0% found this document useful (0 votes)
134 views7 pages

Cloning and Expression of IDP1 Gene

1. Students isolated, cloned, and expressed the IDP1 gene from Saccharomyces cerevisiae yeast in E. coli bacteria over a semester long lab course. 2. They designed primers and used PCR to amplify the IDP1 gene from yeast genomic DNA. The gene was inserted into a plasmid and transformed into E. coli. 3. Western blot and enzyme assays confirmed that E. coli cells expressed the functional IDP1 protein as intended. While less active than a control sample, this demonstrated successful cloning and expression of the yeast gene in bacteria.
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
134 views7 pages

Cloning and Expression of IDP1 Gene

1. Students isolated, cloned, and expressed the IDP1 gene from Saccharomyces cerevisiae yeast in E. coli bacteria over a semester long lab course. 2. They designed primers and used PCR to amplify the IDP1 gene from yeast genomic DNA. The gene was inserted into a plasmid and transformed into E. coli. 3. Western blot and enzyme assays confirmed that E. coli cells expressed the functional IDP1 protein as intended. While less active than a control sample, this demonstrated successful cloning and expression of the yeast gene in bacteria.
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOC, PDF, TXT or read online on Scribd

Molecular Biology Lab Report Laura Quillian and Gray Lyons Isolation, Cloning, and Expression of the IDP1

Gene from S. cerevisiae in E. coli Abstract In the process of a semester-long laboratory course we have learned many molecular techniques similar to those of a graduate school laboratory rotation. Over 12 weeks we have manipulated DNA from Saccharomyces cerevisiae to express a desired functional protein, isocitrate dehydrogenase, in Escherichia coli. The process included database research, PCR primer design, PCR amplification, plasmid cloning, southern blot analysis, expression in E. coli, western blot analysis, and a functional enzyme assay. We show in this report a successful result where the desired protein is correctly expressed and verified by a functional assay. Introduction The following project outlines the laboratory portion of an undergraduate molecular biology course at Davidson College. The course emphasized the understanding of molecular methods and techniques through isolating, cloning, and expressing a gene: the five homologs of isocitrate dehydrogenase (IDH) in Saccharomyces cerevisiae. IDH is an enzyme involved in a cells citric acid pathway responsible for converting isocitrate to -ketogluterate. This reaction is mediated by the concentrations of isocitrate, magnesium ion, and NAD+. This cytosolic enzyme is paralleled with the mitochondrial form (IDP) which requires NADP+ cofactor rather than NAD+ (Loftus et al., 1994). This protein is of particular interest because it is vital in aerobic cellular metabolism, homologous across many species, is sequenced and well-studied, and has been used as a model protein for undergraduate instruction (Mooney and Campbell, 1999). Since yeast genes have been found to be homologous to those of larger organisms, S. cerevisiae has been widely accepted as a model system for genetic research. For the purposes of this experiment, yeast was chosen since its genome does not contain introns thus allowing us to clone straight from gDNA. Another organism commonly used in biological research is Escherichia coli a bacteria frequently manipulated with foreign DNA to express a desired protein. This lab used the combination of yeast DNA in plasmid transformed into [Link] cells to express a tagged recombinant IDP1 protein. Materials and Methods Purification of gDNA. Total genomic DNA was purified from wild-type Saccharomyces cerevisiae and analyzed by spectroscopy to determine concentration as described in Campbell (2002).

Primer design and PCR. Using sequence data published on the Saccharomyces Genome Database ([Link] primers were designed to amplify the open reading frame of each gene as listed in table 1. The PCR reaction was run according to the protocols outlined in the Taq PCR Handbook using Taq PCR Master Mix by Quiagen #201443, except reaction conditions were modified to vary the magnesium concentration to 2.0 mM and 2.25 mM in two different trials. Also, the total reaction volume was increased from 50 L to 100 L to ensure PCR product. Gene Direction Primer Sequence Tm (C) IDH1 Forward ATGCTTAACAGAACAATTGC 46 Reverse TTACATGGTAGATAATTTGTTG 46 IDH2 Forward ATGTTGAGAAATACTTTTTTTTAG 45 Reverse TTATAATCTCTTGATGACTG 44 IDP1 Forward ATGAGTATGTTATCTAGAAG 44 Reverse TTACTCGATCGACTTGATTT 46 IDP2 Forward ATGACAAAGATTAAGGTAGC 46 Reverse TTACAATGCAGCTGCCTCGA 52 ATGAGTAAAATTAAAGTTGTTCA IDP3 Forward T 45 Reverse TTATAGTTTGCACATACCTT 44
Table 1. Primers designed from published open reading frame sequences of IDH genes and projected Tm values.

