Pharmacognosy and Plant Chemistry Page 1 of 26

A 1. A glucosan yield glucose units on hydrolysis. While inulin is a ____

a. fructosan b. hexosan c. pentosan d. diosan e. all of these

A 2. The usual source of tannins from plants are from the :

a. barks/stems b. seeds c. roots d. rhizomes e. all of these

A 3. Ethanol and citric acid are produced by the cellular respiration of carbohydrates, especially
a. glucose b. sucrose c. fructose d. xylose e. lactose

B 4. Because mannitol is absorbed from the GIT and parenterally is not metabolized, then it is used as:
a. digestant b. osmotic diuretic c. acidulant d. cathartic e. laxative

B 5. This gum has pseudo-plastic property to enable ointments to hold their shape and spread readily.
-

a. Karaya b. xanthan c. locust bean d. guar e. Indian gum

D 6. The following are general steps in the preparation of the crude drug for commercial market, except:
a. harvesting b. garbling c. storage and drying d. none of the above

B 7. The usual source of fixed oils:

a. flowers b. seeds c. leaves d. stems e. roots/rhizomes

B 8. This is used as an antidote for alkaloidal poisoning:

a. lactic acid b. tannic acid [Link] acid d. picric acid e. gallic acid

C 9. The most important of the opium alkaloids is:

a. heroin b. codeine c. morphine d. narcotine e. papaverine

C 10. The red-colored product formed when tannins are treated with hydrolytic agents known as:
a. amolonin b. diosgenin c. phlobephenes d. catechin e. leucocyanidin

B 11. The most widely used alkaloid is:

a. heroin b. codeine c. morphine d. narcotine e. papaverine

D 12. Tannins have the ability to precipitate ______ which is utilized in vegetable tanning which converts animal
hides to leather:
a. fats b. carbohydrates c. alkaloids d. proteins e. glycosides

E 13. Among the anthraquinone glycosides, this is not employed as cathartic because it is too irritating to use:
a. aloe b. frangula c. rhubarb d. senna e. chrysarobin

E 14. Ethiodized oil is an iodine addition product of ethyl ester of the fatty acid of:
a. corn b. peanut c. almond d. soybean e. poppy seed

B 15. The alkaloid present in Rauwolfia is

a. emetine b. reserpine c. physostigmine d. morphine e. scopolamine

A 16. The alkaloid formed by the acetylation of morphine is:

a. heroin b. codeine
-
methylation of
c. morphine d. cocaine e. papaverine

D 17. One of the following does not belong to the group; the volatile oils present in Vick’s vaporub:
a. methol b. camphor c. thymol d. eugenol e. cineole

A 18. This alkaloid is employed in ophthalmology to treat glaucoma:

a. eserine b. reserpine c. emetine d. morphine e. strychnine

E 19. One of the following is not a medicinal balsam:

a. storax b. benzoin c. styrax d. tolu e. methyl salicylate

D 20. If Indian hemp is cannabis; then black Indian hemp is:

a. convallaria b. podophyllum c. benzoin d. apocynum e. red squill

B 21. The alkaloid in the form of syrup is used in the treatment of drug overdose in certain poisonings
a. hydrates b. ipecac c. quinine d. ergotamine e. morphine

C 22. The product formed by the action of nitric acid on rectified turpentine oil in the presence of alcohol is:
a. cineole b. eugenol c. terpinol d. borneol e. linalool

D 23. The principal cinchona alkaloid employed therapeutically as anti-protozoal drug

a. quinine b. chloroquine c. quinacrine d. quinidine e. eserine salicylate

D 24. The main therapeutic use of methosalen, a lactone glycoside:

a. anti-coagulant b. aphrodisiac c. anthelmintic d. repigmentation
Pharmacognosy and Plant Chemistry Page 2 of 26

E 25. Sodium morrhuate is the sodium salt of the fatty acid of:
-

a. shark b. whale c. cow d. pig e. cod

C 26. Paregoric is also known as:

a. opium tincture c. camphorated opium tincture e. none of these
b. dover’s powder d. laudanum

C 27. Menthol is the active constituent present in:

a. cinnamon b. coriander c. peppermint d. citronella e. spearmint

D 28. Lemon oil that has a _____ odor must not be used or dispensed:
a. rancid b. resinified c. calcified d. terebenthinate e. foul

D 29. These are lipid metabolites formed in the body of animals from unsaturated fatty acids of the diet:
a. carnauba b. bayberry c. copaiba balsam d. prostaglandin e. lanolin

A 30. Mercuric Iodide, Potassium Iodide and water are the composition of:
a. Mayer’s Reagent c. Wagner’s Reagent e. none of these
b. Dragendorff’s Reagent d. all of these

A 31. Classified as a alcohol glysoside:

a. salicin b. gentisin c. cantharidin d. entadin

B 32. These are antigenic substances capable of sensitizing the body in such a way that unusual responses
occur in hypersensitive individuals:
a. antibodies b. allergens c. allergy d. all of these e. none of these

C 33. This test is used to determine the presence of proteins and involves the reaction of the benzene nucleus
in the protein molecules yielding a deep yellow ppt as positive result.
a. Biuret test c. Xanthoproteic test e. none of these
b. Ninhydrin testrfgv4 d. Millon’s test

C 34. This is a solid vegetable oil

a. coconut oil b. peanut oil c. theobroma d. cod liver oil e. almond oil

D 35. The coloring matter in plants

a. flavones b. anthraquinones c. apigenin d. plant pigments e. none of these

D 36. It is a liquid animal fat

a. coconut oil b. peanut oil c. theobroma d. cod liver oil e. almond oil

B 37. Blue-black color may indicate the presence of

a. condensed tannins b. hydrolysable tannins c. saponin d all of these e. none of these
-
red

B 38. The pathologic product of sperm whale is

a. copaiba b. ambergris c. bayberry d. carnauba e. teaberry

A 39. The terpenes found in volatile oils, as well as other plant products, like steroids, carotenoids, amyrins
and rubber are collectively known as:
a. isoprenoids c. sesquiterpenes e. none of these
b. unoxygenated terpenes d. all of these

B 40. This refers to the evaluation by means of the organs of sense and includes macroscopic appearance of
drugs
a. microscopic b. organoleptic c. macroscopic d. all of these e. none of these

B 41. The process of removing sufficient moisture to ensure good keeping qualities.
a. harvesting b. drying c. collection d. garbling e. none of these

C 42. Source of arbutin, a phenol containing glycoside:

a. buckwheat b. checkerberry c. bear berry d. dragonfruit

A 43. The most widely occurring sterol

a. sitosterol b. cholesterol c. ergosterol d. all of these e. none of these

B 44. The principal sterol in fungi

a. cholesterol b. ergosterol c. B-sitosterol d. all of these e. none of these
D 45. In the enfleurage method, the fatty product impregnated with the floral odor is called:
a. absolutes b. terpenes c. concretes d. pomade

B 46. Limonene has the configuration:

a. three double bonds and no cycle c. one double bond and two cycles
b. two double bonds and one cycle d. three cycles
Pharmacognosy and Plant Chemistry Page 3 of 26

A 47. Ascaridol, a volatile oil constituent obtained from the chenopodium oil is a/an:
a. oxide b. furan derivative c. alcohol d. phenol

D 48. In general, alkaloids may be identified by:

a. specific rotation c. color reactions with specified reagents
b. solubility in various solvents d. all of the above

A 49. This does not possess narcotic properties and is therefore sometimes called anarcotine
a. noscapine c. papaverine HCl e. none of these
b. hydrocodone d. hydromorphone

B
a. liotrix
-
50. It is a uterine stimulating fraction and it is relatively free from action on other smooth muscle
c. sodium dextrothyroxine e. none of these
b. oxytocin d. vasopressin

D --
51. This regulates the threshold for resorption of water by the epithelium of the renal tubules
a. liotrix b. oxytocin c. sodium dextrothyroxine d. vasopressin e. none of these

A 52. These are resinous mixtures that contain cinnamic acid, benzoic acid or both or esters of these acids:
a. balsams b. rosin c. resins d. resenes e. none of these

B 53. A mixture of protein-digesting and milk clotting enzymes obtained from the juice of the pineapple plant
a. chymotrypsin b. bromelain c. lactase d. sutilains e. none of these

C 54. The blue color of the oil of chamomile, an inherent property of the oil when freshly distilled, is due to:
a. chamazulene b. C15H18 c. a and b d. none of the above

D 55. The following employs expression as a method of volatile oil extraction except:
a. sponge process b. ecuelle method c. machine process d. enfleurage

C 56. In percolation with volatile solvents as a method of volatile oil extraction, the volatile solvent is
removed by vacuum distillation and the resulting product is known as:
a. absolutes b. terpenes c. concretes d. pomade

A 57. After separating the waxes from the volatile oil, the resulting product is known as:
a. absolutes b. terpenes c. concretes d. pomade

A 58. A class of proteins which are characterized by solubility in water and in diluted aqueous salt solutions
a. albumins b. globulins c. glutelins d. all of these e. none of these

A 59. The following is/are the properties of the hydrolysable tannins except:
a. they give a dark green color with ferric chloride TS
b. gallic acid when heated result to formation or pyrogallol
c. they yield no precipitate with bromine water TS
d. pyrogallol give soluble compounds with lead acetate

B 60. This is the parent nucleus of the chlorophylls:

a. bilan b. porphine c. tetraporphinpyrrole d. magnesium

C 61. Chemical classes of sapogenin include/s the following:

a. steroid b. triterpenoid c. a and b d. none of the above

B 62. The following is/are true for chlorophyll A, except:

a. chlorophyll A has a methyl substituent attached to the top right-hand pyrrole ring
b. chlorophyll A occur in ferns, mosses and algae
c. the ratio of chlorophyll A to B is usually about 3 : 1 and there is no ready interconversion between them
d. none of the above

A 63. This is the solvent most commonly used for the extraction of chlorophyll from leaves:
a. acetone b. ethanol c. dimethylformamide d. dimethylsulfoxide

A 64. These are derivatives of manelonitrile:

a. cyanophophore glycosides b. glucosinolates c. a and b d. none of the above

A 65. The following is/are the properties of nonhydrolyzable tannins except:

a. they give a bluish to black color with ferric chloride
b. they usually contain phloroglucinol nucleus in part
c. they are usually precipitated by bromine water TS
d. they yield catechol when heated

A 66. To convert an alkaloid salt into a free base, the following should be added:
a. sodium carbonate b. tartaric acid solution c. pet ether d. none of the above
Pharmacognosy and Plant Chemistry Page 4 of 26

C 67. These are the common red to blue pigments of flower petals:
a. flavonoids b. anthracene c. anthocyanins d. benzoquinone

