenic sequences determined was high and it was found
that several intergenic sequences were of small stretches. Since biochemically
characterized ncRNA genes had a minimum length of 50 nucleotides, only the stretches
that contained more than or equal to 50 nucleotides in length were alone considered. This
curing was done by an in-house C programme. Graph 3 displays the intergenic regions
present before and after curing. It has been observed that nearly half of the intergenic
regions were eliminated based on the above criteria.
11
found with respect to the genome size, except [Link]. This suggests that this
particular organism may have different characteristic sequence compared to the other
selected organisms.
The similarity hits that were selected above the set threshold were
evaluated by QRNA using a window scanning approach. A window size of 150
nucleotides and extension of 50 nucleotides was chosen to minimize the CPU time taken
by the QRNA.
Putative ncRNA output results received from the QRNA for each organism is shown in
Graph 5. Here again, the ncRNAs predicted show a proportional increase in their
number compared with respect to their genome size, except [Link].
Spread of the length of the putative ncRNAs was plotted in Graph 6. The
graph shows the range i.e., the smallest and the longest ncRNAs predicted for each
organism together with the average length as pointed by the horizontal line.
12
1. Mycoplasma genetalium G37 complete genome - 0..580074
480 proteins
Location Strand Length PID Gene Synonym Code COG Product
735..1829 + 364 3844620 MG001 - - - DNA polymerase III, subunit beta (dnaN)
2.
735 1829
1829 2761
2846 4798
4813 7323
7295 8548
8552 9184
…… ……
3.
2762 2845
4799 4812
7224 7294
8549 8551
…… ……
Fig1: (1) Protein table format of the Mycoplasma genetalium genome showing the annotation of the protein coding regions and the
names of the characterized and putative proteins.
(2) Coordinates of the protein coding regions alone obtained after a series of conversions from Table to Text and Text to
Table option in Microsoft Word.
(3) Coordinates of the intergenic sequences alone obtained after a simple mathematical application use in Microsoft Excel.
13
Genome Size Comparision Oraganism Genome size
[Link] 580,074
[Link] 8,16,394
[Link]
[Link] 9,63,879
[Link] [Link] 9,96,422
[Link] [Link] 12,11,703
[Link] 13,58,633
[Link]
[Link]
[Link]- Mycoplasma genetalium
[Link] [Link]- Mycoplasma pneumoniae
[Link]- Mycoplasma pulmonis
0 500000 1000000 1500000 [Link]- Mycoplasma gallisepticum
[Link]- Mycoplasma mycoides
Genome length [Link]- Mycoplasma penetrans
100%
80%
60%
40%
20%
0%
[Link] [Link] [Link] [Link] [Link] [Link]
14
1. Starting Ending Length
1 734 734
2762 2845 84
4799 4812 14
7324 7294 0
8549 8551 3
9185 9156 0
9922 9923 2
11253 11251 0
12041 12068 28
12726 12701 0
13566 13569 4
14434 14395 0
15317 15555 239
……. ……. ….
Fig2: (1) Intergenic sequence coordinates and their length in the Mycoplasma genetalium as
obtained after the simple mathematics tool application in Microsoft Excel. Intergenic regions
exist with a gap of 1 nucleotide to as many as thousands of nucleotides (not shown here).
(2) Intergenic regions curated by the C programme to remove the regions whose length is
less than 50 nucleotides. One can easily notice that the number of the intergenic regions decreases
considerably after curing.
Fig3: This figure shows an example of the first few coordinates of the range file created for
Mycoplasma genetalium for use in the emboss application.
