Dna Replication Lab
Uploaded by
ddsvphdDna Replication Lab
Uploaded by
ddsvphdName: __________________________________________ Date: _________________________
DNA Replication Lab
Introduction
Within the nucleus of every cell are long strings of DNA, the code that holds all the information needed to
make and control every cell within a living organism. DNA, which stands for deoxyribonucleic acid, resembles
a long, spiraling ladder. It consists of just a few kinds of atoms: carbon, hydrogen, oxygen, nitrogen, and
phosphorus. Combinations of these atoms form the sugar-phosphate backbone of the DNA -- the sides of the
ladder, in other words.
Other combinations of the atoms form the four bases: thymine (T), adenine (A), cytosine (C), and guanine (G).
These bases are the rungs of the DNA ladder. (It takes two bases to form a rung -- one for each side of the
ladder.) A sugar molecule, a base, and a phosphate molecule group together to make up a nucleotide.
Nucleotides are abundant in the cell's nucleus. Nucleotides are the units which, when linked sugar to
phosphate, make up one side of a DNA ladder.
During DNA replication, special enzymes move up along the DNA ladder, unzipping the molecule as it moves
along. New nucleotides move in to each side of the unzipped ladder. The bases on these nucleotides are very
particular about what they connect to. When the enzyme has passed the end of the DNA, two identical
molecules of DNA are left behind. Cytosine (C) will "pair" to guanine (G), and adenine (A) will "pair" to thymine
(T). How the bases are arranged in the DNA is what determines the genetic code.
When the enzyme has passed the end of the DNA, two identical molecules of DNA are left behind. Each
contains one side of the original DNA and one side made of "new" nucleotides. It is possible that mistakes
were made along the way -- in other words, that a base pair in one DNA molecule doesn't match the
corresponding pair in the other molecule. On average, one mistake may exist in every billion base pairs. That's
the same as typing out the entire Encyclopedia Britannica five times and typing in a wrong letter only once!
Objectives
The replication of DNA before cell division can be shown using paper templates for the components of DNA
nucleotides.
Materials
Cut Outs of basic subunits of DNA
Colors or markers
Scissors
Tape or glue
Paper & pencil
Procedure:
1. Cut out all of the units needed to make the nucleotides from the handout provided.
2. Color code the Nitrogenous bases, phosphorus, and deoxyribose sugar as follows ---
Adenine = red, Guanine = green, Thymine = yellow, Cytosine = blue, Phosphate = brown, and
Deoxyribose = purple.
3. Using the small squares and stars as guides, line up the bases, phosphates and sugars.
4. Now glue the appropriate parts together forming nucleotides.
5. I have provided one Strand of DNA for you, you need to assemble the new complimentary daughter
strand using the nucleotides you have just assembled.
Questions:
1. Of the 4 bases, which other base does adenine most closely resemble? Why? _________________________
__________________________________________________________________________________________
2. Which 2 molecules of a nucleotide form the sides of a DNA ladder? _________________________________
3. If 30% of a DNA molecule is Adenine, what percent do you think is Thymine? Why? ____________________
__________________________________________________________________________________________
__________________________________________________________________________________________
4. What does the term replication mean? ________________________________________________________
__________________________________________________________________________________________
5. What base matches up with Adenine? __________________________ Guanine? ______________________
Cytosine? _______________________ Thymine? ________________________
6. You were busy adding the correct nucleotides to the daughter strand during this lab. What enzyme were
you acting like? ________________________________
7. What enzyme would have unzipped the DNA so we could easily read it? _____________________________
8. If I gave you a strand of DNA that read GGGTCAAAAAATGGCTCAGTTACAGTAAAAAA, what would the
complimentary strand read? __________________________________________________________________
9. Why do you think it is necessary for replication to be occurring at many locations on a chromosome at
once? ____________________________________________________________________________________
_________________________________________________________________________________________
10. Below is a chart comparing the percentages of each base in different organisms? Which organism does not
fit the pattern you know and why? _____________________________________________________________
__________________________________________________________________________________________
__________________________________________________________________________________________
Adenine Thymine Guanine Cytosine
Organism A 24% 24% 32% 32%
Organism B 27% 27% 27% 27%
Organism C 18% 37% 18% 37%