0% found this document useful (0 votes)
3 views384 pages

Annotated Algorithms in Python

The document is a book titled 'Annotated Algorithms in Python with Applications in Physics, Biology, Finance' by Massimo Di Pierro, which is licensed under Creative Commons. It covers various topics related to Python programming, algorithms, and their applications across different fields. The book includes an introduction to Python, control flow, data structures, and detailed discussions on algorithms and their complexities.

Uploaded by

Daniyal
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
3 views384 pages

Annotated Algorithms in Python

The document is a book titled 'Annotated Algorithms in Python with Applications in Physics, Biology, Finance' by Massimo Di Pierro, which is licensed under Creative Commons. It covers various topics related to Python programming, algorithms, and their applications across different fields. The book includes an introduction to Python, control flow, data structures, and detailed discussions on algorithms and their complexities.

Uploaded by

Daniyal
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

MASSIMO DI PIERRO

A N N O TAT E D A L G O R I T H M S I N P Y T H O N
W I T H A P P L I C AT I O N S I N P H Y S I C S , B I O L O G Y, F I N A N C E ( 3 R D E D . )

EXPERTS4SOLUTIONS
Copyright 2013 by Massimo Di Pierro. All rights reserved.

THE CONTENT OF THIS BOOK IS PROVIDED UNDER THE TERMS OF THE CRE-
ATIVE COMMONS PUBLIC LICENSE BY-NC-ND 3.0.
[Link]

THE WORK IS PROTECTED BY COPYRIGHT AND/OR OTHER APPLICABLE LAW.


ANY USE OF THE WORK OTHER THAN AS AUTHORIZED UNDER THIS LICENSE
OR COPYRIGHT LAW IS PROHIBITED.
BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HERE, YOU ACCEPT
AND AGREE TO BE BOUND BY THE TERMS OF THIS LICENSE. TO THE EX-
TENT THIS LICENSE MAY BE CONSIDERED TO BE A CONTRACT, THE LICENSOR
GRANTS YOU THE RIGHTS CONTAINED HERE IN CONSIDERATION OF YOUR
ACCEPTANCE OF SUCH TERMS AND CONDITIONS.
Limit of Liability/Disclaimer of Warranty: While the publisher and author have
used their best efforts in preparing this book, they make no representations or
warranties with respect to the accuracy or completeness of the contents of this book
and specifically disclaim any implied warranties of merchantability or fitness for a
particular purpose. No warranty may be created or extended by sales representatives
or written sales materials. The advice and strategies contained herein may not be
suitable for your situation. You should consult with a professional where appropriate.
Neither the publisher nor the author shall be liable for any loss of profit or any other
commercial damages, including but not limited to special, incidental, consequential, or
other damages.

For more information about appropriate use of this material, contact:


Massimo Di Pierro
School of Computing
DePaul University
243 S Wabash Ave
Chicago, IL 60604 (USA)
Email: [Link]@[Link]

Library of Congress Cataloging-in-Publication Data:

ISBN: 9798254871569
Build Date: April 3, 2026
to my son
Contents

1 Introduction 15
1.1 Main Ideas . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
1.2 About Python . . . . . . . . . . . . . . . . . . . . . . . . . 18
1.3 Book Structure . . . . . . . . . . . . . . . . . . . . . . . . . 19
1.4 Book Software . . . . . . . . . . . . . . . . . . . . . . . . . 21

2 Overview of the Python Language 23


2.1 About Python . . . . . . . . . . . . . . . . . . . . . . . . . 23
2.1.1 Python versus Java and C++ syntax . . . . . . . . 24
2.1.2 help, dir . . . . . . . . . . . . . . . . . . . . . . . . 24
2.2 Types of variables . . . . . . . . . . . . . . . . . . . . . . . 25
2.2.1 int and long . . . . . . . . . . . . . . . . . . . . . . 26
2.2.2 float and decimal . . . . . . . . . . . . . . . . . . . 27
2.2.3 complex . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.2.4 str . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.2.5 list and array . . . . . . . . . . . . . . . . . . . . . 31
2.2.6 tuple . . . . . . . . . . . . . . . . . . . . . . . . . . 33
2.2.7 dict . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
2.2.8 set . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
2.3 Python control flow statements . . . . . . . . . . . . . . . 37
2.3.1 for...in . . . . . . . . . . . . . . . . . . . . . . . . 38
2.3.2 while . . . . . . . . . . . . . . . . . . . . . . . . . . 40
2.3.3 if...elif...else . . . . . . . . . . . . . . . . . . . 40
2.3.4 try...except...else...finally . . . . . . . . . . . 41
6

2.3.5 def...return . . . . . . . . . . . . . . . . . . . . . . 43
2.3.6 lambda . . . . . . . . . . . . . . . . . . . . . . . . . 46
2.4 Classes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
2.4.1 Special methods and operator overloading . . . . 48
2.4.2 class Financial Transaction . . . . . . . . . . . . . 49
2.5 File input/output . . . . . . . . . . . . . . . . . . . . . . . 51
2.6 How to import modules . . . . . . . . . . . . . . . . . . . 51
2.6.1 math and cmath . . . . . . . . . . . . . . . . . . . . . 52
2.6.2 os . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
2.6.3 sys . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
2.6.4 datetime . . . . . . . . . . . . . . . . . . . . . . . . 53
2.6.5 time . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
2.6.6 urllib and json . . . . . . . . . . . . . . . . . . . . 55
2.6.7 pickle . . . . . . . . . . . . . . . . . . . . . . . . . 55
2.6.8 sqlite . . . . . . . . . . . . . . . . . . . . . . . . . 56
2.6.9 numpy . . . . . . . . . . . . . . . . . . . . . . . . . . 60
2.6.10 matplotlib . . . . . . . . . . . . . . . . . . . . . . . 62

3 Theory of Algorithms 71
3.1 Order of growth of algorithms . . . . . . . . . . . . . . . 72
3.1.1 Best and worst running times . . . . . . . . . . . . 75
3.2 Recurrence relations . . . . . . . . . . . . . . . . . . . . . 79
3.2.1 Reducible recurrence relations . . . . . . . . . . . 81
3.3 Types of algorithms . . . . . . . . . . . . . . . . . . . . . . 84
3.3.1 Memoization . . . . . . . . . . . . . . . . . . . . . 86
3.4 Timing algorithms . . . . . . . . . . . . . . . . . . . . . . 88
3.5 Data structures . . . . . . . . . . . . . . . . . . . . . . . . 90
3.5.1 Arrays . . . . . . . . . . . . . . . . . . . . . . . . . 90
3.5.2 List . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
3.5.3 Stack . . . . . . . . . . . . . . . . . . . . . . . . . . 90
3.5.4 Queue . . . . . . . . . . . . . . . . . . . . . . . . . 91
3.5.5 Sorting . . . . . . . . . . . . . . . . . . . . . . . . . 92
3.6 Tree algorithms . . . . . . . . . . . . . . . . . . . . . . . . 94
3.6.1 Heapsort and priority queues . . . . . . . . . . . . 94
3.6.2 Binary search trees . . . . . . . . . . . . . . . . . . 98
7

3.6.3 Other types of trees . . . . . . . . . . . . . . . . . 99


3.7 Graph algorithms . . . . . . . . . . . . . . . . . . . . . . . 100
3.7.1 Breadth-first search . . . . . . . . . . . . . . . . . . 102
3.7.2 Depth-first search . . . . . . . . . . . . . . . . . . . 103
3.7.3 Disjoint sets . . . . . . . . . . . . . . . . . . . . . . 104
3.7.4 Minimum spanning tree: Kruskal . . . . . . . . . 106
3.7.5 Minimum spanning tree: Prim . . . . . . . . . . . 108
3.7.6 Single-source shortest paths: Dijkstra . . . . . . . 110
3.8 Greedy algorithms . . . . . . . . . . . . . . . . . . . . . . 111
3.8.1 Huffman encoding . . . . . . . . . . . . . . . . . . 111
3.8.2 Longest common subsequence . . . . . . . . . . . 115
3.8.3 Needleman–Wunsch . . . . . . . . . . . . . . . . . 117
3.8.4 Continuous Knapsack . . . . . . . . . . . . . . . . 119
3.8.5 Discrete Knapsack . . . . . . . . . . . . . . . . . . 120
3.9 Artificial intelligence and machine learning . . . . . . . . 124
3.9.1 Clustering algorithms . . . . . . . . . . . . . . . . 124
3.9.2 Neural network . . . . . . . . . . . . . . . . . . . . 129
3.9.3 Genetic algorithms . . . . . . . . . . . . . . . . . . 136
3.10 Long and infinite loops . . . . . . . . . . . . . . . . . . . . 138
3.10.1 P, NP, and NPC . . . . . . . . . . . . . . . . . . . . 138
3.10.2 Cantor"s argument . . . . . . . . . . . . . . . . . . 138
3.10.3 Gödel"s theorem . . . . . . . . . . . . . . . . . . . 140

4 Numerical Algorithms 141


4.1 Well-posed and stable problems . . . . . . . . . . . . . . 141
4.2 Approximations and error analysis . . . . . . . . . . . . . 142
4.2.1 Error propagation . . . . . . . . . . . . . . . . . . 144
4.2.2 buckingham . . . . . . . . . . . . . . . . . . . . . . . 145
4.3 Standard strategies . . . . . . . . . . . . . . . . . . . . . . 146
4.3.1 Approximate continuous with discrete . . . . . . 146
4.3.2 Replace derivatives with finite differences . . . . 146
4.3.3 Replace nonlinear with linear . . . . . . . . . . . . 148
4.3.4 Transform a problem into a different one . . . . . 150
4.3.5 Approximate the true result via iteration . . . . . 151
4.3.6 Taylor series . . . . . . . . . . . . . . . . . . . . . . 151
8

4.3.7 Stopping Conditions . . . . . . . . . . . . . . . . . 158


4.4 Linear algebra . . . . . . . . . . . . . . . . . . . . . . . . . 159
4.4.1 Linear systems . . . . . . . . . . . . . . . . . . . . 160
4.4.2 Examples of linear transformations . . . . . . . . 167
4.4.3 Matrix inversion and the Gauss–Jordan algorithm 169
4.4.4 Transposing a matrix . . . . . . . . . . . . . . . . . 171
4.4.5 Solving systems of linear equations . . . . . . . . 172
4.4.6 Norm and condition number again . . . . . . . . 173
4.4.7 Cholesky factorization . . . . . . . . . . . . . . . . 176
4.4.8 Modern portfolio theory . . . . . . . . . . . . . . . 178
4.4.9 Linear least squares, χ2 . . . . . . . . . . . . . . . 182
4.4.10 Trading and technical analysis . . . . . . . . . . . 186
4.4.11 Eigenvalues and the Jacobi algorithm . . . . . . . 189
4.4.12 Principal component analysis . . . . . . . . . . . . 192
4.5 Sparse matrix inversion . . . . . . . . . . . . . . . . . . . 194
4.5.1 Minimum residual . . . . . . . . . . . . . . . . . . 195
4.5.2 Stabilized biconjugate gradient . . . . . . . . . . . 196
4.6 Solvers for nonlinear equations . . . . . . . . . . . . . . . 199
4.6.1 Fixed-point method . . . . . . . . . . . . . . . . . 199
4.6.2 Bisection method . . . . . . . . . . . . . . . . . . . 200
4.6.3 Newton method . . . . . . . . . . . . . . . . . . . 201
4.6.4 Secant method . . . . . . . . . . . . . . . . . . . . 202
4.7 Optimization in one dimension . . . . . . . . . . . . . . . 203
4.7.1 Bisection method . . . . . . . . . . . . . . . . . . . 203
4.7.2 Newton method . . . . . . . . . . . . . . . . . . . 203
4.7.3 Secant method . . . . . . . . . . . . . . . . . . . . 204
4.7.4 Golden section search . . . . . . . . . . . . . . . . 204
4.8 Functions of many variables . . . . . . . . . . . . . . . . . 205
4.8.1 Jacobian, gradient, and Hessian . . . . . . . . . . 207
4.8.2 Newton method (solver) . . . . . . . . . . . . . . . 209
4.8.3 Newton method (optimize) . . . . . . . . . . . . . 210
4.8.4 Improved Newton method (optimize) . . . . . . . 211
4.9 Nonlinear fitting . . . . . . . . . . . . . . . . . . . . . . . 212
4.10 Integration . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
4.10.1 Quadrature . . . . . . . . . . . . . . . . . . . . . . 217
9

4.11 Fourier transforms . . . . . . . . . . . . . . . . . . . . . . 220


4.12 Differential equations . . . . . . . . . . . . . . . . . . . . . 224

5 Probability and Statistics 229


5.1 Probability . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
5.1.1 Conditional probability and independence . . . . 231
5.1.2 Discrete random variables . . . . . . . . . . . . . . 232
5.1.3 Continuous random variables . . . . . . . . . . . 234
5.1.4 Covariance and correlations . . . . . . . . . . . . . 236
5.1.5 Strong law of large numbers . . . . . . . . . . . . 238
5.1.6 Central limit theorem . . . . . . . . . . . . . . . . 238
5.1.7 Error in the mean . . . . . . . . . . . . . . . . . . . 240
5.2 Combinatorics and discrete random variables . . . . . . 240
5.2.1 Different plugs in different sockets . . . . . . . . . 240
5.2.2 Equivalent plugs in different sockets . . . . . . . 241
5.2.3 Colored cards . . . . . . . . . . . . . . . . . . . . . 242
5.2.4 Gambler"s fallacy . . . . . . . . . . . . . . . . . . . 242

6 Random Numbers and Distributions 245


6.1 Randomness, determinism, chaos and order . . . . . . . 245
6.2 Real randomness . . . . . . . . . . . . . . . . . . . . . . . 246
6.2.1 Memoryless to Bernoulli distribution . . . . . . . 247
6.2.2 Bernoulli to uniform distribution . . . . . . . . . . 248
6.3 Entropy generators . . . . . . . . . . . . . . . . . . . . . . 249
6.4 Pseudo-randomness . . . . . . . . . . . . . . . . . . . . . 249
6.4.1 Linear congruential generator . . . . . . . . . . . 250
6.4.2 Defects of PRNGs . . . . . . . . . . . . . . . . . . 252
6.4.3 Multiplicative recursive generator . . . . . . . . . 252
6.4.4 Lagged Fibonacci generator . . . . . . . . . . . . . 253
6.4.5 Marsaglia"s add-with-carry generator . . . . . . . 253
6.4.6 Marsaglia"s subtract-and-borrow generator . . . . 253
6.4.7 Lüscher"s generator . . . . . . . . . . . . . . . . . 254
6.4.8 Knuth"s polynomial congruential generator . . . 254
6.4.9 PRNGs in cryptography . . . . . . . . . . . . . . . 254
6.4.10 Inverse congruential generator . . . . . . . . . . . 255
10

6.4.11 Marsenne twister . . . . . . . . . . . . . . . . . . . 256


6.5 Parallel generators and independent sequences . . . . . 257
6.5.1 Non-overlapping blocks . . . . . . . . . . . . . . . 258
6.5.2 Leapfrogging . . . . . . . . . . . . . . . . . . . . . 258
6.5.3 Lehmer trees . . . . . . . . . . . . . . . . . . . . . 259
6.6 Generating random numbers from a given distribution . 260
6.6.1 Uniform distribution . . . . . . . . . . . . . . . . . 261
6.6.2 Bernoulli distribution . . . . . . . . . . . . . . . . 262
6.6.3 Biased dice and table lookup . . . . . . . . . . . . 262
6.6.4 Fishman–Yarberry method . . . . . . . . . . . . . 264
6.6.5 Binomial distribution . . . . . . . . . . . . . . . . 266
6.6.6 Negative binomial distribution . . . . . . . . . . . 267
6.6.7 Poisson distribution . . . . . . . . . . . . . . . . . 269
6.7 Probability distributions for continuous random variables272
6.7.1 Uniform in range . . . . . . . . . . . . . . . . . . . 272
6.7.2 Exponential distribution . . . . . . . . . . . . . . . 272
6.7.3 Normal/Gaussian distribution . . . . . . . . . . . 274
6.7.4 Pareto distribution . . . . . . . . . . . . . . . . . . 277
6.7.5 In and on a circle . . . . . . . . . . . . . . . . . . . 278
6.7.6 In and on a sphere . . . . . . . . . . . . . . . . . . 278
6.8 Resampling . . . . . . . . . . . . . . . . . . . . . . . . . . 279
6.9 Binning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 280

7 Monte Carlo Simulations 283


7.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . 283
7.1.1 Computing π . . . . . . . . . . . . . . . . . . . . . 283
7.1.2 Simulating an online merchant . . . . . . . . . . . 286
7.2 Error analysis and the bootstrap method . . . . . . . . . 289
7.3 A general purpose Monte Carlo engine . . . . . . . . . . 291
7.3.1 Value at risk . . . . . . . . . . . . . . . . . . . . . . 292
7.3.2 Network reliability . . . . . . . . . . . . . . . . . . 294
7.3.3 Critical mass . . . . . . . . . . . . . . . . . . . . . 296
7.4 Monte Carlo integration . . . . . . . . . . . . . . . . . . . 299
7.4.1 One-dimensional Monte Carlo integration . . . . 299
7.4.2 Two-dimensional Monte Carlo integration . . . . 301
11

7.4.3 n-dimensional Monte Carlo integration . . . . . . 302


7.5 Stochastic, Markov, Wiener, and processes . . . . . . . . . 303
7.5.1 Discrete random walk (Bernoulli process) . . . . 304
7.5.2 Random walk: Ito process . . . . . . . . . . . . . . 305
7.6 Option pricing . . . . . . . . . . . . . . . . . . . . . . . . . 306
7.6.1 Pricing European options: Binomial tree . . . . . 308
7.6.2 Pricing European options: Monte Carlo . . . . . . 310
7.6.3 Pricing any option with Monte Carlo . . . . . . . 312
7.7 Markov chain Monte Carlo (MCMC) and Metropolis . . 314
7.7.1 The Ising model . . . . . . . . . . . . . . . . . . . 317
7.8 Simulated annealing . . . . . . . . . . . . . . . . . . . . . 320
7.8.1 Protein folding . . . . . . . . . . . . . . . . . . . . 321

8 Parallel Algorithms 325


8.1 Parallel architectures . . . . . . . . . . . . . . . . . . . . . 326
8.1.1 Flynn taxonomy . . . . . . . . . . . . . . . . . . . 326
8.1.2 Network topologies . . . . . . . . . . . . . . . . . 328
8.1.3 Network characteristics . . . . . . . . . . . . . . . 331
8.2 Parallel metrics . . . . . . . . . . . . . . . . . . . . . . . . 332
8.2.1 Latency and bandwidth . . . . . . . . . . . . . . . 332
8.2.2 Speedup . . . . . . . . . . . . . . . . . . . . . . . . 333
8.2.3 Efficiency . . . . . . . . . . . . . . . . . . . . . . . 334
8.2.4 Isoefficiency . . . . . . . . . . . . . . . . . . . . . . 335
8.2.5 Cost . . . . . . . . . . . . . . . . . . . . . . . . . . 336
8.2.6 Cost optimality . . . . . . . . . . . . . . . . . . . . 337
8.2.7 Amdahl"s law . . . . . . . . . . . . . . . . . . . . . 338
8.3 Message passing . . . . . . . . . . . . . . . . . . . . . . . 338
8.3.1 Broadcast . . . . . . . . . . . . . . . . . . . . . . . 344
8.3.2 Scatter and collect . . . . . . . . . . . . . . . . . . 345
8.3.3 Reduce . . . . . . . . . . . . . . . . . . . . . . . . . 347
8.3.4 Barrier . . . . . . . . . . . . . . . . . . . . . . . . . 350
8.3.5 Global running times . . . . . . . . . . . . . . . . 350
8.4 mpi4py . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 351
8.5 Master-Worker and Map-Reduce . . . . . . . . . . . . . . 352
8.6 pyOpenCL . . . . . . . . . . . . . . . . . . . . . . . . . . . 356
12

8.6.1 A first example with PyOpenCL . . . . . . . . . . 357


8.6.2 Laplace solver . . . . . . . . . . . . . . . . . . . . . 359

9 Appendices 363
9.1 Appendix A: Math Review and Notation . . . . . . . . . 363
9.1.1 Symbols . . . . . . . . . . . . . . . . . . . . . . . . 363
9.1.2 Set theory . . . . . . . . . . . . . . . . . . . . . . . 363
9.1.3 Logarithms . . . . . . . . . . . . . . . . . . . . . . 367
9.1.4 Finite sums . . . . . . . . . . . . . . . . . . . . . . 367
9.1.5 Limits (n → ∞) . . . . . . . . . . . . . . . . . . . . 369

Index 375

Bibliography 379
CONTENTS 13
1
Introduction

This book is assembled from lectures given by the author over a period of
10 years at the School of Computing of DePaul University. The lectures
cover multiple classes, including Analysis and Design of Algorithms, Sci-
entific Computing, Monte Carlo Simulations, and Parallel Algorithms.
These lectures teach the core knowledge required by any scientist inter-
ested in numerical algorithms and by students interested in computa-
tional finance.
The notes are not comprehensive, yet they try to identify and describe
the most important concepts taught in those courses using a few common
tools and unified notation.
In particular, these notes do not include proofs; instead, they provide
definitions and annotated code. The code is built in a modular way and
is reused as much as possible throughout the book so that no step of the
computations is left to the imagination. Each function defined in the code
is accompanied by one or more examples of practical applications.
We take an interdisciplinary approach by providing examples in finance,
physics, biology, and computer science. This is to emphasize that, al-
though we often compartmentalize knowledge, there are very few ideas
and methodologies that constitute the foundations of them all. Ultimately,
this book is about problem solving using computers. The algorithms you
16 annotated algorithms in python

will learn can be applied to different disciplines. Throughout history, it


is not uncommon that an algorithm invented by a physicist would find
application in, for example, biology or finance.
Almost all of the algorithms written in this book can be found in the nlib
github repository:
[Link]

1.1 Main Ideas

Even if we cover many different algorithms and examples, there are a few
central ideas in this book that we try to emphasize over and over.
The first idea is that we can simplify the solution of a problem by using
an approximation and then systematically improve our approximation by
iterating and computing corrections.
The divide-and-conquer methodology can be seen as an example of this
approach. We do this with the insertion sort when we sort the first two
numbers, then we sort the first three, then we sort the first four, and so
on. We do it with merge sort when we sort each set of two numbers,
then each set of four, then each set of eight, and so on. We do it with the
Prim, Kruskal, and Dijkstra algorithms when we iterate over the nodes of
a graph, and as we acquire knowledge about them, we use it to update
the information about the shortest paths.
We use this approach in almost all our numerical algorithms because any
differentiable function can be approximated with a linear function:

f ( x + δx ) ≃ f ( x ) + f ′ ( x )δx (1.1)

We use this formula in the Newton method to solve nonlinear equations


and optimization problems, in one or more dimensions.
We use the same approximation in the fix point method, which we use
to solve equations like f ( x ) = 0; in the minimum residual and conjugate
gradient methods; and to solve the Laplace equation in the last chapter of
the book. In all these algorithms, we start with a random guess for the
solution, and we iteratively find a better one until convergence.
introduction 17

The second idea of the book is that certain quantities are random, but even
random numbers have patterns that we can capture using instruments
like distributions and correlations. The presence of these patterns helps
us model those systems that may have a random output (e.g., nuclear
reactions, financial systems) and also helps us in computations. In fact,
we can use random numbers to compute quantities that are not random
(Monte Carlo methods). The most common approximation that we make
in different parts of the book is that when a random variable x is localized
at a point with a given uncertainty, δx, then its distribution is Gaussian.
Thanks to the properties of Gaussian random numbers, we conclude the
following:
• Using the linear approximation (our first big idea), if z = f ( x ), the
uncertainty in the output is

δz = f ′ ( x )δx (1.2)

• If we add two independent Gaussian random variables z = x + y, the


uncertainty in the output is
q
δz = δx2 + δy2 (1.3)

• If we add N independent and identically distributed Gaussian vari-


ables z = ∑ xi , the uncertainty in the output is

δz = Nδx (1.4)

We use this over and over, for example, when relating the volatility
over different time intervals (daily, yearly).
• If we compute an average of N independent and identically distributed
Gaussian random variables, z = 1/N ∑ xi , the uncertainty in the aver-
age is √
δz = δx/ N (1.5)
We use this to estimate the error on the average in a Monte Carlo com-

putation. In that case, we write it as dµ = σ/ N, and σ is the standard
deviation of { xi }.
18 annotated algorithms in python

The third idea is that the time it takes to run an iterative algorithm is pro-
portional to the number of iterations. It is therefore our goal to minimize
the number of iterations required to reach a target precision. We develop
a language to compare algorithms based on their running time and clas-
sify algorithms into categories. This is useful to choose the best algorithm
based on the problem at hand.
In the chapter on parallel algorithms, we learn how to distribute those
iterations over multiple parallel processes and how to break individual
iterations into independent steps that can be executed concurrently on
parallel processes, to reduce the total time required to obtain a solution
within a given target precision. In the parallel case, the running time ac-
quires an overhead that depends on the communication patterns between
the parallel processes, the communication latency, and bandwidth.
In the ultimate analysis, we can even try to understand ourselves as a par-
allel machine that models the input from the world by approximations.
The brain is a graph that can be modeled by a neural network. The learn-
ing process is an ongoing optimization process in which the brain adjusts
its synapses to produce better and better responses. The decision process
mimics a search tree. We solve problems by searching for the most simi-
lar problems that we have encountered before, then we refine the solution.
Our DNA is a code that evolved to efficiently compress the information
necessary to grow us from a single cell into a complex being. We evolved
according to evolutionary mechanisms that can be modeled using genetic
algorithms. We can find our similarities with other organisms using the
longest common subsequence algorithm. We can reconstruct our evolu-
tionary tree using shortest-path algorithms and find out how we came to
be.