15
1200 Curing of Intergenic Regions
16
>L43967_1_734 Mycoplasma genetalium G37 intergenic sequence
TAAGTTATTATTTAGTTAATACTTTTAACAATATTATTAAGGTATTTAAAAAATACTATT
ATAGTATTTAACATAGTTAAATACCTTCCTTAATACTGTTAAATTATATTCAATCAATAC
ATATATAATATTATTAAAATACTTGATAAGTATTATTTAGATATTAGACAAATACTAATT
TTATATTGCTTTAATACTTAATAAATACTACTTATGTATTAAGTAAATATTACTGTAATA
CTAATAACAATATTATTACAATATGCTAGAATAATATTGCTAGTATCAATAATTACTAAT
ATAGTATTAGGAAAATACCATAATAATATTTCTACATAATACTAAGTTAATACTATGTGT
AGAATAATAAATAATCAGATTAAAAAAATTTTATTTATCTGAAACATATTTAATCAATTG
AACTGATTATTTTCAGCAGTAATAATTACATATGTACATAGTACATATGTAAAATATCAT
TAATTTCTGTTATATATAATAGTATCTATTTTAGAGAGTATTAATTATTACTATAATTAA
GCATTTATGCTTAATTATAAGCTTTTTATGAACAAAATTATAGACATTTTAGTTCTTATA
ATAAATAATAGATATTAAAGAAAATAAAAAAATAGAAATAAATATCATAACCCTTGATAA
CCCAGAAATTAATACTTAATCAAAAATGAAAATATTAATTAATAAAAGTGAATTGAATAA
AATTTTGGGAAAAA
>L43967_2762_2845 Mycoplasma genitalium G37 intergenic sequence
AAAACCTTTCATTTTTAATGTGTTATAATTATTTGTTATGCCATAAATTTAGTTTGTGGC
AAAAGCTTCTGTACTGTTTATTTA
>L43967_15317_15555 Mycoplasma genitalium G37 intergenic sequence
ACCCTCAACCTCCTGAGTGCAAATCAGGTGCTCTATCAGTTGAGCTACATCCCCATTATT
GGTGGAAGTAAATGGACTTGAACCATCGACCTCACCCTTATCAGGGGTGTGCTCTAACCA
ACTGAGCTATACTTCCAAGCATAATCCTAAGGGTATTTAACTAATTATTATAACAATTTT
AATTTAACCAAAATACCCCTCGAATTTTAACAGTTTTTATAATCAAAACAGCTAATTTT
>L43967_19760_19824 Mycoplasma genitalium G37 intergenic sequence
ATAAATTTAATAGTGTTGAAAGACAAACATTATTAATTTTTGATCAGCTAAATAAAACAA
AGCAA
>L43967_20356_20543 Mycoplasma genetalium G37 intergenic sequence
CTCAAAAAACTAATACATCAAACTTCAACCGTTTACTTTTTTATGAACAAGCACTACAAA
GGTTTTATGAAGAATTATTTCAAATAGATTATTTAAGAAGATTTGAAAACATTCCCATTA
AAGATAAGAATCAAATTGCGCTTTTTAAAACTGTTTTTGATGATTACAAAACCATTGATT
TAGCAGAA
Fig4: Result of the extractseq application in emboss suite which gives sequences of interest. The figure shows the fasta format of
the first few intergenic sequences of the Mycoplasma genetalium obtained from the extractseq application given the range file and
whole genome sequence as input.
17
Organism Database Organisms in No. of Blastn
Created Database hits
[Link]
[Link]
[Link] ggmpnpudb [Link] 1852
[Link]
[Link]
[Link]
[Link]
[Link] ggpppdb [Link] 1787
[Link]
[Link]
[Link]
[Link]
[Link]
[Link] gempppdb [Link] 850
[Link]
[Link]
[Link]
[Link]
[Link] ggmpepndb [Link] 1012
[Link]
[Link]
[Link]
[Link]
[Link] ggmpepudb [Link] 565
[Link]
[Link]
[Link]
[Link]
[Link] gampppdb [Link] 386
[Link]
[Link]
Table1: This table shows the databases created with the WU BLAST 2.0 application and the
organism against which the database is searched for similarity.
18
BLASTN 2.0MP-WashU [03-Mar-2004] [linux24-i686-ILP32F64 2004-03-03T16:23:09]
Notice: this program and its default parameter settings are optimized to find
nearly identical sequences rapidly. To identify weak protein similarities
encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX.
Database: [Link]
5 sequences; 5,347,031 total letters.