C 68. Which of the following glycosides yield allyl isothiocyanate as one of the products of hydrolysis:
a. amyglandin b. prunasin c. sinigrin d. sinalbin

D 69. These are major carotenoids in plants, except:

a. b-carotene b. lycopene c. a-carotene d. gossypol

C 70. Most of the glycosides are subject to hydrolysis, resulting in the cleavage of glycosidic linkages, by:
a. acid or enzyme b. alkali c. a and b d. none of the above

B 71. Which of the following glycosides represent the group of bound poisons?
a. glucosinolates b. cyanophore c. a and b d. none of the above

A 72. Which of the following glycosides yield HCN as one of the products of hydrolysis:
a. amyglandin b. sinigrin c. sinalbin d. none of the above

A 73. Which of the following is classified as alcohol glycosides:

a. salicin b. glucovanillin c. prunasin d. arbutin

A 74. Which of the following yield a phenolic compound as one of its products of hydrolysis:
a. arbutin b. salicin c. glucovanillin d. none of the above

B 75. The conversion of papaverine into papaveroline is a _____ type of reaction

a. dehydration b. demethylation c. hydrolysis d. oxidation

D 76. Which of the following is a rare type of alkaloid?

a. primary b. secondary c. tertiary d. quaternary

D 77. Each of the following volatile oils has a hydrocarbon as major constituent except:
a. turpentine oil b. lemon oil c. pepper oil d. rose oil

A 78. The conversion of morphine into apomorphine is a _____ type of reaction

a. dehydration b. demethylation c. hydrolysis d. oxidation

C 79. Each of the following volatile oils has an aldehyde as a major constituent except:
a. Ceylon cinnamon oil b. lemon oil c. camphor oil d. cassia cinnamon oil

A 80. These are natural or induced solid or semisolid exudations from plants or from insects feeding on
plants:
a. resins b. oleoresins c. gum resins d. balsams

A 81. Specific glycoside obtained from Coccus cacti:

a. carminic acid b. tannic acid c. ratanhiaphenol d. bergapten

B 82. Alkaloids as salts may be liberated from plant components using:

a. acidulated water b. sodium carbonate c. methanol d. ether

D 83. Scientific name of Neem, used as an insecticide and bitter:

a. Avena sativa b. Arnica Montana c. Illicium verum d. Azadirachta indica

A 84. These are esters of high molecular, monohydric alcohols and high molecular fatty acid:
a. waxes b. phospholipids c. glycolipids d. sphingomyelins

A 85. The plant material is treated with ammonium hydroxide in order to:
a. convert alkaloidal salts into free base c. a and b
b. convert free bases into alkaloidal salts d. none of the above

A 86. Theophylline is classified as:

a. xanthine b. pyridine c. indole d. isoquinolone

C 87. Anti-acne principle synthesized from castor oil:

a. ricinoleic acid b. prussic acid c. azeleic acid d. saffric acid

B 88. Flavonoid found in yellow flower pigments:

a. flavonols b. chalcones c. anthocyanins d. biflavonyls

B 89. Menstruum used to extract solanine from potatoes:

a. water b. acetic acid c. alcohol d. benzene

A 90. Glycoside found in garlic which possesses anti-platelet, anti-microbial and anti-rheumatic properties:
a. allicin b. berberine c. cantharmin d. sanguinarine
Pharmacognosy and Plant Chemistry Page 5 of 26

A 91. These are esters consisting of glycerol in combination with fatty acids, phosphoric acid and certain
nitrogenous compounds:
a. phospholipids b. waxes c. glycolipids d. sterols

C 92. Glycosidic principle obtained from fish berries, Cocculus indicus formerly used as an analeptic:
a. quassin b. humulin c. picrotoxin d. gentisin

A 93. A French pharmacist collaborated with Pelletier in the discovery of Quinine which has become a
worldwide treatment of malaria:
a. Joseph Caventou b. Pierre Robiquet c. Frederick Serturner d. Rudolf Brandes

D 94. Drugs classified according to the natural relationship among plants and animals:
a. zoological arrangement c. morphological classification
b. chemical classification d. taxonomic classification

B 95. Generally accepted medicinal use of tannins:

a. tanning of leather c. laboratory precipitant
b. astringent d. as ingredient in the preparation of ink

D 96. Cocaine has a long duration of local anesthetic action because it is a:

a. bronchoconstrictor b. bronchodilator c. vasodilator d. vasoconstrictor

D 97. Quinoline alkaloid employed for malaria:

a. Cinchonidine b. Cinchonine c. Quinidine d. Quinine

D 98. Most important monosaccharides found in plants:

a. trioses b. levulose c. pentoses d. hexoses

D 99. It reacts with iodine to form a deep blue complex:

a. insulin b. starches c. amylopectin d. amylose

D 100. The paste forming properties of starch are due to this constituent:
a. inulin b. starches c. amylose d. amylopectin

C 101. Plant acid isolated in crystal form from lemon by Scheele in 1784:
a. tartaric acid b. lactic acid c. citric acid d. nitric acid

B 102. The characteristic bitter flavor of beer is due to:

a. burnt caramel b. lupulus c. barley d. mace

C 103. Purified water soluble mixture of glycosides extracted from cascara:

a. cascaroside b. emodin c. casanthranol d. rhamin

A 104. Animal used in the biological assay of digitalis for its potency:
a. pigeon b. horse c. rabbit d. cat

A 105. A phytochemist who made a number of significant discoveries including codeine in 1832 and the isolation
of narcotine:
a. Pierre Robiquet b. Frederick Serturner c. Joseph Caventou d. Emil von Behring

A 106. A German pharmacist who isolated hyoscyamine in 1819 and with fellow pharmacist, Philip Geiger,
collaborated in research to discover atropine in 1835:
a. Rudolf Brandes b. Emil von Behring c. Frederick Serturner d. Pelletier

C 107. Enzymes that hydrolyze a considerable number of glycosides:

a. invertase b. maltase c. emulsin and myrosin d. lactase

A 108. Known as the first broad-spectrum antibiotic discovered:

a. chloramphenicol b. erythromycin c. penicillin d. streptomycin
A 109. It destroys red blood corpuscles by hemolysis and are toxic especially to cold-blooded animals:
a. saponin glycosides c. cyanogenic glycosides
b. anthraquinone glycosides d. favonol glycosides

D 110. The following are stereoptenes, except:

a. menthol b. camphor c. thymol d. eugenol

A 111. The following are characteristic of volatile oils except:

a. miscible with water c. they are optically active
b. they have odorous principles d. they resinify

B 112. A type of distillation applied to plant material that is dried and not subject to injury by boiling:
a. direct steam b. water distillation c. steam distillation d. water and stem distillation
Pharmacognosy and Plant Chemistry Page 6 of 26

A 113. Known as alligator pear, its pulverized seeds can be used to treat rheumatism and neuralgia:
a. Persea americana b. Arcangelista flava c. Nerium oleander d. none

A 114. The purified fatlike substance obtained from the wool of sheep:
a. lanolin b. cetyl esters wax c. cysteine d. spermaceti

C 115. The scientific name of kintsay:

a. Vitex negundi b. Lantan camara c. Apium graveolens d. none

D 116. It contains kuskus oil and is known as moras:

a. cocos nucifera b. vetiveria zizanioides c. quisqualis indica d. none

D 117. Citral is an:

a. alcohol volatile oil b. ketone volatile oil c. hydrocarbon volatile oil d. aldehyde volatile oil

B 118. The active constituent of Capsicum frutescens:

a. capsicin b. capsaicin c. capsin d. b and c only e. a and b only

C 119. A drying agent used to purify essential oils:

a. anhydrous calcium carbonate c. anhydrous calcium sulfate
b. calcium chloride d. all of these

A 120. The following are tests for saponin glycosides except:

a. Barfoed’s b. hemolysis test c. capillary test d. froth test

B 121. It is a purified carbohydrate product obtained from the inner rind of citrus fruits:
a. lactic acid b. pectin c. tartaric acid d. citric acid

D 122. The following are monosaccharides except:

a. fructose b. glucose c. mannose d. sucrose

A 123. A type of extraction used in the preparation of tincture or fluidextracts:

a. percolation b. digestion c. infusion d. maceration

D 124. A local source of cyanogenic glycosides is:

a. Cyanogenum esculenta b. Manihot esculentum c. Manihot cympogon d. Manihot esculenta

B 125. A resin which is used as a diaphoretic:

a. ginger b. capsicum c. hashish d. pistachia

B 126. It contains the alkaloid called ditamine and is known as Australian quinine bark:
a. dilaw b. dita c. dawag d. none

B 127. The technical term for solvent used during extraction:

a. menstrual b. menstruum c. extract d. marc

C 128. It is one of the ingredients of the embalming material of the Egyptians:

a. benzoin b. tolu balsam c. myrrh d. none

A 129. The official test animal employed in the standardization of mydriatic drugs such as atropine:
a. cat b. dog c. horses d. rabbit

A 130. It is used in the treatment of asthma by using the leaves and flowers as cigarettes:
a. talumpunay b. tanglad c. mais d. none

B 131. The element responsible for the basic pharmacological properties of alkaloids:
a. sulfur b. nitrogen c. oxygen d. phosphorus
B 132. The botanical origin of motherwort or damong maria which can be used as insect repellant:
a. Alstonia macrophylla b. Artemisia vulgaris c. Citrus aurantium d. none

B 133. The scientific name of makahiya or sensitive plant:

a. Moringa oleifera b. Mimosa pudica c. Tinospora rumphii d. none

A 134. A plant causing dermatitis:

a. poison ivy b. amanita phalloides c. anise d. all of the above

C 135. Takip-kuhol contains bitter principle vellarin used as counter-irritant. Its scientific name is:
a. Datura metel b. hyptis suaveolens c. Centella asiatica d. none

C 136. Glycoside found in cassava:

a. mandelonitrile b. cyanohydrine c. mannihoxotin d. hydrocyanic acid
Pharmacognosy and Plant Chemistry Page 7 of 26

C 137. An oleoresin used externally as counterirritant:

a. white pine b. balsam of peru c. turpentine d. none

B 138. It is known as Indian hemp or hashish:

a. myrrh b. cannabis c. copaiba d. none

A 139. It is known as Ringworm bush or shrub, used to treat ringworm by using its leaves:
a. akapulko b. abutra c. ambal d. none

A 140. The botanical origin of bitter gourd:

a. Momordica charantia b. Oremna odorate c. Anoma reticulate d. none

A 141. Caffeine belongs to this class of alkaloids:

a. cinchona alkaloids b. ergot alkaloids c. xanthine alkaloids d. vinca alkaloids