1.2 About Python

The programming language used in this book is Python [1] version 3.8.
This is because Python algorithms are very similar to the corresponding
pseudo-code, and therefore this language is easy to read and understand
compared to other languages such as C++ or Java. Moreover, Python
introduction 19

is a popular language in many Universities and Companies (including


Google).
The goal of the book is to explain the algorithms by building them from
scratch. It is not our goal to teach the user about existing libraries that
may be (and often are) faster than our implementation. Two notable ex-
amples are NumPy [2] and SciPy [3]. These libraries provide a Python
interface to the BLAS and LaPack libraries for linear algebra and appli-
cations. Although we wholeheartedly recommend using them when de-
veloping production code, we believe they are not appropriate for teach-
ing the algorithms themselves because those algorithms are written in C,
FORTRAN, and assembly languages and are not easy to read.

1.3 Book Structure

This book is divided into the following chapters:


• This introduction.
• An introduction to the Python programming language. The introduc-
tion assumes the reader is not new to basic programming concepts,
such as conditionals, loops, and function calls, and teaches the basic
syntax of the Python language, with particular focus on those built-
in modules that are important for scientific applications (math, cmath,
decimal, random) and a few others.
• Chapter 3 is a short review of the general theory of algorithms with
applications. There we review how to determine the running time of
an algorithm from simple loops to more complex recursive algorithms.
We review basic data structures used to store information such as lists,
arrays, stacks, queues, trees, and graphs. We also review the classifi-
cation of basic algorithms such as divide-and-conquer, dynamic pro-
gramming, and greedy algorithms. In the examples, we peek into com-
plex algorithms such as Shannon–Fano compression, a maze solver, a
clustering algorithm, and a neural network.
• In chapter 4, we talk about traditional numerical algorithms, in particu-
lar, linear algebra, solvers, optimizers, integrators, and Fourier–Laplace
20 annotated algorithms in python

transformations. We start by reviewing the concept of Taylor series and


their convergence to understand approximations, sources of error, and
convergence. We then use those concepts to build more complex algo-
rithms by systematically improving their first-order (linear) approxima-
tion. Linear algebra serves us as a tool to approximate and implement
functions of many variables.
• In chapter 5, we provide a review of probability and statistics and im-
plement basic Python functions to perform statistical analysis of ran-
dom variables.
• In chapter 6, we discuss algorithms to generate random numbers from
many distributions. Python already has a built-in module to generate
random numbers, and in subsequent chapters, we utilize it, yet in this
chapter, we discuss in detail how pseudo random number generators
work and their pitfalls.
• In chapter 7, we write about Monte Carlo simulations. This is a numer-
ical technique that utilizes random numbers to solve otherwise deter-
ministic problems. For example, in chapter 4, we talk about numerical
integration in one dimension. Those algorithms can be extended to
perform numerical integration in a few (two, three, sometimes four)
dimensions, but they fail for very large numbers of dimensions. That
is where Monte Carlo integration comes to our rescue, as it increasingly
becomes the integration method of choice as the number of variables
increases. We present applications of Monte Carlo simulations.
• In chapter 8, we discuss parallel algorithms. There are many paradigms
for parallel programming these days, and the tendency is toward
inhomogeneous architectures. Although we review many different
types of architectures, we focus on three programming paradigms that
have been very successful: message-passing, map-reduce, and multi-
threaded GPU programming. In the message-passing case, we create a
simple “parallel simulator” (PSim) in Python that allows us to under-
stand the basic ideas behind message passing and issues with different
network topologies. In the GPU case, we use the pyOpenCL [4] library
to run OpenCL kernels on the GPU (or CPUs).
introduction 21

• Finally, in the appendix, we provide a compendium of useful formulas


and definitions.

1.4 Book Software

We utilize the following software libraries developed by the author and


available under an Open Source BSD License:
• [Link]
• [Link]
We also utilize the following third party libraries:
• [Link]
• [Link]
• [Link]
• [Link]
All the code included in these notes is released by the author under the
three-clause BSD License.

Acknowledgements

Many thanks to Alan Etkins, Brian Fox, Dan Bowker, Ethan Sud-
man, Holly Monteith, Konstantinos Moutselos, Luca De Alfaro, Michael
Gheith, Paula Mikrut, Sean Neilan, and John Plamondon for reviewing
different editions of this book. We also thank all the students of our
classes for their useful comments and suggestions. Finally, we thank
Wikipedia, from which we borrowed a few ideas and examples.
2
Overview of the Python Language

2.1 About Python

Python is a general-purpose high-level programming language. Its design


philosophy emphasizes programmer productivity and code readability. It
has a minimalist core syntax with very few basic commands and simple
semantics. It also has a large and comprehensive standard library, includ-
ing an Application Programming Interface (API) to many of the under-
lying operating system (OS) functions. Python provides built-in objects
such as linked lists (list), tuples (tuple), hash tables (dict), arbitrarily
long integers (long), complex numbers, and arbitrary precision decimal
numbers.
Python supports multiple programming paradigms, including object-
oriented (class), imperative (def), and functional (lambda) programming.
Python has a dynamic type system and automatic memory management
using reference counting (similar to Perl, Ruby, and Scheme).
Python was first released by Guido van Rossum in 1991 [6]. The lan-
guage has an open, community-based development model managed by
the nonprofit Python Software Foundation. There are many interpreters
and compilers that implement the Python language, including one in Java
(Jython), one built on .Net (IronPython), and one built in Python itself
(PyPy). In this brief review, we refer to the reference C implementation
24 annotated algorithms in python

created by Guido.
You can find many tutorials, the official documentation, and library refer-
ences of the language on the official Python website. [1]
For additional Python references, we can recommend the books in ref. [6]
and ref. [7].
You may skip this chapter if you are already familiar with the Python
language.

2.1.1 Python versus Java and C++ syntax

Java/C++ Python
assignment a = b; a=b
comparison if (a == b) if a == b:
loops for(a = 0; a < n; a + +) for a in range(0, n):
block Braces {...} indentation
function f loat f (float a) { def f ( a):
function call f ( a) f ( a)
arrays/lists a [i ] a [i ]
member [Link] [Link]
nothing null / void∗ None
As in Java, variables that are primitive types (bool, int, float) are passed by
copy, but more complex types, unlike C++, are passed by reference. This
means when we pass an object to a function, in Python, we do not make
a copy of the object, we simply define an alternate name for referencing
the object in the function.

2.1.2 help, dir


The Python language provides two commands to obtain documentation
about objects defined in the current scope, whether the object is built in
or user defined.
We can ask for help about an object, for example, “1”:
1 >>> help(1)
overview of the python language 25

2 Help on int object:


3

4 class int(object)
5 | int(x[, base]) -> integer
6 |
7 | Convert a string or number to an integer, if possible. A floating point
8 | argument will be truncated towards zero (this does not include a string
9 | representation of a floating point number!) When converting a string, use
10 | the optional base. It is an error to supply a base when converting a
11 | non-string. If the argument is outside the integer range a long object
12 | will be returned instead.
13 |
14 | Methods defined here:
15 |
16 | __abs__(...)
17 | x.__abs__() < == > abs(x)
18 ...

and because “1” is an integer, we get a description about the int class and
all its methods. Here the output has been truncated because it is very
long and detailed.
Similarly, we can obtain a list of object attributes (including methods) for
any object using the command dir. For example:
1 >>> dir(1)
2 ["__abs__", "__add__", "__and__", "__class__", "__cmp__", "__coerce__",
3 "__delattr__", "__div__", "__divmod__", "__doc__", "__float__",
4 "__floordiv__", "__getattribute__", "__getnewargs__", "__hash__", "__hex__",
5 "__index__", "__init__", "__int__", "__invert__", "__long__", "__lshift__",
6 "__mod__", "__mul__", "__neg__", "__new__", "__nonzero__", "__oct__",
7 "__or__", "__pos__", "__pow__", "__radd__", "__rand__", "__rdiv__",
8 "__rdivmod__", "__reduce__", "__reduce_ex__", "__repr__", "__rfloordiv__",
9 "__rlshift__", "__rmod__", "__rmul__", "__ror__", "__rpow__", "__rrshift__",
10 "__rshift__", "__rsub__", "__rtruediv__", "__rxor__", "__setattr__",
11 "__str__", "__sub__", "__truediv__", "__xor__"]

2.2 Types of variables

Python is a dynamically typed language, meaning that variables do not


have a type and therefore do not have to be declared. Variables may also
change the type of value they hold through their lives. Values, on the
other hand, do have a type. You can query a variable for the type of value
it contains:
1 >>> a = 3
26 annotated algorithms in python

2 >>> type(a)
3 <type 'int'>
4 >>> a = 3.14
5 >>> type(a)
6 <type 'float'>
7 >>> a = "hello python"
8 >>> type(a)
9 <type 'str'>

Python also includes, natively, data structures such as lists and dictionar-
ies.

2.2.1 int and long


There are two types representing integer numbers: int and long. The dif-
ference is that int corresponds to the microprocessor"s native bit length.
Typically, this is 32 bits and can hold signed integers in range [−231 , +231 ),
whereas the long type can hold almost any arbitrary integer. It is impor-
tant that Python automatically converts one into the other as necessary,
and you can mix and match the two types in computations. Here is an
example:
1 >>> a = 1024
2 >>> type(a)
3 <type 'int'>
4 >>> b = a ** 128
5 >>> b
6 20815864389328798163850480654728171077230524494533409610638224700807216119346720
7 59602447888346464836968484322790856201558276713249664692981627981321135464152584
8 82590187784406915463666993231671009459188410953796224233873542950969577339250027
9 68876520583464697770622321657076833170056511209332449663781837603694136444406281
10 042053396870977465916057756101739472373801429441421111406337458176
11 >>> type(b)
12 <type "long">

Computers represent 32-bit integer numbers by converting them to base


2. The conversion works in the following way:
1 def int2binary(n, nbits=32):
2 if n<0:
3 return [1 if bit == 0 else 0 for bit in int2binary(-n-1, nbits)]
4 bits = [0] * nbits
5 for i in range(nbits):
6 n, bits[i] = divmod(n, 2)
7 if n: raise OverflowError
8 return bits
overview of the python language 27

The case n < 0 is called two"s complement and is defined as the value
obtained by subtracting the number from the largest power of 2 (232 for
32 bits). Just by looking at the most significant bit, one can determine the
sign of the binary number (1 for negative and 0 for zero or positive).

2.2.2 float and decimal


There are two ways to represent decimal numbers in Python: using the
native double precision (64 bits) representation, float, or using the decimal
module.
Most numerical problems are dealt with simply using float:
1 >>> pi = 3.141592653589793
2 >>> two_pi = 2.0 * pi

Floating point numbers are internally represented as follows:

x = ±m2e (2.1)

where x is the number, m is called the mantissa and is zero or a num-


ber in the range [1, 2), and e is called the exponent. The sign, m, and e
can be computed using the following algorithm, which also writes their
representation in binary:
1 def float2binary(x, nm=4, ne=4):
2 if x == 0:
3 return 0, [0] * nm, [0] * ne
4 sign, mantissa, exponent = (1 if x<0 else 0), abs(x), 0
5 while abs(mantissa)>=2:
6 mantissa, exponent = 0.5 * mantissa, exponent+1
7 while 0<abs(mantissa)<1:
8 mantissa, exponent = 2.0 * mantissa, exponent-1
9 mantissa = int2binary(int(2 ** (nm-1) * mantissa), nm)
10 exponent = int2binary(exponent, ne)
11 return sign, mantissa, exponent

Because the exponent is stored in a fixed number of bits (11 for a 64-bit
floating point number), exponents smaller than −1022 and larger than
1023 cannot be represented. An arithmetic operation that returns a num-
ber smaller than 2−1022 ≃ 10−308 cannot be represented and results in
an underflow error. An operation that returns a number larger than
28 annotated algorithms in python

21023 ≃ 10308 also cannot be represented and results in an overflow er-


ror.
Here is an example of overflow:
1 >>> a = 10.0 ** 200
2 >>> a * a
3 inf

And here is an example of underflow:


1 >>> a = 10.0 ** -200
2 >>> a * a
3 0.0

Another problem with finite precision arithmetic is the loss of precision


in computation. Consider the case of the difference between two numbers
with very different orders of magnitude. To compute the difference, the
CPU reduces them to the same exponent (the largest of the two) and then
computes the difference in the two mantissas. If two numbers differ by a
factor 2k , then the mantissa of the smallest number, in binary, needs to be
shifted by k positions, thus resulting in a loss of information because the
k least significant bits in the mantissa are ignored. If the difference be-
tween the two numbers is greater than a factor 252 , all bits in the mantissa
of the smallest number are ignored, and the smallest number becomes
completely invisible.
Following is a practical example that produces an incorrect result:
1 >>> a = 1.0
2 >>> b = 2.0 ** 53
3 >>> a+b-b
4 0.0

a simple example of what occurs internally in a processor to add two


floating point numbers together. The IEEE 754 standard states that for
32-bit floating point numbers, the exponent has a range of −126 to +127:
1 262 in IEEE 754: 0 10000111 00000110000000000000000 (+ e:8 m:1.0234375)
2 3 in IEEE 754: 0 10000000 10000000000000000000000 (+ e:1 m:1.5)
3 265 in IEEE 754: 0 10000111 00001001000000000000000

To add 262.0 to 3.0, the exponents must be the same. The exponent of the
lesser number is increased to the exponent of the greater number. In this
case, 3"s exponent must be increased by 7. Increasing the exponent by 7
overview of the python language 29

means the mantissa must be shifted seven binary digits to the right:
1 0 10000111 00000110000000000000000
2 0 10000111 00000011000000000000000 (The implied ``1'' is also pushed seven
places to the right)
3 ------------------------------------
4 0 10000111 00001001000000000000000 which is the IEEE 754 format for 265.0

In the case of two numbers in which the exponent is greater than the
number of digits in the mantissa, the smaller number is shifted right off
the end. The effect is a zero added to the larger number.
In some cases, only some of the bits of the smaller number"s mantissa are
lost if a partial addition occurs.
This precision issue is always present but not always obvious. It may
consist of a small discrepancy between the true value and the computed
value. This difference may increase during the computation, in particular,
in iterative algorithms, and may be sizable in the result of a complex
algorithm.
Python also has a module for decimal floating point arithmetic that al-
lows decimal numbers to be represented exactly. The class Decimal incor-
porates a notion of significant places (unlike the hardware-based binary
floating point, the decimal module has a user-alterable precision):
1 >>> from decimal import Decimal, getcontext
2 >>> getcontext().prec = 28 # set precision
3 >>> Decimal(1) / Decimal(7)
4 Decimal("0.1428571428571428571428571429")

Decimal numbers can be used almost everywhere in place of floating


point number arithmetic but are slower and should be used only where
arbitrary precision arithmetic is required. It does not suffer from the over-
flow, underflow, and precision issues described earlier:
1 >>> from decimal import Decimal
2 >>> a = Decimal(10.0) ** 300
3 >>> a * a
4 Decimal("1.000000000000000000000000000E+600")
30 annotated algorithms in python

2.2.3 complex

Python has native support for complex numbers. The imaginary unit is
represented by the character j:
1 >>> c = 1+2j
2 >>> c
3 (1+2j)
4 >>> [Link]
5 1.0
6 >>> [Link]
7 2.0
8 >>> abs(c)
9 2.2360679775

The real and imaginary parts of a complex number are stored as 64-bit
floating point numbers.
Normal arithmetic operations are supported. The cmath module contains
trigonometric and other functions for complex numbers. For example,
1 >>> phi = 1j
2 >>> import cmath
3 >>> [Link](phi)
4 (0.540302305868+0.841470984808j)

2.2.4 str

Python supports the use of two different types of strings: ASCII strings
and Unicode strings. ASCII strings are delimited by "...", "...",
"""...""", or """...""". Triple quotes delimit multiline strings. Unicode
strings start with a u, followed by the string containing Unicode charac-
ters. A Unicode string can be converted into an ASCII string by choosing
an encoding (e.g., UTF8):
1 >>> a = "this is an ASCII string"
2 >>> b = u"This is a Unicode string"
3 >>> a = [Link]("utf8")

After executing these three commands, the resulting a is an ASCII string


storing UTF8 encoded characters.
It is also possible to write variables into strings in various ways:
1 >>> "number is " + str(3)
2 number is 3
overview of the python language 31

3 >>> "number is %s" % (3)


4 number is 3
5 >>> "number is %(number)s" % dict(number=3)
6 number is 3

The final notation is more explicit and less error prone and is to be pre-
ferred.
Many Python objects, for example, numbers, can be serialized into strings
using str or repr. These two commands are very similar but produce
slightly different output. For example,
1 >>> for i in [3, "hello"]:
2 ... print(str(i), repr(i))
3 3 3
4 hello "hello"

For user-defined classes, str and repr can be defined and redefined using
the special operators __str__ and __repr__. These are briefly described
later in this chapter. For more information on the topic, refer to the official
Python documentation [8].
Another important characteristic of a Python string is that it is an iterable
object, similar to a list:
1 >>> for i in "hello":
2 ... print(i)
3 h
4 e
5 l
6 l
7 o

2.2.5 list and array


The distinction between lists and arrays is usually in their implementation
and in the relative difference in speed of the operations they can perform.
Python defines a type called list that internally is implemented more like
an array.
The main methods of Python lists are append, insert, and delete. Other
useful methods include count, index, reverse, and sort:
1 >>> b = [1, 2, 3]
2 >>> type(b)
32 annotated algorithms in python

3 <type "list">
4 >>> [Link](8)
5 >>> [Link](2, 7) # insert 7 at index 2 (3rd element)
6 >>> del b[0]
7 >>> b
8 [2, 7, 3, 8]
9 >>> len(b)
10 4
11 >>> [Link](3)
12 >>> [Link]()
13 >>> b, " 3 appears ", [Link](3), " times. The number 7 appears at index ", b.
index(7)
14 [3, 8, 3, 7, 2] 3 appears 2 times. The number 7 appears at index 3

Lists can be sliced:


1 >>> a= [2, 7, 3, 8]
2 >>> a[:3]
3 [2, 7, 3]
4 >>> a[1:]
5 [7, 3, 8]
6 >>> a[-2:]
7 [3, 8]

and concatenated/joined:
1 >>> a = [2, 7, 3, 8]
2 >>> a = [2, 3]
3 >>> b = [5, 6]
4 >>> a + b
5 [2, 3, 5, 6]

A list is iterable; you can loop over it:


1 >>> a = [1, 2, 3]
2 >>> for i in a:
3 ... print(i)
4 1
5 2
6 3

A list can also be sorted in place with the sort method:


1 >>> [Link]()

There is a very common situation for which a list comprehension can be


used. Consider the following code:
1 >>> a = [1, 2, 3, 4, 5]
2 >>> b = []
3 >>> for x in a:
4 ... if x % 2 == 0:
overview of the python language 33

5 ... [Link](x * 3)
6 >>> b
7 [6, 12]

This code clearly processes a list of items, selects and modifies a subset
of the input list, and creates a new result list. This code can be entirely
replaced with the following list comprehension:
1 >>> a = [1, 2, 3, 4, 5]
2 >>> b = [x * 3 for x in a if x % 2 == 0]
3 >>> b
4 [6, 12]

Python has a module called array. It provides an efficient array imple-


mentation. Unlike lists, array elements must all be of the same type, and
the type must be either a char, short, int, long, float, or double. A type
of char, short, int, or long may be either signed or unsigned. Notice these
are C-types, not Python types.
1 >>> from array import array
2 >>> a = array("d", [1, 2, 3, 4, 5])
3 array("d", [1.0, 2.0, 3.0, 4.0, 5.0])

An array object can be used in the same way as a list, but its elements
must all be of the same type, specified by the first argument of the con-
structor (“d” for double, “l” for signed long, “f” for float, and “c” for
character). For a complete list of available options, refer to the official
Python documentation.
Using “array” over “list” can be faster, but more important, the “array”
storage is more compact for large arrays.

2.2.6 tuple

A tuple is similar to a list, but its size and elements are immutable. If a
tuple element is an object, the object itself is mutable, but the reference to
the object is fixed. A tuple is defined by elements separated by a comma
and optionally delimited by round parentheses:
1 >>> a = 1, 2, 3
2 >>> a = (1, 2, 3)

The round brackets are required for a tuple of zero elements such as
1 >>> a = () # this is an empty tuple
34 annotated algorithms in python

A trailing comma is required for a one-element tuple but not for two or
more elements:
1 >>> a = (1) # not a tuple
2 >>> a = (1,) # this is a tuple of one element
3 >>> b = (1, 2) # this is a tuple of two elements

Since lists are mutable; this works:


1 >>> a = [1, 2, 3]
2 >>> a[1] = 5
3 >>> a
4 [1, 5, 3]

the element assignment does not work for a tuple:


1 >>> a = (1, 2, 3)
2 >>> a[1]
3 2
4 >>> a[1] = 5
5 Traceback (most recent call last):
6 File "<stdin>", line 1, in <module>
7 TypeError: "tuple" object does not support item assignment

A tuple, like a list, is an iterable object. Notice that a tuple consisting of a


single element must include a trailing comma:
1 >>> a = (1)
2 >>> type(a)
3 <type 'int'>
4 >>> a = (1,)
5 >>> type(a)
6 <type "tuple">

Tuples are very useful for efficient packing of objects because of their
immutability. The brackets are often optional. You may easily get each
element of a tuple by assigning multiple variables to a tuple at one time:
1 >>> a = (2, 3, "hello")
2 >>> (x, y, z) = a
3 >>> x
4 2
5 >>> z
6 hello
7 >>> a = "alpha", 35, "sigma" # notice the rounded brackets are optional
8 >>> p, r, q = a
9 print(r)
10 35
overview of the python language 35

2.2.7 dict

A Python dict-ionary is a hash table that maps a key object to a value


object:
1 >>> a = {"k":"v", "k2":3}
2 >>> a["k"]
3 v
4 >>> a["k2"]
5 3
6 >>> "k" in a
7 True
8 >>> "v" in a
9 False

You will notice that the format to define a dictionary is the same as the
JavaScript Object Notation [JSON]. Dictionaries may be nested:
1 >>> a = {"x":3, "y":54, "z":{"a":1, "b":2}}
2 >>> a["z"]
3 {"a": 1, "b": 2}
4 >>> a["z"]["a"]
5 1

Keys can be of any hashable type (int, string, or any object whose class
implements the __hash__ method). Values can be of any type. Different
keys and values in the same dictionary do not have to be of the same type.
If the keys are alphanumeric characters, a dictionary can also be declared
with the alternative syntax:
1 >>> a = dict(k="v", h2=3)
2 >>> a["k"]
3 v
4 >>> a
5 {"h2": 3, "k": "v"}

Useful methods are has_key, keys, values, items, and update:


1 >>> a = dict(k="v", k2=3)
2 >>> [Link]()
3 ["k2", "k"]
4 >>> [Link]()
5 [3, "v"]
6 >>> [Link]({"n1":"new item"}) # adding a new item
7 >>> [Link](dict(n2="newer item")) # alternate method to add a new item
8 >>> a["n3"] = "newest item" # another method to add a new item
9 >>> [Link]()
10 [("k2", 3), ("k", "v"), ("n3", "newest item"), ("n2", "newer item"), ("n1", "new
item")]
36 annotated algorithms in python

The items method produces a list of tuples, each containing a key and its
associated value.
Dictionary elements and list elements can be deleted with the command
del:

1 >>> a = [1, 2, 3]
2 >>> del a[1]
3 >>> a
4 [1, 3]
5 >>> a = dict(k="v", h2=3)
6 >>> del a["h2"]
7 >>> a
8 {"k": "v"}

Internally, Python uses the hash operator to convert objects into integers
and uses that integer to determine where to store the value. Using a key
that is not hashable will cause an un-hashable type error:
1 >>> hash("hello world")
2 -1500746465
3 >>> k = [1, 2, 3]
4 >>> a = {k:"4"}
5 Traceback (most recent call last):
6 File "<stdin>", line 1, in <module>
7 TypeError: unhashable type: "list"

2.2.8 set

A set is something between a list and a dictionary. It represents a non-


ordered list of unique elements. Elements in a set cannot be repeated.
Internally, it is implemented as a hash table, similar to a set of keys in a
dictionary. A set is created using the set constructor. Its argument can be
a list, a tuple, or an iterator:
1 >>> s = set([1, 2, 3, 4, 5, 5, 5, 5]) # notice duplicate elements are removed
2 >>> s
3 set([1, 2, 3, 4, 5])
4 >>> s = set((1, 2, 3, 4, 5))
5 >>> s
6 set([1, 2, 3, 4, 5])
7 >>> s = set(i for i in range(1, 6))
8 >>> s
9 set([1, 2, 3, 4, 5])

Sets are not ordered lists therefore appending to the end is not applicable.
overview of the python language 37

Instead of append, add elements to a set using the add method:


1 >>> s = set()
2 >>> [Link](2)
3 >>> [Link](3)
4 >>> [Link](2)
5 >>> s
6 set([2, 3])

Notice that the same element cannot be added twice (2 in the example).
There is no exception or error thrown when trying to add the same ele-
ment more than once.
Because sets are not ordered, the order in which you add items is not
necessarily the order in which they will be returned:
1 >>> s = set([6, "b", "beta", -3.4, "a", 3, 5.3])
2 >>> (s)
3 set(["a", 3, 6, 5.3, "beta", "b", -3.4])

The set object supports normal set operations like union, intersection, and
difference:
1 >>> a = set([1, 2, 3])
2 >>> b = set([2, 3, 4])
3 >>> c = set([2, 3])
4 >>> [Link](b)
5 set([1, 2, 3, 4])
6 >>> [Link](b)
7 set([2, 3])
8 >>> [Link](b)
9 set([1])
10 >>> if len(c) == len([Link](c)):
11 ... print("c is a subset of a")
12 ... else:
13 ... print("c is not a subset of a")
14 ...
15 c is a subset of a

To check for membership,


1 >>> 2 in a
2 True

2.3 Python control flow statements

Python uses indentation to delimit blocks of code. A block starts with a


line ending with colon and continues for all lines that have a similar or
38 annotated algorithms in python

higher indentation as the next line:


1 >>> i = 0
2 >>> while i < 3:
3 ... print(i)
4 ... i = i + 1
5 0
6 1
7 2

It is common to use four spaces for each level of indentation. It is a


good policy not to mix tabs with spaces, which can result in (invisible)
confusion.