Searching....10....20....30....40....50....60....70....80....90....100% done
Smallest
Sum
High Probability
Sequences producing High-scoring Segment Pairs: Score P(N) N
19
>gb|U00089| Mycoplasma pneumoniae M129, intergenic sequence
Length = 816,394
Fig5: Output of the blastn programme from the WU BLAST 2.0 run with the intergenic sequences of Mycoplasma genitalium
against the database containing the intergenic sequences of the other five Mycoplasma genomes: [Link], [Link],
[Link], [Link], [Link].(The alignment is only partially shown). The blastn programme was run with default
parameters.
20
No. of Blast hits
[Link] 386
[Link] 565
[Link] 1012
[Link] 850
[Link] 1787
[Link] 1852
21
>L43967_15317_15555-1>179-Mycoplasma
ACCCTCAACCTCCTGAGTGCAAATCAGGTGCTCTATCAGTTGAGCTACATCCCCATTATT
GGTGGAAGTAAATGGACTTGAACCATCGACCTCACCCTTATCAGGGGTGTGCTCTAACCA
ACTGAGCTATACTTCCAAGCATAATCCTAAGGGTAT-TTAACTA-ATTATTATAACAATT
T
>gb-U00089--19096>19275-Mycoplasma
ACCCTCAACCTCCTGAGTGCAAATCAGGTGCTCTATCAGTTGAGCTACATCCCCATTATT
GGTGGAAGTAAATGGACTTGAACCATCGACCTCACCCTTATCAGGGGTGTGCTCTAACCA
ACTGAGCTATACTTCCAGGCAAAATCTTC-GTACAGGTTCGCTTCATAATTATATTAATT
T
>L43967_15317_15555-1<239-Mycoplasma
AAAATTA-GCTGTTTTGATTATAAAAACTG-TTAAAATTCGAGGGGTATTTTGGTTAAAT
TAAAATTGTTATAATAATTA-GTTA-AATACCCTTAGGATT-ATGCTTGGAAGTATAGCT
CAGTTGGTTAGAGCACACCCCTGATAAGGGTGAGGTCGATGGTTCAAGTCCATTTACTTC
CACCAATAAT---GGGGATGTAGCTCAACTGATAGAGCACCTGATTTGCACTCAGGAGGT
TGAGGGT
>gb-AE015450.1--417273>417511-Mycoplasma
AATTTTACGC-GTTGTTATTACCAATCGAAATTAAAAATTAAGCAG-ATATTCTTTAA--
TGAGCT-GA-AT--TAATTATGTTATAATTCATATGGCAATCACGACTGGAAGTATAGCT
CAGCTGGTTAGAGCACACCCCTGATAAGGGTGAGGTCGATGGTTCAAGTCCATTTACTTC
CACCAGTTTTTTTGGGGACGTAGCTCAATTGATAGAGCACCTGATTTGCACTCAGGAGGT
CGAGGGT
>L43967_19760_19824-5<65-Mycoplasma
TTGCTTTGTTTTATTTAGCTGATCAA-AAATTAATAATGTTTGTCTTTCAACACTATTAA
AT
>emb-BX293980.1--57200>57261-Mycoplasma
TTGTTTTGTTTTATTTAATTGATCAATAAATTGATTTAGTTTATCTTTATTTATTAATAA
AT
Fig6.1: This figure shows one of the output file of the perl script [Link] run with the blastn result of [Link]
intergenic sequences Vs Mycoplasma database as input. The first file is named .q as extension (here genblast.q). This is the file used as
input for the qrna programme in QRNA-2.0.1 suite. This consists of a collection of sequences in fasta format, where two sequences are
the two component of an alignment with the gaps left in place.
22
1. FILE: genblast
DIR: /home/kalyankpy/coput2/blast//
FIRST TRIMMING
Minimum length = 1
Maximum Evalue = 0.01
Minimum %id = 0
Maximum %id = 100
SECOND TRIMMING
Alignments culled by = SC
Depth of alignments = 1
shift =1
Fig6.2: This figure shows the second file of the output from the perl script [Link] run with the blastn result of
[Link] intergenic sequences Vs Mycoplasma database as input. This is a file named with .[Link] (here, [Link]) as
extension that has the report of the BLASTN alignment that have been pruned in the process of creating a file with .q as extension
according to the options used in the perl script.