A 142. This plant is used to wrap cooked rice for fragrance:

a. pandan-mabango b. romero c. palo maria d. none

A 143. Hallucinogenic agent derived from Cannabis sativa includes:

a. tetrahydrocannabinol b. scopolamine c. emetine d. all of the above

A 144. The official test animal employed to assay Curare alkaloids, since these animal manifest the head drop,
indicative of muscle relaxation:
a. rabbit b. cat c. monkey d. dog

A 145. Intrinsic factor in pernicious anemia:

a. cyanocobalamin b. hemoglobin c. ferrous d. all of the above

C 146. It contains ocimene, eugenol and pinene and a decoction of this herb is for treatment of cough:
a. foeniculum vulgare b. bixa orellana c. ocimum basilicum d. none

C 147. Is a flavor used to disguise the bitterness of certain preparation, such as those containing quinine:
a. eridictyon b. podophyllum c. jalap d. kava

D 148. All these drugs contain caffeine except:

a. coffee b. cola c. tea d. coca

A 149. The solid, oxidized hydrocarbon portion of volatile oils:

a. stearoptene b. eleoptene c. none of these d. stearic acid

B 150. The study of the used of chemical agents which are more selectively toxic to the invading organism than to
host is known as:
a. physiology b. chemotherapy c. immunology d. pharmacology

D 151. The solid resin from turpentine:

a. benzoin b. styrax c. tolu d. rosin

A 152. When the powder of this alkaloid is burned, the resultant vapor is inhaled for the relief of asthma:
a. stramonium b. caffeine c. cinchona d. cocaine

D 153. Which of the following is an anti-hypertensive and psychotherapeutic alkaloid:

a. physostigmine b. quinie c. papaverine d. reserpine

C 154. Medicinal effects and potencies of cardio-active glycosides depend on:

a. digitalase b. glucose c. genin structure and glycone component d. cardiac/cardiotonic effect

C 155. The most notable property of tannins utilized in the leather industry:
a. denature proteins b. precipitate protein c. denature proteins and ppt protein d. none of these

A 156. A test for carbohydrates containing protein producing a red-blue or purple ring between the two layers:
a. molisch test b. xanthoproteic test c. ninhydrin test d. biuret test

B 157. Parts of this plant are used as condiments, except:

a. bawang b. makabuhay c. siling labuyo d. luya

B 158. Although the prostaglandins are hormone-like, they more closely resemble which of the following
chemically:
a. prophyrins b. lipids c. carbohydrates d. enzymes

C 159. It is known as lemon grass under the family Poaceae, used as diuretic, aromatic bath and scent for
perfume:
a. tangan-tangan b. dayap c. tanglad d. none
Pharmacognosy and Plant Chemistry Page 8 of 26

B 160. The local name of Quisqualis indica:

a. niyog b. niyog-niyogan c. moras d. none

C 161. The scientific name of mansanilya:

a. quassia indica b. coleus scutellarodes c. chrysanthemum indicum d. none

B 162. Component of volatile oil which is responsible for its antiseptic and germicidal action:
a. ethers b. phenols c. hydrocarbons d. esters

A 163. Yeast is rich source of:

a. riboflavin b. folic acid c. ascorbic acid d. thiamine

A/D 164. Is the common medicinal use of volatile oil:

a. carminative b. bacteriostatic c. antimicrobial d. all of these

D 165. Codeine which is used as an analgesic and depressant to the cough reflex is a derivative of:
a. benzoic acid b. cocaine c. salicylic acid d. morphine

B 166. The polyglucan used as a plasma expander and is formed from sucrose by the action of the enzyme
transglucosylase:
a. inulin b. dextran c. gelatin d. hetastarch

A 167. Attacks protopectin yielding soluble pectin:

a. protopectase b. pectose c. pectinase d. pectase

A 168. The starting materials for the synthesis of fats in plants:

a. fatty acids and glycerol b. lipids c. carbohydrates d. sugars

B 169. Which of the following vitamins is a precursor of coenzyme A?

a. cobamide b. panthothenate c. thiamine d. riboflavin

D 170. A descriptive material pertaining to any drugs or preparation in the USP/NF:

a. material medica b. official description c. all of these d. official monograph

B 171. One of the following means ‘ food of the gods’:

a. coffee b. theobroma c. tea d. cassia

C 172. Pigment of flowers which is of glycosidic character:

a. xanthophyll b. cytochrome c. anthocyanins d. lutein

D 173. End product of acid formation in the plant and occurs as insoluble calcium salt or raphides:
a. calcium acetate b. calcium citrate c. calcium tartrate d. calcium oxalate

A 174. 1, 3, 7-trimethyl xanthine is the chemical name of:

a. caffeine b. theophylline c. theobromine d. thebaine

D 175. Plastid pigments are commonly extracted by which of the following solvents?
a. alcohol b. acetone c. chloroform d. ether

A 176. A plant pigment of therapeutic importance in preventing xeropthalmia is:

a. carotene b. xanthophylls c. fucoxanthin d. chlorophyll

A 177. A test to distinguish tartrates from citrates makes use of this reagent:
a. deniges reagent b. bromine water c. mayer’s reagent d. dragendorff’s reagent

D 178. USP official alkaloid(s) with oncolytic action is/are the following:
a. leucristine b. vinblastine c. vinca luekoblastin d. all three

A 179. Method of extracting volatile oils with the use of cold fat:
a. enfleurage b. digestion c. percolation d. maceration

B 180. Which vitamin is formed in the body by exposure to ultraviolet irradiation or sunlight?
a. vitamin E b. vitamin D c. vitamin A d. vitamin C

C 181. The following is not a polysaccharide:

a. dextran b. cellulose c. sucrose d. insulin

B 182. Active constituent of the volatile oil of tanglad which is a very good source of vitamin A:
a. geraniol b. citral c. citronellal d. citronellol

C 183. The alkaloid obtained from ergot which is used to relieve or treat migraine is:
a. ergometrine b. vinblastine c. ergotamine d. solanine
Pharmacognosy and Plant Chemistry Page 9 of 26

B 184. Condensed tannins give the specific colored precipitates with FeCl3 test:
a. blue-black ppt b. green-black ppt c. blue-green ppt d. blue ppt

C 185. Volatile oil plays a vital role in plants as:

a. astringents c. insect repellants/attractants
b. protein synthesizer d. cellular processes

A 186. A drug which disguises the bitter taste of quinine by paralyzing the taste buds is:
a. glycyrrhiza b. yerba soldado c. buchu d. yerba santa

D 187. The new name of the family Palmae:

a. poaceae b. asteraceae c. caesalpinaceae d. arecaceae

D 188. Free vitamin A does not occur in plants, but in its place are compounds that are converted into vitamin
A in the small animal body. These precursors of vitamin A are called:
a. provitamin B b. neovitamin A c. B-carotene d. b and c

D 189. The hallucinogen derived from ergot:

a. THC b. ETO c. EDTA d. LSD

D 190. Confirmatory test for glucose:

a. Fehling’s test b. Biuret’s test c. Iodine test d. Moore’s test

C 191. The purified mixture of simple protein principles obtained from the sperm or testes of suitable species of
fish, usually those belonging to the genera Oncorhyncus Suckley:
a. penicillamine c. protamine sulfate
b. heparin sodium d. none of the above

D 192. An alkaloid which does not react with or form precipitate with alkaloidal reagent is:
a. hyoscyamine b. quinine c. atropine d. caffeine

A 193. The new name of the family Graminea:

a. Poaceae b. Asteraceae c. Caesalpinaceae d. Arecaceae

A 194. Animals used to determine the phenol coefficient or antiseptic value of certain drug:
a. mice b. rabbits c. pigeons d. guinea pigs

B 195. A structural polysaccharide found I primary cell walls and functions as intercellular cement:
a. cellulose b. pectins c. lichen starch d. starch e. alginic acid

D 196. The step in the preparation of crude drug which consists of the removal of the extraneous matter prior
to packaging:
a. selection b. all of these c. collection d. garbling

C 197. The wax present in beeswax is:

a. ceryl stearate b. myricyl cerotate c. myricyl palmitate d. ceryl palmitate

C 198. The primary function of plants not present in animals but on which animal and man depend greatly:
a. respiration b. glycolysis c. photosynthesis d. metabolism

B 199. These yield fixed oils except:

a. coconut b. lemon grass c. peanut d. corn

B 200. Colloidal substance obtained from Gelidium cartilagineum also known as:
a. gelatin b. glandular cells c. tragacanth d. alginic acid

C 201. Oil tubes found in plants under Apiaceae family that contain the volatile oil:
a. parenchyma cells b. glandular cells c. vittae d. schizogenous passages

C 202. The enzyme in black mustard seed that hydrolyzes the glycoside:
a. emulsin b. amygdalase c. myrosin d. papain

D 203. Plant sources of tropane alkaloids except:

a. belladonna b. stramonium c. hyoscyamus d. senna

A 204. Citrus volatile oils whose aroma is injuriously affected by heat is best obtained by:
a. expression b. maceration c. enfleurage d. percolation

B 205. The following are differences of hydrolyzable from non-hydrolyzable tannins except:
a. hydrolyzable tannins form blue-black precipitates with ferric chloride
b. non-hydrolyzable tannins decolorize potassium permanganate
c. hydrolyzable tannins show no visible result with bromine water
d. none of the above choices
Pharmacognosy and Plant Chemistry Page 10 of 26

A 206. The enzyme that catalyze the hydrolysis of proteins:

a. trypsin b. amylotrypsin c. ptyalin d. none of these

A 207. Purified carbohydrate product obtained from the dilute acid extract of the inner portion of the rind of citrus
fruits or from apple pomace:
a. pectin b. dextran c. xanthan gum d. agar

D 208. The following fixed oils are used as solvent for IM injections, except:
a. sesame oil b. peanut oil c. corn oil d. olive oil

D 209. Plant sources of purine bases alkaloids:

a. kola b. tea c. cacao d. all of these

D 210. An amorphous mixture of glucosides obtained from the leaf of Digitalis purpurea:
a. digitoxin b. digitonin c. digitalis d. gitalin

C 211. Contain about a dozen cardioactive glycosides, the principal of which is scillaren A:
a. red squill b. ouabain c. squill d. deslanoside

C 212. Forms colloidal solutions in water that foam upon shaking, and destroys the RBC by hemolysis:
a. tannins b. alkaloiuds c. saponins d. fats

B 213. Also known as Vitamin H which acts as a carboxyl-carrying cofactor in several carboxylase enzyme system:
a. choline b. biotin c. yeast d. PABA

A 214. Saccharomyces cerevisiae is:

a. Brewer’s yeast b. Torula yeast c. both a and b d. neither a and b

A 215. Component of lecithin and a precursor of acetylcholine:

a. choline b. biotin c. yeast d. PABA

A 216. The organism used in the parasitic method of producing Ergot alkaloids:
a. Claviceps purpurea b. Claviceps paspali c. both a and b d. none of the given