2.3.1 for...in

In Python, you can loop over iterable objects:


1 >>> a = [0, 1, "hello", "python"]
2 >>> for i in a:
3 ... print(i)
4 0
5 1
6 hello
7 python

In the preceding example, you will notice that the loop index “i” takes on
the values of each element in the list [0, 1, "hello", "python"] sequentially.
The Python range keyword creates a list of integers automatically that may
be used in a “for” loop without manually creating a long list of numbers.
1 >>> a = range(0, 5)
2 >>> a
3 [0, 1, 2, 3, 4]
4 >>> for i in a:
5 ... print(i)
6 0
7 1
8 2
9 3
10 4

The parameters for range(a, b, c) are as follows: the first parameter is


the starting value of the list. The second parameter is the next value if
the list contains one more element. The third parameter is the increment
value.
overview of the python language 39

The keyword range can also be called with one parameter. It is matched
to “b” with the first parameter defaulting to 0 and the third to 1:
1 >>> range(5)
2 [0, 1, 2, 3, 4]
3 >>> range(53, 57)
4 [53, 54, 55, 56]
5 >>> range(102, 200, 10)
6 [102, 112, 122, 132, 142, 152, 162, 172, 182, 192]
7 >>> range(0, -10, -1)
8 [0, -1, -2, -3, -4, -5, -6, -7, -8, -9]

The keyword range is very convenient for iterating over a list of numbers.
This is equivalent to the C/C++/C#/Java syntax:
1 for(int i=0; i<4; i=i+1) { ... }

Another useful command is enumerate, which counts while looping and


returns a tuple consisting of (index, value):
1 >>> a = [0, 1, "hello", "python"]
2 >>> for (i, j) in enumerate(a): # the ( ) around i, j are optional
3 ... print(i, j)
4 0 0
5 1 1
6 2 hello
7 3 python

There is also a keyword range(a, b, c) that returns a list of integers start-


ing with the value a, incrementing by c, and ending with the last value
smaller than b, where a defaults to 0 and c defaults to 1.
You can jump out of a loop using break:
1 >>> for i in [1, 2, 3]:
2 ... print(i)
3 ... break
4 1

You can jump to the next loop iteration without executing the entire code
block with continue:
1 >>> for i in [1, 2, 3]:
2 ... print(i)
3 ... continue
4 ... print("test")
5 1
6 2
7 3
40 annotated algorithms in python

Python also supports list comprehensions, and you can build lists using
the following syntax:
1 >>> a = [i * i for i in [0, 1, 2, 3]:
2 >>> a
3 [0, 1, 4, 9]

Sometimes you may need a counter to “count” the elements of a list while
looping:
1 >>> a = [e * (i+1) for (i, e) in enumerate(["a", "b", "c", "d"])]
2 >>> a
3 ["a", "bb", "ccc", "dddd"]

2.3.2 while

Comparison operators in Python follow the C/C++/Java operators of ==


, !=, ..., and so on. However, Python also accepts the <> operator as not
equal to and is equivalent to !=. Logical operators are and, or, and not.
The while loop in Python works much as it does in many other program-
ming languages, by looping an indefinite number of times and testing a
condition before each iteration. If the condition is False, the loop ends:
1 >>> i = 0
2 >>> while i < 10:
3 ... i = i + 1
4 >>> i
5 10

The for loop was introduced earlier in this chapter.


There is no loop...until or do...while construct in Python.

2.3.3 if...elif...else

The use of conditionals in Python is intuitive:


1 >>> for i in range(3):
2 ... if i == 0:
3 ... print("zero")
4 ... elif i == 1:
5 ... print("one")
6 ... else:
7 ... print("other")
8 zero
9 one
overview of the python language 41

10 other

The elif means “else if.” Both elif and else clauses are optional. There
can be more than one elif but only one else statement. Complex condi-
tions can be created using the not, and, and or logical operators:
1 >>> for i in range(3):
2 ... if i == 0 or (i == 1 and i + 1 == 2):
3 ... print("0 or 1")

2.3.4 try...except...else...finally

Python can throw - pardon, raise - exceptions:


1 >>> try:
2 ... a = 1 / 0
3 ... except Exception, e:
4 ... print("oops: %s" % e)
5 ... else:
6 ... print("no problem here")
7 ... finally:
8 ... print("done")
9 oops: integer division or modulo by zero
10 done

If an exception is raised, it is caught by the except clause, and the else


clause is not executed. The finally clause is always executed.
There can be multiple except clauses for different possible exceptions:
1 >>> try:
2 ... raise SyntaxError
3 ... except ValueError:
4 ... print("value error")
5 ... except SyntaxError:
6 ... print("syntax error")
7 syntax error

The finally clause is guaranteed to be executed while the except and else
are not. In the following example, the function returns within a try block.
This is bad practice, but it shows that the finally will execute regardless
of the reason the try block is exited:
1 >>> def f(x):
2 ... try:
3 ... r = x * x
4 ... return r # bad practice
5 ... except:
42 annotated algorithms in python

6 ... print("exception occurred %s" % e


7 ... else:
8 ... print("nothing else to do")
9 ... finally:
10 ... print("Finally we get here")
11 ...
12 >>> y = f(3)
13 Finally we get here
14 >>> "result is ", y
15 result is 9

For every try, you must have either an except or a finally, while the else
is optional.
Here is a list of built-in Python exceptions:
1 BaseException
2 +-- SystemExit
3 +-- KeyboardInterrupt
4 +-- Exception
5 +-- GeneratorExit
6 +-- StopIteration
7 +-- StandardError
8 | +-- ArithmeticError
9 | | +-- FloatingPointError
10 | | +-- OverflowError
11 | | +-- ZeroDivisionError
12 | +-- AssertionError
13 | +-- AttributeError
14 | +-- EnvironmentError
15 | | +-- IOError
16 | | +-- OSError
17 | | +-- WindowsError (Windows)
18 | | +-- VMSError (VMS)
19 | +-- EOFError
20 | +-- ImportError
21 | +-- LookupError
22 | | +-- IndexError
23 | | +-- KeyError
24 | +-- MemoryError
25 | +-- NameError
26 | | +-- UnboundLocalError
27 | +-- ReferenceError
28 | +-- RuntimeError
29 | | +-- NotImplementedError
30 | +-- SyntaxError
31 | | +-- IndentationError
32 | | +-- TabError
33 | +-- SystemError
overview of the python language 43

34 | +-- TypeError
35 | +-- ValueError
36 | | +-- UnicodeError
37 | | +-- UnicodeDecodeError
38 | | +-- UnicodeEncodeError
39 | | +-- UnicodeTranslateError
40 +-- Warning
41 +-- DeprecationWarning
42 +-- PendingDeprecationWarning
43 +-- RuntimeWarning
44 +-- SyntaxWarning
45 +-- UserWarning
46 +-- FutureWarning
47 +-- ImportWarning
48 +-- UnicodeWarning

For a detailed description of each of these, refer to the official Python


documentation.
Any object can be raised as an exception, but it is good practice to raise
objects that extend one of the built-in exception classes.

2.3.5 def...return

Functions are declared using def. Here is a typical Python function:


1 >>> def f(a, b):
2 ... return a + b
3 >>> f(4, 2)
4 6

There is no need (or way) to specify the type of an argument(s) or the


return value(s). In this example, a function f is defined that can take two
arguments.
Functions are the first code syntax feature described in this chapter to
introduce the concept of scope, or namespace. In the preceding example,
the identifiers a and b are undefined outside of the scope of function f:
1 >>> def f(a):
2 ... return a + 1
3 >>> f(1)
4 2
5 >>> a
6 Traceback (most recent call last):
7 File "<pyshell#22>", line 1, in <module>
8 print(a)
44 annotated algorithms in python

9 NameError: name "a" is not defined

Identifiers defined outside of the function scope are accessible within the
function; observe how the identifier a is handled in the following code:
1 >>> a = 1
2 >>> def f(b):
3 ... return a + b
4 >>> f(1)
5 2
6 >>> a = 2
7 >>> f(1) # new value of a is used
8 3
9 >>> a = 1 # reset a
10 >>> def g(b):
11 ... a = 2 # creates a new local a
12 ... return a + b
13 >>> g(2)
14 4
15 >>> a # global a is unchanged
16 1

If a is modified, subsequent function calls will use the new value of the
global a because the function definition binds the storage location of the
identifier a, not the value of a itself at the time of function declaration;
however, if a is assigned-to inside function g, the global a is unaffected be-
cause the new local a hides the global value. The external-scope reference
can be used in the creation of closures:
1 >>> def f(x):
2 ... def g(y):
3 ... return x * y
4 ... return g
5 >>> doubler = f(2) # doubler is a new function
6 >>> tripler = f(3) # tripler is a new function
7 >>> quadrupler = f(4) # quadrupler is a new function
8 >>> doubler(5)
9 10
10 >>> tripler(5)
11 15
12 >>> quadrupler(5)
13 20

Function f creates new functions; note that the scope of the name g is
entirely internal to f. Closures are extremely powerful.
Function arguments can have default values and can return multiple re-
overview of the python language 45

sults as a tuple (notice the parentheses are optional and are omitted in the
example):
1 >>> def f(a, b=2):
2 ... return a + b, a - b
3 >>> x, y = f(5)
4 >>> x
5 7
6 >>> y
7 3

Function arguments can be passed explicitly by name; therefore the order


of arguments specified in the caller can be different from the order of
arguments with which the function was defined:
1 >>> def f(a, b=2):
2 ... return a + b, a - b
3 >>> x, y = f(b=5, a=2)
4 >>> x
5 7
6 >>> y
7 -3

Functions can also take a runtime-variable number of arguments. Param-


eters that start with * and ** must be the last two parameters. If the **
parameter is used, it must be last in the list. Extra values passed in will
be placed in the * identifier parameter, whereas named values will be
placed into the ** identifier. Notice that when passing values into the
function, the unnamed values must be before any and all named values:
1 >>> def f(a, b, * extra, ** extraNamed):
2 ... print("a = ", a)
3 ... print("b = ", b)
4 ... print("extra = ", extra)
5 ... print("extranamed = ", extraNamed)
6 >>> f(1, 2, 5, 6, x=3, y=2, z=6)
7 a = 1
8 b = 2
9 extra = (5, 6)
10 extranamed = {"y": 2, "x": 3, "z": 6}

Here the first two parameters (1 and 2) are matched with the parameters
a and b, while the tuple 5, 6 is placed into extra and the remaining items
(which are in a dictionary format) are placed into extraNamed.
In the opposite case, a list or tuple can be passed to a function that re-
46 annotated algorithms in python

quires individual positional arguments by unpacking them:


1 >>> def f(a, b):
2 ... return a + b
3 >>> c = (1, 2)
4 >>> f( * c)
5 3

and a dictionary can be unpacked to deliver keyword arguments:


1 >>> def f(a, b):
2 ... return a + b
3 >>> c = {"a":1, "b":2}
4 >>> f( ** c)
5 3

2.3.6 lambda

The keyword lambda provides a way to define a short unnamed function:


1 >>> a = lambda b: b + 2
2 >>> a(3)
3 5

The expression “lambda [a]:[b]” literally reads as “a function with argu-


ments [a] that returns [b].” The lambda expression is itself unnamed, but
the function acquires a name by being assigned to identifier a. The scop-
ing rules for def apply to lambda equally, and in fact, the preceding code,
with respect to a, is identical to the function declaration using def:
1 >>> def a(b):
2 ... return b + 2
3 >>> a(3)
4 5

The only benefit of lambda is brevity; however, brevity can be very conve-
nient in certain situations. Consider a function called map that applies a
function to all items in a list, creating a new list:
1 >>> a = [1, 7, 2, 5, 4, 8]
2 >>> map(lambda x: x + 2, a)
3 [3, 9, 4, 7, 6, 10]

This code would have doubled in size had def been used instead of lambda.
The main drawback of lambda is that (in the Python implementation) the
syntax allows only for a single expression; however, for longer functions,
def can be used, and the extra cost of providing a function name decreases
overview of the python language 47

as the length of the function grows.


Just like def, lambda can be used to curry functions: new functions can be
created by wrapping existing functions such that the new function carries
a different set of arguments:
1 >>> def f(a, b): return a + b
2 >>> g = lambda a: f(a, 3)
3 >>> g(2)
4 5

Python functions created with either def or lambda allow refactoring of


existing functions in terms of a different set of arguments.

2.4 Classes

Because Python is dynamically typed, Python classes and objects may


seem odd. In fact, member variables (attributes) do not need to be specif-
ically defined when declaring a class, and different instances of the same
class can have different attributes. Attributes are generally associated with
the instance, not the class (except when declared as “class attributes, ”
which is the same as “static member variables” in C++/Java).
Here is an example:
1 >>> class MyClass(object): pass
2 >>> myinstance = MyClass()
3 >>> [Link] = 3
4 >>> [Link]
5 3

Notice that pass is a do-nothing command. In this case, it is used to define


a class MyClass that contains nothing. MyClass() calls the constructor of
the class (in this case, the default constructor) and returns an object, an
instance of the class. The (object) in the class definition indicates that our
class extends the built-in object class. This is not required, but it is good
practice.
Here is a more involved class with multiple methods:
1 >>> class Complex(object):
2 ... z = 2
3 ... def __init__(self, real=0.0, imag=0.0):
4 ... [Link], [Link] = real, imag
48 annotated algorithms in python

5 ... def magnitude(self):


6 ... return ([Link] ** 2 + [Link] ** 2) ** 0.5
7 ... def __add__(self, other):
8 ... return Complex([Link]+[Link], [Link]+[Link])
9 >>> a = Complex(1, 3)
10 >>> b = Complex(2, 1)
11 >>> c = a + b
12 >>> [Link]()
13 5

Functions declared inside the class are methods. Some methods have
special reserved names. For example, __init__ is the constructor. In the
example, we created a class to store the real and the imag part of a complex
number. The constructor takes these two variables and stores them into
self (not a keyword but a variable that plays the same role as this in Java
and ( * this) in C++; this syntax is necessary to avoid ambiguity when
declaring nested classes, such as a class that is local to a method inside
another class, something Python allows but Java and C++ do not).
The self variable is defined by the first argument of each method. They
all must have it, but they can use another variable name. Even if we use
another name, the first argument of a method always refers to the object
calling the method. It plays the same role as the this keyword in Java and
C++.
Method __add__ is also a special method (all special methods start and
end in double underscore) and it overloads the + operator between self
and other. In the example, a+b is equivalent to a call to a.__add__(b), and
the __add__ method receives self=a and other=b.
All variables are local variables of the method, except variables declared
outside methods, which are called class variables, equivalent to C++ static
member variables, which hold the same value for all instances of the class.

2.4.1 Special methods and operator overloading


Class attributes, methods, and operators starting with a double under-
score are usually intended to be private (e.g., to be used internally but
not exposed outside the class), although this is a convention that is not
enforced by the interpreter.
overview of the python language 49

Some of them are reserved keywords and have a special meaning:


• __len__

• __getitem__

• __setitem__

They can be used, for example, to create a container object that acts like a
list:
1 >>> class MyList(object):
2 >>> def __init__(self, * a): self.a = list(a)
3 >>> def __len__(self): return len(self.a)
4 >>> def __getitem__(self, key): return self.a[key]
5 >>> def __setitem__(self, key, value): self.a[key] = value
6 >>> b = MyList(3, 4, 5)
7 >>> b[1]
8 4
9 >>> b.a[1] = 7
10 >>> b.a
11 [3, 7, 5]

Other special operators include __getattr__ and __setattr__, which define


the get and set methods (getters and setters) for the class, and __add__,
__sub__, __mul__, and __div__, which overload arithmetic operators. For

the use of these operators, we refer the reader to the chapter on linear
algebra, where they will be used to implement algebra for matrices.

2.4.2 class Financial Transaction


As one more example of a class, we implement a class that represents
a financial transaction. We can think of a simple transaction as a single
money transfer of quantity a that occurs at a given time t. We adopt
the convention that a positive amount represents money flowing in and a
negative value represents money flowing out.
The present value (computed at time t0 ) for a transaction occurring at
time t days from now of amount A is defined as

PV(t, A) = Ae−tr (2.2)

where r is the daily risk-free interest rate. If t is measured in days, r


has to be the daily risk-free return. Here we will assume it defaults to
50 annotated algorithms in python

r = 005/365 (5% annually).


Here is a possible implementation of the transaction:
1 from datetime import date
2 from math import exp
3 today = [Link]()
4 r_free = 0.05/365.0
5

6 class FinancialTransaction(object):
7 def __init__(self, t, a, description=''):
8 self.t= t
9 self.a = a
10 [Link] = description
11 def pv(self, t0=today, r=r_free):
12 return self.a * exp(r * (t0-self.t).days)
13 def __str__(self):
14 return "%.2f dollars in %i days (%s)" % \
15 (self.a, self.t, [Link])

Here we assume t and t0 are [Link] objects that store a date. The
date constructor takes the year, the month, and the day separated by a
comma. The expression (t0-t).days computes the distance in days be-
tween t0 and t.
Similarly, we can implement a Cash Flow class to store a list of transactions,
with the add method to add a new transaction to the list. The present value
of a cash flow is the sum of the present values of each transaction:
1 class CashFlow(object):
2 def __init__(self):
3 [Link] = []
4 def add(self, transaction):
5 [Link](transaction)
6 def pv(self, t0, r=r_free):
7 return sum([Link](t0, r) for x in [Link])
8 def __str__(self):
9 return "\n".join(str(x) for x in [Link])

What is the net present value at the beginning of 2012 for a bond that
pays $1000 the 20th of each month for the following 24 months (assuming
a fixed interest rate of 5% per year)?
1 >>> bond = CashFlow()
2 >>> today = date(2012, 1, 1)
3 >>> for year in range(2012, 2014):
4 ... for month in range(1, 13):
5 ... coupon = FinancialTransaction(date(year, month, 20), 1000)
overview of the python language 51

6 ... [Link](coupon)
7 >>> round([Link](today, r=0.05/365), 0)
8 22826

This means the cost for this bond should be $22, 826.

2.5 File input/output

In Python, you can open and write in a file with


1 >>> file = open("[Link]", "w")
2 >>> [Link]("hello world")
3 >>> [Link]()

Similarly, you can read back from the file with


1 >>> file = open("[Link]", "r")
2 >>> [Link]()
3 hello world

Alternatively, you can read in binary mode with “rb, ” write in binary
mode with “wb, ” and open the file in append mode “a” using standard
C notation.
The read command takes an optional argument, which is the number of
bytes. You can also jump to any location in a file using seek :
You can read back from the file with read:
1 >>> [Link](6)
2 >>> [Link]()
3 world

and you can close the file with:


1 >>> [Link]()

2.6 How to import modules

The real power of Python is in its library modules. They provide a large
and consistent set of application programming interfaces (APIs) to many
system libraries (often in a way independent of the operating system).
For example, if you need to use a random number generator, you can do
the following:
52 annotated algorithms in python

1 >>> import random


2 >>> [Link](0, 9)
3 5

This prints a random integer in the range of (0, 9], 5 in the example. The
function randint is defined in the module random. It is also possible to
import an object from a module into the current namespace:
1 >>> from random import randint
2 >>> randint(0, 9)

or import all objects from a module into the current namespace:


1 >>> from random import *
2 >>> randint(0, 9)

or import everything in a newly defined namespace:


1 >>> import random as myrand
2 >>> [Link](0, 9)

In the rest of this book, we will mainly use objects defined in modules
math, cmath, os, sys, datetime, time, and pickle. We will also use the random
module, but we will describe it in a later chapter.
In the following subsections, we consider those modules that are most
useful.

2.6.1 math and cmath


Here is a sampling of some of the methods available in the math and cmath
packages:
• [Link](x) returns true if the floating point number x is positive or
negative infinity
• [Link](x) returns true if the floating point number x is NaN; see
Python documentation or IEEE 754 standards for more information
• [Link](x) returns e ** x

• [Link](x[, base] returns the logarithm of x to the optional base; if


base is not supplied, e is assumed

• [Link](x), [Link](x), [Link](x) returns the cos, sin, tan of the


value of x; x is in radians
overview of the python language 53

• [Link], math.e are the constants for pi and e to available precision


• [Link](x) can be used to check if a number is infinity.

2.6.2 os

This module provides an interface for the operating system API:


1 >>> import os
2 >>> [Link]("..")
3 >>> [Link]("filename_to_be_deleted")

Some of the os functions, such as chdir, are not thread safe, for example,
they should not be used in a multithreaded environment.
[Link] very useful; it allows the concatenation of paths in an OS-
independent way:
1 >>> import os
2 >>> a = [Link]("path", "sub_path")
3 >>> a
4 path/sub_path

System environment variables can be accessed via


1 >>> [Link]

which is a read-only dictionary.

2.6.3 sys

The sys module contains many variables and functions, but used the most
is [Link]. It contains a list of paths where Python searches for modules.
When we try to import a module, Python searches the folders listed in
[Link]. If you install additional modules in some location and want
Python to find them, you need to append the path to that location to
[Link]:

1 >>> import sys


2 >>> [Link]("path/to/my/modules")

2.6.4 datetime

The use of the datetime module is best illustrated by some examples:


1 >>> import datetime
54 annotated algorithms in python

2 >>> [Link]()
3 2008-07-04 14:03:90
4 >>> [Link]()
5 2008-07-04

Occasionally you may need to time stamp data based on the UTC time as
opposed to local time. In this case, you can use the following function:
1 >>> import datetime
2 >>> [Link]()
3 2008-07-04 14:03:90

The datetimemodule contains various classes: date, datetime, time, and


timedelta. The difference between two dates or two datetimes or two time
objects is a timedelta:
1 >>> a = [Link](2008, 1, 1, 20, 30)
2 >>> b = [Link](2008, 1, 2, 20, 30)
3 >>> c = b - a
4 >>> [Link]
5 1

We can also parse dates and datetimes from strings:


1 >>> s = "2011-12-31"
2 >>> a = [Link](s, "%Y-%m-%d")
3 >>> [Link], [Link], [Link]
4 2011 31 12

Notice that “%Y” matches the four-digit year, “%m” matches the month as
a number (1–12), “%d” matches the day (1–31), “%H” matches the hour,
“%M” matches the minute, and “%S” matches the seconds. Check the
Python documentation for more options.

2.6.5 time

The time module differs from date and datetime because it represents time
as seconds from the epoch (beginning of 1970):
1 >>> import time
2 >>> t = [Link]()
3 1215138737.571

Refer to the Python documentation for conversion functions between time


in seconds and time as a datetime.
overview of the python language 55

2.6.6 urllib and json


The urllib is a module to download data or a web page from a URL:
1 >>> import [Link]
2 >>> page = [Link]("[Link]
3 >>> html = [Link]()

Many web services return data in JSON format. JSON is slowly replacing
XML as a favorite protocol for data transfer on the web. It is lighter,
simpler to use, and more human readable. JSON can be thought of as
serialized JavaScript. The JSON data can be converted to a Python object
using a library called json:
1 >>> import json
2 >>> a = [1, 2, 3]
3 >>> b = [Link](a)
4 >>> type(b)
5 <type 'str'>
6 >>> c = [Link](b)
7 >>> a == c
8 True

The module json has loads and dumps methods which work very much as
pickle"s methods, but they serialize the objects into a string using JSON
instead of the pickle protocol.