23
#---------------------------------------------------------------------------------
# qrna 2.0.1 (Tue Aug 19 11:30:55 CDT 2003) using squid 1.5m (Sept 1997)
#---------------------------------------------------------------------------------
# PAM model = BLOSUM62
#---------------------------------------------------------------------------------
# RNA model = /mix_tied_linux.cfg
# RIBOPROB matrix = /[Link]
#---------------------------------------------------------------------------------
# seq file = /home/kalyankpy/perlscriptresult/genblast.q
# #seqs: 772 (max_len = 3420)
#---------------------------------------------------------------------------------
# window version: window = 150 slide = 50 -- length range = [0,9999999]
#---------------------------------------------------------------------------------
# 1 [both strands] (sre_shuffled)
>L43967_1_734-90>722-Mycoplasma (664)
>gb-U00089--130>767-Mycoplasma (664)
L43967_1_734-90 TTAATTTTATTAAAACTATAACTTATTTTTTATAAACATTCTATGTTTTT
gb-U00089--130> [Link]
L43967_1_734-90 [Link]
gb-U00089--130> [Link]
L43967_1_734-90 [Link]
gb-U00089--130> [Link]
24
OTH ends *(+) = (0..[150]..149)
OTH ends (-) = (0..[150]..149)
COD ends *(+) = (120..[27]..146)
COD ends (-) = (41..[12]..52)
RNA ends *(+) = (0..[21]..20)
RNA ends (-) = (0..[150]..149)
winner = OTH
OTH = 184.281 COD = 166.408 RNA = 179.710
logoddspostOTH = 0.000 logoddspostCOD = -17.873 logoddspostRNA = -4.571
sigmoidalOTH = 4.571 sigmoidalCOD = -17.932 sigmoidalRNA = -4.571
Fig7: This is the qrna output file obtained by the syntax: qrna –w 150 –x 50 –a –B genblast.q.
The qrna is a c programme written to evaluate the given alignment for its ability to forma a structural RNA. The above fig is the
partial output of the qrna run with a scanning window option (here window size = 150, extension size = 50 nucleotides).
Every new blast alignment starts with two lines: “>Query_name” followed by “>Subject_name”
“Divergence time” indicates the particular time parameterization of QRNA used. By default QRNA decides on the divergence time
(in this case it is 0.401) given the percentage identity of the alignment (61.75%).
Each new analyzed window starts with the line: length alignment:
For each window and for each sequence in the alignment we have a line of the form:
posX: 0-149 [0-145](146) -- (0.42 0.08 0.06 0.43)
The first pair of numbers represents the first and last coordinates of the window respect to the beginning of the alignment. The pair
of numbers in brackets represents the mapping of the window into the coordinate system of sequence X (after removing the gaps).
The adjacent number in parenthesis is the length of that segment in sequence X. finally the four decimal numbers in parenthesis are
the fraction of A, C, G, T’s respectively in the segment of sequence X involved in that particular window.
For each model, and for each strand, you are given the actual local regions (they could be more than one per model and strand) that
score according to the model. The notation is (from..[Length]..to). Coordinates for both strands are given relative to the positive
strand. The * indicates the strand with the strongest signal for a given model.
For the given scoring algorithm (here it is local viterbi by default) we get three row of numbers:
Row 1: The scores of the alignment under each of the three models. The null model is a forth model which assumes that the two
sequences in the alignment are independent from each other.
Row 2: The two (COD and RNA) log-odds posterior probabilities respect to the OTH model.
Row 3: The three sigmoidal scores calculated using the other two models as null models. The model with the highest sigmoidal
score is the winner.