B 217. A true from of adulteration:

a. admixture b. sophistication c. substitution d. deterioration

D 218. First anti-fungal antibiotic:

a. bacitracin b. nystatin c. fulvicin d. griseofulvin

A 219. Glycosides are also known as:

a. sugar-ether b. sugar-ester c. sugar-acids d. none of the above

B 220. The alkaloid used as a means of doubling chromosomes in the study of plant genetics:
a. ephedrine b. colchicines c. atropine d. eserine

D 221. Ideal temperature for storage of volatile oils:

a. 8-50o C b. 15-20oC c. 25-40oC d. 2-8oC

A 222. Contact insecticide:

a. rotenone b. pyrethrin c. nicotine d. all of the above

D 223. This is also known as 4-hydroxy-3-methoxy benzaldehyde popularly used as flavoring agent:
a. eugenol b. glycyrrhizin c. coumarin d. vanillin

C 224. The plant part from where the refined corn oil is obtained:
a. fruit b. seed c. embryo d. hairy portion

D 225. Which of the following belongs to anthraquinone glycosides:

a. vanilla b. glycyrrhiza c. mustard d. senna

A 226. Unicellular organisms that are well-known for their ability to metabolize sugar into alcohol and CO2:
a. yeast b. bacteria c. molds d. fungus

B 227. Rutin and hesperidin combination is also known as:

a. vitamin F b. vitamin P c. vitamin H d. vitamin K

C 228. Resin component devoid of chemical properties:

a. hydrocarbons b. resinotannols c. resenes d. balsam

A 229. The most important contributor to lemon oil flavor:

a. citral b. neural c. limonene d. geraniol
Pharmacognosy and Plant Chemistry Page 11 of 26

D 230. Contracts the gall bladder stimulating the flow of bile:

a. enterokinin b. secretin c. gastrin d. cholecystokinin

B 231. The undissolved portion of the drug that remains after extraction:
a. solute b. marc c. solvent d. active drug

A 232. The first of the broad spectrum antibiotics:

a. chloromycetin b. terramycin c. aureomycin d. penicillin

A 233. Fixed oils are frequently extracted from their sources by:
a. expression b. steam distillation c. filtration d. none of these

C 234. A purified carbohydrate product extracted from the brown seaweeds Macrosystic pyrifera by the use
of dilute alkali:
a. Karaya gum b. gelatin c. algin d. carrageenan

A 235. The principal component of essential oil:

a. terpenes b. aldehyde c. lactose d. esters

C 236. Class of natural products with potent and diverse biological activities involved in platelet aggregation,
pain and inflammation:
a. enzyme b. hormones c. prostaglandins d. tubocurarine

C 237. The first immunoglobulin to appear when a newly born infant begins its own antibody production:
a. IgD b. IgA c. IgM d. IgE

D 238. The general test for carbohydrate based on the dehydration of sugar to furfural derivatives when the
sugar is treated with concentrated, sulfuric acid producing a violet ring between two layers:
a. Fehling’s test b. Hainse’s test c. Benedict test d. Molisch

D 239. The following are tests for reducing sugars except:

a. Barfoed b. Benedict c. Fehling d. none of the above

B 240. The non-sugar portion of a glycoside is known as:

a. glycone b. genin c. inactive portion d. active

C 241. A plant pigment of therapeutic importance in preventing xerophthalmia is:

a. xanthophyll b. fucoxanthine c. carotene d. ahloroophyll

B 242. Fermenting enzymes that converts monosaccharides to ethyl alcohol and carbon dioxide:
a. rennin b. zymase c. urease d. sutilains

C 243. Glycosidic volatile oils are obtained by:

a. expression b. ecuelle method c. enzymatic hydrolysis d. destructive distillation

B 244. The alkaloid which continues to be the drug of choice against malaria:
a. cincholine b. quinine c. papaverine d. argonovine

B 245. Vinca rosea yields vinblastine which is:

a. antispasmodic b. anticancer c. antimalarial d. anti-TB

B 246. Japanese peppermint is solely employed as a source of:

a. terpinol b. menthol c. borneol d. carvacrol

C 247. Vinca rosea yields this antineoplastic alkaloid:

a. reserpine b. strychnine c. vincristine d. quinine

D 248. This alkaloid is used as a skeletal muscle relaxant:

a. cocaine b. papaverine c. berberine d. tubo-curarine

B 249. If Indian hemp is marijuana, then black Indian hemp is:

a. hashish b. apocynum c. shabu d. pot

B 250. Benne oil:

a. flaxseed oil b. sesame oil c. almond oil d. olive oil

D 251. The alkaloid reagent composed of iodine, in potassium iodine solution is known as:
a. Hager’s reagent b. Mayer’s reagent c. Dragendroff’s reagent d. Wagner’s reagent

D 252. A medicinally important lipid which is used as a sclerosing agent:

a. jojoba oil b. chaulmoogra oil c. licopodium d. sodium morrhuate
Pharmacognosy and Plant Chemistry Page 12 of 26

B 253. The root of Rauwolfia serpentina is used as:

a. sedative b. antihypertensive c. depressant d. stimulant

A 254. It serves as a commercial source of strychnine and brucine:

a. nux vomica b. calaban bean c. hydrastis d. sanguinaria

C 255. Source of castor oil:

a. Jatropha curas b. Michelia champaca c. Ricinus communis d. Croton tiglium

A 256. These are official tests done on living animals as well as on intact or excised organs and which often
indicate the strength of a particular drug or its preparation:
a. bioassays c. microscopic test e. chemical assay
b. histochemical test d. microbiological test

D 257. A specially prepared gelatin product used in neurosurgery and in thoracic and ocular surgery:
a. heparin sodium b. gelatin c. absorbable gelatin sponge d. absorbable gelatin film

C 258. An opium alkaloid known as narcotine isolated by Robiquet is now officially called as:
a. morphine b. codeines c. noscapine d. thebaine

C 259. Caffeine belongs to this class of alkaloids:

a. cinchona b. ergot c. xanthine d. vinca

B 260. An imidazole alkaloid obtained from pilocarpus jaborandi is used to treat:

a. gouty arthritis b. glaucoma c. cardiac stimulation d. exytoxic

A 261. The alkaloid found in calabar bean:

a. physostigmine b. cocaine c. colchicines d. emetine

B 262. Which of these lipids are used to control the consistency of creams and ointments?
a. cholesterol b. waxes c. stearic acid d. lecithin

D 263. A test to determine the presence of cyanogenic glycosides:

a. Borntrager test b. Lieberman-Burchard test c. Moore’s test d. Guignard test

B 264. The following alkaloid are present in Datura metel except:

a. atropine b. caffeine c. hyoscyamine d. scopolamine

A 265. Which of the following terms best describes a cofactor that is firmly bound to an apoenzyme:
a. holoenzymes b. nucleosides c. monosaccharides d. heteropolysaccharides e. transferase

A 266. Plant part collected when vegetative processes have ceased:

a. roots and rhizome b. flowers c. leaves d. seeds

B 267. One of the following is a sugar alcohol found in plants

a. Danthron b. Dulcitol c. Mannitol d. Sorbitol e. Tartaric acid

B 268. It is incorporated in tablets and lozenges that intended to aid in breaking tobacco habit
a. Quinine SO4 b. Lobeline SO4 c. Atropine SO4 d. Hyoscine HBr e. Cocaine HCl

C 269. This is the most widely used opium alkaloid which are narcotic analgesics and antitussives and are used as
sedatives, especially in allaying coughs.
a. Morphine b. Papaverine c. Codeine d. Heroine e. None

A 270. This term is used to designate simple organic compounds containing not more than 6 carbon atoms and
2 or 3 carboxyl groups:
a. Plant acids b. Succinic acid c. Isocitric acid d. all of these e. none

A 271. Expensive substance used in perfumery which is a pathological product found in intestines of sperm whales
or cast by them into the sea as a response to injury by squid beaks on which the sperm whale feeds:
a. ambergris b. ichthyocolla c. muskone d. acipenser

C 272. Devil’s dung used as a carminative, and anti-spasmodic:

a. jalap b. gamboges c. asafetida d. witch hazel

B 273. Use of bornyl acetate, a volatile oil constituents:

a. increase capillary permeability b. expectorant c. vasodilation d. none

A 274. The residue left after distilling the volatile oil from the oleoresin obtained from the various species of Pinus
a. colophony b. jalap c. mastic d. pinene
Pharmacognosy and Plant Chemistry Page 13 of 26

C 275. Dried stalks of seaweed which is used in dilating the cavities such as cervix in labor or abortion induction
due to its swelling chracteristic:
a. Kelp b. Agar c. Laminaria d. Lappa

C 276. The chief component of Melissa officinalis, is commonly known as lemon balm:
a. geraniol b. decanal c. citral d. limonene

C 277. A muccopolysaccahride obtained from saliva which is active against Gram (+) bacteria, by transforming
the insoluble polysaccharides
a. muramidase b. lysozyme c. a and b d. none

C 278. Oleandrin, the active component present in Rose bay, Nerium oleander, is classified as:
a. phenolic b. alkaloid c. glycoside d. peptide

D 279. Aromatic water prepared from its flowers has been used as vehicles for eye and skin lotions:
a. sage b. thyme c. oregano d. elder flower

A 280. Alkaloid obtained from Sarothammus scorparius which was formerly used fro cardiac arrythmias:
a. sparteine b. connine c. thebaine d. levuline

B 281. Alkaloid obtained from wolfsbane root or monkshood:

a. coniine b. aconitine c. Viburnine d. Selegiline

C 282. Odorous principle found in tonka beans which is used as a fixative in perfumery, flavor and as precursor of
anti- coagulants:
a. psoralens b. monobenzone c. coumarine d. phenytioin

C 283. Acvtive principle in ginseng is calssified as a________ glycoside:

a. anthraquinone b. flavanoid c. saponin d. alcohol

C 284. An acid present in apples and pears which is used as a sialogogue and combines with salicylic acid and
benzoic acid for desloughening effects:
a. lqctic acid b. pyruvic acid c. malic acid d. oxalic acid

C 285. Neroli oil:

a. Orange oil b. Orange peel oil c. Orange flower oil d. All of the above

B 286. High molecular weight polysaccharide gum produced by a pure culture fermentation of a carbohydrate with
Xanthamonas campestriesI, then purified by recovery with isopropyl alcohol, dried and milled:
a. dextran b. keltrol c. goat’s thorn d. gum Arabic

B 287. Milky white viscid secretion from the salivary glands of the worker hive bee, Apis mellifera, and is used as
a general tonic, toward the effects of old age:
a. lac b. royal jelly c. ginseng d. propolis