2.6.7 pickle

This is a very powerful module. It provides functions that can serialize


almost any Python object, including self-referential objects. For example,
let"s build a weird object:
1 >>> class MyClass(object): pass
2 >>> myinstance = MyClass()
3 >>> myinstance.x = "something"
4 >>> a = [1 , 2, {"hello":"world"}, [3, 4, [myinstance]]]

and now:
1 >>> import pickle
2 >>> b = [Link](a)
3 >>> c = [Link](b)

In this example, b is a string representation of a, and c is a copy of a


generated by deserializing b. The module pickle can also serialize to and
56 annotated algorithms in python

deserialize from a file:


1 >>> [Link](a, open("[Link]", "wb"))
2 >>> c = [Link](open("[Link]", "rb"))

2.6.8 sqlite

The Python dictionary type is very useful, but it lacks persistence because
it is stored in RAM (it is lost if a program ends) and cannot be shared by
more than one process running concurrently. Moreover, it is not transac-
tion safe. This means that it is not possible to group operations together
so that they succeed or fail as one.
Think for example of using the dictionary to store a bank account. The
key is the account number and the value is a list of transactions. We
want the dictionary to be safely stored on file. We want it to be accessible
by multiple processes and applications. We want transaction safety: it
should not be possible for an application to fail during a money transfer,
resulting in the disappearance of money.
Python provides a module called shelve with the same interface as dict,
which is stored on disk instead of in RAM. One problem with this module
is that the file is not locked when accessed. If two processes try to access
it concurrently, the data become corrupted. This module also does not
provide transactional safety.
The proper alternative consists of using a database. There are two types
of databases: relational databases (which normally use SQL syntax) and
non-relational databases (often referred to as NoSQL). Key-value persis-
tent storage databases usually follow under the latter category. Relational
databases excel at storing structured data (in the form of tables), estab-
lishing relations between rows of those tables, and searches involving
multiple tables linked by references. NoSQL databases excel at storing
and retrieving schemaless data and replication of data (redundancy for
fail safety).
Python comes with an embedded SQL database called SQLite [9]. All data
in the database are stored in one single file. It supports the SQL query
language and transactional safety. It is very fast and allows concurrent
overview of the python language 57

read (from multiple processes), although not concurrent write (the file
is locked when a process is writing to the file until the transaction is
committed). Concurrent write requests are queued and executed in order
when the database is unlocked.
Installing and using any of these database systems is beyond the scope of
this book and not necessary for our purposes. In particular, we are not
concerned with relations, data replications, and speed.
As an exercise, we are going to implement a new Python class called
PersistentDictionary that exposes an interface similar to a dict but uses
the SQLite database for storage. The database file is created if it does not
exist. PersistentDictionary will use a single table (also called persistence)
to store rows containing a key (pkey) and a value (pvalue).
For later convenience, we will also add a method that can generate a
UUID key. A UUID is a random string that is long enough to be, most
likely, unique. This means that two calls to the same function will return
different values, and the probability that the two values will be the same
is negligible. Python includes a library to generate UUID strings based
on a common industry standard. We use the function uuid4, which also
uses the time and the IP of the machine to generate the UUID. This means
the UUID is unlikely to have conflicts with (be equal to) another UUID
generated on other machines. The uuid method will be useful to generate
random unique keys.
We will also add a method that allows us to search for keys in the database
using GLOB patterns (in a GLOB pattern, “ * ” represents a generic wild-
card and “?” is a single-character wildcard).
Here is the code:

Listing 2.1: in file: [Link]


1 import os
2 import uuid
3 import sqlite3
4 import pickle
5 import unittest
6

7 class PersistentDictionary(object):
58 annotated algorithms in python

8 """
9 A sqlite based key, value storage.
10 The value can be any pickleable object.
11 Similar interface to Python dict
12 Supports the GLOB syntax in methods keys(), items(), __delitem__()
13

14 Usage Example:
15 >>> p = PersistentDictionary(path="[Link]")
16 >>> key = "test/" + [Link]()
17 >>> p[key] = {"a": 1, "b": 2}
18 >>> p[key]
19 {'a': 1, 'b': 2}
20 >>> len([Link]("test/*"))
21 1
22 >>> del p[key]
23 """
24

25 CREATE_TABLE = "CREATE TABLE persistence (pkey, pvalue)"


26 SELECT_KEYS = "SELECT pkey FROM persistence WHERE pkey GLOB ?"
27 SELECT_VALUE = "SELECT pvalue FROM persistence WHERE pkey GLOB ?"
28 INSERT_KEY_VALUE = "INSERT INTO persistence(pkey, pvalue) VALUES (?, ?)"
29 UPDATE_KEY_VALUE = "UPDATE persistence SET pvalue = ? WHERE pkey = ?"
30 DELETE_KEY_VALUE = "DELETE FROM persistence WHERE pkey LIKE ?"
31 SELECT_KEY_VALUE = "SELECT pkey, pvalue FROM persistence WHERE pkey GLOB ?"
32

33 def __init__(self,
34 path="[Link]",
35 autocommit=True,
36 serializer=pickle):
37 [Link] = path
38 [Link] = autocommit
39 [Link] = serializer
40 create_table = not [Link](path)
41 [Link] = [Link](path)
42 [Link].text_factory = str # do not use unicode
43 [Link] = [Link]()
44 if create_table:
45 [Link](self.CREATE_TABLE)
46 [Link]()
47
48 def uuid(self):
49 return str(uuid.uuid4())
50
51 def keys(self, pattern=" * "):
52 "returns a list of keys filtered by a pattern, * is the wildcard"
53 [Link](self.SELECT_KEYS, (pattern,))
54 return [row[0] for row in [Link]()]
55
56 def __contains__(self, key):
overview of the python language 59

57 return True if [Link](key)!=None else False


58

59 def __iter__(self):
60 for key in self:
61 yield key
62

63 def __setitem__(self, key, value):


64 if key in self:
65 if value is None:
66 del self[key]
67 else:
68 svalue = [Link](value)
69 [Link](self.UPDATE_KEY_VALUE, (svalue, key))
70 else:
71 svalue = [Link](value)
72 [Link](self.INSERT_KEY_VALUE, (key, svalue))
73 if [Link]: [Link]()
74
75 def get(self, key):
76 [Link](self.SELECT_VALUE, (key,))
77 row = [Link]()
78 return [Link](row[0]) if row else None
79
80 def __getitem__(self, key):
81 [Link](self.SELECT_VALUE, (key,))
82 row = [Link]()
83 if not row: raise KeyError
84 return [Link](row[0])
85
86 def __delitem__(self, pattern):
87 [Link](self.DELETE_KEY_VALUE, (pattern,))
88 if [Link]: [Link]()
89

90 def items(self, pattern=" * "):


91 [Link](self.SELECT_KEY_VALUE, (pattern,))
92 return [(row[0], [Link](row[1])) \
93 for row in [Link]()]
94

95 def dumps(self, pattern=" * "):


96 [Link](self.SELECT_KEY_VALUE, (pattern,))
97 rows = [Link]()
98 return [Link](dict((row[0], [Link](row[1])
)
99 for row in rows))
100

101 def loads(self, raw):


102 data = [Link](raw)
103 for key, value in [Link]():
104 self[key] = value
60 annotated algorithms in python

This code now allows us to do the following:


• Create a persistent dictionary:
1 >>> p = PersistentDictionary(path="[Link]", autocommit=False)

• Store data in it:


1 >>> p["some/key"] = "some value"

where “some/key” must be a string and “some value” can be any


Python pickleable object.
• Generate a UUID to be used as the key:
1 >>> key = [Link]()
2 >>> p[key] = "some other value"

• Retrieve the data:


1 >>> data = p["some/key"]

• Loop over keys:


1 >>> for key in p: print(key, p[key])

• List all keys:


1 >>> keys = [Link]()

• List all keys matching a pattern:


1 >>> keys = [Link]("some/ * ")

• List all key-value pairs matching a pattern:


1 >>> for key, value in [Link]("some/ * "): print(key, value)

• Delete keys matching a pattern:


1 >>> del p["some/ * "]

2.6.9 numpy

The library numpy [2] is the Python library for efficient arrays, multidimen-
sional arrays, and their manipulation. numpy does not ship with Python
and must be installed separately.
On most platforms, this is as easy as typing in the Bash Shell:
1 pip install numpy

Yet on other platforms, it can be a more lengthy process, and we leave it


overview of the python language 61

to the reader to find the best installation procedure.


The basic object in numpy is the ndarray (n-dimensional array). Here we
make a 10 × 4 × 3 array of 64 bits float:
1 >>> import numpy
2 >>> a = [Link]((10, 4, 3), dtype=numpy.float64)

The class ndarray is more efficient than Python"s list. It takes much less
space because their elements have a fixed given type (e.g., float64). Other
popular available types are: int8, int16, int32, int64, uint8, uint16, uint32,
uint64, float16, float32, float64, complex64, and complex128.
We can access elements:
1 >>> a[0, 0, 0] = 1
2 >>> a[0, 0, 0]
3 1.0

We can query for its size:


1 >>> [Link]
2 (10, 4, 3)

We can reshape its elements:


1 >>> b = [Link]((10, 12))
2 >>> [Link]
3 (10, 12)

We can map one type into another


1 >>> c = [Link](float32)

We can load and save them:


1 >>> [Link]("[Link]", a)
2 >>> b = [Link]("[Link]")

And we can perform operations on them (most operations are element-


wise operations):
1 >>> a = [Link]([[1, 2], [3, 4]]) # converts a list into a ndarray
2 >>> a
3 [[1 2]
4 [3 4]]
5 >>> a+1
6 [[2 3]
7 [4 5]]
8 >>> a+a
9 [[2 4]
62 annotated algorithms in python

10 [6 8]]
11 >>> a * 2
12 [[2 4]
13 [6 8]]
14 >>> a * a
15 [[ 1 4]
16 [ 9 16]]
17 >>> [Link](a)
18 [[ 2.71828183 7.3890561 ]
19 [ 20.08553692 54.59815003]]

The numpy module also implements common linear algebra operations:


1 >>> from numpy import dot
2 >>> from [Link] import inv
3 >>> dot(a, a)
4 [[ 7 10]
5 [15 22]]
6 >>> inv(a)
7 [[-2. 1. ]
8 [ 1.5 -0.5]]

These operations are particularly efficient because they are implemented


on top of the BLAS and LaPack libraries.
There are many other functions in the numpy module, and you can read
more about it in the official documentation.

2.6.10 matplotlib

Library matplotlib [10] is the de facto standard plotting library for Python.
It is one of the best and most versatile plotting libraries available. It has
two modes of operation. One mode of operation, called pylab, follows a
Matlab-like syntax. The other mode follows a more Python-style syntax.
Here we use the latter.
You can install matplotlib with
1 pip install matplotlib

and it requires numpy. In matplotlib, we need to distinguish the following


objects:
• Figure: a blank grid that can contain pairs of XY axes
• Axes: a pair of XY axes that may contain multiple superimposed plots
overview of the python language 63

• FigureCanvas: a binary representation of a figure with everything that


it contains
• plot: a representation of a data set such as a line plot or a scatter plot
In matplotlib, a canvas can be visualized in a window or serialized into
an image file. Here we take the latter approach and create two helper
functions that take data and configuration parameters and output PNG
images.
We start by importing matplotlib and other required libraries:

Listing 2.2: in file: [Link]


1 import math
2 import cmath
3 import random
4 import os
5 import tempfile
6 [Link]["MPLCONfigureDIR"] = [Link]()

Now we define a helper that can plot lines, points with error bars, his-
tograms, and scatter plots on a single canvas:

Listing 2.3: in file: [Link]


1 import io
2 from [Link] import Figure
3 from [Link].backend_agg import FigureCanvasAgg
4 from [Link] import Ellipse
5

6 class Canvas(object):
7

8 def __init__(self, title='', xlab="x", ylab="y", xrange=None, yrange=None):


9 [Link] = Figure()
10 [Link].set_facecolor("white")
11 [Link] = [Link].add_subplot(111)
12 [Link].set_title(title)
13 [Link].set_xlabel(xlab)
14 [Link].set_ylabel(ylab)
15 if xrange:
16 [Link].set_xlim(xrange)
17 if yrange:
18 [Link].set_ylim(yrange)
19 [Link] = []
20
21 def save(self, filename="[Link]"):
22 if [Link]:
64 annotated algorithms in python

23 legend = [Link]([e[0] for e in [Link]],


24 [e[1] for e in [Link]])
25 legend.get_frame().set_alpha(0.7)
26 if filename:
27 FigureCanvasAgg([Link]).print_png(open(filename, "wb"))
28 else:
29 s = [Link]()
30 FigureCanvasAgg([Link]).print_png(s)
31 return [Link]()
32

33 def binary(self):
34 return [Link](None)
35

36 def hist(self, data, bins=20, color="blue", legend=None):


37 q = [Link](data, bins)
38 #if legend:
39 # [Link]((q[0], legend))
40 return self
41

42 def plot(self, data, color="blue", style="-", width=2,


43 legend=None, xrange=None):
44 if callable(data) and xrange:
45 x = [xrange[0]+0.01 * i * (xrange[1]-xrange[0]) for i in range(0,
101)]
46 y = [data(p) for p in x]
47 elif data and isinstance(data[0], (int, float)):
48 x, y = range(len(data)), data
49 else:
50 x, y = [p[0] for p in data], [p[1] for p in data]
51 q = [Link](x, y, linestyle=style, linewidth=width, color=color)
52 if legend:
53 [Link]((q[0], legend))
54 return self
55
56 def errorbar(self, data, color="black", marker="o", width=2, legend=None):
57 x, y, dy = [p[0] for p in data], [p[1] for p in data], [p[2] for p in
data]
58 q = [Link](x, y, yerr=dy, fmt=marker, linewidth=width, color=
color)
59 if legend:
60 [Link]((q[0], legend))
61 return self
62
63 def ellipses(self, data, color="blue", width=0.01, height=0.01, legend=None)
:
64 for point in data:
65 x, y = point[:2]
66 dx = point[2] if len(point)>2 else width
67 dy = point[3] if len(point)>3 else height
overview of the python language 65

68 ellipse = Ellipse(xy=(x, y), width=dx, height=dy)


69 [Link].add_artist(ellipse)
70 ellipse.set_clip_box([Link])
71 ellipse.set_alpha(0.5)
72 ellipse.set_facecolor(color)
73 if legend:
74 [Link]((q[0], legend))
75 return self
76
77 def imshow(self, data, interpolation="bilinear"):
78 [Link](data).set_interpolation(interpolation)
79 return self

Notice we only make one set of axes.


The argument 111 of figure.add_subplot(111) indicates that we want a
grid of 1 × 1 axes, and we ask for the first one of them (the only one).
The linesets parameter is a list of dictionaries. Each dictionary must have
a “data” key corresponding to a list of ( x, y) values. Each dictionary is
rendered by a line connecting the points. It can have a “label, ” a “color,
” a “style, ” and a “width.”
The pointsets parameter is a list of dictionaries. Each dictionary must
have a “data” key corresponding to a list of ( x, y, δy) values. Each dictio-
nary is rendered by a set of circles with error bars. It can optionally have
a “label, ” a “color, ” and a “marker” (symbol to replace the circle).
The histsets parameter is a list of dictionaries. Each dictionary must
have a “data” key corresponding to a list of x values. Each dictionary is
rendered by histogram. Each dictionary can optionally have a “label” and
a “color.”
The ellisets parameter is also a list of dictionaries. Each dictionary must
have a “data” key corresponding to a list of ( x, y, δx, δy) values. Each
dictionary is rendered by a set of ellipses, one per point. It can optionally
have a “color.”
We chose to draw all these types of plots with a single function because it
is common to superimpose fitting lines to histograms, points, and scatter
plots.
As an example, we can plot a parabola 3 ∗ x ∗ ∗2 − 2 ∗ x + 5 in the interval
66 annotated algorithms in python

[-3, 3] using 100 points.

Listing 2.4: in file: [Link]


1 >>> parabola = lambda x: 3 * x ** 2 -2 * x + 5
2 >>> points = [(i * 3/50, parabola(i * 3/50)) for i in range(-50, 51)]
3 >>> Canvas(title="Parabola", xlab="x", ylab="y").plot(points).save("images/
[Link]")

Figure 2.1: Example of a line plot.

Here is an example of a histogram of 1000 random gaussian points with


mean 3 and standard deviation 5:

Listing 2.5: in file: [Link]


1 >>> points = [[Link](3, 5) for d in range(1000)]
2 >>> Canvas(title="Gaussian", xlab="arithmetic return", ylab="frequency").hist(
points).save("images/[Link]")

Here is a scatter plot for random data points:

Listing 2.6: in file: [Link]


1 >>> from random import gauss
2 >>> points = [(gauss(0, 1), gauss(0, 1), gauss(0, 0.2), gauss(0, 0.2))
3 ... for i in range(30)]
4 >>> Canvas(title="example scatter plot", xrange=(-2, 2), yrange=(-2, 2)
overview of the python language 67

Figure 2.2: Example of a histogram plot. Distribution of daily arithmetic returns for the
APPL stock in 2011 (source: Yahoo! Finance).

5 ... ).ellipses(points).save("images/[Link]")

Here is a scatter plot showing a spiral:

Listing 2.7: in file: [Link]


1 >>> points = [(r/20 * [Link](r/20), r/20 * [Link](r/20), 1.0, 1.0)
2 ... for r in range(1000)]
3 >>> Canvas(title="Spiral", xlab="x", ylab="y",
4 ... xrange=(-50, 50), yrange=(-50, 50),
5 ... ).ellipses(points).save("images/[Link]")

Listing 2.8: in file: [Link]


1 >>> def f(x, y): return (x-1) ** 2+(y-2) ** 2
2 >>> points = [[f(0.1 * i-3, 0.1 * j-3) for i in range(61)] for j in range(61)]
3 >>> Canvas(title="example 2d function").imshow(points).save("images/[Link]"
)

The class Canvas is both in [Link] and in the Python module canvas [11].
68 annotated algorithms in python

Figure 2.3: Example of a scatter plot using some random points.

Figure 2.4: Example of a scatter plot.


overview of the python language 69

Figure 2.5: Example of a two-dimensional color plot using for f ( x, y) = ( x − 1)2 + (y −


2)2 .
3
Theory of Algorithms

An algorithm is a step-by-step procedure for solving a problem and is


typically developed before doing any programming. The word comes
from algorism, from the mathematician al-Khwarizmi, and was used to
refer to the rules of performing arithmetic using Hindu–Arabic numerals
and the systematic solution of equations.
In fact, algorithms are independent of any programming language. Effi-
cient algorithms can have a dramatic effect on our problem-solving capa-
bilities.
The basic steps of algorithms are loops (for), conditionals (if), and func-
tion calls. Algorithms also make use of arithmetic expressions, logical ex-
pressions (not, and, or), and expressions that can be reduced to the other
basic components.
The issues that concern us when developing and analyzing algorithms are
the following:
1. Correctness: of the problem specification, of the proposed algorithm,
and of its implementation in some programming language (we will
not worry about the third one; program verification is another subject
altogether)
2. Amount of work done: for example, running time of the algorithm in
terms of the input size (independent of hardware and programming
72 annotated algorithms in python

language)
3. Amount of space used: here we mean the amount of extra space (sys-
tem resources) beyond the size of the input (independent of hardware
and programming language); we will say that an algorithm is in place
if the amount of extra space is constant with respect to input size
4. Simplicity, clarity: unfortunately, the simplest is not always the best in
other ways
5. Optimality: can we prove that it does as well as or better than any
other algorithm?

3.1 Order of growth of algorithms

The insertion sort is a simple algorithm in which an array of elements is


sorted in place, one entry at a time. It is not the fastest sorting algorithm,
but it is simple and does not require extra memory other than the memory
needed to store the input array.
The insertion sort works by iterating. Every iteration i of the insertion sort
removes one element from the input data and inserts it into the correct
position in the already-sorted subarray A[j] for 0 ≤ j < i. The algorithm
iterates n times (where n is the total size of the input array) until no input
elements remain to be sorted:
1 def insertion_sort(A):
2 for i in range(1, len(A)):
3 for j in range(i, 0, -1):
4 if A[j]<A[j-1]:
5 A[j], A[j-1] = A[j-1], A[j]
6 else: break

Here is an example:
1 >>> import random
2 >>> a=[[Link](0, 100) for k in range(20)]
3 >>> insertion_sort(a)
4 >>> a
5 [6, 8, 9, 17, 30, 31, 45, 48, 49, 56, 56, 57, 65, 66, 75, 75, 82, 89, 90, 99]

One important question is, how long does this algorithm take to run?
How does its running time scale with the input size?
theory of algorithms 73

Given any algorithm, we can define three characteristic functions:


• Tworst (n): the running time in the worst case
• Tbest (n): the running time in the best case
• Taverage (n): the running time in the average case
The best case for an insertion sort is realized when the input is already
sorted. In this case, the inner for loop exits (breaks) always at the first
iteration, thus only the most outer loop is important, and this is propor-
tional to n; therefore Tbest (n) ∝ n. The worst case for the insertion sort is
realized when the input is sorted in reversed order. In this case, we can
prove, and we do so subsequently, that Tworst (n) ∝ n2 . For this algorithm,
a statistical analysis shows that the worst case is also the average case.
Often we cannot determine exactly the running time function, but we may
be able to set bounds to the running time.
We define the following sets:
• O( g(n)): the set of functions that grow no faster than g(n) when n → ∞
• Ω( g(n)): the set of functions that grow no slower than g(n) when
n→∞
• Θ( g(n)): the set of functions that grow at the same rate as g(n) when
n→∞
• o ( g(n)): the set of functions that grow slower than g(n) when n → ∞
• ω ( g(n)): the set of functions that grow faster than g(n) when n → ∞
We can rewrite the preceding definitions in a more formal way:

O( g(n)) ≡ { f (n) : ∃n0 , c0 , ∀n > n0 , 0 ≤ f (n) < c0 g(n)} (3.1)


Ω( g(n)) ≡ { f (n) : ∃n0 , c0 , ∀n > n0 , 0 ≤ c0 g(n) < f (n)} (3.2)
Θ( g(n)) ≡ O( g(n)) ∩ Ω( g(n)) (3.3)
o ( g(n)) ≡ O( g(n)) − Ω( g(n)) (3.4)
ω ( g(n)) ≡ Ω( g(n)) − O( g(n)) (3.5)
74 annotated algorithms in python

We can also provide a practical rule to determine if a function f belongs


to one of the previous sets defined by g.
Compute the limit
f (n)
lim =a (3.6)
n→∞ g(n)
and look up the result in the following table:

a is positive or zero =⇒ f (n) ∈ O( g(n)) ⇔ f ⪯ g


a is positive or infinity =⇒ f (n) ∈ Ω( g(n)) ⇔ f ⪰ g
a is positive =⇒ f (n) ∈ Θ( g(n)) ⇔ f ∼ g (3.7)
a is zero =⇒ f (n) ∈ o ( g(n)) ⇔ f ≺ g
a is infinity =⇒ f (n) ∈ ω ( g(n)) ⇔ f ≻ g

Notice the preceding practical rule assumes the limits exist.


Here is an example:
Given f (n) = n log n + 3n and g(n) = n2

n log n + 3n l ′ Hopital 1/n


lim −→ lim =0 (3.8)
n→∞ n2 n→∞ 2

we conclude that n log n + 3n is in O(n2 ).


Given an algorithm A that acts on input of size n, we say that the algo-
rithm is O( g(n)) if its worst running time as a function of n is in O( g(n)).
Similarly, we say that the algorithm is in Ω( g(n)) if its best running time
is in Ω( g(n)). We also say that the algorithm is in Θ( g(n)) if both its best
running time and its worst running time are in Θ( g(n)).
More formally, we can write the following:

Tworst (n) ∈ O( g(n)) ⇒ A ∈ O( g(n)) (3.9)


Tbest (n) ∈ Ω( g(n)) ⇒ A ∈ Ω( g(n)) (3.10)
A ∈ O( g(n))andA ∈ O( g(n)) ⇒ A ∈ Θ( g(n)) (3.11)
(3.12)
theory of algorithms 75

We still have not solved the problem of computing the best, average, and
worst running times.