25
---------------Some General Statistics-------------------
FILE: ./genblast.2qrna
method: LOCAL_DIAG_VITERBI
Cutoff: 5
---------------Statistics by Windows---------------------
# windows: 2574
RNA>0: 41/2574
RNA>cutoff: 2/2574
COD>0: 2/2574
COD>cutoff: 0/2574
in phases: 2045/2574
RNA: 2/2045
COD: 0/2045
OTH: 2043/2045
in transitions: 0/2574
RNA/COD: 0/0
RNA/OTH: 0/0
COD/OTH: 0/0
RNA/COD/OTH: 0/0
---------------------------------------------------------
Fig8: This is the output of the phase_count_fast.pl perl script that extracted the RNA loci (with RNA
score larger than a cutoff set with option –u, here –u is default set to 5). The script identified 1
independent locus in Mycoplasma genitalium that scores as RNA above 5 bits out of the 2574
windows from the 386 blastn alignments. The listed coordinates of each of the locus is of the
following form:
num-loci name_seq(seq_length)loc_from loc_to(loc_lenght)number_wind
type_loc COD_sc RNA_sc
Therefore,
1-loci L43967_167180_175806-Mycoplasma 7457 7653 (197) 2 RNA -39.20 26.19
means that the first [Link] locus corresponds to intergenic sequence named
L43967_167180_175806-Mycoplasma. The locus has a length of 197 nucleotides and covers the
region from 7457 to 7653. Two different windows have contributed to this RNA locus, and the
average sigmoidal score for the coding model is -39.20 bits, while the average sigmoidal score for the
RNA model is 26.19 bits.
26
No. of ncRNAs
60 52
50
40 39
40
30
20 12
10 4
1
0
[Link] [Link] [Link] [Link] [Link] [Link]
350
300
250
Length (nt)
200
150
100
50
0
[Link] [Link] [Link] [Link] [Link] [Link]
27
Fig9: Analysis of the BLASTN alignments between [Link] intergenic sequences and the intergenic sequence database of
[Link], [Link], [Link], [Link], [Link]. Alignments have been grouped by percentage identity.
Each figure represents the histogram of the number of alignments bined in each percentage identity interval. Green colour
histogram shows the total number of windows analyzed. Blue colour histogram shows the windows that score as RNA or Coding
sequence above cutoff of 0 bits.
a) Figure showing the number of sequences scored as Coding regions in the windows analyzed.
b) Figure showing the number of sequences scored as RNAs in the windows analyzed.
Fig10: Analysis of the BLASTN alignments between [Link] intergenic sequences and the intergenic sequence database of
[Link], [Link], [Link], [Link], [Link]. Alignments have been grouped by percentage identity.
Each figure represents the scores of all the alignments as a function of the percentage identity of the alignments. “*” represents the
average of the RNA or Coding sequence scores. The error bars correspond to one standard deviation.
a) Figure showing the average of the scores scored as Coding regions in the windows analyzed.
b) Figure showing the average of the scores scored as RNAs in the windows analyzed.
28
29
[Link]--sigmoidal LOD
30
<len> = 303 +/- 198 ID=[100:0] total_counts [361]
real COD-phase_counts_above: 0 [16//361]
25
NUMBER OF WINDOWS // qrna 2.0.1
20
15
10
0
100 95 90 85 80 75 70 65 60 55 50
% ID
Fig 9a: Figure showing the number of sequences30
scored as coding regions in the windows analyzed
[Link]--sigmoidal LOD
30
<len> = 303 +/- 198 ID=[100:0] total_counts [361]
real RNA-phase_counts_above: 0 [28//361]
25
NUMBER OF WINDOWS // qrna 2.0.1
20
15
10
0
100 95 90 85 80 75 70 65 60 55 50
% ID
Fig 9a: Figure showing the number of sequences
31 scored as RNAs in the windows analyzed
[Link]--sigmoidal LOD
60
<len> = 303 +/- 198 ID=[100:0]
ave COD lodscore above: 0 [16//361]
40
COD sigmoidal LODSCORE // qrna 2.0.1
20
-20
-40
-60
-80
100 95 90 85 80 75 70 65 60 55 50
% ID
Fig 10a: Figure showing the average of the scores32scored as coding regions in the windows analyzed
[Link]--sigmoidal LOD
20
<len> = 303 +/- 198 ID=[100:0]
ave RNA lodscore above: 0 [28//361]
10
RNA sigmoidal LODSCORE // qrna 2.0.1
-10
-20
-30
-40
-50
-60
100 95 90 85 80 75 70 65 60 55 50
% ID
Fig 10b: Figure showing the average of the scores
33 scored as RNAs in the windows analyzed.