Ligation, Transformation, and Screen. Purified PCR product was ligated into Quiagen pQE-30 UA cloning vector using QiaExpress UA cloning Kit #32179 and transfectred into competent JM109 strain of E. coli cells as described by E. coli competent cells except transformation reaction incubated for only 45 minutes rather than the recommended 60. Cells were plated on LB-ampicillin media and grown overnight. Eight clonal colonies were chosen for screening Southern Blot. Total gDNA was probed with PCR product and blotted onto a Nytran membrane under alkaline conditions. The procedure is described in Campbell (2002). Western Blot and Enzyme Assay. Proteins were isolated from E. coli cells using procedure described in Ni-NTA Spin Handbook except a clean column for the final wash was mistakenly not used, thus introducing the possibility of contamination. Protines were run on 4-15% vertical gradient gel and probed with RGS-His6 antibody. The enzyme assay was conducted on spectrophotmeters as described in Laboratory Manual with special emphasis on varying concentration of recombinant protein. Results Quantification of the concentration of the gDNA was necessary for the PCR reactions. The concentration of the gDNA was 20.5 L/mL. PCR reactions were performed using Taq DNA Polymerase, the primers designed from the ORF sequence of

IDP1, and the purified gDNA from S. cerevisiae. Since 5 x 104 DNA copies was the ideal number of starting template for the reaction, and using the concentration of gDNA, it was calculated that 2.03 L of gDNA stock was needed for successful PCR. However, cutting the total volume of the reaction created the concentration of DNA to be too weak for proper amplification. Although a 50 L aliquot did not yield any PCR product, DNA amplification was detectable when the reaction was repeated using 100 L (Figure 1).

Figure 1. 0.9% agarose gel in 0.5X TBE loaded with PCR product from 100 L reactions (lanes 1-8, left to right: IDP1, IDP2, IDP3, IDH1, IDH2, 1kb ladder, IDH2 with 2.25 mM 2.0 MgCl2). The bands at ~1000 kb molecular weight indicate the presence of PCR product.

After ligation into the expression vector and transformation into E. coli, it was necessary to ensure that IDP1 was correctly inserted and oriented in the vector. Two restriction enzymes, Bam HI and Hind III, were used to pop out the insert for analysis. If the plasmids contained insert, the bands should be 810 bp in length and 567 bp in length. The digestion with Bam HI and Hind III showed that we did indeed have insert in our expression vector (Figure 2).

Figure 2. 0.9% agarose gel in 0.5X TBE loaded with IDP1 ligated plasmids re-cut with restriction enzymes Bam HI and Hind III (lanes 1-6) and molecular weight marker (lane 8). The presence of bands at ~810 and ~570 kb (lanes 1-5) indicate the gene was correctly inserted into the plasmid, whereas lane 6 does not indicate insert.

The second digestion was performed using just Bam HI to confirm the insert was ligated in the forward orientation. If IDP1 was in the correct orientation, then a band should appear at 811bp, if in reverse, the band should be 538 bp. The results show three colonies which took up plasmids with correctly oriented IDP1 and one that had incorrectly oriented IDP1 in their vectors (Figure 3).

Figure 3. 0.9% agarose gel in 0.5X TBE loaded with IDP1 ligated plasmids re-cut with restriction enzyme Bam HI (lanes 2-5) and molecular weight marker (lane 1). Lanes 2-4 show bands at ~810 kb thus indicating correct orentation in the plasmid, while lane 5 shows a band at ~540 kb thus indicating reverse orientation in the plasmid.

Southern Blot was performed on the DNA from the ligated plasmids using PCR amplified genes as probes and detected with True Blue, which showed binding in two lanes. One band is the IDP1 gene, while the other band is a detection of IDP2, which may appear because of sequence similarity between IDP1 and IDP2 (Figure 4).

Figure 4. Southern blot. Nytran membrane turboblot under alkaline conditions of ligated plasmids probed with clean IDP1 PCR product. Lanes 1-6, left to right, IDH1, IDH2, IDP1, IDP3, IDP2, blank. Banding in lane 3 indicates presence of IDP1 gene, faint band in lane 5 suggests sequence similarity between IDP1 and IDP2.

Western blot analysis was performed to determine if the IDP1 protein was being expressed and was functional in the cells. Using the RGS antibody for the His-6 tag, which is translated and attached to the N-terminus of IDP1, two distinct bands were detected in the elution lanes (Figure 5). As noted in the materials and methods, the elution may have been contaminated because a clean column was not used for the final wash.