3.1.1 Best and worst running times


The procedure for computing the worst and best running times is simi-
lar. It is simple in theory but difficult in practice because it requires an
understanding of the algorithm"s inner workings.
Consider the following algorithm, which finds the minimum of an array
or list A:
1 def find_minimum(A):
2 minimum = a[0]
3 for element in A:
4 if element < minimum:
5 minimum = element
6 return minimum

To compute the running time in the worst case, we assume that the max-
imum number of computations is performed. That happens when the if
statements are always True. To compute the best running time, we assume
that the minimum number of computations is performed. That happens
when the if statement is always False. Under each of the two scenarios, we
compute the running time by counting how many times the most nested
operation is performed.
In the preceding algorithm, the most nested operation is the evaluation of
the if statement, and that is executed for each element in A; for example,
assuming A has n elements, the if statement will be executed n times.
Therefore both the best and worst running times are proportional to n,
thus making this algorithm O(n), Ω(n), and Θ(n).
More formally, we can observe that this algorithm performs the following
operations:
• One assignment (line 2)
• Loops n =len(A) times (line 3)
• For each loop iteration, performs one comparison (line 4)
76 annotated algorithms in python

• Line 5 is executed only if the condition is true


Because there are no nested loops, the time to execute each loop iteration
is about the same, and the running time is proportional to the number of
loop iterations.
For a loop iteration that does not contain further loops, the time it takes to
compute each iteration, its running time, is constant (therefore equal to 1).
For algorithms that contain nested loops, we will have to evaluate nested
sums.
Here is the simplest example:
1 def loop0(n):
2 for i in range(0, n):
3 print(i)

which we can map into

i <n
T (n) = ∑ 1 = n ∈ Θ(n) ⇒ loop0 ∈ Θ(n) (3.13)
i =0

Here is a similar example where we have a single loop (corresponding to


a single sum) that loops n2 times:
1 def loop1(n):
2 for i in range(0, n * n):
3 print(i)

and here is the corresponding running time formula:

i < n2
T (n) = ∑ 1 = n2 ∈ Θ(n2 ) ⇒ loop1 ∈ Θ(n2 ) (3.14)
i =0

The following provides an example of nested loops:


1 def loop2(n):
2 for i in range(0, n):
3 for j in range(0, n):
4 print(i, j)

Here the time for the inner loop is directly determined by n and does not
depend on the outer loop"s counter; therefore
theory of algorithms 77

i <n j<n i <n


T (n) = ∑ ∑ 1 = ∑ n = n2 + ... ∈ Θ(n2 ) ⇒ loop2 ∈ Θ(n2 ) (3.15)
i =0 j =0 i =0

This is not always the case. In the following code, the inner loop does
depend on the value of the outer loop:
1 def loop3(n):
2 for i in range(0, n):
3 for j in range(0, i):
4 print(i, j)

Therefore, when we write its running time in terms of a sum, care must
be taken that the upper limit of the inner sum is the upper limit of the
outer sum:

i < n j <i i <n


1
T (n) = ∑ ∑1= ∑ i = 2 n(n − 1) ∈ Θ(n2 ) ⇒ loop3 ∈ Θ(n2 ) (3.16)
i =0 j =0 i =0

The appendix of this book provides examples of typical sums that come
up in these types of formulas and their solutions.
Here is one more example falling in the same category, although the inner
loop depends quadratically on the index of the outer loop:
Example: loop4
1 def loop4(n):
2 for i in range(0, n):
3 for j in range(0, i * i):
4 print(i, j)

Therefore the formula for the running time is more complicated:

2
i < n j <i i <n
1
T (n) = ∑ ∑ 1 = ∑ i2 = 6 n(n − 1)(2n − 1) ∈ Θ(n3 ) (3.17)
i =0 j =0 i =0

⇒ loop4 ∈ Θ(n3 ) (3.18)


78 annotated algorithms in python

If the algorithm does not contain nested loops, then we need to compute
the running time of each loop and take the maximum:
Example: concatenate0
1 def concatenate0(n):
2 for i in range(n * n):
3 print(i)
4 for j in range(n * n * n):
5 print(j)

T (n) = Θ(max(n2 , n3 )) ⇒ concatenate0 ∈ Θ(n3 ) (3.19)

If there is an if statement, we need to compute the running time for each


condition and pick the maximum when computing the worst running
time, or the minimum for the best running time:
1 def concatenate1(n):
2 if a<0:
3 for i in range(n * n):
4 print(i)
5 else:
6 for j in range(n * n * n):
7 print(j)

Tworst (n) = Θ(max(n2 , n3 )) ⇒ concatenate1 ∈ O(n3 ) (3.20)

Tbest (n) = Θ(min(n2 , n3 )) ⇒ concatenate1 ∈ Ω(n2 ) (3.21)

This can be expressed more formally as follows:

O( f (n)) + Θ( g(n)) = Θ( g(n)) iff f (n) ∈ O( g(n)) (3.22)


Θ( f (n)) + Θ( g(n)) = Θ( g(n)) iff f (n) ∈ O( g(n)) (3.23)
Ω( f (n)) + Θ( g(n)) = Ω( f (n)) iff f (n) ∈ Ω( g(n)) (3.24)

which we can apply as in the following example:


T (n) = [n2 + n + 3 + en − log n] ∈ Θ(en ) because n2 ∈ O(en ) (3.25)
| {z } | {z }
Θ ( n2 ) Θ(en )
theory of algorithms 79

3.2 Recurrence relations

The merge sort [13] is another sorting algorithm. It is faster than the inser-
tion sort. It was invented by John von Neumann, the physicist credited
for inventing also modern computer architecture and game theory.
The merge sort works as follows.
If the input array has length 0 or 1, then it is already sorted, and the
algorithm does not perform any other operation.
If the input array has a length greater than 1, it divides the array into two
subsets of about half the size. Each subarray is sorted by applying the
merge sort recursively (it calls itself!). It then merges the two subarrays
back into one sorted array (this step is called merge).
Consider the following Python implementation of the merge sort:
1 def mergesort(A, p=0, r=None):
2 if r is None: r = len(A)
3 if p<r-1:
4 q = int((p+r)/2)
5 mergesort(A, p, q)
6 mergesort(A, q, r)
7 merge(A, p, q, r)
8

9 def merge(A, p, q, r):


10 B, i, j = [], p, q
11 while True:
12 if A[i]<=A[j]:
13 [Link](A[i])
14 i=i+1
15 else:
16 [Link](A[j])
17 j=j+1
18 if i == q:
19 while j<r:
20 [Link](A[j])
21 j=j+1
22 break
23 if j == r:
24 while i<q:
25 [Link](A[i])
26 i=i+1
27 break
28 A[p:r]=B
80 annotated algorithms in python

Because this algorithm calls itself recursively, it is more difficult to compute


its running time.
Consider the merge function first. At each step, it increases either i or j,
where i is always in between p and q and j is always in between q and r.
This means that the running time of the merge is proportional to the total
number of values they can span from p to r. This implies that

merge ∈ Θ(r − p) (3.26)

We cannot compute the running time of the mergesort function using the
same direct analysis, but we can assume its running time is T (n), where
n = r − p and n is the size of the input data to be sorted and also the dif-
ference between its two arguments p and r. We can express this running
time in terms of its components:
• It calls itself twice on half of the input data, 2T (n/2)
• It calls the merge once on the entire data, Θ(n)
We can summarize this into

T (n) = 2T (n/2) + n (3.27)

This is called a recurrence relation. We turned the problem of computing


the running time of the algorithm into the problem of solving the recur-
rence relation. This is now a math problem.
Some recurrence relations can be difficult to solve, but most of them fol-
low in one of these categories:
theory of algorithms 81

T (n) = aT (n − b) + Θ( f (n)) ⇒ T ∈ Θ(max ( an , n f (n))) (3.28)


T (n) = T (b) + T (n − b − a) + Θ( f (n)) ⇒ T ∈ Θ(n f (n)) (3.29)
m m m
T (n) = aT (n/b) + Θ(n ) ∧ a < b ⇒ T ∈ Θ(n ) (3.30)
T (n) = aT (n/b) + Θ(nm ) ∧ a = bm ⇒ T ∈ Θ(nm log n) (3.31)
m m logb a
T (n) = aT (n/b) + Θ(n ) ∧ a > b ⇒ T ∈ Θ(n ) (3.32)
m p m m p
T (n) = aT (n/b) + Θ(n log n) ∧ a < b ⇒ T ∈ Θ(n log n) (3.33)
T (n) = aT (n/b) + Θ(nm log p n) ∧ a = bm ⇒ T ∈ Θ(nm log p+1 n)(3.34)
T (n) = aT (n/b) + Θ(nm log p n) ∧ a > bm ⇒ T ∈ Θ(nlogb a ) (3.35)
n n
T (n) = aT (n/b) + Θ(q ) ⇒ T ∈ Θ(q ) (3.36)
T (n) = aT (n/a − b) + Θ( f (n)) ⇒ T ∈ Θ( f (n) log(n)) (3.37)
(they work for m ≥ 0, p ≥ 0, and q > 1).
These results are a practical simplification of a theorem known as the
master theorem [14].

3.2.1 Reducible recurrence relations


Other recurrence relations do not immediately fit one of the preceding
patterns, but often they can be reduced (transformed) to fit.
Consider the following recurrence relation:

T (n) = 2T ( n) + log n (3.38)

We can replace n with ek = n in eq. (3.38) and obtain


T (ek ) = 2T (ek/2 ) + k (3.39)
If we also replace T (ek ) with S(k ) = T (ek ), we obtain
S(k )= 2 S(k/2) +k (3.40)
|{z} | {z }
T (ek ) T (ek/2 )

so that we can now apply the master theorem to S. We obtain that S(k) ∈
Θ(k log k ). Once we have the order of growth of S, we can determine the
order of growth of T (n) by substitution:
82 annotated algorithms in python

T (n) = S(log n) ∈ Θ(log n log log n) (3.41)


| {z } | {z }
k k

Note that there are recurrence relations that cannot be solved with any of
the methods described.
Here are some examples of recursive algorithms and their corresponding
recurrence relations with solution:
1 def factorial1(n):
2 if n == 0:
3 return 1
4 else:
5 return n * factorial1(n-1)

T (n) = T (n − 1) + 1 ⇒ T (n) ∈ Θ(n) ⇒ factorial1 ∈ Θ(n) (3.42)

1 def recursive0(n):
2 if n == 0:
3 return 1
4 else:
5 loop3(n)
6 return n * n * recursive0(n-1)

T (n) = T (n − 1) + P2 (n) ⇒ T (n) ∈ Θ(n2 ) ⇒ recursive0 ∈ Θ(n3 ) (3.43)

1 def recursive1(n):
2 if n == 0:
3 return 1
4 else:
5 loop3(n)
6 return n * recursive1(n-1) * recursive1(n-1)

T (n) = 2T (n − 1) + P2 (n) ⇒ T (n) ∈ Θ(2n ) ⇒ recursive1 ∈ Θ(2n )


(3.44)
1 def recursive2(n):
2 if n == 0:
3 return 1
theory of algorithms 83

4 else:
5 a=factorial0(n)
6 return a * recursive2(n/2) * recursive1(n/2)

T (n) = 2T (n/2) + P1 (n) ⇒ T (n) ∈ Θ(n log n) ⇒ recursive2 ∈ Θ(n log n)


(3.45)
One example of practical interest for us is the binary search below. It finds
the location of the element in a sorted input array A:
1 def binary_search(A, element):
2 a, b = 0, len(A)-1
3 while b>=a:
4 x = int((a+b)/2)
5 if A[x]<element:
6 a = x+1
7 elif A[x]>element:
8 b = x-1
9 else:
10 return x
11 return None

Notice that this algorithm does not appear to be recursive, but in practice,
it is because of the apparently infinite while loop. The content of the while
loop runs in constant time and then loops again on a problem of half of
the original size:

T (n) = T (n/2) + 1 ⇒ binary_search ∈ Θ(log n) (3.46)

The idea of the binary_search is used in the bisection method for solving
nonlinear equations.
Do not confuse T notation with Θ notation:

Algorithm Recurrence Relationship Running time


Binary Search T (n) = T ( n2 ) + Θ(1) Θ(log(n))
Binary Tree Traversal T (n) = 2T ( n2 ) + Θ(1) Θ(n)
Optimal Sorted Matrix Search T (n) = 2T ( n2 ) + Θ(log(n)) Θ(n)
Merge Sort T (n) = T ( n2 ) + Θ(n) Θ(nlog(n))

The theta notation can also be used to describe the memory used by an
84 annotated algorithms in python

algorithm as a function of the input, Tmemory , as well as its running time.

3.3 Types of algorithms

Divide-and-conquer is a method of designing algorithms that (infor-


mally) proceeds as follows: given an instance of the problem to be solved,
split this into several, smaller sub-instances (of the same problem), in-
dependently solve each of the sub-instances and then combine the sub-
instance solutions to yield a solution for the original instance. This de-
scription raises the question, by what methods are the sub-instances to be
independently solved? The answer to this question is central to the con-
cept of the divide-and-conquer algorithm and is a key factor in gauging
their efficiency. The solution is unique for each problem.
The merge sort algorithm of the previous section is an example of a
divide-and-conquer algorithm. In the merge sort, we sort an array by
dividing it into two arrays and recursively sorting (conquering) each of
the smaller arrays.
Most divide-and-conquer algorithms are recursive, although this is not a
requirement.
Dynamic programming is a paradigm that is most often applied in the
construction of algorithms to solve a certain class of optimization prob-
lems, that is, problems that require the minimization or maximization of
some measure. One disadvantage of using divide-and-conquer is that
the process of recursively solving separate sub-instances can result in the
same computations being performed repeatedly because identical sub-
instances may arise. For example, if you are computing the path between
two nodes in a graph, some portions of multiple paths will follow the
same last few hops. Why compute the last few hops for every path when
you would get the same result every time?
The idea behind dynamic programming is to avoid this pathology by ob-
viating the requirement to calculate the same quantity twice. The method
usually accomplishes this by maintaining a table of sub-instance results.
We say that dynamic programming is a bottom-up technique in which the
theory of algorithms 85

smallest sub-instances are explicitly solved first and the results of these
are used to construct solutions to progressively larger sub-instances. In
contrast, we say that the divide-and-conquer is a top-down technique.
We can refactor the mergesort algorithm to eliminate recursion in the al-
gorithm implementation, while keeping the logic of the algorithm un-
changed. Here is a possible implementation:
1 def mergesort_nonrecursive(A):
2 blocksize, n = 1, len(A)
3 while blocksize<n:
4 for p in range(0, n, 2 * blocksize):
5 q = p+blocksize
6 r = min(q+blocksize, n)
7 if r>q:
8 Merge(A, p, q, r)
9 blocksize = 2 * blocksize

Notice that this has the same running time as the original mergesort be-
cause, although it is not recursive, it performs the same operations:

Tbest ∈ Θ(n log n) (3.47)


Taverage ∈ Θ(n log n) (3.48)
Tworst ∈ Θ(n log n) (3.49)
Tmemory ∈ Θ (1) (3.50)

Greedy algorithms work in phases. In each phase, a decision is made


that appears to be good, without regard for future consequences. Gen-
erally, this means that some local optimum is chosen. This “take what
you can get now” strategy is the source of the name for this class of algo-
rithms. When the algorithm terminates, we hope that the local optimum
is equal to the global optimum. If this is the case, then the algorithm is
correct; otherwise, the algorithm has produced a suboptimal solution. If
the best answer is not required, then simple greedy algorithms are some-
times used to generate approximate answers, rather than using the more
complicated algorithms generally required to generate an exact answer.
Even for problems that can be solved exactly by a greedy algorithm, es-
tablishing the correctness of the method may be a nontrivial process.
86 annotated algorithms in python

For example, computing change for a purchase in a store is a good case of


a greedy algorithm. Assume you need to give change back for a purchase.
You would have three choices:
• Give the smallest denomination repeatedly until the correct amount is
returned
• Give a random denomination repeatedly until you reach the correct
amount. If a random choice exceeds the total, then pick another de-
nomination until the correct amount is returned
• Give the largest denomination less than the amount to return repeat-
edly until the correct amount is returned
In this case, the third choice is the correct one.
Other types of algorithms do not fit into any of the preceding categories.
One is, for example, backtracking. Backtracking is not covered in this
course.

3.3.1 Memoization
One case of a top-down approach that is very general and falls under the
umbrella of dynamic programming is called memoization. Memoization
consists of allowing users to write algorithms using a naive divide-and-
conquer approach, but functions that may be called more than once are
modified so that their output is cached, and if they are called again with
the same initial state, instead of the algorithm running again, the output
is retrieved from the cache and returned without any computations.
Consider, for example, Fibonacci numbers:

Fib(0) = 0 (3.51)
Fib(1) = 1 (3.52)
Fib(n) = Fib(n − 1) + Fib(n − 2) for n > 1 (3.53)

which we can implement using divide-and-conquer as follows:


theory of algorithms 87

1 def fib(n):
2 return n if n<2 else fib(n-1)+fib(n-2)

The recurrence relation for this algorithm is T (n) = T (n − 1) + T (n − 2) +


1, and its solution can be proven to be exponential. This is because this
algorithm calls itself more than necessary with the same input values and
keeps solving the same subproblem over and over.
Python can implement memoization using the following decorator:

Listing 3.1: in file: [Link]


1 class memoize(object):
2 def __init__ (self, f):
3 self.f = f
4 [Link] = {}
5 def __call__ (self, * args, ** kwargs):
6 key = str((self.f.__name__, args, kwargs))
7 try:
8 value = [Link][key]
9 except KeyError:
10 value = self.f( * args, ** kwargs)
11 [Link][key] = value
12 return value

and simply decorating the recursive function as follows:

Listing 3.2: in file: [Link]


1 @memoize
2 def fib(n):
3 return n if n<2 else fib(n-1)+fib(n-2)

which we can call as

Listing 3.3: in file: [Link]


1 >>> fib(11)
2 89

A decorator is a Python function that takes a function and returns a


callable object (or a function) to replace the one passed as input. In the
previous example, we are using the @memoize decorator to replace the fib
function with the __call__ argument of the memoize class.
This makes the algorithm run much faster. Its running time goes from
exponential to linear. Notice that the preceding memoize decorator is very
general and can be used to decorate any other function.
88 annotated algorithms in python

One more direct dynamic programming approach consists in removing


the recursion:
1 def fib(n):
2 if n < 2: return n
3 a, b = 0, 1
4 for i in range(1, n):
5 a, b = b, a+b
6 return b

This also makes the algorithm linear and T (n) ∈ Θ(n).


Notice that we easily modify the memoization algorithm to store the
partial results in a shared space, for example, on disk using the
PersistentDictionary:

Listing 3.4: in file: [Link]


1 class memoize_persistent(object):
2 STORAGE = "[Link]"
3 def __init__ (self, f):
4 self.f = f
5 [Link] = PersistentDictionary(memoize_persistent.STORAGE)
6 def __call__ (self, * args, ** kwargs):
7 key = str((self.f.__name__, args, kwargs))
8 if key in [Link]:
9 value = [Link][key]
10 else:
11 value = self.f( * args, ** kwargs)
12 [Link][key] = value
13 return value

We can use it as we did before, but we can now start and stop the program
or run concurrent parallel programs, and as long as they have access to
the “[Link]” file, they will share the cache.

3.4 Timing algorithms

The order of growth is a theoretical concept. In practice, we need to


time algorithms to check if findings are correct and, more important, to
determine the magnitude of the constants in the T functions.
For example, consider this:
1 def f1(n):
2 return sum(g1(x) for x in range(n))
theory of algorithms 89

3
4 def f2(n):
5 return sum(g2(x) for x in range(n ** 2))

Since f1 is Θ(n) and f2 is Θ(n2 ), we may be led to conclude that the latter
is slower. It may very well be that g1 is 106 smaller than g2 and therefore
T f 1 (n) = c1 n, T f 2 (n) = c2 n2 , but if c1 = 106 c2 , then T f 1 (n) > T f 2 (n) when
n < 106 .
To time functions in Python, we can use this simple algorithm:
1 import time
2

3 def timef(f, ns=1000, dt = 60):


4 t = t0 = [Link]()
5 for k in range(1, ns):
6 f()
7 t = [Link]()
8 if t - t0 > dt: break
9 return (t - t0) / k

This function calls and averages the running time of f() for the minimum
between ns=1000 iterations and dt=60 seconds.
It is now easy, for example, to time the fib function without memoize,
1 >>> def fib(n):
2 ... return n if n<2 else fib(n-1)+fib(n-2)
3 >>> for k in range(15, 20):
4 ... print(k, timef(lambda:fib(k)))
5 15 0.000315684575338
6 16 0.000576375363706
7 17 0.000936052104732
8 18 0.00135168084153
9 19 0.00217730337912

and with memoize,


1 >>> @memoize
2 ... def fib(n):
3 ... return n if n<2 else fib(n-1)+fib(n-2)
4 >>> for k in range(15, 20):
5 ... print(k, timef(lambda:fib(k)))
6 15 4.24022311802e-06
7 16 4.02901146386e-06
8 17 4.21922128122e-06
9 18 4.02495429084e-06
10 19 3.73784963552e-06
90 annotated algorithms in python

The former shows an exponential behavior; the latter does not.

3.5 Data structures

3.5.1 Arrays
An array is a data structure in which a series of numbers are stored con-
tiguously in memory. The time to access each number (to read or write
it) is constant. The time to remove, append, or insert an element may
require moving the entire array to a more spacious memory location, and
therefore, in the worst case, the time is proportional to the size of the
array.
Arrays are the appropriate containers when the number of elements does
not change often and when elements have to be accessed in random order.

3.5.2 List
A list is a data structure in which data are not stored contiguously, and
each element has knowledge of the location of the next element (and per-
haps of the previous element, in a doubly linked list). This means that
accessing any element for (read and write) requires finding the element
and therefore looping. In the worst case, the time to find an element is
proportional to the size of the list. Once an element has been found, any
operation on the element, including read, write, delete, and insert, before
or after can be done in constant time.
Lists are the appropriate choice when the number of elements can vary
often and when their elements are usually accessed sequentially via iter-
ations.
In Python, what is called a list is actually an array of pointers to the
elements.

3.5.3 Stack
A stack data structure is a container, and it is usually implemented as a
list. It has the property that the first thing you can take out is the last thing
theory of algorithms 91

put in. This is commonly known as last-in, first-out, or LIFO. The method
to insert or add data to the container is called push, and the method to
extract data is called pop.
In Python, we can implement push by appending an item at the end of
a list (Python already has a method for this called .append), and we can
implement pop by removing the last element of a list and returning it
(Python has a method for this called .pop).
A simple stack example is as follows:
1 >>> stk = []
2 >>> [Link]("One")
3 >>> [Link]("Two")
4 >>> [Link]()
5 Two
6 >>> [Link]("Three")
7 >>> [Link]()
8 Three
9 >>> [Link]()
10 One

3.5.4 Queue
A queue data structure is similar to a stack but, whereas the stack returns
the most recent item added, a queue returns the oldest item in the list.
This is commonly called first-in, first-out, or FIFO. To use Python lists to
implement a queue, insert the element to add in the first position of the
list as follows:
1 >>> que = []
2 >>> [Link](0, "One")
3 >>> [Link](0, "Two")
4 >>> [Link]()
5 One
6 >>> [Link](0, "Three")
7 >>> [Link]()
8 Two
9 >>> [Link]()
10 Three

Lists in Python are not an efficient mechanism for implementing queues.


Each insertion or removal of an element at the front of a list requires
all the elements in the list to be shifted by one. The Python package
92 annotated algorithms in python

[Link] is designed to implement queues and stacks. For a


stack or queue, you use the same method .append to add items. For a
stack, .pop is used to return the most recent item added, while to build a
queue, use .popleft to remove the oldest item in the list:
1 >>> from collections import deque
2 >>> que = deque([])
3 >>> [Link]("One")
4 >>> [Link]("Two")
5 >>> [Link]()
6 One
7 >>> [Link]("Three")
8 >>> [Link]()
9 Two
10 >>> [Link]()
11 Three

3.5.5 Sorting
In the previous sections, we have seen the insertion sort and the merge sort.
Here we consider, as examples, other sorting algorithms: the quicksort [13],
the randomized quicksort, and the counting sort:
1 def quicksort(A, p=0, r=-1):
2 if r is -1:
3 r=len(A)
4 if p<r-1:
5 q=partition(A, p, r)
6 quicksort(A, p, q)
7 quicksort(A, q+1, r)
8
9 def partition(A, i, j):
10 x=A[i]
11 h=i
12 for k in range(i+1, j):
13 if A[k]<x:
14 h=h+1
15 A[h], A[k] = A[k], A[h]
16 A[h], A[i] = A[i], A[h]
17 return h

The running time of the quicksort is given by


theory of algorithms 93

Tbest ∈ Θ(n log n) (3.54)


Taverage ∈ Θ(n log n) (3.55)
2
Tworst ∈ Θ(n ) (3.56)
(3.57)

The quicksort can also be randomized by picking the pivot, A[r], at ran-
dom:
1 def quicksort(A, p=0, r=-1):
2 if r is -1:
3 r=len(A)
4 if p<r-1:
5 q = [Link](p, r-1)
6 A[p], A[q] = A[q], A[p]
7 q=partition(A, p, r)
8 quicksort(A, p, q)
9 quicksort(A, q+1, r)

In this case, the best and the worst running times do not change, but the
average improves when the input is already almost sorted.
The counting sort algorithm is special because it only works for arrays of
positive integers. This extra requirement allows it to run faster than other
sorting algorithms, under some conditions. In fact, this algorithm is linear
in the range span by the elements of the input array.
Here is a possible implementation:
1 def countingsort(A):
2 if min(A)<0:
3 raise "_counting_sort List Unbound"
4 i, n, k = 0, len(A), max(A)+1
5 C = [0] * k
6 for j in range(n):
7 C[A[j]] = C[A[j]]+1
8 for j in range(k):
9 while C[j]>0:
10 (A[i], C[j], i) = (j, C[j]-1, i+1)
94 annotated algorithms in python

If we define k = max ( A) − min( A) + 1 and n = len( A), we see

Tbest ∈ Θ(k + n) (3.58)


Taverage ∈ Θ(k + n) (3.59)
Tworst ∈ Θ(k + n) (3.60)
Tmemory ∈ Θ(k) (3.61)

Notice that here we have also computed Tmemory , for example, the order of
growth of memory (not of time) as a function of the input size. In fact, this
algorithm differs from the previous ones because it requires a temporary
array C.

3.6 Tree algorithms

3.6.1 Heapsort and priority queues


Consider a complete binary tree as the one in the following figure:

Figure 3.1: Example of a heap data structure. The number represents not the data in the
heap but the numbering of the nodes.