A 288. When nonhydolyzable tannins were boiled with hydrochloric acid, an insoluble compound known as______
is formed.
a. Phlobaphenes b. Cathecol c. Gallic acid d. Ellagic acid

A 289. Tannins is an effective antidote for_____poisoning.

a. Alkaloid b. Phosphorous c. Insecticide d. Lead

C 290. A CNS stimulant obtained from Nux vomica

a. Venleurosine b. Ergotoxine c. Brucine d. Strychnine

D 291. Constituent of Claviceps purpurea employed as a uterine muscle relaxant

a. Pilocarpine b. Ergotoxine c. Ergotamine tartarate d. Ergonovine maleate

D 292. Pilocarpine, an imidazole alkaloid is employed for the treatment of

a. Bronchial asthma b. Hypertension c. Motion sickness d. Glaucoma

B 293. These are usually hard, transparent, or translucent and when heated, they soften and finally melt
a. Alkaloids b. Resins c. Gums d. Tannins

A 294. Tragacanth is a dried gummy exudates from:

a. Astralagus gummifer b. Astralagus gumnifer c. Acacia senegal d. a and b

D 295. All of these are volatile oils that are used as condiments except:
a. anise b. clove oil c. nutmeg d. eucalyptus oil
Pharmacognosy and Plant Chemistry Page 14 of 26

A 296. A process of extraction which involve by macerating the drugs for a short period of time with
either hot or cold water.
a. infusion b. decoction c. maceration d. percolation

C 297. The following are plant acids except:

a. citric acid b. palmitic acid c. lactic acid d. tartaric acid

D 298. Active constituent of wintergreen oil:

a. eucalyptus oil b. olive oil c. methol oil d. gaultheria oil

D 299. A method of evaluating plants according to the type of constituent present

a. pharmacological b. pharmaceutical c. morphological d. chemical

D 300. These are acetal in which the hydroxyl of the sugar is condensed with a hydroxyl group of the
non sugar component:
a. tannins b. carbohydrates c. resins d. glycosides

A 301. The following are alkaloidal reagents except:

a. Millon’s reagent b. Mayer’s reagent c. Dragendorff’s reagent d. Wagner’s reagent

D 302. These are colorless but yields intense red or violet color when tested with boiled acid
a. flavanoids b. flavone c. cathechin d. leukan thocyanins

B 303. Used for the treatment of cystitis:

a. Blumea balsamifera b. Zea mays c. Sorbus aucuparia d. Saccharum officinarum

B 304. A phytochemical screening for saponin glycosides which measures the rate of fluidity of the extract:
a. viscosity method b. capillary method c. Liebermann Burchard method d. all of these

C 305. A ketone volatile oil that is used as antipruritus:

a. eucalyptol b. spearmint c. camphor d. inositol

C 306. These are esters of long chain fatty acids and alcohol
a. fixed oils b. fats c. lipids d. waxes

A 307. Gotu Kola obtained from the leaves and stems of Centella asiatica used as diuretic, blood purifier, treats
leprosy , body strengthener and revilaizer is locally known as:
a. takip-kuhol b. sulasi c. lagundi d. mahogany

A 308. An alkaloid which does not react with or precipitate with alkaloidal reagent is:
a. caffeine b. quinine c. hyoscyamine d. emitine

A 309. Are unicellular organisms that are well known for their ability to metabolize sugar into alcohol and
carbon dioxide:
a. yeast b. dried yeast c. baker’s yeast d. brewer’s yeast
B 1. The inhibition in a noncompetitive reaction:
a. competes with the active site of the enzyme c. increases the rate of reaction
b. binds simultaneously with substrate other than the active site d. both b and c

A 2. The order and sequence of amino acid in a polypeptide determines what protein structure?
a. primary b. secondary c. tertiary d. quaternary

B 3. Amino acids that cannot be synthesized in the organism are called _____
a. non essential amino acids b. essential amino acids c. standard amino acids d. alpha amino acids

A 4. Which hormone regulates the level of blood sodium?

a. aldosterone b. sterol c. corticosteroid d. cortisone

B 5. It is a precursor of vitamin A
a. B-carotene b. retinol c. retinal d. opium

C 6. Which of the following is a precursor of vitamin D?

a. prostaglandin b. linoleic acid c. cholesterol d. aldosterone

A 7. Which of these class enzymes introduces a double bond by the removal of hydrogen?
a. dehydrogenase b. dehydrolase c. decarboxylase d. lipase

A 8. The ionic property of amino acid is exhibited by its

a. zwitterions form b. NH2 group c. COO group d. positively charged groups

D 9. All of the following are simple proteins except:

a. glutelins b. globulins c. albumins d. glycoproteins

C [Link] simplest monosaccharide is __________

a. erythrose b. starch c. glyceraldehydes d. arabinose

C 11. Denaturation of protein is a result of:

a. cleavage of the peptide bond b. formation of H-bond c. breaking of H-bond d. none of these

A 12. Competitive inhibition is a ______ reaction

a. reversible b. irreversible c. pH and temperature d. none of these

A 13. In the Seliwanioff’s test, the reaction of resorcinol and acid on the sugar forms
a. hydroxymethyl furfural b. pyranose c. hydrazine d. purine

A 14. High concentration of neutral salts causes the precipitation of proteins. This is called _______
a. salting out b. salting in c. coagulation d. both b and c

A 15. The type of enzyme inhibition reaction whereby the inhibitor competes with the substrate at the active site:
a. competitive inhibition b. noncompetitive inhibition c. reversible inhibition d. incomplete
inhibition

C 16. The following are waxes except:

a. beeswax b. sperm oil c. bile acids d. lanolin

A 17. The inactive form of enzymes are called:

a. zymogens b. apoenzymes c. cofactor d. both b and c

D 18. Which of the following amino acids has no alpha amino group?
a. praline b. hydroxyproline c. glycine d. both a and b

B 19. An enzyme is a substance which

a. convert heat to energy b. act as a catalyst c. change chemically in reaction d. is not specific in reaction

B 20. Milk curdling enzyme present in gastric juice of infants:

a. pepsin b. rennin c. trypsin d. maltase

A 21. Carbohydrates are

a. polyhydroxyaldehydes / polyhydroxyketones c. hemiacetals
b. polyhydroxy acids d. polymers of amino acids

C 22. Insulin is usually classified as:

a. protein b. enzyme c. hormone d. carbohydrates

A 23. What amount of glucose is present in the human blood?

a. 60 to 90 mg in 100 ml blood c. 2% of the total human body weight
b. 5 to 6 g in 100 ml blood d. none of these

A 24. It is the organelle which serves as the site of the electron transport chain.
a. mitochondria b. ribosome c. nucleus d. lysosome

C 25. The end product of the hydrolysis of glycogen is:

Pharmacognosy and Plant Chemistry Page 16 of 26

a. galactose b. fructose c. glucose d. arabinose

C 26. Iodine test is a reaction which may be used to identify carbohydrates. The reaction is due to
a. presence of the free aldehyde group c. presence of amylose portion
b presence of alcohol group d. presence of glucose

B 27. Benedict’s reagent yield positive result to:

a. monosaccharide only b. reducing sugars c. sucrose d. polysaccharides

B 28. Hypertonic solutions will cause the cell to:

a. swell b. shrink c. burst d. undergo hemolysis

A 29. Rancidity of fats maybe due to :

a. oxidation b. hydrogenation c. saponification d. condensation

C 30. The deficiency of this hormone causes diabetes mellitus:

a. progesterone b. testosterone c. insulin d. glucagons

A 31. The active proteolytic enzyme in gastric juice is:

a. pepsin b. trypsin c. maltase d. catalase

B 32. The site of oxidation reaction in electron transport chain is in the

a. nucleus b. mitochondrion c. ribosome d. golgi bodies

B 33. Protein digestion starts in the

a. mouth b. stomach c. intestine d. pancreas

A 34. The conversion of an amino acid to sugar is:

a. gluconeogenesis b. glycolysis c. glycogenesis d. glycogenolysis

B 35. Which of the following is not an amino acid?

a. leucine b. choline c. valine d. glycine

A 36. The protein part of the enzyme molecule is the:

a. apoenzyme b. coenzyme c. cofactor d. holoenzyme

C 37. Optimum temperature for enzyme activity in the body:

a. 40oC b. 60oC c. 37oC d. 10oC

B 38. Glucose is stored in the liver as:

a. galactose b. glycogen c. lactose d. fructose

B 39. The enzyme conformation adapts to the incoming substrate in

a. Lock and Key theory b. Induced fit theory c. competitive inhibition d. noncompetitive inhibition

B 40. The process of converting glucose into glycogen is called:

a. gluconeogenesis b. glycogenesis c. glycolysis d. glycogenolysis

A 41. All are pyrimidine bases except:

a. guanine b. cytosine c. uracil d. thymine

B 42. Glucose, amino acid and fatty acid enter the citric acid cycle by their conversion into:
a. pyruvate b. acetyl CoA c. acetoacetyl CoA d. palmitic acid

A 43. A hormone which stimulates glycogenesis:

a. insulin b. glucagons c. epinephrine d. vasopressin

A 44. Chemicals extracted from organism such as bacteria and can inhibit growth or destroy other microorganism:
a. antibiotic b. enzyme c. hormone d. vitamins

C 45. The gland or tissue that regulates the blood glucose level:
a. parathyroid b. thyroid c. pancreas d. adrenal

D 46. Which vitamin is formed in the body by exposure to ultraviolet irradiation or sunlight?
a. vitamin A b. vitamin B c. Vitamin C d. vitamin D

C 47. Excess vitamin A and D is stored in the body, but excess vitamin B and C is readily excreted. What
property shows this?
a. vit. C and B are water-soluble b. vit. A and D are fat –soluble c. both a and b d. none of these

A 48. It is the entire genetic make up of an organism

a. gene b. anticodon c. codon d. mutation

B 49. The vitamin which is used in the prevention of degenerative changes in the central nervous system:
a. vit. A b. vit. B complex c. vit. C d. vit. D

A 50. It is a model which best explains the enzyme-substrate action:

Pharmacognosy and Plant Chemistry Page 17 of 26

a. lock and key b. molecular c. VSEPR d. Kreb

D 51. The activation of pepsinogen requires:

a. pepsin b. NaOH c. enterokinase d. HCl

B 52. DNA is primarily found in the

a. cytosol b. nucleus/mitochondria c. cell wall d. endoplasmic reticulum

B 53. It is the enzyme which hydrolyzes starch to dextrin and maltose:

a. catalase b. amylase c. pepsin d. lactase

D 54. A synthetic DNA is called

a. replicated DNA b. plasmid c. Gene d. recombinant DNA

B 55. Hydrolysis of ATP is an

a. energy requiring reaction b. energy producing reaction c. no energy is involved d. energy is absorbed