DISCUSSION
The intergenic regions in prokaryotes are small; however, their presence has long
been shown to play a significant role in these organisms. The percentage of the intergenic regions
in Mycoplasma genomes varied from 9.2% in [Link] (smallest) to 18% [Link]
(largest) genome. Number of intergenic regions was spread to over 122 locations (least in
[Link]) to 643 (highest in [Link]). Average length of intergenic regions ranged from
234 (in [Link]) to 441 (in [Link]) nucleotides. This indicates that the average length
of intergenic regions in a smaller genome is greater compared to the average length in a larger
genome. This could be due to the appearance of large number of small interspersing regions
(intergenic regions with few nucleotides only) in [Link] that results in the reduction of the
average length.
The QRNA was used with an option of shuffling the sequence. This estimates the
false positives that could arise with the given sequence composition and length. Earlier results in
similar ncRNA predictions in [Link] have shown 85% true positives (Rivas and Eddy 2001). The
predicted loci in the present study are regions of conserved secondary structures that include
ncRNAs and need not be individual ncRNAs alone.
To assess the significance of the prediction, the predicted loci were searched for
similarity against the already known and biochemically characterized ncRNAs obtained from the
ncRNA database at [Link] (updated till 2002).
The putative non-coding RNAs were searched against known Mycoplasma ncRNA
data (only two ncRNAs have been characterized in Mycoplasma capricolum). The results
indicated that one of the putative ncRNA from the current study was showing a good percentage of
identity (60%) with one of the two biochemically available Mycoplasma ncRNA data viz.,
Mc_MCS4 ncRNA obtained from Mycoplasma capricolum. The Mc_MCS4 has already been
shown to have extensive similarity with the eukaryotic U6 snRNA also. This strengthens our
candidate ncRNA to be a possible functional entity. Since the number of ncRNA in
34
biochemically determined database was small the database was expanded to include other
prokaryotic ncRNAs.
The results indicated that a stretch of nucleotides in the putative ncRNA was
showing significant similarity to MicF RNAs from [Link], [Link], and [Link]. Since MicF
was known to regulate the expression of OmpF and the stretch of nucleotides showing similarity
were conserved across all the species, one can possibly say that the putative ncRNA stretch may be
a MicF counterpart in Mycoplasma. Another ncRNA showing significant similarity to [Link]
OxyS RNA was also noticed. OxyS RNA was known to modulate gene expression in response to
Hydrogen peroxide, a common chemical produced by mammals in response to infection. So, this
proposes a defense mechanism operating in Mycoplasma.
The database was further expanded to include eukaryotic ncRNAs that constituted
the characterized miRNA and development regulating RNAs and protein function modifying
RNAs. The putative ncRNAs were found to have more than 60% identity with a number of
miRNAs from mouse, humans, A. thaliana and [Link]. Fig. 11a shows a blastn hit showing
71% identity against one of the putative ncRNA from [Link]. This clearly shows that the
putative ncRNA does have a conserved secondary structure similar to the well characterized stem
loop region of [Link] miRNA. Fig 11b shows a blastn hit having an identity of 63% from the
same [Link] with the characterized ncRNA obtained from the development regulating RNA
of Homosapiens.
35
>cbr-mir-268 MI0000541 Caenorhabditis briggsae miR-268 stem-loop
Length = 79
Query: 64 CAAAC-CTCTAAACTT-CTAAGAACTTCTTCTTCTTCTTCTTCTTC 21
|| || | || | || || | |||||| || ||||||||||||
Sbjct: 34 CAGACACACTCA-CTGACTCACTGCTTCTTGTTTTTCTTCTTCTTC 78
Fig 11a: A 71% identity blastn hit obtained for one of the putative ncRNA from [Link]. This
clearly shows that the putative ncRNA have a conserved secondary structure similar to the well
characterized stem loop region [Link] miRNA.
Significant hits were found with the development regulating ncRNAs included
those from Homosapiens also.