It starts from the top node, called the root. Each node has zero, one, or
two children. It is called complete because nodes have been added from
top to bottom and left to right, filling available slots. We can think of each
level of the tree as a generation, where the older generation consists of one
node, the next generation of two, the next of four, and so on. We can also
theory of algorithms 95

number nodes from top to bottom and left to right, as in the image. This
allows us to map the elements of a complete binary tree into the elements
of an array.
We can implement a complete binary tree using a list, and the child–
parent relations are given by the following formulas:
1 def heap_parent(i):
2 return int((i-1)/2)
3

4 def heap_left_child(i):
5 return 2 * i+1
6

7 def heap_right_child(i):
8 return 2 * i+2

We can store data (e.g., numbers) in the nodes (or in the corresponding
array). If the data are stored in such a way that the value at one node is
always greater or equal than the value at its children, the array is called a
heap and also a priority queue.
First of all, we need an algorithm to convert a list into a heap:
1 def heapify(A):
2 for i in range(int(len(A)/2)-1, -1, -1):
3 heapify_one(A, i)
4

5 def heapify_one(A, i, heapsize=None):


6 if heapsize is None:
7 heapsize = len(A)
8 left = 2 * i+1
9 right = 2 * i+2
10 if left<heapsize and A[left]>A[i]:
11 largest = left
12 else:
13 largest = i
14 if right<heapsize and A[right]>A[largest]:
15 largest = right
16 if largest!=i:
17 (A[i], A[largest]) = (A[largest], A[i])
18 heapify_one(A, largest, heapsize)

Now we can call build_heap on any array or list and turn it into a heap.
Because the first element is by definition the smallest, we can use the heap
to sort numbers in three steps:
• We turn the array into a heap
96 annotated algorithms in python

• We extract the largest element


• We apply recursion by sorting the remaining elements
Instead of using the preceding divide-and-conquer approach, it is better
to use a dynamic programming approach. When we extract the largest
element, we swap it with the last element of the array and make the heap
one element shorter. The new, shorter heap does not need a full build_heap
step because the only element out of order is the root node. We can fix
this by a single call to heapify.
This is a possible implementation for the heapsort [15]:
1 def heapsort(A):
2 heapify(A)
3 n = len(A)
4 for i in range(n-1, 0, -1):
5 (A[0], A[i]) = (A[i], A[0])
6 heapify_one(A, 0, i)

In the average and worst cases, it runs as fast as the quicksort, but in the
best case, it is linear:

Tbest ∈ Θ(n) (3.62)


Taverage ∈ Θ(n log n) (3.63)
Tworst ∈ Θ(n log n) (3.64)
Tmemory ∈ Θ (1) (3.65)

A heap can be used to implement a priority queue, for example, storage


from which we can efficiently extract the largest element.
All we need is a function that allows extracting the root element from a
heap (as we did in the heapsort and heapify of the remaining data) and a
function to push a new value into the heap:
1 def heap_pop(A):
2 if len(A)<1:
3 raise RuntimeError("Heap Underflow")
4 largest = A[0]
5 A[0] = A[len(A)-1]
6 del A[len(A)-1]
theory of algorithms 97

7 heapify_one(A, 0)
8 return largest
9

10 def heap_push(A, value):


11 [Link](value)
12 i = len(A)-1
13 while i>0:
14 j = heap_parent(i)
15 if A[j]<A[i]:
16 (A[i], A[j], i) = (A[j], A[i], j)
17 else:
18 break

The running times for heap_pop and heap_push are the same:

Tbest ∈ Θ (1) (3.66)


Taverage ∈ Θ(log n) (3.67)
Tworst ∈ Θ(log n) (3.68)
Tmemory ∈ Θ (1) (3.69)

Here is an example:
1 >>> a = [6, 2, 7, 9, 3]
2 >>> heap = []
3 >>> for element in a: heap_push(heap, element)
4 >>> while heap: print(heap_pop(heap))
5 9
6 7
7 6
8 3
9 2

Heaps find application in many numerical algorithms. In fact, there is


a built-in Python module for them called heapq, which provides similar
functionality to the functions defined here, except that we defined a max
heap (pops the max element) while heapq is a min heap (pops the mini-
mum):
1 >>> from heapq import heappop, heappush
2 >>> a = [6, 2, 7, 9, 3]
3 >>> heap = []
4 >>> for element in a: heappush(heap, element)
5 >>> while heap: print(heappop(heap))
6 9
98 annotated algorithms in python

7 7
8 6
9 3
10 2

Notice heappop instead of heap_pop and heappush instead of heap_push.

3.6.2 Binary search trees


A binary tree is a tree in which each node has at most two children (left
and right). A binary tree is called a binary search tree if the value of a node
is always greater than or equal to the value of its left child and less than
or equal to the value of its right child.
A binary search tree is a kind of storage that can efficiently be used for
searching if a particular value is in the storage. In fact, if the value for
which we are looking is less than the value of the root node, we only have
to search the left branch of the tree, and if the value is greater, we only
have to search the right branch. Using divide-and-conquer, searching each
branch of the tree is even simpler than searching the entire tree because it
is also a tree, but smaller.
This means that we can search simply by traversing the tree from top to
bottom along some path down the tree. We choose the path by moving
down and turning left or right at each node, until we find the element for
which we are looking or we find the end of the tree. We can search T (d),
where d is the depth of the tree. We will see later that it is possible to
build binary trees where d = log n.
To implement it, we need to have a class to represent a binary tree:
1 class BinarySearchTree(object):
2 def __init__(self):
3 [Link] = [Link] = None
4 [Link] = [Link] = None
5 def __setitem__(self, key, value):
6 if [Link] == None:
7 [Link], [Link] = key, value
8 elif key == [Link]:
9 [Link] = value
10 elif key < [Link]:
11 if [Link]:
12 [Link][key] = value
theory of algorithms 99

13 else:
14 [Link] = BinarySearchTree(key, value)
15 else:
16 if [Link]:
17 [Link][key] = value
18 else:
19 [Link] = BinarySearchTree(key, value)
20 def __getitem__(self, key):
21 if [Link] == None:
22 retur None
23 elif key == [Link]:
24 return [Link]
25 elif key<[Link] and [Link]:
26 return [Link][key]
27 elif key>[Link] and [Link]:
28 return [Link][key]
29 else:
30 return None
31 def min(self):
32 node = self
33 while [Link]:
34 node = [Link]
35 return [Link], [Link]
36 def max(self):
37 node = self
38 while [Link]:
39 node = [Link]
40 return [Link], [Link]

The binary tree can be used as follows:


1 >>> root = BinarySearchTree()
2 >>> root[5] = "aaa"
3 >>> root[3] = "bbb"
4 >>> root[8] = "ccc"
5 >>> [Link]
6 3
7 >>> [Link]
8 bbb
9 >>> root[3]
10 bbb
11 >>> [Link]()
12 8 ccc

Notice that an empty tree is treated as an exception, where key = None.

3.6.3 Other types of trees


There are many other types of trees.
100 annotated algorithms in python

For example, AVL trees are binary search trees that are rebalanced after
each insertion or deletion. They are rebalanced in such a way that for each
node, the height of the left subtree minus the height of the right subtree is
more or less the same. The rebalance operation can be done in O(log n).
For an AVL tree, the time for inserting or removing an element is given
by

Tbest ∈ Θ (1) (3.70)


Taverage ∈ Θ(log n) (3.71)
Tworst ∈ Θ(log n) (3.72)
(3.73)

Until now, we have considered binary trees (each node has two children
and stores one value). We can generalize this to k trees, for which each
node has k children and stores more than one value.
B-trees are a type of k-tree optimized to read and write large blocks of
data. They are normally used to implement database indices and are
designed to minimize the amount of data to move when the tree is rebal-
anced.

3.7 Graph algorithms

A graph G is a set of vertices V and a set of links (also called edges) con-
necting those vertices E. Each link connects one vertex to another.
As an example, you can think of a set of cities connected by roads. The
cities are the vertices and the roads are the links.
A link may have attributes. In the case of a road, it could be the name of
the road or its length.
In general, a link, indicated with the notation eij , connecting vertex i with
vertex j is called a directed link. If the link has no direction eij = e ji , it is
called an undirected link. A graph that contains only undirected links is
an undirected graph; otherwise, it is a directed graph.
theory of algorithms 101

In the road analogy, some roads can be “one way” (directed links) and
some can be “two way” (undirected links).
A walk is an alternating sequence of vertices and links, with each link
being incident to the vertices immediately preceding and succeeding it in
the sequence. A trail is a walk with no repeated links.
A path is a walk with no repeated vertices. A walk is closed if the initial
vertex is also the terminal vertex.
A cycle is a closed trail with at least one edge and with no repeated ver-
tices, except that the initial vertex is also the terminal vertex.
A graph that contains no cycles is an acyclic graph. Any connected acyclic
undirected graph is also a tree.
A loop is a one-link path connecting a vertex with itself.
A non null graph is connected if, for every pair of vertices, there is a walk
whose ends are the given vertices. Let us write i˜j if there is a path from
i to j. Then ˜ is an equivalence relation. The equivalence classes under ˜
are the vertex sets of the connected components of G. A connected graph
is therefore a graph with exactly one connected component.
A graph is called complete when every pair of vertices is connected by a
link (or edge).
A clique of a graph is a subset of vertices in which every pair is an edge.
The degree of a vertex of a graph is the number of edges incident to it.
If i and j are vertices, the distance from i to j, written dij , is the minimum
length of any path from i to j. In a connected undirected graph, the
length of links induces a metric because for every two vertices, we can
define their distance as the length of the shortest path connecting them.
The eccentricity, e(i ), of the vertex i is the maximum value of dij , where
j is allowed to range over all of the vertices of the graph. This gives the
largest shortest distance to any connected node in the graph.
The subgraph of G induced by a subset W of its vertices V (W ⊆ V) is the
graph formed by the vertices in W and all edges whose two endpoints are
102 annotated algorithms in python

in W.
The graph is the more complex of the data structures considered so far
because it includes the tree as a particular case (yes, a tree is also a graph,
but in general, a graph is not a tree), and the tree includes a list as a
particular case (yes, a list is a tree in which every node has no more than
one child); therefore a list is also a particular case of a graph.
The graph is such a general data structure that it can be used to model the
brain. Think of neurons as vertices and synapses as links connecting them.
We push this analogy later by implementing a simple neural network
simulator.
In what follows, we represent a graph in the following way, where links
are edges:
1 >>> vertices = ["A", "B", "C", "D", "E"]
2 >>> links = [(0, 1), (1, 2), (1, 3), (2, 5), (3, 4), (3, 2)]
3 >>> graph = (vertices, links)

Vertices are stored in a list or array and so are links. Each link is a tuple
containing the ID of the source vertex, the ID of the target vertex, and
perhaps optional parameters. Optional parameters are discussed later, but
for now, they may include link details such as length, speed, reliability, or
billing rate.

3.7.1 Breadth-first search


The breadth-first search [16] (BFS) is an algorithm designed to visit all
vertices in a connected graph. In the cities analogy, we are looking for a
travel strategy to make sure we visit every city reachable by roads, once
and only once.
The algorithm begins at one vertex, the origin, and expands out, eventu-
ally visiting each node in the graph that is somehow connected to the ori-
gin vertex. Its main feature is that it explores the neighbors of the current
vertex before moving on to explore remote vertices and their neighbors.
It visits other vertices in the same order in which they are discovered.
The algorithm starts by building a table of neighbors so that for each
theory of algorithms 103

vertex, it knows which other vertices it is connected to. It then maintains


two lists, a list of blacknodes (defined as vertices that have been visited)
and graynodes (defined as vertices that have been discovered because the
algorithm has visited its neighbor). It returns a list of blacknodes in the
order in which they have been visited.
Here is the algorithm:

Listing 3.5: in file: [Link]


1 def breadth_first_search(graph, start):
2 vertices, links = graph
3 blacknodes = []
4 graynodes = [start]
5 neighbors = [[] for vertex in vertices]
6 for link in links:
7 neighbors[link[0]].append(link[1])
8 while graynodes:
9 current = [Link]()
10 for neighbor in neighbors[current]:
11 if not neighbor in blacknodes+graynodes:
12 [Link](0, neighbor)
13 [Link](current)
14 return blacknodes

The BFS algorithm scales as follows:

Tbest ∈ Θ ( n E + nV ) (3.74)
Taverage ∈ Θ ( n E + nV ) (3.75)
Tworst ∈ Θ ( n E + nV ) (3.76)
Tmemory ∈ Θ(n) (3.77)

3.7.2 Depth-first search


The depth-first search [17] (DFS) algorithm is very similar to the BFS, but
it takes the opposite approach and explores as far as possible along each
branch before backtracking.
In the cities analogy, if the BFS was exploring cities in the neighborhood
before moving farther away, the DFS does the opposite and brings us first
to distant places before visiting other nearby cities.
Here is a possible implementation:
104 annotated algorithms in python

Listing 3.6: in file: [Link]


1 def depth_first_search(graph, start):
2 vertices, links = graph
3 blacknodes = []
4 graynodes = [start]
5 neighbors = [[] for vertex in vertices]
6 for link in links:
7 neighbors[link[0]].append(link[1])
8 while graynodes:
9 current = [Link]()
10 for neighbor in neighbors[current]:
11 if not neighbor in blacknodes+graynodes:
12 [Link](neighbor)
13 [Link](current)
14 return blacknodes

Notice that the BFS and the DFS differ by a single line, which determines
whether graynodes is a queue (BSF) or a stack (DFS). When graynodes is
a queue, the first vertex discovered is the first visited. When it is a stack,
the last vertex discovered is the first visited.
The DFS algorithm goes as follows:

Tbest ∈ Θ ( n E + nV ) (3.78)
Taverage ∈ Θ ( n E + nV ) (3.79)
Tworst ∈ Θ ( n E + nV ) (3.80)
Tmemory ∈ Θ (1) (3.81)

3.7.3 Disjoint sets


This is a data structure that can be used to store a set of sets and imple-
ments efficiently the join operation between sets. Each element of a set
is identified by a representative element. The algorithm starts by placing
each element in a set of its own, so there are n initial disjoint sets. Each
is represented by itself. When two sets are joined, the representative el-
ement of the latter is made to point to the representative element of the
former. The set of sets is stored as an array of integers. If at position i the
array stores a negative number, this number is interpreted as being the
representative element of its own set. If the number stored at position i is
instead a nonnegative number j, it means that it belongs to a set that was
joined with the set containing j.
theory of algorithms 105

Here is the implementation:

Listing 3.7: in file: [Link]


1 class DisjointSets(object):
2 def __init__(self, n):
3 [Link] = [-1] * n
4 [Link] = n
5 def parent(self, i):
6 while True:
7 j = [Link][i]
8 if j<0:
9 return i
10 i = j
11 def join(self, i, j):
12 i, j = [Link](i), [Link](j)
13 if i!=j:
14 [Link][i] += [Link][j]
15 [Link][j] = i
16 [Link]-=1
17 return True # they have been joined
18 return False # they were already joined
19 def joined(self, i, j):
20 return [Link](i) == [Link](j)
21 def __len__(self):
22 return [Link]

Notice that we added a member variable counter that is initialized to the


number of disjoint sets and is decreased by one every time two sets are
merged. This allows us to keep track of how many disjoint sets exist at
each time. We also override the __len__ operator so that we can check the
value of the counter using the len function on a DisjointSet.
As an example of application, here is a code that builds a nd maze. It may
be easier to picture it with d = 2, a two-dimensional maze. The algorithm
works by assuming there is a wall connecting any couple of two adjacent
cells. It labels the cells using an integer index. It puts all the cells into a
DisjointSets data structure and then keeps tearing down walls at random.
Two cells on the maze belong to the same set if they are connected, for
example, if there is a path that connects them. At the beginning, each
cell is its own set because it is isolated by walls. Walls are torn down by
being removed from the list wall if the wall was separating two disjoint
sets of cells. Walls are torn down until all cells belong to the same set, for
example, there is a path connecting any cell to any cell:
106 annotated algorithms in python

1 def make_maze(n, d):


2 walls = [(i, i+n ** j) for i in range(n ** 2) for j in range(d) if (i/n ** j
)%n+1<n]
3 torn_down_walls = []
4 ds = DisjointSets(n ** d)
5 [Link](walls)
6 for i, wall in enumerate(walls):
7 if [Link](wall[0], wall[1]):
8 torn_down_walls.append(wall)
9 if len(ds) == 1:
10 break
11 walls = [wall for wall in walls if not wall in torn_down_walls]
12 return walls, torn_down_walls

Here is an example of how to use it. This example also draws the walls
and the border of the maze:
1 >>> walls, torn_down_walls = make_maze(n=20, d=2)

The following figure shows a representation of a generated maze:

Figure 3.2: Example of a maze as generated using the DisjointSets algorithm.

3.7.4 Minimum spanning tree: Kruskal


Given a connected graph with weighted links (links with a weight or
length), a minimum spanning tree is a subset of that graph that connects
all vertices of the original graph, and the sum of the link weights is mini-
mal. This subgraph is also a tree because the condition of minimal weight
implies that there is only one path connecting each couple of vertices.
One algorithm to build the minimal spanning tree of a graph is the
theory of algorithms 107

Figure 3.3: Example of a minimum spanning tree subgraph of a larger graph. The
numbers on the links indicate their weight or length.

Kruskal [18] algorithm. It works by placing all vertices in a DisjointSets


structure and looping over links in order of their weight. If the link con-
nects two vertices belonging to different sets, the link is selected to be
part of the minimum spanning tree, and the two sets are joined, else the
link is ignored. The Kruskal algorithm assumes an undirected graph, for
example, all links are bidirectional, and the weight of a link is the same in
both directions:

Listing 3.8: in file: [Link]


1 def Kruskal(graph):
2 vertices, links = graph
3 A = []
4 S = DisjointSets(len(vertices))
5 [Link](cmp=lambda a, b: cmp(a[2], b[2]))
6 for source, dest, length in links:
7 if [Link](source, dest):
8 [Link]((source, dest, length))
9 return A

The Kruskal algorithm goes as follows:

Tworst ∈ Θ(n E log nV ) (3.82)


Tmemory ∈ Θ(n E ) (3.83)

We provide an example of application in the next subsection.


108 annotated algorithms in python

3.7.5 Minimum spanning tree: Prim


The Prim [19] algorithm solves the same problem as the Kruskal algo-
rithm, but the Prim algorithm works on a directed graph. It works by
placing all vertices in a minimum priority queue where the queue met-
ric for each vertex is the length, or weighted value, of a link connecting
the vertex to the closest known neighbor vertex. At each iteration, the
algorithm pops a vertex from the priority queue, loops over its neighbors
(adjacent links), and, if it finds that one of its neighbors is already in the
queue and it is possible to connect it to the current vertex using a shorter
link than the one connecting the neighbor to its current closest vertex, the
neighbor information is then updated. The algorithm loops until there
are no vertices in the priority queue.
The Prim algorithm also differs from the Kruskal algorithm because the
former needs a starting vertex, whereas the latter does not. The result
when interpreted as a subgraph does not depend on the starting vertex:

Listing 3.9: in file: [Link]


1 from heapq import heappush, heappop, heapify
2
3 class PrimVertex(object):
4 INFINITY = 1e100
5 def __init__(self, id, links):
6 [Link] = id
7 [Link] = None
8 self.closest_dist = [Link]
9 [Link] = [link[1:] for link in links if link[0] == id]
10 def __lt__(self, other):
11 return self.closest_dist < other.closest_dist
12

13 def Prim(graph, start):


14 vertices, links = graph
15 P = [PrimVertex(i, links) for i in vertices]
16 Q = [P[i] for i in vertices if not i == start]
17 vertex = P[start]
18 while Q:
19 for neighbor_id, length in [Link]:
20 neighbor = P[neighbor_id]
21 if neighbor in Q and length<neighbor.closest_dist:
22 [Link] = vertex
23 neighbor.closest_dist = length
24 heapify(Q)
theory of algorithms 109

25 vertex = heappop(Q)
26 return [([Link], [Link], v.closest_dist) for v in P if not [Link] == start
]
1 >>> vertices = range(10)
2 >>> links = [(i, j, abs([Link](i+j+1))) for i in vertices for j in vertices]
3 >>> graph = [vertices, links]
4 >>> link = Prim(graph, 0)
5 >>> for link in links: print(link)
6 (1, 4, 0.279...)
7 (2, 0, 0.141...)
8 (3, 2, 0.279...)
9 (4, 1, 0.279...)
10 (5, 0, 0.279...)
11 (6, 2, 0.412...)
12 (7, 8, 0.287...)
13 (8, 7, 0.287...)
14 (9, 6, 0.287...)

The Prim algorithm, when using a priority queue for Q, goes as follows:

Tworst ∈ Θ(n E + nV log nV ) (3.84)


Tmemory ∈ Θ(n E ) (3.85)

One important application of the minimum spanning tree is in evolution-


ary biology. Consider, for example, the DNA for the genes that produce
hemoglobin, a molecule responsible for the transport of oxygen in blood.
This protein is present in every animal, and the gene is also present in the
DNA of every known animal. Yet its DNA structure is a little different.
One can select a pool of animals and, for each two of them, compute the
similarity of the DNA of their hemoglobin genes using the lcs algorithm
discussed later. One can then link each two animals by a metric that rep-
resents how similar the two animals are. We can then run the Prim or
the Kruskal algorithm to find the minimum spanning tree. The tree rep-
resents the most likely evolutionary tree connecting those animal species.
Actually, three genes are responsible for hemoglobin (HBA1, HBA2, and
HBB). By performing the analysis on different genes and comparing the
results, it is possible to establish a consistency check of the results. [20]
Similar studies are performed routinely in evolutionary biology. They
can also be applied to viruses to understand how viruses evolved over
time. [21]
110 annotated algorithms in python

3.7.6 Single-source shortest paths: Dijkstra


The Dijkstra [22] algorithm solves a similar problem to the Kruskal and
Prim algorithms. Given a graph, it computes, for each vertex, the shortest
path connecting the vertex to a starting (or source, or root) vertex. The
collection of links on all the paths defines the single-source shortest paths.
It works, like Prim, by placing all vertices in a min priority queue where
the queue metric for each vertex is the length of the path connecting the
vertex to the source. At each iteration, the algorithm pops a vertex from
the priority queue, loops over its neighbors (adjacent links), and, if it
finds that one of its neighbors is already in the queue and it is possible
to connect it to the current vertex using a link that makes the path to the
source shorter, the neighbor information is updated. The algorithm loops
until there are no more vertices in the priority queue.
The implementation of this algorithm is almost identical to the Prim algo-
rithm, except for two lines:

Listing 3.10: in file: [Link]


1 from heapq import heappush, heappop, heapify
2

3 def Dijkstra(graph, start):


4 vertices, links = graph
5 P = [PrimVertex(i, links) for i in vertices]
6 Q = [P[i] for i in vertices if not i == start]
7 vertex = P[start]
8 vertex.closest_dist = 0
9 while Q:
10 for neighbor_id, length in [Link]:
11 neighbor = P[neighbor_id]
12 dist = length+vertex.closest_dist
13 if neighbor in Q and dist<neighbor.closest_dist:
14 [Link] = vertex
15 neighbor.closest_dist = dist
16 heapify(Q)
17 vertex = heappop(Q)
18 return [([Link], [Link], v.closest_dist) for v in P if not [Link] == start
]

Listing 3.11: in file: [Link]


1 >>> vertices = range(10)
2 >>> links = [(i, j, abs([Link](i+j+1))) for i in vertices for j in vertices]
3 >>> graph = [vertices, links]
theory of algorithms 111

4 >>> links = Dijkstra(graph, 0)


5 >>> for link in links: print(link)
6 (1, 2, 0.897...)
7 (2, 0, 0.141...)
8 (3, 2, 0.420...)
9 (4, 2, 0.798...)
10 (5, 0, 0.279...)
11 (6, 2, 0.553...)
12 (7, 2, 0.685...)
13 (8, 0, 0.412...)
14 (9, 0, 0.544...)

The Dijkstra algorithm goes as follows:

Tworst ∈ Θ(n E + nV log nV ) (3.86)


Tmemory ∈ Θ(n E ) (3.87)

An application of the Dijkstra is in solving a maze such as the one built


when discussing disjoint sets. To use the Dijkstra algorithm, we need to
generate a maze, take the links representing torn-down walls, and use
them to build an undirected graph. This is done by symmetrizing the
links (if i and j are connected, j and i are also connected) and adding to
each link a length (1, because all links connect next-neighbor cells):
1 >>> n, d = 4, 2
2 >>> walls, links = make_maze(n, d)
3 >>> symmetrized_links = [(i, j, 1) for (i, j) in links]+[(j, i, 1) for (i, j) in
links]
4 >>> graph = [range(n * n), symmetrized_links]
5 >>> links = Dijkstra(graph, 0)
6 >>> paths = dict((i, (j, d)) for (i, j, d) in links)

Given a maze cell i, path[i] gives us a tuple ( j, d) where d is the number


of steps for the shortest path to reach the origin (0) and j is the ID of the
next cell along this path. The following figure shows a generated maze
and a reconstructed path connecting an arbitrary cell to the origin:

3.8 Greedy algorithms

3.8.1 Huffman encoding


The Shannon–Fano encoding [23][24] (also known as minimal prefix code)
is a lossless data compression algorithm. In this encoding, each character
112 annotated algorithms in python

Figure 3.4: The result shows an application of the Dijkstra algorithm for the single
source shortest path applied to solve a maze.

in a string is mapped into a sequence of bits so characters that appear


with less frequency are encoded with a longer sequence of bits, whereas
characters that appear with more frequency are encoded with a shorter
sequence.
The Huffman encoding [25] is an implementation of the Shannon–Fano en-
coding, but the sequence of bits into which each character is mapped is
chosen such that the length of the compressed string is minimal. This
choice is constructed in the following way. We associate a tree with each
character in the string to compress. Each tree is a trivial tree containing
only one node: the root node. We then associate with the root node the
frequency of the character representing the tree. We then extract from the
list of trees the two trees with rarest or lowest frequency: t1 and t2. We
form a new tree, t3, we attach t1 and t2 to t3, and we associate a frequency
with t3 equal to the sum of the frequencies of t1 and t2. We repeat this
operation until the list of trees contains only one tree. At this point, we as-
sociate a sequence of bits with each node of the tree. Each bit corresponds
to one level on the tree. The more frequent characters end up being closer
to the root and are encoded with a few bits, while rare characters are far
from the root and encoded with more bits.
PKZIP, ARJ, ARC, JPEG, MPEG3 (mp3), MPEG4, and other compressed
file formats all use the Huffman coding algorithm for compressing strings.
theory of algorithms 113

Note that Huffman is a compression algorithm with no information loss.