C 56. Which of the following is a characteristic of lipid?

a. zwitterions b. amphiphilic c. hydrophobic d. hydrophilic

A 57. It is a condition that results when sugar level is below normal

a. hypoglycemia b. hyperglycemia c. ketonuria d. uremia

A 58. An example of globular protein

a. albumin b. collagen c. fibrin d. silk

A 59. Complementary base pairs in the DNA double helix are bonded by
a. H-bond b. ester bond c. Van der Waals d. dipole- dipole

C 60. Which nitrogen base is not found in DNA?

a. thymine b. cytosine c. uracil d. guanine

C 61. An organic cofactor in an enzyme

a. vitamins b. coenzymes c. a and b d. none of these

B 62. At what stage of glucose oxidation is most of the energy produced?

a. glycolysis b. aerobic stage c. glycogenesis d. glygenolysis

D 63. The best known building blocks of RNA and DNA are:
a. purines b. pyrimidines c. fatty acids d. a and b

C 64. It is responsible for the storage and transmission of genetic information

a. adenine b. RNA c. DNA d. nucleic acid

C 65. Build up of urea in the kidney is called

a. ketonuria b. glycemia c. uremia d. all of these

A 66. The transfer of genetic information from DNA by the formation of mRNA
a. transcription b. translation c. trans-amination d. replication

D 67. What is the end product of electron transport chain?

a. oxygen b. hydrogen c. carbon dioxide d. water

B 68. The energy producing reaction

a. metabolic b. catabolic c. anabolic d. all of these

A 69. It is the molecule that directs the activity of the cells

a. DNA b. RNA c. nucleoproteins d. hormones

C 70. The sugar involved in DNA

a. ribose b. pentose c. deoxyribose d. xylose

C 71. The common metabolic pathway is

a. glycolysis b. beta oxidation c. Kreb’s cycle d. glucogenesis

B 72. Rosenheim’s test is used to detect the presence of:

a. ethanolamine b. choline c. cholesterol d. glycone moiety

C 73. Detects the presence of alpha amino acids:

a. Biuret b. Molisch c. Ninhydrin d. Hopkins-cole

B 74. The process of producing fats from acetyl Co-A is called:

a. glycolysis b. lipogenesis c. glycogenolysis d. glucogenesis

A 75. The following are test reagents to detect the presence of amino acids, except:
a. Grignard’s b. Xanthoproteic c. Millon-Nasse d. Sakaguchi

A 76. The condition that lowers the pH of the blood due to starvation is called
Pharmacognosy and Plant Chemistry Page 18 of 26

a. acidosis b. alkalosis c. hyperglycemia d. glycosuria

B 77. The substance responsible for the emulsion of fats is:

a. HCl b. bile acids c. pepsin d. trypsin

B 78. Hubl’s solution if used to ascertain degree of:

a. saturation b. unsaturation c. peroxidation d. acidity

B 79. IUPAC name of acrolein:

a. pentenal b. propenal c. hexanal d. acetone

C 80. The positive indication for the presence of glycerol in acrolein test:
a. yellow colored solution c. silver mirror formed in the test tube
b. black markings in filter paper d. play of colors from blue to shades of red

B 81. Cerebrosides are positive in the following tests, except:

a. Molisch b. Biuret c. Lassaigne’s d. none of the above

B 82. Osmic test is used to detect the presence of ____ in lipids:

a. metals b. prostate groups c. unsaturated groups d. glycerol

A 83. The most sensitive chemical test to detect the presence of cholesterol:
a. Liebermann-Burchard c. Formaldehyde-sulkfuric acid
b. Salkowski reaction d. Colorimetric spectrophotometry

D 84. The following are phopholipids, except:

a. plasmalogen b. lecithin c. cephalin d. choline

C 85. A mixed triglyceride contains:

a. three similar fatty acids esterified with glycerol c. three different fatty acids esterified with glycerol
b. two similar fatty acids esterified with glycerol d. all of the above choices

B 86. The central compound found in the structure of sphingolipids:

a. glycerol b. sphingosine c. ceramide d. phosphocholine

A 87. Lipid whose specific test is the Furter-Meyer test:

a. tocopherol b. retinal c. sphingomyelin d. cerebroside

A 88. Precipitate of _____ indicates the presence of phospholipids in the lipid sample:
a. ammonium phosphomolybdate c. phosphorus triiodide
b. phosphorus periodate d. phospho-ammonium sulfate complex

B 89. The following are glycolipids, except:

a. globosides b. phosphatides c. gangliosides d. cerebrosides

B 90. The parent compound of phospholipids:

a. glycerol b. phosphatidic acid c. ethanolamine d. none of the above

D 91. A non-pentose sugar which is also positive for Tollen’s phloroglucinol test:
a. galactose b. glucose c. fructose d. cellobiose

C 92. The reagent present in Molisch test which is responsible for the dehydration reaction:
a. sodium canbonate b. magnesiumstearate c. sulfuric acid d. NaOH

C 93. ID test to detect the presence of glycogen:

a. phloroglucinol b. molisch c. iodine d. seliwanoff

C 94. The only sugar readily forms insoluble osazone crystals:

a. lactose b. sucrose c. mannose d. sucrose

D 95. Important structural material found in the exoskeletons of many lower animals:
a. chnondroitin b. heparin c. hyaluronic acid d. chitin

B 96. Hydrolysis of osazones produce:

a. phenylhydrazones b. ozones c. sugars d. none of the above

C 97. General term for a group of polysaccharides present on the primary cell wall:
a. xanthan b. mucilage c. pectin d. carageenan

C 98. Specific test for galactose, due to the formation of highly insoluble crystals:
a. phenylhydrazine test b. fermentation c. mucic acid d. molisch

A 99. Type of RNA which serves as template for the amino acid sequence being synthesized:
a. mRNA b. tRNA c. rRnNA d. none of the above

B 100. Positive indication for Anthrone test:

a. purple ring b. blue-green color c. effervescence d. yellow ppt
Pharmacognosy and Plant Chemistry Page 19 of 26

B 101. Differentiating test between helical and linear polysaccharides:

a. Molisch b. iodine c. Schweitzer d. fermentation
C 102. The difference between Benedict’s and Barfoed’s test reagent lies in:
a. sequestering agent used b. active component used c. pH of the solution d. alkali used

C 103. Hydrolytic product of chitin:

a. iduronatet b. acetylgalactosamine c. acetylglucosamine d. glucuronic acid

C 104. Glucose and fructose are:

a. anomers b. epimers c. geometric isomers d. allosteres

B 105. The complementary strand of CGACCTTGATCGACGTCGA:

a. TCGTTCCAGCTAGTAACTAG c. AGCAAGGTCGATCATGATC
b. GCTGGAACTAGCTGCAGCT d. ATCAAGGTCGATCATGATC

C 106. Alkaline bismuth reagent is used to detect the presence of:

a. polysaccharides b. disaccharides c. reducing sugars d. glycitols

D 107. Action of dilute alkali on sugars:

a. dehydration b. hyperconjunction c. hydrolysis d. tautomerization

A 108. The following are the components of DNA nucleosides, except:

a. phosphoric acid b. sugar c. adenine d. cytosine

A 109. Central dogma concept wherein the RNA molecule is used as template for the synthesis of DNA molecule:
a. transcription b. translation c. mutation d. none of the above

D 110. The following proteins are present in egg white, except:

a. ovomucin b. ovoglobulin c. albumin d. osseomucoid

C 111. Anaerobic glycolysis occurs in the:

a. nucleus b. mitochondria c. cytoplasm d. lysosomes

D 112. Ketogenic amino acids:

a. leucine b. tyrosine c. phenylalamine d. all of the above

B 113. Osazone test is also known as:

a. Nylander’s test b. Kowarsky test c. Trommer’s test d. Folin’s test
A 114. Genetic defect characterized by mental retardation and cataract, since the unmetabolized sugar is toxic to the
lens of the eyes:
a. galactosemia b. fructosemia c. pentosuria d. fructosuria
D 115. Body functions of lipids:
a. transformation into proteins and carbohydrates c. insulation and paddings for organs
b. catabolism to provide body with heat and energy d. all of the above
B 116. Pyridoxine is a compound of this enzyme:
a. enolase b. decarboxylase c. hydrogenase d. isomerase
B 117. The following are neutral amino acids, except:
a. methionine b. lysine c. threonine d. leucine
A 118. In man, the principal end product of protein metabolism is:
a. uric acid b. lactic acid c. pyruvic acid d. urea
B 119. Condition wherein acetone accumulates in the blood:
a. ketosuria b. ketonemia c. ketosis d. ketonuria

B 120. Glutamine is a _____ amino acid :

a. neutral b. basic c. acidic d. racemin

B 121. Oxidation product of ketone bodies:

a. reduced sugars b. carbon dioxide c. alcohols d. aldehydes

C 122. Phosphoprotein found in egg yolk:

a. ovocasein b. tendomucoid c. vitelin d. avidin

C 123. Amino acids positive for Sakaguchi reaction:

a. gelatin b. alanine c. arginine d. tyrosine

B 124. Histidine is negative for:

a. Pauly reaction b. Sodium Nitroprusside c. Ninhydrine d. Xanthoproteic

C 125. An official simple protein obtained from corn:

a. glutelion b. gliadin c. zein d. maize
C 126. Principle involved in the isolation of casein milk:
a. salting in b. salting out c. isoelectric precipitation d. none of the above
Pharmacognosy and Plant Chemistry Page 20 of 26

A 127. Process of converting liver glycogen into blood glucose:

a. glycogenolysis b. gluconeogenesis c. glycolysis d. glycogenesis
B 128. Genetic information is stored and carried in all cells by:
a. single-stranded DNA c. double-stranded RNA
b. double-stranded DNA d. single-stranded circular DNA

B 129. Principal site for the synthesis of urea:

a. kidney b. liver c. spleen d. intestinal mucosa

C 130. Pentose present in gum Arabic:

a. xylose b. ribose c. arabinose d. threose

C 131. Which of the following is responsible for the transfer of genetic information?
a. ATP b. GTP c. DNA d. RNA

C 132. Only form of inorganic nitrogen which can be utilized by living cells:
a. urea b. ornithine c. ammonia d. nitrogen gas

A 133. The following are essential amino acids, except:

a. tyrosine b. lysine c. methionine d. arginine

C 134. The chief end product of purine metabolism in man:

a. CO b. urea c. uric acid d. ammonia

D 135. The principal end product of protein metabolism:

a. carbon dioxide b. ammonia c. hippuric acid d. urea

B 136. Presence of glucose in appreciable amounts in the urine:

a. Hematuria b. glycosuria c. glycosemia d. albuminuria

D 137. The following are the tests for kidney efficiency, except:
a. phenylsulfophthelein test b. urea clearance test c. water output test d. crystallization method