Figure 5. Western blot. Protein samples run on vertical 4-15% gradient gel probed with RGS-His6 antibody. Lane 1-3 IDP1 elution, lane 4 MW His6, lanes 5-6 IDP1 lysate, lanes 7-8 IDP1 flow-through, lane 9 IDP1 wash solution. Lane 1 best indicates the presence of His6-tagged IDP1 protein.

Assays on the IDP1 protein were performed to determine the functionality of the recombinant protein. Different concentrations of lysate, containing IDP1 protein, were compared with 10 L of control IDP1 ordered from an industrial source (Figure 6). The more concentrated lysate assays exhibited more enzyme activity and depleted substrate faster than the lower concentration solutions. 10 L of the recombinant lysate was less active than equal volume of control IDP1.
IDP1 Activity
0.45 0.4 Absorbance (%T) 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 0 50 100 Time (s) 150 200 10 uL Lysate 20 uL Lysate 30 uL Lysate Negative Control

Figure 6. Enzyme assay. Mixtures of 10 L isocitrate, 10 L NADP+, and varying amounts of lysate were brought to a total volume of 200 L in buffer and concurrently measured for absorbance over a 3 minute time interval in s spectrophotometer. Negtative control is 10 Lwild-type IDP1. The graph indicates the enzyme is active, though not as active as an equal concentration of store-bought IDP1.

Discussion We have shown that IDP1 can be cloned and amplified, ligated and transformed, translated and expressed. The results from the experiments above can be used in many interesting ways, not only to clone known genes, but also to disclose the limitless amount of undiscovered genes that have potential in medicine and gene therapy. The Southern blot showed correct gene being expressed. The Southern blot, however, did have two bands detected. The second band implies sequence similarity between IDP1 and IDP2. When IDP2 was used as a probe in the ECL blot, IDP1 was detected (Madden and Shafer, 2002). This only strengthens the argument that IDP1 and IDP2 share similar sequences. The Western Blot showed a functional protein which was later assayed to show that our recombinant IDP1 did indeed bind hydrogen to transform isocitrate into ketoglutarate. The second band detected in the Western blot could have been from contamination of the eluted protein. When purifying IDP1, a second and clean elution column was not used for the final wash. The pure protein was thus eluted into a column which had contained other proteins. This may be the cause for the second band; the RGS antibody may recognize another protein in E. coli cells. It is not impossible for the RGS antibody to recognize another protein with similar amino acid sequence and bind, giving the second band. To ensure that the Western blot was indeed showing the IDP1 protein, an enzyme assay was performed. The assay indicated that there was enzyme activity present for the recombinant proteins, as well as the control protein. In figure 6, because the negative control has greater IDP1 activity than an equal amount of recombinant protein, the recombinant protein is not as active although functional. Thus, the data show there is working protein; however, recombinant IDP1 does not work as well as wild-type IDP1. This could be because due to the intrusive modulation of function caused by the His6 tag. Overall, the research was a success. The gene was cloned, amplified and made into functional protein. The implications of this research are limitless. Protein was expressed by E. coli that was originally in yeast and was completely functional. The future for the gene has just begun. Future research could include transforming the expression vector in other competent cells or even cancerous cells and see if the protein remains stable. We could probe other organism for IDP1 and see if any orthologs appear, in mice, cats, even human cells. A comparison of sequences between yeast and humans could be done and the conserved sequences analyzed. Evolutionary divergence could be calculated. For biologists studying phylogenic trees and evolution, the conservation of proteins necessary for respiration and thus high conserved, though somewhat changed, is an important tool. With the methods above, comparison is easier and more defendable. These methods could then be applied to many different proteins and used in future research for analysis of even more genes.

References Campbell, M.A. Laboratory Schedule: Molecular Biology. Davidson College Biology Department. <[Link] 2002. Accessed 2002 May 8. E. coli Competent Cells. Promega Corporation, #L2001. 1-6. 2000. Laboratory Manual. Davidson College Biology Depatment. Principles of Biology 111, Spring Semester. 2002. Loftus, T.M., Hall, L.V., Anderson, S.L. and McAlister-Henn, L. Isolation and characterization of the yeast gene encoding cytosolic NADP+-specific isocitrate dehydrogenase. Biochemistry. 33: 9661-9667. 1994. Madden, J. and Shafer L. Personal correspondence. Davidson College Molecular Biology Thursday Lab, Davidson, NC, 2002. Mooney, E. and Campbell, A. M. A Project-Based Biotechnology Laboratory Course using Isocitrate Dehydrogenase. BioScene. 25 (2): 3 - 11. 1999. Ni-NTA Spin Handbook. Qiagen Corporation. 14-72. 2000. Taq PCR Handbook. Qiagen Corporation. 7-35. 1999.

You might also like