In the JPEG and MPEG compression algorithms, Huffman algorithms are
combined with some form or cut of the Fourier spectrum (e.g., MP3 is an
audio compression format in which frequencies below 2 KHz are dumped
and not compressed because they are not audible). Therefore the JPEG
and MPEG formats are referred to as compression with information loss.
Here is a possible implementation of Huffman encoding using the Python
heapq library. Notice that in order for it to work properly, we need to wrap
the set of symbols they represent, and their relative frequency, into a class
HuffmanNode that implements the < (__lt__) operator.

Listing 3.12: in file: [Link]


1 from heapq import heappush, heappop
2

3 class HuffmanNode:
4 def __init__(self, frequency, content):
5 [Link] = frequency
6 [Link] = content
7 def __lt__(self, other):
8 return [Link] < [Link]
9 def unpack(self):
10 return [Link], [Link]
11

12 def encode_huffman(input):
13

14 def inorder_tree_walk(t, key, keys):


15 (f, ab) = t
16 if isinstance(ab, tuple):
17 inorder_tree_walk(ab[0], key+"0", keys)
18 inorder_tree_walk(ab[1], key+"1", keys)
19 else:
20 keys[ab] = key
21
22 symbols = {}
23 for symbol in input:
24 symbols[symbol] = [Link](symbol, 0)+1
25 heap = []
26 for (k, f) in [Link]():
27 heappush(heap, HuffmanNode(f, k))
28 while len(heap)>1:
29 (f1, k1) = heappop(heap).unpack()
30 (f2, k2) = heappop(heap).unpack()
31 heappush(heap, HuffmanNode(f1 + f2, ((f1, k1), (f2, k2))))
32 symbol_map = {}
114 annotated algorithms in python

33 root = heap[0].unpack()
34 inorder_tree_walk(root, '', symbol_map)
35 encoded = ''.join(symbol_map[symbol] for symbol in input)
36 return symbol_map, encoded
37

38 def decode_huffman(keys, encoded):


39 reversed_map = dict((v, k) for (k, v) in [Link]())
40 i, output = 0, []
41 for j in range(1, len(encoded)+1):
42 if encoded[i:j] in reversed_map:
43 [Link](reversed_map[encoded[i:j]])
44 i=j
45 return ''.join(output)

We can use it as follows:

Listing 3.13: in file: [Link]


1 >>> input = "this is a nice day"
2 >>> keys, encoded = encode_huffman(input)
3 >>> print(encoded)
4 00100101110011101100111011111000111100001111010000011110100
5 >>> decoded = decode_huffman(keys, encoded)
6 >>> decoded == input
7 True
8 >>> print(1.0 * len(input)/(len(encoded)/8))
9 2.44...

We managed to compress the original data by a factor 2.57.


We can ask how good is this compression factor. The maximum theo-
retical best compression factor is given by the Shannon entropy, defined
as

E = − ∑ wi log2 wi (3.88)
u

where wi is the relative frequency of each symbol. In our case, this is easy
to compute as

Listing 3.14: in file: [Link]


1 >>> from math import log
2 >>> input = "this is a nice day"
3 >>> w = [1.0 * [Link](c)/len(input) for c in set(input)]
4 >>> E = -sum(wi * log(wi, 2) for wi in w)
5 >>> print(E)
6 3.23...
theory of algorithms 115

How could we have done better? Notice for example that the Huffman
encoding does not take into account the order in which symbols appear.
The original string contains the triple “is” twice, and we could have taken
advantage of that pattern, but we did not.
Our choice of using characters as symbols is arbitrary. We could have
used a couple of characters as symbols or triplets or any other subse-
quences of bytes of the original input. We could also have used symbols
of different lengths for different parts of the input (we could have used a
single symbol for “is”). A different choice would have given a different
compression ratio, perhaps better, perhaps worse.

3.8.2 Longest common subsequence


Given two sequences of characters S1 and S2 , this is the problem of de-
termining the length of the longest common subsequence (LCS) that is a
subsequence of both S1 and S2 .
There are several applications for the LCS [26] algorithm:
• Molecular biology: DNA sequences (genes) can be represented as se-
quences of four letters ACGT, corresponding to the four sub-molecules
forming DNA. When biologists find a new sequence, they want to find
similar sequences or ones that are close. One way of computing how
similar two sequences are is to find the length of their LCS.
• File comparison: The Unix program diff is used to compare two dif-
ferent versions of the same file, to determine what changes have been
made to the file. It works by finding a LCS of the lines of the two
files and displays the set of lines that have changed. In this instance
of the problem, we should think of each line of a file as being a single
complicated character.
• Spelling correction: If some text contains a word, w, that is not in the
dictionary, a “close” word (e.g., one with a small edit distance to w)
may be suggested as a correction. Transposition errors are common in
written text. A transposition can be treated as a deletion plus an inser-
tion, but a simple variation on the algorithm can treat a transposition
116 annotated algorithms in python

as a single point mutation.


• Speech recognition: Algorithms similar to the LCS are used in some
speech recognition systems—find a close match between a new utter-
ance and one in a library of classified utterances.
Let"s start with some simple observations about the LCS problem. If we
have two strings, say, “ATGGCACTACGAT” and “ATCGAGC, ” we can
represent a subsequence as a way of writing the two so that certain letters
line up:
1 ATGGCACTACGAT
2 || | | |
3 ATCG AG C

From this we can observe the following simple fact: if the two strings start
with the same letter, it"s always safe to choose that starting letter as the
first character of the subsequence. This is because, if you have some other
subsequence, represented as a collection of lines as drawn here, you can
“push” the leftmost line to the start of the two strings without causing any
other crossings and get a representation of an equally long subsequence
that does start this way.
Conversely, suppose that, like in the preceding example, the two first
characters differ. Then it is not possible for both of them to be part of a
common subsequence. There are three possible choices: remove the first
letter from either one of the strings or remove the letter from both strings.
Finally, observe that once we"ve decided what to do with the first char-
acters of the strings, the remaining subproblem is again a LCS problem
on two shorter strings. Therefore we can solve it recursively. However,
because we don"t know which choice of the three to take, we will take
them all and see which choice returns the best result.
Rather than finding the subsequence itself, it turns out to be more efficient
to find the length of the longest subsequence. Then, in the case where
the first characters differ, we can determine which subproblem gives the
correct solution by solving both and taking the max of the resulting sub-
sequence lengths. Once we turn this into a dynamic programming algo-
rithm, we get the following:
theory of algorithms 117

Listing 3.15: in file: [Link]


1 def lcs(a, b):
2 previous = [0] * len(a)
3 for i, r in enumerate(a):
4 current = []
5 for j, c in enumerate(b):
6 if r == c:
7 e = previous[j-1]+1 if i * j>0 else 1
8 else:
9 e = max(previous[j] if i>0 else 0,
10 current[-1] if j>0 else 0)
11 [Link](e)
12 previous=current
13 return current[-1]

Here is an example:

Listing 3.16: in file: [Link]


1 >>> dna1 = "ATGCTTTAGAGGATGCGTAGATAGCTAAATAGCTCGCTAGA"
2 >>> dna2 = "GATAGGTACCACAATAATAAGGATAGCTCGCAAATCCTCGA"
3 >>> lcs(dna1, dna2)
4 26

The algorithms can be shown to be O(nm) (where m = len(a) and n =


len(b)).
Another application of this algorithm is in the Unix diff utility. Here is a
simple example to find the number of common lines between two files:
1 >>> a = open("[Link]").readlines()
2 >>> b = open("[Link]").readlines()
3 >>> lcs(a, b)

3.8.3 Needleman–Wunsch
With some minor changes to the LCS algorithm, we obtain the
Needleman–Wunsch algorithm [27], which solves the problem of global
sequence alignment. The changes are that, instead of using only two al-
ternating rows (c and d for storing the temporary results, we store all
temporary results in an array z; when two matching symbols are found
and they are not consecutive, we apply a penalty equal to pm , where m
is the distance between the two matches and is also the size of the gap in
the matching subsequence:
118 annotated algorithms in python

Listing 3.17: in file: [Link]


1 def needleman_wunsch(a, b, p=0.97):
2 z=[]
3 for i, r in enumerate(a):
4 [Link]([])
5 for j, c in enumerate(b):
6 if r == c:
7 e = z[i-1][j-1]+1 if i * j>0 else 1
8 else:
9 e = p * max(z[i-1][j] if i>0 else 0,
10 z[i][j-1] if j>0 else 0)
11 z[-1].append(e)
12 return z

This algorithm can be used to identify common subsequences of DNA


between chromosomes (or in general common similar subsequences be-
tween any two strings of binary data). Here is an example in which we
look for common genes in two randomly generated chromosomes:

Listing 3.18: in file: [Link]


1 >>> bases = "ATGC"
2 >>> from random import choice
3 >>> genes = [''.join(choice(bases) for k in range(10)) for i in range(20)]
4 >>> chromosome1 = ''.join(choice(genes) for i in range(10))
5 >>> chromosome2 = ''.join(choice(genes) for i in range(10))
6 >>> z = needleman_wunsch(chromosome1, chromosome2)
7 >>> Canvas(title="Needleman-Wunsch").imshow(z).save("images/[Link]")

The output of the algorithm is the following image:


The arrow-like patterns in the figure correspond to locations where
chromosome1 (Y coordinate) and where chromosome2 (X coordinate) have
DNA in common. Those are the places where the sequences are more
likely to be aligned for a more detailed comparison.
Both LCS and Needleman–Wunsch are available as optimized implemen-
tations in Biopython:
1 >>> from Bio import pairwise2
2 >>> alignments = [Link](chromosome1, chromosome2)
3 >>> print(alignments[0].score)

Alternatively, using NumPy to vectorize the Needleman–Wunsch DP ta-


ble:
1 >>> import numpy as np
2 >>> def needleman_wunsch_np(a, b, p=0.97):
theory of algorithms 119

Figure 3.5: A Needleman and Wunsch plot sequence alignment. The arrow-like patterns
indicate the point in the two sequences (represented by the X- and Y-coordinates) where
the two sequences are more likely to align.

3 ... z = [Link]((len(a), len(b)))


4 ... for i, r in enumerate(a):
5 ... for j, c in enumerate(b):
6 ... if r == c:
7 ... z[i, j] = z[i-1, j-1] + 1 if i*j > 0 else 1
8 ... else:
9 ... z[i, j] = p * max(z[i-1, j] if i > 0 else 0,
10 ... z[i, j-1] if j > 0 else 0)
11 ... return z

3.8.4 Continuous Knapsack


Assume you want to fill your knapsack such that you will maximize the
value of its contents [28]. However, you are limited by the volume your
knapsack can hold. In the continuous knapsack, the amount of each prod-
uct can vary continuously. In the discrete one, each product has a finite
size, and you either carry it or no.
The continuous knapsack problem can be formulated as the problem of
120 annotated algorithms in python

maximizing
f ( x ) = a0 x0 + a1 x1 + ... + an xn (3.89)

given the constraint

b0 x0 + b1 x1 + ... + bn xn ≤ c (3.90)

where coefficients ai , bi , and c are provided and xi ∈ [0, 1] are to be deter-


mined.
Using financial terms, we can say that
• The set { x0 , x1 , ..., xn } forms a portfolio
• bi is the cost of investment i
• c is the total investment capital available
• ai is the expected return of investment for investment i
• f ( x ) is the expected value of our portfolio { x0 , x1 , ..., xn }
Here is the solving algorithm:

Listing 3.19: in file: [Link]


1 def continuum_knapsack(a, b, c):
2 table = [(a[i]/b[i], i) for i in range(len(a))]
3 [Link]()
4 [Link]()
5 f=0.0
6 for (y, i) in table:
7 quantity = min(c/b[i], 1)
8 [Link]((i, quantity))
9 c = c-b[i] * quantity
10 f = f+a[i] * quantity
11 return (f, x)

This algorithm is dominated by the sort; therefore

Tworst ( x ) ∈ O(n log n) (3.91)

3.8.5 Discrete Knapsack


The discrete Knapsack problem is very similar to the continuous knapsack
problem but xi ∈ {0, 1} (can only be 0 or 1).
theory of algorithms 121

Consider the jars of liquids replaced with baskets of objects, say, a basket
each of gold bars, silver coins, copper beads, and Rolex watches. How
many of each item do you take? The discrete knapsack problem does
not consider “baskets of items” but rather all the items together. In this
example, dump out all the baskets and you have individual objects to
take. Which objects do you take, and which do you leave behind?
In this case, a greedy approach does not apply and the problem is, in
general, NP complete. This concept is defined formally later but it means
that there is no known algorithm that can solve this problem and that
its order of growth is a polynomial. The best known algorithm has an
exponential running time.
This kind of problem is unsolvable for large input.
If we assume that c and bi are all multiples of a finite factor ε, then it is
possible to solve the problem in O(c/ε). Even when there is not a finite
factor ε, we can always round c and bi to some finite precision ε, and we
can conclude that, for any finite precision ε, we can solve the problem in
linear time. The algorithm that solves this problem follows a dynamic
programming approach.
We can reformulate the problem in terms of a simple capital budgeting
problem. We have to invest $5M. We assume ε =$1M. We are in contact
with three investment firms. Each offers a number of investment oppor-
tunities characterized by an investment cost c[i, j] and an expected return
of investment r [i, j]. The index i labels the investment firm and the index j
labels the different investment opportunities offered by the firm. We have
to build a portfolio that maximizes the return of investment. We can-
not select more than one investment for each firm, and we cannot select
fractions of investments.
Without loss of generality, we will assume that

c[i, j] ≤ c[i, j + 1] and r [i, j] ≤ r [i, j + 1] (3.92)

which means that investment opportunities for each firm are sorted ac-
cording to their cost.
122 annotated algorithms in python

Consider the following explicit case:

Firm i=0 Firm i=1 Firm i=2


proposal c[0, j] r [0, j] c[1, j] r [1, j] c[2, j] r [2, j]
j=0 0 0 0 0 0 0
(Table 1)
j=1 1 5 2 8 1 4
j=2 2 6 3 9 - -
j=3 - - 4 12 - -

(table values are always multiples of ε =$1M).


Notice that we can label each possible portfolio by a triplet { j0 , j1 , j2 }.
A straightforward way to solve this is to try all possibilities and choose
the best. In this case, there are only 3 × 4 × 2 = 24 possible portfolios.
Many of these are infeasible (e.g., portfolio {2, 3, 0} costs $6M and we
cannot afford it). Other portfolios are feasible but very poor (like portfolio
{0, 0, 1}, which is feasible but returns only $4M).
Here are some disadvantages of total enumeration:
• For larger problems, the enumeration of all possible solutions may not
be computationally feasible.
• Infeasible combinations may not be detectable a priori, leading to inef-
ficiency.
• Information about previously investigated combinations is not used
to eliminate inferior or infeasible combinations (unless we use mem-
oization, but in this case the algorithm would grow polynomially in
memory space).
We can, instead, use a dynamic programming approach.
We break the problem into three stages, and at each stage, we fill a ta-
ble of optimal investments for each discrete amount of money. At each
stage i, we only consider investments from firm i and the table during the
previous stage.
So stage 0 represents the money allocated to firm 0, stage 1 the money to
firm 1, and stage 2 the money to firm 2.
theory of algorithms 123

STAGE ZERO: we maximize the return of investment considering only


offers from firm 0. We fill a table f [0, k ] with the maximum return of
investment if we invest k million dollars in firm 0:

f [0, k ] = max r [0, j] (3.93)


j|c[0,j]<k

k f [0, k ]
0 0
1 5
2∗ 6∗
3 6
4 6
5 6

STAGE TWO: we maximize the return of investment considering offers


from firm 1 and the prior table. We fill a table f [1, k] with the maximum
return of investment if we invest k million dollars in firm 0 and firm 1:

f [1, k ] = max r [1, j] + f [0, k − c[0, j]] (3.94)


j|c[1,j]<k

k c[2, j] f [0, k − c[0, j]] f [1, k ]


0 0 0 0
1 0 1 5
2 2 0 8
3 2 1 9
4 3 1 13
5∗ 4∗ 1∗ 18∗

STAGE THREE: we maximize the return of investment considering offers


from firm 2 and the preceding table. We fill a table f [2, k ] with the maxi-
mum return of investment if we invest k million dollars in firm 0, firm 1,
and firm 2:
f [2, k ] = max r [2, j] + f [1, k − c[1, j]] (3.95)
j|c[2,j]<k
124 annotated algorithms in python

k c[2, j] f [1, k − c[1, j]] f [2, k ]


0 0 0 0
1 0 1 5
2 2 0 8
3 2 1 9
4 1 3 13
5∗ 2∗ 3∗ 18∗
The maximum return of investment with $5M is therefore $18M. It can
be achieved by investing $2M in firm 2 and $3M in firms 0 and 1. The
optimal choice is marked with a star in each table. Note that to determine
how much money has to be allocated to maximize the return of invest-
ment requires storing past tables to be able to look up the solution to
subproblems.
We can generalize eq.(3.94) and eq.(3.95) for any number of investment
firms (decision stages):

f [i, k ] = max r [i, j] + f [i − 1, k − c[i − 1, j]] (3.96)


j|c[i,j]<k

3.9 Artificial intelligence and machine learning

3.9.1 Clustering algorithms


There are many algorithms available to cluster data [29]. They are all
based on empirical principles because the clusters themselves are defined
by the algorithm used to identify them. Normally we distinguish three
categories:
• Hierarchical clustering: These algorithms start by considering each point
a cluster of its own. At each iteration, the two clusters closest to each
other are joined together, forming a larger cluster. Hierarchical cluster-
ing algorithms differ from each other about the rule used to determine
the distance between clusters. The algorithm returns a tree represent-
ing the clusters that are joined, called a dendrogram.
theory of algorithms 125

• Centroid-based clustering: These algorithms require that each point be


represented by a vector and each cluster also be represented by a vector
(centroid of the cluster). With each iteration, a better estimation for
the centroids is given. An example of centroid-based clustering is k-
means clustering. These algorithms require an a priori knowledge of
the number of clusters and return the position of the centroids as well
the set of points belonging to each cluster.
• Distribution-based clustering: These algorithms are based on statistics
(more than the other two categories). They assume the points are gen-
erated from a distribution (which must be known a priori) and deter-
mine the parameters of the distribution. It provides clustering because
the distribution may be a sum of more than one localized distribution
(each being a cluster).
Both k-means and distribution-based clustering assume an a priori knowl-
edge about the data that often defies the purpose of using clustering: learn
something we do not know about the data using an empirical algorithm.
They also require that the points be represented by vectors in a Euclidean
space, which is not always the case. Consider the case of clustering DNA
sequences or financial time series. Technically the latter can be presented
as vectors, but their dimensionality can be very large, thus making the
algorithms impractical.
Hierarchical clustering only requires the notion of a distance between
points, for some of the points.
The following algorithm is a hierarchical clustering algorithm with the
following characteristics:
• Individual points do not need to be vectors (although they can be).
• Points may have a weight used to determine their relative importance
in identifying the characteristics of the cluster (think of clustering finan-
cial assets based on the time series of their returns; the weight could
the average traded volume).
• The distance between points is computed by a metric function provided
by the user. The metric can return None if there is no known connection
126 annotated algorithms in python

Figure 3.6: Example of a dendrogram.

between two points.


• The algorithm can be used to build the entire dendrogram , or it can stop
for a given value of k, a target number of clusters.
• For points that are vectors and a given k, the result is similar to the
result of the k-means clustering.
The algorithm works like any other hierarchical clustering algorithm. At
the beginning, all-to-all distances are computed and stored in a list d. Each
point is its own cluster. At each iteration, the two clusters closer together
are merged to form one bigger cluster. The distance between each other
cluster and the merged cluster is computed by performing a weighted
average of the distances between the other cluster and the two merged
clusters. The weight factors are provided as input. This is equivalent to
what the k-means algorithm does by computing the position of a centroid
based on the vectors of the member points.
The algorithm self.q implements disjointed sets representing the set of
clusters. The algorithm self.q is a dictionary. If self.q[i] is a list, then i
is its own cluster, and the list contains the IDs of the member points. If
theory of algorithms 127

self.q[i]is an integer, then cluster i is no longer its own cluster as it was


merged to the cluster represented by the integer.
At each point in time, each cluster is represented by one element, which
can be found recursively by [Link](i). This function returns the ID
of the cluster containing element i and returns a list of IDs of all points
in the same cluster:

Listing 3.20: in file: [Link]


1 class Cluster(object):
2 def __init__(self, points, metric, weights=None):
3 [Link], [Link] = points, metric
4 self.k = len(points)
5 self.w = weights or [1.0] * self.k
6 self.q = dict((i, [i]) for i, e in enumerate(points))
7 self.d = []
8 for i in range(self.k):
9 for j in range(i+1, self.k):
10 m = metric(points[i], points[j])
11 if not m is None:
12 [Link]((m, i, j))
13 [Link]()
14 [Link] = []
15 def parent(self, i):
16 while isinstance(i, int): (parent, i) = (i, self.q[i])
17 return parent, i
18 def step(self):
19 if self.k>1:
20 # find new clusters to join
21 (self.r, i, j), self.d = self.d[0], self.d[1:]
22 # join them
23 i, x = [Link](i) # find members of cluster i
24 j, y = [Link](j) # find members if cluster j
25 x += y # join members
26 self.q[j] = i # make j cluster point to i
27 self.k -= 1 # decrease cluster count
28 # update all distances to new joined cluster
29 new_d = [] # links not related to joined clusters
30 old_d = {} # old links related to joined clusters
31 for (r, h, k) in self.d:
32 if h in (i, j):
33 a, b = old_d.get(k, (0.0, 0.0))
34 old_d[k] = a+self.w[k] * r, b+self.w[k]
35 elif k in (i, j):
36 a, b = old_d.get(h, (0.0, 0.0))
37 old_d[h] = a+self.w[h] * r, b+self.w[h]
38 else:
128 annotated algorithms in python

39 new_d.append((r, h, k))
40 new_d += [(a/b, i, k) for k, (a, b) in old_d.items()]
41 new_d.sort()
42 self.d = new_d
43 # update weight of new cluster
44 self.w[i] = self.w[i]+self.w[j]
45 # get new list of cluster members
46 self.v = [s for s in [Link]() if isinstance(s, list)]
47 [Link]((self.r, len(self.v)))
48 return self.r, self.v
49

50 def find(self, k):


51 # if necessary start again
52 if self.k<k: self.__init__([Link], [Link])
53 # step until we get k clusters
54 while self.k>k: [Link]()
55 # return list of cluster members
56 return self.r, self.v

Given a set of points, we can determine the most likely number of clusters
representing the data, and we can make a plot of the number of clusters
versus distance and look for a plateau in the plot. In correspondence with
the plateau, we can read from the y-coordinate the number of clusters.
This is done by the function cluster in the preceding algorithm, which
returns the average distance between clusters and a list of clusters.
For example:

Listing 3.21: in file: [Link]


1 >>> def metric(a, b):
2 ... return [Link](sum((x-b[i]) ** 2 for i, x in enumerate(a)))
3 >>> points = [[[Link](i % 5, 0.3) for j in range(10)] for i in range(200)]
4 >>> c = Cluster(points, metric)
5 >>> r, clusters = [Link](1) # cluster all points until one cluster only
6 >>> Canvas(title="clustering example", xlab="distance", ylab="number of clusters
"
7 ... ).plot([Link][150:]).save("[Link]")
8 >>> Canvas(title="clustering example (2d projection)", xlab="p[0]", ylab="p[1]"
9 ... ).ellipses([p[:2] for p in points]).save("[Link]")

The same clustering can be performed using scipy:


1 >>> import numpy as np
2 >>> from [Link] import linkage, fcluster
3 >>> from [Link] import pdist
4 >>> points = [Link]([[[Link](i % 5, 0.3) for j in range(10)]
5 ... for i in range(200)])
theory of algorithms 129

6 >>> Z = linkage(points, method='weighted')


7 >>> clusters = fcluster(Z, t=5, criterion='maxclust')

With our sample data, we obtain the following plot (“[Link]”):

Figure 3.7: Number of clusters found as a function of the distance cutoff.

and the location where the curve bends corresponds to five clusters. Al-
though our points live in 10 dimensions, we can try to project them into
two dimensions and see the five clusters (“[Link]”):

3.9.2 Neural network


An artificial neural network is an electrical circuit (usually simulated in
software) that mimics the functionality of the neurons in the animal (and
human) brain [30]. It is usually employed in pattern recognition. The net-
work consists of a set of simulated neurons, connected by links (synapses).
Some links connect the neurons with each other, some connect the neu-
rons with the input and some with the output. Neurons are usually or-
ganized in the layers with one input layer of neurons connected only with
the input and the next layer. Another one, the output layer, comprises neu-
rons connected only with the output and previous layers, or many hidden
130 annotated algorithms in python

Figure 3.8: Visual representation of the clusters where the points coordinates are pro-
jected in 2D.

layers of neurons connected only with other neurons. Each neuron is char-
acterized by input links and output links. Each output of a neuron is a
function of its inputs. The exact shape of that function depends on the
network and on parameters that can be adjusted. Usually this function is
chosen to be a monotonic increasing function on the sum of the inputs,
where both the inputs and the outputs take values in the [0, 1] range. The
inputs can be thought as electrical signals reaching the neuron. The out-
put is the electrical signal emitted by the neuron. Each neuron is defined
by a set of parameters a which determined the relative weight of the input
signals. A common choice for this characteristic function is:

outputij = tanh(∑ aijk inputik ) (3.97)


k

where i labels the neuron, j labels the output, k labels the input, and aijk
are characteristic parameters describing the neurons.
theory of algorithms 131

The network is trained by providing an input and adjusting the character-


istics aijk of each neuron k to produce the expected output. The network
is trained iteratively until its parameters converge (if they converge), and
then it is ready to make predictions. We say the network has learned from
the training data set.