>Hs_NTT
Length = 17,572
Query: 11 TATTTAATATTTATAATTGCTATTTAGCATCTTAAAA-AAGA-CG-TCTTT-AAA-TATA 65
|| |||| | || ||| | | || | |||| | ||| | |||| ||| ||||
Sbjct: 5336 TACATAAT-TAGATCATTTATTCTAAGTAAATTAAGAGAAGCTCTATCTTCCAAAATATA 5394
Query: 66 GATAGTTATACTAATTAGAAAATAGTTAAT-AAG 98
|||| | || ||| |||| | ||||| |||
Sbjct: 5395 GATATCTCTAGCAAT-AGAAGAGTTTTAATTAAG 5427
Fig 11b: A sample sequence hit having an identity of about 63% from the same [Link] with
the characterized ncRNA obtained from development regulating RNA of Homosapiens.
36
These results indicate that the ncRNAs were conserved across other kingdoms of
life. Since the ncRNAs are generally conserved across a wider spectrum, the ncRNAs can
possibly play variant roles in different cellular processes, though the role is yet to be proved
biochemically (which still remains as a challenging task).
The very existence and expression profile of ncRNAs is not predictable, their
functional analysis remains challenging. Given the predicted ncRNAs, the task can be handled
with reduced burden.
37
REFERENCES
1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped
BLAST and PSI-BLAST: a new generation of protein database search programme.
Nucleic Acids Research 1997, 25:3389
2. Argman L, Hershberg R, Vogel J, Bejerano G, Wagner EG, Margalit H and Altuvia S:
Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Current
Biology 2001, 11:941
3. Badger JH and Oslen GJ: CRITICA: Coding Region Identification Tool Involving
Comparative Analysis. Molecular Biology and Evolution 1999, 16:512
4. Capara MG, Wilsen TW: RNA: versatility in form and function. Nature Structural
Biology 2000, 7:831
5. Elena Rivas & Sean R Eddy: Secondary structure alone is generally not statistically
significant for the detection of non-coding RNAs. Bioinformatics 2000, 16:583
6. Elena Rivas, Sean R Eddy: QRNA: A non-coding RNA genefinder using comparative
genome sequence analysis ([Link] 2001
7. Elena Rivas, Robert J Klein, Thomas A Jones and Sean R Eddy: Computational
identification of non-coding RNAs in Escherichia coli by comparative genomics.
Current Biology 2001, 11:1369
8. Elena Rivas & Sean R Eddy: Non-coding RNA gene detection using comparative
sequence analysis. BMC Bioinformatics 2001, 2:8
9. Erdmann VA, Barciszewska MZ, Szymanski M, Hochberg A, de Groot N, Barciszewski J:
The non-coding RNAs as riboregulators. Nucleic Acids Research 2001, 29:189
10. Gish W: WU-BLAST 2.0 ([Link] 2003
11. Huttenhofer A, Kiefmann M, Meier-Ewert S, O’Brien J, Lehrach H, Bachellerie JP,
Brosius J: RNomics: an experimental approach that identifies 201 candidates for
novel, small, non-messenger RNAs in mouse. EMBO journal, 2001, 20:2943
38
12. Lowe TM, Sean R Eddy: tRNAscan-SE: a program for improved detection of transfer
RNA genes in genomic sequence. Nucleic Acids Research, 1997, 25:955
13. Lowe Sean R Eddy: A computational tool for methylation guide snoRNAs in yeast.
Science, 1999, 283:1168
14. Maciej Szymanski and Jan Barciszawski: Beyond the proteome: non-coding regulatory
RNAs. Genome Biology 2002, 3: 0005.1
15. Mattick JS: Non-coding RNAs: the architects of eukaryotic complexity. EMBO
Reports 2001, 2:986
16. Olivas WM, Muhlrad D, Parker R: Analysis of the yeast genome: identification of new
non-coding and small ORF-containing RNAs. Nucleic Acids Research 1997, 25:4619
17. Sean R Eddy: Non-coding RNA genes. Current Opinion in Genetics and Development
1999, 9:695
18. Sean R Eddy: Non-coding RNA genes and modern RNA world. Nature Review
Genetics 2001, 2:919
19. Shchattner P: Searching for RNA genes using base-composition statistics. Nucleic
Acids Research 2002, 30:2076
20. Wasserman KM, Zhang A, Storz G: Small RNAs in Escherichia coli. Trends in
Microbiology 1999, 7:37
21. Zweib, Wower I, Wower J: Comparative sequence analysis of tmRNA. Nucleic Acids
Research 1999, 27:2063
39