B 138. Growth hormone is also known as:

a. thyrotropic hormone b. somatotropin c. gonadotropin d. interstitial stimulating
hormone

A 139. What is the anti-codon in tRNA that corresponds to the codon ACG in mRNA?
a. UGC b. TGC c. GCA d. CGU

A 140. Condition wherein bile pigment is present in excess in the blood:

a. jaundice b. hepatitis c. cirrhosis d. cystic fibrosis

B 141. The following are non-essential amino acids, except:

a. glycine b. leucine c. cysteine d. glutamine

B 142. Principal digestive constituent of the gastric juice:

a. trypsin b. pepsin c. gastrin d. enterokinase

B 143. Condition wherein the concentration of uric acid accumulates in blood reaches as high as 15 mg. Percent:
a. leukemia b. gout c. murexia d. any of the above

C 144. The study of the composition and the chemical processes occurring in the living matter is:
a. qualitative chemistry c biochemistry e. inorganic chemistry
b. organic chemistry d. quantitative chemistry

A 145. What is wobble?

a. the ability of certain anticodons to pair with codons that differ at the third base
b. an error in translation induced by streptomycin
c. a mechanism that allows for a peptide extension in the 50S sub-unit of the ribosome
d. thermal motions leading to local denaturation of the DNA double helix

C 146. The most important function of HCl in the stomach is:

a. hydrolysis of protein c. activation of pepsinogen e. stimulation of pancreatic
secretion
b. neutralization of chyme d. destruction of bacteria

C 147. Transamination is:

a. conversion of amino acid to hydroxy acid c. conversion of amino acids to keto acids
b. loss of ammonia from amino acid d. formation of ammonium salt from ammonia

A 148. The lipid that is converted to Vitamin D12 upon irradiation:

a. ergosterol b. glycerol c. cholesterol d. all of the above

A 149. The metabolic degradation of hemoglobin takes place principally in:

a. the reticuloendothilial system c. the white blood cells
Pharmacognosy and Plant Chemistry Page 21 of 26

b. the red blood cells d. the liver cell

C 150. The amino acid that is an important precursor of hemoglobin is:

a. alanine b. proline c. glycine d. cysteine
C 151. Serine is converted to ethanolamine by the removal of:
a. oxygen b. ammonia c. carbon dioxide d. a carboxyl group

C 152. Ninhydrin gives a blue coloration with:

a. proteins b. carbohydrates c. amino acids d. simple sugars

A 153. Which is the monomer unit of proteins?

a. amino acid b. monosaccharide c. fatty acid d. purine

A 154. The proteinase that is found mostly in gastric juice of young animals:
a. rennin c. steapsin e. none of the above
b. pepsin d. ptyalin

B 155. Conjugated proteins which are a combination of amino acids and carbohydrates:
a. nucleoproteins b. glycoproteins c. phosphoproteins d. chromoproteins

A 156. Gamma decarboxylation of aspartic acid produces:

a. alanine b. asparagines c. glutamic acid d. glycine

B 157. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine

A 158. It is a disease due to protein deficiency:

a. Kwashiorkor b. diabetes c. albuminuria d. jaundice

C 159. Which of the following amino acids is not essential in mammals?

a. phenylaline b. lysine c. tyrosine d. methionine

D 160. The following are examples of chromopretien, except:

a. chlorophyll b. hemoglobin c. cytochromes d. heparin

D 161. For the amino acid cysteine, choose the appropriate description of its side chain:
a. acidic b. basic c. aromatic d. sulfur-containing

C 162. Which of the following amino acids has a net positive charge at physiologic pH?
a. cysteine b. glutamic acid c. lysine d. valine

D 163. Sickle cell anemia is the clinical manifestation of homozygous genes for an abnormal hemoglobin molecule.
The mutational event responsible for the mutation in the beta chain is:
a. crossing over b. insertion c. deletion d. point mutation

C 164. When starches are heated , they produce:

a. sugars b. glycogen c. dextrins d. disaccharides

B 165. Check the incorrect statement:

a. ribose is an aldopentose c. galactose is an aldohexose
b. maltose is a ketohexose d. glucose is an aldohexose

A 166. The reducing property of sugars is due to this group:

a. aldehyde b. nitro c. carboxyl d. methyl

D 167. The monosaccharide most rapidly absorbed from the small intestine is:
a. glucose b. fructose c. mannose d. galactose

C 168. A condition known as atherosclerosis results as an accumulation in the blood vessels of

a. calcium b. pathogens c. cholesterol d. ketones

C 169. Ketoses can be differentiated from aldoses by this test:

a. Molisch’s test b. Benedict’s test c. Seliwanoff’s test d. Tollen’s test

C 170. The clinical test for the determination of cholesterol:

a. Liebermann-Burchard b. Salkowski c. both a and b d. none of the above

C 171. Concentrated dehydrating acids change monosaccharides to:

a. simple sugars b. saccharic acids c. furfurals d. uronic acids e. aldaric acids

C 172. A mucopolysaccharide which possesses an anticoagulant property:

a. pectin b. hyaluronic acid c. heparin d. chitin e. chondroitin sulfate

A 173. Which of the following is the test for reducing sugars for urine?
a. Benedict’s test b. acrolein test c. Biuret test d. Brown Ring test
B 174. Lactose can be differentiated from fructose by:
a. Mucic acid test b. Barfoed’s test c. Fehling’s test d. Iodine test e. Tollen’s test
Pharmacognosy and Plant Chemistry Page 22 of 26

B 175. Polymers that are responsible for the metabolic capabilities and morphology of organisms are:
a. carbohydrates b. proteins c. polysaccharides d. nucleic acid

B 176. The product obtained from the partial hydrolysis of collagen:

a. myosin b. gelatin c. actin d. fibrinogen e. thrombin

B 177. The main carbohydrate of the blood is:

a. D-fructose b. D-glucose c. mannitol d. sorbitol

B 178. A normal value of glucose in the blood:

a. 100 to 200 mg% b. 80–120 mg% c. 50–75 mg% d. 200–300 mg%

B 179. Butter becomes rancid upon exposure to air due to formation of:
a. acetic acid b. butyric acid c. formic acid d. propionic acid

C 180. The cholesterol molecule is:

a. an aromatic ring b. a straight chain acid c. a steroid d. A tocopherol

C 181. Which of the following is a phospholipid?

a. glycogen b. prostaglandin c. sphingomyelin d. oleic acid

C 182. The passage of the end products of digestion from the small intestine into the blood stream:
a. metabolism b. digestion c. absorption d. oxidation e. reduction

A 183. Endocrine gland that is a small oval body situated at the base of the brain:
a. hypophysis b. pancreas c. adrenal d. none of the above

A 184. Cellular elements of the blood devoid of nucleus:

a. RBC b. WBC c. thrombocytes d. all of the above

C 185. Is the sum total of all activities directed towards the maintenance of life:
a. catabolism b. anabolism c. metabolism d. photosynthesis e. fermentation

C 186. This substance accumulates in the muscles as a result of vigorous exercise:

a. muscle glycogen b. amino acids c. lactic acid d. glucose

B 187. A common intermediate of metabolism of carbohydrates, fatty acids and amino acids is:
a. glycerol b. acetyl CoA c. acetoacetate d. oxaloacetate e. acetylcholine

B 188. The principal site of glucose production in the human body is the :
a. blood b. liver c. pituitary gland d. small intestine

A 189. The major buffer of the extracellular fluid:

a. bicarbonate-carbon dioxide b. amino acids c. phosphate d. none of the above

C 190. Separates from cells when blood is coagulated:

a. fibrinogen b. plasma c. serum d. thrombin e. none of the above

C 191. Glycolipids found in high concentrations in the brain and nerve cells especially in the myelin sheath:
a. lecithin b. cephalins c. cerebrosides d. sphingolipids

A 192. Alcohol in the body is :

a. oxidized to CO2 and HOH c. excreted by kidneys
b. excreted mainly by lungs d. excreted by large intestine

C 193. Which of the following tissues contains the enzyme glucose-6-phosphatase and is able to supply glucose to
the blood?
a. heart b. brain c. liver d. none of the above

D 194. Complete digestion of all foodstuffs occurs in the :

a. large intestine b. stomach c. mouth d. small intestine e. pancreas

B 195. This compound is not a normal constituent of urine:

a. sodium chloride b. albumin c. urea d. uric acid

A 196. Decomposition of carbohydrates brought about by the action of enzymes liberating ethyl alcohol and CO2:
a. fermentation b. adsorption c. detoxification d. hydrolysis
e. saponification

C 197. Blood clotting can be prevented by:

a. sodium chloride b. potassium chloride c. sodium citrate

D 198. This hormone elevates blood sugar concentration:

a. insulin b. progesterone c. estrogen d. glucagons
B 199. Deficiency in this vitamin causes red blood cell fragility:
a. vitamin A b. vitamin K c. Vitamin D d. vitamin E

C 200. The end-product in the hydrolysis of glycogen is:

Pharmacognosy and Plant Chemistry Page 23 of 26

a. galactose b. mannose c. glucose d. arabinose

A 201. In which form is glucose stored in the liver?

a. glycogen b. glucose (unchanged) c. sucrose d. starch

B 202. Which of the following is NOT an ID test for proteins and amino acids?
a. Ninhydrin b. Bial’s c. Biuret d. Xanthoproteic

D 203. What vitamin deficiency causes pellagra?

a. riboflavin b. thiamin c. pantothenic acid d. nicotinic acid

D 204. All are pyrimidine base, except:

a. cytosine b. thymine c. uracil d. guanine

B 205. The sugar that yields only glucose when hydrolyzed is:
a. galactose b. maltose c. fructose d. sucrose

D 206. Which is not a B-complex vitamin?

a. folic acid b. nicotinic acid c. riboflavin d. ascorbic acid

A 207. The following sugars are aldohexoses except:

a. fructose b. galactose c. glucose d. mannose

D 208. All the amino acid below contain sulfur, except:

a. cystine b. methionine c. cysteine d. glycine

A 209. The following are essential fatty acids, except:

a. oleic acid b. linoleic acid c. linolenic acid d. arachidonic acid

D 210. This test detects the presence of two or more peptide bonds:
a. Ninhydrin b. Fehling’s c. Tollen’s d. Biuret

B 211. This vitamin easily undergoes oxidation:

a. vitamin A b. vitamin C c. vitamin B12 d. vitamin B1

B 212. The end product of anaerobic glucose metabolism is:

a. pyruvate b. lactate c. carbon dioxide d. water

A 213. The inactive form of an enzyme is sometimes called:

a. zymogen b. holoenzyme c. apoenzyme d. coenzyme

D 214. Photosynthesis is a process involved in the manufacture of:

a. carbohydrates b. fats c. proteins d. all of the above

B 215. The major extracellular cation is:

a. potassium b. sodium c. calcium d. iron

B 216. Which sugar will not give a red precipitate with cupric oxide when heated with Benedict’s solution?
a. glucose b. sucrose c. maltose d. fructose

A 217. Night blindness is a symptom of a deficiency in this vitamin:

a. vitamin A b. vitamin C c. vitamin B d. vitamin D

D 218. The activation of pepsinogen requires:

a. NaOH b. bicarbonate c. acetic acid d. HCl

D 219. Nucleosides upon hydrolysis will yield:

a. adenine + phosphate b. quanine + phosphate c. histones + ribose d. cytosine + ribose

C 220. Protein digestion starts in the:

a. mouth b. small intestine c. stomach d. large intestine

C 221. Major form of utilizable energy in all cells:

a. ADP b. GDP c. ATP d. GTP

A 222. Which of the following supplies the highest amount of energy per gram?
a. fat b. glycogen c. protein d. starch

A 223. The following are proteins in milk, except:

a. rennin b. casein c. lactoalbumin d. lactoglobulin

A 224. The conversion of beta carotene to vitamin A is carried out in the:

a. liver b. small intestine c. lungs d. pancreas

A 225. This sugar is also called an “invert sugar”:

a. sucrose b. fructose c. glucose d. galactose

A 226. What type of sugar is found in nucleic acids?

Pharmacognosy and Plant Chemistry Page 24 of 26

a. riboses b. glucoses c. mannoses d. galactoses

D 227. The biochemical function of hemoglobin is:

a. defense b. regulatory c. structural d. oxygen transport
C 228. The following enzymes catalyze hydrolysis reactions, except:
a. proteases b. esterases c. transaminases d. nucleases
C 229. Porphyrins are involved in the building of:
a. bones b. muscles c. blood d. connective tissue
B 230. Which among the following sugar is sweetest?
a. glucose b. fructose c. sucrose d. galactose
A 231. Information and control centers of the cell:
a. nucleoproteins b. enzymes c. carbohydrates d. lipids

A 232. Hydrolysis of nucleoproteins will yield:

a. Nucleic acids and histones c. nucleic acid and purines
b. nucleic acid and sugar d. nucleic acid and pyrimidines

C 233. The condition wherein protein is found in the urine is:

a. glycosuria b. ketonuria c. proteinuria d. dysuria

A 234. Alpha-hydroxy propionic acid is:

a. lactic acid b. aminoacetic acid c. ascorbic acid d. pyruvic acid

B 235. This test detects the presence of indole rings:

a. Molisch b. Hopkin’s cole c. Millon’s d. Ninhydrin

C 236. The steps of central states:

a. replication, translation and transcription c. replication, transcription and translation
b. replication, transcription and transmission d. transcription, translation and replication

B 237. Reverse transcription takes place in:

a. bacteria b. viruses c. algae d. molds

D 238. The number of chromosomes in the human cells is:

a. 41 b. 42 c. 43 d. 46
A 239. Digestion of starch starts in the :
a. mouth b. stomach c. small intestine d. large intestine
D 240. The ordered steps in protein synthesis is:
a. transcription, transplantation, activation, elongation c. initiation, activation, elongation, termination
b. activation, elongation, initiation, termination d. activation, initiation, elongation, termination

D 241. Genetic code is:

a. universal b. composed of 3 nucleotides c. continuous d. all are correct

B 242. Which of the following is called transamination?

a. conversion of amino acids to hydroxy acids c. lose of ammonia from amino acids
b. conversion of amino acids to keto acids d. formation of ammonium salts from ammonia
A 243. Dextran is:
a. carbohydrate b. glucose polymer c. glycoside d. protein
B 244. A genetic disease due to defective mechanism for pyrimidine dimmers:
a. phenyl ketonuria b. xeroderma pigmentosum c. albinism d. N-glycosyl linkage
D 246. The type of RNA molecule that brings amino acids to the site of protein synthesis is:
a. rRNA b. aRNA c. mRNA d. tRNA

D 247. Most allergies are caused by:

a. Error in the immune system b. histamines produced by the body c. dust d. all of the above

B 248. RNA which plays an important role in the structure and biosynthetic function of ribosome:
a. mRNA b. rRNA c. tRNA d. DNA

D 249. In the secondary structure of RNA:

a. adenine will always pair with thymine c .cytosine will always pair with uracil;
b. cytosine will always pair with thymine d. adinine will always pair with uracil

D 250. A nucleic acid is made up of:

a. sugar, nucleoside and a base c. nitrogenous base, amino acid and sugar
b. proteins, sugar and a phosphate group d. nitrogenous base, phosphate and sugar
Pharmacognosy and Plant Chemistry Page 25 of 26

C 251. Bond between 2 amino acids

a. glycosidic bond b. N-glycosyl linkage c. peptide bond d. hydrogen bond

A 252. Which of the following is not a test for protein?

a. acrolein b. Biuret c. Millons d. xanthoproteic

A 253. Acetyl CoA combines with oxaloacetate to form:

a. citrate b. carnitine c. acyl-carnitine d. none of the above

B 254. The proteins that make the fur, wool, claws and feathers:
a. collagen b. keratin c. silk d. none of the above

B 255. Liquid vegetable oils may be transformed into solid fats by the process of:
a. oxidation b. hydrogenation c. substitution d. reduction

B 256. The chemical messengers produced by the endocrine glands:

a. genes b. hormones c. vitamins d. enzymes

A 257. It is the sugar found in milk:

a. lactose b. maltose c. sucrose d. raffinose

C 258. Prostaglandins are synthesized from:

a. oleic b. stearic c. essential fatty acid d. non-essential fatty acid

C 259. Amino acid at an isoelectric point exists as:

a. acid b. base c. zwitterions d. none of the above

B 260. The color of the skin, hair and eyes is due to pigment called:
a. cytochrome b. melanin c. keratin d. heparin

B 261. Starches are partially digested in the mouth by:

a. protease b. ptyalin c. pepsionogen d. pepsin

C 262. The only element in living matter from strong multiple bonds readily are:
a. oxygen b. nitrogen c. carbon d. all of the above

A 263. Serotonin, a neurotransmitter, is derived from the amino acid:

a. tryptophan b. threonine c. tyrosine d. phenylalanine

A 264. Alkaline hydrolysis of fat:

a. saponification b. hydrogenation c. alkalinization d. hydroxylation e. all of the above

C 265. The main center of biosynthesis of nucleic acid is the:

a. cell wall b. cytoplasm c. nucleus d. none of the above

A 266. Normal pH of the blood:

a. 7.4-7.45 b. 6.6-6.9 c. 5.5-6.6 d. 4.8-8

A 267. Known as good cholesterol:

a. HDL b. ergocalciferol c. ACTH d. LDL

A 268. Blood minus its cellular components:

a. plasma b. serum c. hemoglobin d. fibrin

B 269. Which of the following is not an amino acid:

a. leucine b. choline c. valine d. lysine

A 270. Are globular proteins, except:

a. collagen b. serum albumins c. serum globulins d. hemoglobin

D 271. The precursor of vitamin A is:

a. arachidonic acid b. isoprene c. naphtoquinone d. carotene

B 272. Are fibrous proteins, except:

a. keratin b. histones c. elastin d. collagen

C 273. A type of antibodies that plays an important role in allergic response which causes anaphylactic shock,
hayfever and asthma:
a. IgA b. IgM c. IgE d. IgG

C 274. An inherited disease that affect red blood cells:

a. albinism b. hyperglycemia c. sickle cell anemia d. hypoglycemia
D 275. Are esters of fatty acids with glycerol:
a. phospholipids b. glycolipids c. waxes d. fats
A 276. The metallic salt of a high fatty acid:
a. soap b. detergent c. inorganic salt d. glycerin
Pharmacognosy and Plant Chemistry Page 26 of 26

A 277. The following are enzymes found in pancreatic juice, except:

a. papain b. trypsin c. chymotrypsin d. carboxypolypepticase
C 278. The following are pathological constituents of urine, except:
a. glucose b. albumin c. creatinine d. blood
D 279. All of the following carbohydrates are considered to be polysaccharide, except:
a. heparin b. starch c. glycogen d. maltose
C 280. Which of the following hormones promotes rapid glycogenolysis in both liver and muscle:
a. ACTH b. glutemine c. epinephrine d. prolactin
D 281. Fruity odor of urine is indicative of acetone bodies, a diagnostic value in case of acidosis in:
a. diabetes insipidus b. porphyria c. cretinism d. diabetes mellitus
B 282. Rotation of polarized light is caused by solutions of all of the following amino acids, except:
a. alanine b. glycine c. leucine d. valine
C 283. The precursor of vitamin D3:
a. ergosterol b. stigmasterol c. 7-dehydrocholesterol d. cholesterol
B 286. The enzyme present in the stomach which hydrolyzes proteins:
a. trypsin b. pepsin c. amylopsin d. enterokinase
B 287. The reaction that takes place in cytoplasm:
a. aerobic b. anaerobic c. oxidation d. reduction
C 288. Compounds of protein with a carbohydrate component:
a. lipoproteins b. phosphoproteins c. glycoproteins d. nucleoproteins
D 289. What amino acid functions as a hormone?
a. valine b. leucine c. alanine d. thyroxine
C 290. The pathway that occurs in the mitochondria:
a. urea cycle b. citric acid cycle c. glycolysis d. fatty acid cycle
C 291. Carbohydrates that cannot be hydrolyzed to compounds with simpler molecules:
a. oligosaccharides b. disaccharides c. monosaccharides d. polysaccharides
D 292. In the metabolism of protein, the liver:
a. synthesizes amino acids b. breaks down amino acid c. absorbs blood d. stores amino acid
B 293. What is the stage of glucose oxidation that requires oxygen?
a. anaerobic b. aerobic c. catabolic d. anabolic
B 294. An important protein in contractile muscle:
a. keratin b. myosin c. elastin d. fibrin
C 295. Which is the main constituent of the group substance in the connective tissue?
a. heparin b. fructosan c. hyaluronic acid d. mannosan
C 296. Raffinose, an important non-reducing sugar, is a:
a. monosaccharide b. disaccharide c. trisaccharide d. tetrasaccharide
A 297. Non-protein molecules that are often associated with proteins are called:
a. prosthetic group b. side chain c. zwitterions d. casein
A 298. They are chemical messengers:
a. hormones b. enzymes c. vitamins d. amino acids
C 299. It is a polysaccharide:
a. lactose b. maltose c. amylose d. fructose
B 300. Which sugar contains an aldehyde group?
a. ketose b. aldose c. sorbitol d. mannitol