Figure 3.9: Example of a minimalist neural network.

Listing 3.22: in file: [Link]


1 class NeuralNetwork:
2 """
3 Back-Propagation Neural Networks
4 Placed in the public domain.
5 Original author: Neil Schemenauer <nas@[Link]>
6 Modified by: Massimo Di Pierro
7 Read more: [Link]
8 """
9

10 @staticmethod
11 def rand(a, b):
12 """ calculate a random number where: a <= rand < b """
13 return (b-a) * [Link]() + a
14
15 @staticmethod
16 def sigmoid(x):
17 """ our sigmoid function, tanh is a little nicer than the standard 1/(1+
e^-x) """
18 return [Link](x)
132 annotated algorithms in python

19
20 @staticmethod
21 def dsigmoid(y):
22 """ # derivative of our sigmoid function, in terms of the output """
23 return 1.0 - y ** 2
24

25 def __init__(self, ni, nh, no):


26 # number of input, hidden, and output nodes
27 [Link] = ni + 1 # +1 for bias node
28 [Link] = nh
29 [Link] = no
30
31 # activations for nodes
32 [Link] = [1.0] * [Link]
33 [Link] = [1.0] * [Link]
34 [Link] = [1.0] * [Link]
35

36 # create weights
37 [Link] = Matrix([Link], [Link], fill=lambda r, c: [Link](-0.2,
0.2))
38 [Link] = Matrix([Link], [Link], fill=lambda r, c: [Link](-2.0,
2.0))
39
40 # last change in weights for momentum
41 [Link] = Matrix([Link], [Link])
42 [Link] = Matrix([Link], [Link])
43

44 def update(self, inputs):


45 if len(inputs) != [Link]-1:
46 raise ValueError("wrong number of inputs")
47

48 # input activations
49 for i in range([Link]-1):
50 [Link][i] = inputs[i]
51

52 # hidden activations
53 for j in range([Link]):
54 s = sum([Link][i] * [Link][i, j] for i in range([Link]))
55 [Link][j] = [Link](s)
56
57 # output activations
58 for k in range([Link]):
59 s = sum([Link][j] * [Link][j, k] for j in range([Link]))
60 [Link][k] = [Link](s)
61 return [Link][:]
62
63 def back_propagate(self, targets, N, M):
64 if len(targets) != [Link]:
65 raise ValueError("wrong number of target values")
theory of algorithms 133

66
67 # calculate error terms for output
68 output_deltas = [0.0] * [Link]
69 for k in range([Link]):
70 error = targets[k]-[Link][k]
71 output_deltas[k] = [Link]([Link][k]) * error
72
73 # calculate error terms for hidden
74 hidden_deltas = [0.0] * [Link]
75 for j in range([Link]):
76 error = sum(output_deltas[k] * [Link][j, k] for k in range([Link])
)
77 hidden_deltas[j] = [Link]([Link][j]) * error
78

79 # update output weights


80 for j in range([Link]):
81 for k in range([Link]):
82 change = output_deltas[k] * [Link][j]
83 [Link][j, k] = [Link][j, k] + N * change + M * [Link][j, k]
84 [Link][j, k] = change
85
86 # update input weights
87 for i in range([Link]):
88 for j in range([Link]):
89 change = hidden_deltas[j] * [Link][i]
90 [Link][i, j] = [Link][i, j] + N * change + M * [Link][i, j]
91 [Link][i, j] = change
92

93 # calculate error
94 error = sum(0.5 * (targets[k]-[Link][k]) ** 2 for k in range(len(
targets)))
95 return error
96

97 def test(self, patterns):


98 for p in patterns:
99 print(p[0], "->", [Link](p[0]))
100
101 def weights(self):
102 print("Input weights:")
103 for i in range([Link]):
104 print([Link][i])
105 print()
106 print("Output weights:")
107 for j in range([Link]):
108 print([Link][j])
109
110 def train(self, patterns, iterations=1000, N=0.5, M=0.1, check=False):
111 # N: learning rate
112 # M: momentum factor
134 annotated algorithms in python

113 for i in range(iterations):


114 error = 0.0
115 for p in patterns:
116 inputs = p[0]
117 targets = p[1]
118 [Link](inputs)
119 error = error + self.back_propagate(targets, N, M)
120 if check and i % 100 == 0:
121 print("error %-14f" % error)

The same neural network can be implemented more efficiently using


NumPy for vectorized operations:
1 import numpy as np
2
3 class NeuralNetworkNumPy:
4 def __init__(self, ni, nh, no):
5 [Link], [Link], [Link] = ni + 1, nh, no
6 [Link] = [Link]([Link])
7 [Link] = [Link]([Link])
8 [Link] = [Link]([Link])
9 [Link] = [Link](-0.2, 0.2, ([Link], [Link]))
10 [Link] = [Link](-2.0, 2.0, ([Link], [Link]))
11 [Link] = [Link](([Link], [Link]))
12 [Link] = [Link](([Link], [Link]))
13
14 def update(self, inputs):
15 [Link][:[Link]-1] = inputs
16 [Link] = [Link]([Link] @ [Link])
17 [Link] = [Link]([Link] @ [Link])
18 return [Link]()
19

20 def back_propagate(self, targets, N, M):


21 targets = [Link](targets)
22 output_deltas = (1 - [Link] ** 2) * (targets - [Link])
23 hidden_deltas = (1 - [Link] ** 2) * (output_deltas @ [Link].T)
24 change = [Link]([Link], output_deltas)
25 [Link] += N * change + M * [Link]; [Link] = change
26 change = [Link]([Link], hidden_deltas)
27 [Link] += N * change + M * [Link]; [Link] = change
28 return 0.5 * [Link]((targets - [Link]) ** 2)
29

30 def train(self, patterns, iterations=1000, N=0.5, M=0.1):


31 for i in range(iterations):
32 for p in patterns:
33 [Link](p[0])
34 self.back_propagate(p[1], N, M)

Using scikit-learn, a neural network follows the same fit/predict pat-


theory of algorithms 135

tern as linear regression. The MLPClassifier (for classification) and


MLPRegressor (for regression) wrap a multi-layer perceptron with the same
interface: call fit(X, y) with the training data, then predict(X_new) for
predictions. Internally, scikit-learn handles weight initialization, back-
propagation, and convergence—the user only specifies the architecture
(number and size of hidden layers) and hyperparameters.
1 >>> from sklearn.neural_network import MLPClassifier
2 >>> import numpy as np
3 >>> X = [Link]([[0, 0], [0, 1], [1, 0], [1, 1]])
4 >>> y = [Link]([0, 1, 1, 0]) # XOR
5 >>> model = MLPClassifier(hidden_layer_sizes=(4,), activation='tanh',
6 ... max_iter=2000, random_state=1)
7 >>> [Link](X, y)
8 >>> [Link](X)
9 array([0, 1, 1, 0])
10 >>> model.predict_proba(X) # class probabilities

In the following example, we teach the network the XOR function, and
we create a network with two inputs, two intermediate neurons, and one
output. We train it and check what it learned:

Listing 3.23: in file: [Link]


1 >>> pat = [[[0, 0], [0]], [[0, 1], [1]], [[1, 0], [1]], [[1, 1], [0]]]
2 >>> n = NeuralNetwork(2, 2, 1)
3 >>> [Link](pat)
4 >>> [Link](pat)
5 [0, 0] -> [0.00...]
6 [0, 1] -> [0.98...]
7 [1, 0] -> [0.98...]
8 [1, 1] -> [-0.00...]

Now, we use our neural network to learn patterns in stock prices and
predict the next day return. We then check what it has learned, comparing
the sign of the prediction with the sign of the actual return for the same
days used to train the network:

Listing 3.24: in file: [Link]


1 >>> storage = PersistentDictionary("[Link]")
2 >>> v = [day["arithmetic_return"] * 300 for day in storage["AAPL/2011"][1:]]
3 >>> pat = [[v[i:i+5], [v[i+5]]] for i in range(len(v)-5)]
4 >>> n = NeuralNetwork(5, 5, 1)
5 >>> [Link](pat)
6 >>> predictions = [[Link](item[0]) for item in pat]
7 >>> success_rate = sum(1.0 for i, e in enumerate(predictions)
136 annotated algorithms in python

8 ... if e[0] * v[i+5]>0)/len(pat)

The learning process depends on the random number generator; there-


fore, sometimes, for this small training data set, the network succeeds in
predicting the sign of the next day arithmetic return of the stock with
more than 50% probability, and sometimes it does not. We leave it to the
reader to study the significance of this result but using a different subset
of the data for the training of the network and for testing its success rate.

3.9.3 Genetic algorithms


Here we consider a simple example of genetic algorithms [31].
We have a population of chromosomes in which each chromosome is just
a data structure, in our example, a string of random “ATGC” characters.
We also have a metric to measure the fitness of each chromosome.
At each iteration, only the top-ranking chromosomes in the population
survive. The top 10 mate with each other, and their offspring constitute
the population for the next iteration. When two members of the pop-
ulation mate, the newborn member of the population has a new DNA
sequence, half of which comes from the father and half from the mother,
with two randomly mutated DNA basis.
The algorithm stops when we reach a maximum number of generations
or we find a chromosome of the population with maximum fitness.
In the following example, the fitness is measured by the similarity be-
tween a chromosome and a random target chromosome. The population
evolves to approximate better and better that one random target chromo-
some:
1 from random import randint, choice
2

3 class Chromosome:
4 alphabet = "ATGC"
5 size = 32
6 mutations = 2
7 def __init__(self, father=None, mother=None):
8 if not father or not mother:
9 [Link] = [choice([Link]) for i in range([Link])]
theory of algorithms 137

10 else:
11 [Link] = [Link][:[Link]/2]+[Link][[Link]/2:]
12 for mutation in range([Link]):
13 [Link][randint(0, [Link]-1)] = choice([Link])
14 def fitness(self, target):
15 return sum(1 for i, c in enumerate([Link]) if c == [Link][i])
16
17 def top(population, target, n=10):
18 table = [([Link](target), chromo) for chromo in population]
19 [Link](reverse = True)
20 return [row[1] for row in table][:n]
21
22 def oneof(population):
23 return population[randint(0, len(population)-1)]
24
25 def main():
26 GENERATIONS = 10000
27 OFFSPRING = 20
28 SEEDS = 20
29 TARGET = Chromosome()
30
31 population = [Chromosome() for i in range(SEEDS)]
32 for i in range(GENERATIONS):
33 print("\n\nGENERATION:", i)
34 print(0, [Link])
35 fittest = top(population, TARGET)
36 for chromosome in fittest: print(i, [Link])
37 if max([Link](TARGET) for chromo in fittest) == [Link]:
38 print("SOLUTION FOUND")
39 break
40 population = [Chromosome(father=oneof(fittest), mother=oneof(fittest)) \
41 for i in range(OFFSPRING)]
42

43 if __name__ == "__main__": main()

Notice that this algorithm can easily be modified to accommodate other


fitness metrics and DNA that consists of a data structure other than a se-
quence of “ATGC” symbols. The only trickery is finding a proper mating
algorithm that preserves some of the fitness features of the parents in the
DNA of their offspring. If this does not happen, each next generation
loses the fitness properties gained by its parents, thus causing the algo-
rithm not to converge. In our case, it works because if the parents are
“close” to the target, then half of the DNA of each parent is also close
to the corresponding half of the target DNA. Therefore the DNA of the
offspring is as fit as the average of their parents. On top of this, the two
138 annotated algorithms in python

random mutations allow the algorithm to further explore the space of all
possible DNA sequences.

3.10 Long and infinite loops

3.10.1 P, NP, and NPC


We say a problem is in P if it can be solved in polynomial time: Tworst ∈
O(nα ) for some α.
We say a problem is in NP if an input string can be verified to be a solution
in polynomial time: Tworst ∈ O(nα ) for some α.
We say a problem is in co-NP if an input string can be verified not to be a
solution in polynomial time: Tworst ∈ O(nα ) for some α.
We say a problem is in NPH (NP Hard) if it is harder than any other
problem in NP.
We say a problem is in NPC (NP Complete) if it is in NP and in NPH.
Consequences:

if ∃ x | x ∈ NPC and x ∈ P ⇒ ∀y ∈ NP, y ∈ P (3.98)

There are a number of open problems about the relations among these
sets. Is the set co-NP equivalent to NP? Or perhaps is the intersection
between co-NP and NP equal to P? Are NP and NPC the same set? These
questions are very important in computer science because if, for example,
NP turns out to be the same set as NPC, it means that it must be possible
to find algorithms that solve in polynomial time problems that currently
do not have a polynomial time solution. Conversely, if one could prove
that NP is not equivalent to NPC, we would know that a polynomial time
solution to NPC problems does not exist [32].

3.10.2 Cantor"s argument


Cantor proved that the real numbers in any interval (e.g., in [0, 1)) are
more than the integer numbers, therefore real numbers are uncount-
able [33]. The proof proceeds as follows:
theory of algorithms 139

1. Consider the real numbers in the interval [0, 1) not including 1.


2. Assume that these real numbers are countable. Therefore it is possible
to associate each of them to an integer

1 ←→ [Link]...
2 ←→ [Link]...
3 ←→ [Link]...
(3.99)
4 ←→ [Link]...
5 ←→ [Link]...
... ... ...
(here x represent a decimal digit of a real numbers)
3. Now construct a number α = [Link].... where the first decimal
digit differs from the first decimal digit of the first real number of table
3.99, the second decimal digit differs from the second decimal digit of
the second real number of table 3.99, and so on and so on for all the
infinite decimal digits:

1 ←→ [Link]...
2 ←→ [Link]...
3 ←→ [Link]...
(3.100)
4 ←→ [Link]...
5 ←→ [Link]...
... ... ...

4. The new number α is a real number, and by construction, it is not


in the table. In fact, it differs with each item by at least one decimal
digit. Therefore the existence of α disproves the assumption that all
real numbers in the interval [0, 1) are listed in the table.
There is a very practical consequence of this argument. In fact, in chapter
2, we have seen the distinction between type float and class Decimal. We
have seen about pitfalls of float and how Decimal can represent floating
point numbers with arbitrary precision (assuming we have the memory
to do so). Cantor"s argument tells us there are numbers that cannot even
be represented as Decimal because they would require an infinite amount
of storage; π and e are examples of these numbers.
140 annotated algorithms in python

3.10.3 Gödel"s theorem


Gödel used a similar diagonal argument to prove that there are as many
problems (or theorems) as real numbers and as many algorithms (or
proofs) as natural numbers [33]. Because there is more of the former
than the latter, it follows that there are problems for which there is no
corresponding solving algorithm. Another interpretation of Gödel"s the-
orem is that, in any formal language, for example, mathematics, there are
theorems that cannot be proved.
Another consequence of Gödel"s theorem is the following: it is impossible
to write a computer program to test if a given algorithm stops or enters
into an infinite loop.
Consider the following code:
1 def next(i):
2 while len(set(str(i * i))) > 2:
3 i=i+2
4 print(i)
5
6 next(81621)

This code check searches for a number equal or greater than 81621 whose
square is comprised of only two digits. Nobody knows whether such
number exists, therefore nobody knows if this code stops.
Although one day this problem may be solved, there are many other prob-
lems that are still unsolved; actually, there are an infinite number of them.
4
Numerical Algorithms

4.1 Well-posed and stable problems

Numerical algorithms deal mostly with well-posed and stable problems.


A problem is well posed if
• The solution exists and is unique
• The solution has a continuous dependence on input data (a small
change in the input causes a small change in the output)
Most physical problems are well posed, except at critical points, where any
infinitesimal variation in one of the input parameters of the system can
cause a large change in the output and therefore in the behavior of the
system. This is called chaos.
Consider the case of dropping a ball on a triangular-shaped mountain.
Let the input of the problem be the horizontal position where the drop
occurs and the output the horizontal position of the ball after a fixed
amount of time. Almost anywhere the ball is dropped, it will roll down
the mountain following deterministic and classical laws of physics, thus
the position is calculable and a continuous function of the input position.
This is true everywhere, except when the ball is dropped on top of the
peak of the mountain. In this case, a minor infinitesimal variation to
the right or to the left can make the ball roll to the right or to the left,
142 annotated algorithms in python

respectively. Therefore this is not a well posed problem.


A problem is said to be stable if the solution is not just continuous but also
weakly sensitive to input data. This means that the change of the output
(in percent) is smaller than the change in the input (in percent).
Numerical algorithms work best with stable problems.
We can quantify this as follows. Let x be an input and y be the output of
a function:
y = f (x) (4.1)

We define the condition number of f in x as

|dy/y|
cond( f , x ) ≡ = | x f ′ ( x )/ f ( x )| (4.2)
|dx/x |
(the latter equality only holds if f is differentiable in x).
A problem with a low condition number is said to be well-conditioned,
while a problem with a high condition number is said to be ill-
conditioned. XXX
We say that a problem characterized by a function f is well conditioned
in a domain D if the condition number is less than 1 for every input in
the domain. We also say that a problem is stable if it is well conditioned.
In this book, we are mostly concerned with stable (well-conditioned)
problems. If a problem is well-conditioned in for all input in a domain, it
is also stable.

4.2 Approximations and error analysis

Consider a physical quantity, for example, the length of a nail. Given


one nail, we can measure its length by choosing a measuring instrument.
Whatever instrument we choose, we will be able to measure the length of
the nail within the resolution of the instrument. For example, with a tape
measure with a resolution of 1 mm, we will only be able to determine the
length of the nail within 1 mm of resolution. Repeated measurements per-
formed at different times, by different people, using different instruments
numerical algorithms 143

may bring different results. We can choose a more precise instrument, but
it would not change the fact that different measures will bring different
values compatible with the resolution of the instrument. Eventually one
will have to face the fact that there may not be such a thing as the length
of a nail. For example, the length varies with the temperature and the
details of how the measurement is performed. In fact, a nail (as every-
thing else) is made out of atoms, which are made of protons, neutrons,
and electrons, which determine an electromagnetic cloud that fluctuates
in space and time and depends on the surrounding objects and interacts
with the instrument of measure. The length of the nail is the result of a
measure.
For each measure there is a result, but the results of multiple measure-
ments are not identical. The results of many measurements performed
with the same resolution can be summarized in a distribution of results.
This distribution will have a mean x̄ and a standard deviation δx, which
we call uncertainty. From now on, unless otherwise specified, we assume
that the distribution of results is Gaussian so that x̄ can be interpreted as
the mean and δx as the standard deviation.
Now let us consider a system that, given an input x, produces the output
y; x and y are physical quantities that we can measure, although only
with a finite resolution. We can model the system with a function f such
that y = f ( x ) and, in general, f is not known.
We have to make various approximations:
• We can replace the “true” value for the input with our best estimate, x̄,
and its associated uncertainty, δx.
• We can replace the “true” value for the output with our best estimate,
ȳ, and its associated uncertainty, δy.
• Even if we know there is a “true” function f describing the system,
our implementation for the function is always an approximation, f¯. In
fact, we may not have a single approximation but a series of approxi-
mations of increasing precision, f n , which become more and more ac-
curate (usually) as n increases. If we are lucky, up to precision errors,
144 annotated algorithms in python

as n increases, our approximations will become closer and closer to f ,


but this will take an infinite amount of time. We have to stop at some
finite n.
With the preceding definition, we can define the following types of errors:
• Data error: the difference between x and x̄.
• Computational error: the difference between f¯( x̄ ) and y. Computa-
tional error includes two parts systematic error and statistical error.
• Statistical error: due to the fact that, often, the computation of f¯( x ) =
limn→∞ f n ( x ) is too computationally expensive and we must approxi-
mate f¯( x ) with f n ( x ). This error can be estimated and controlled.
• Systematic error: due to the fact that f¯( x ) = limn→∞ f n ( x ) ̸= f ( x ).
This is for two reasons: modeling errors (we do not know f ( x )) and
rounding errors (we do not implement f ( x ) with arbitrary precision
arithmetics).
• Total error: defined as the computational error + the propagated data
error and in a formula:

δy = | f ( x̄ ) − f n ( x̄ )| + | f n′ ( x̄ )|δx (4.3)

The first term is the computational error (we use f n instead of the true
f ), and the second term is the propagated data error (δx, the uncer-
tainty in x, propagates through f n ).

4.2.1 Error propagation


When a variable x has a finite Gaussian uncertainty δx, how does the
uncertainty propagate through a function f ? Assuming the uncertainty is
small, we can always expand using a Taylor series:

y + δy = f ( x + δx ) = f ( x ) + f ′ ( x )δx + O(δx2 ) (4.4)


And because we interpret δy as the width of the distribution y, it should
be positive:
δy = | f ′ ( x )|δx (4.5)
numerical algorithms 145

We have used this formula before for the propagated data error. For
functions of two variables z = f ( x, y) and assuming the uncertainties in x
and y are independent,

s
2 2
∂ f ( x, y) ∂ f ( x, y)
δz = δx2 + δy2 (4.6)
∂x ∂y

which for simple arithmetic operations reduces to


p
z = x + y δz = δx2 + δy2
p
z = x − y δz = δx2 + δy2
p
z = x∗y δz = | x ∗ y| (δx/x )2 + (δy/y)2
p
z = x/y δz = | x/y| (δx/x )2 + (δy/y)2
Notice that when z = x − y approaches zero, the uncertainty in z is larger
than the uncertainty in x and y and can overwhelm the result. Also notice
that if z = x/y and y is small compared to x, then the uncertainty in z can
be large. Bottom line: try to avoid differences between numbers that are
in proximity of each other and try to avoid dividing by small numbers.

4.2.2 buckingham

Buckingham is a Python library that implements error propagation and


unit conversion. It defines a single class called Number, and a number ob-
ject has value, an uncertainty, and a dimensionality (e.g., length, volume,
mass).
Here is an example:
1 >>> from buckingham import *
2 >>> globals().update(allunits())
3 >>> L = (4 + pm(0.5)) * meter
4 >>> v = 5 * meter/second
5 >>> t = L/v
6 >>> t)
7 (8.00 +/- 1.00)/10
8 >>> [Link]()
9 second
10 >>> [Link]("hour")
11 (2.222 +/- 0.278)/10^4

Notice how adding an uncertainty to a numeric value with +


146 annotated algorithms in python

pm(...) or adding units to a numeric value (integer or floating point)


transforms the float number into a Number object. A Number object be-
haves like a floating point but propagates its uncertainty and its units.
Internally, all units are converted to the International System, unless an
explicit conversion is specified.

4.3 Standard strategies

Here are some strategies that are normally employed in numerical algo-
rithms:
• Approximate a continuous system with a discrete system
• Replace integrals with sums
• Replace derivatives with finite differences
• Replace nonlinear with linear + corrections
• Transform a problem into a different one
• Approach the true result by iterations
Here are some examples of each of the strategies.

4.3.1 Approximate continuous with discrete


Consider a ball in a one-dimensional box of size L, and let x be the posi-
tion of the ball in the box. Instead of treating x as a continuous variable,
we can assume a finite resolution of h = L/n (where h is the minimum
distance we can distinguish without instruments and n is the maximum
number of distinct discrete points we can discriminate), and set x ≡ hi,
where i is an integer in between 0 and n; x = 0 when i = 0 and x = L
when i = n.

4.3.2 Replace derivatives with finite differences


Computing d f ( x )/dx analytically is only possible when the function f
is expressed in simple analytical terms. Computing it analytically is not
numerical algorithms 147

possible when f ( x ) is itself implemented as a numerical algorithm. Here


is an example:
1 def f(x):
2 (s, t) = (1.0, 1.0)
3 for i in range(1, 10): (s, t) = (s+t, t * x/i)
4 return s

What is the derivative of f ( x )?


The most common ways to define a derivative are the right derivative

d f + (x) f ( x + h) − f ( x )
= lim (4.7)
dx h →0 h
the left derivative
d f − (x) f ( x ) − f ( x − h)
= lim (4.8)
dx h →0 h
and the average of the two

1 d f + (x) d f − (x) f ( x + h) − f ( x − h)
 
d f (x)
= + = lim (4.9)
dx 2 dx dx h →0 2h

If the function is differentiable in x, then, by definition of “differentiable,


” the left and right definitions are equal, and the three prior definitions
are equivalent. We can pick one or the other, and the difference will be a
systematic error.
If the limit exists, then it means that

d f (x) f ( x + h) − f ( x − h)
= + O(h) (4.10)
dx 2h

where O(h) indicates a correction that, at most, is proportional to h.


The three definitions are equivalent for functions that are differentiable in
x, and the latter is preferable because it is more symmetric.
Notice that even more definitions are possible as long as they agree in the
limit h → 0. Definitions that converge faster as h goes to zero are referred
to as “improvement.”
148 annotated algorithms in python

We can easily implement the concept of a numerical derivative in code


by creating a functional D that takes a function f and returns the function
d f (x)
dx (a functional is a function that returns another function):

Listing 4.1: in file: [Link]


1 def D(f, h=1e-6): # first derivative of f
2 return lambda x, f=f, h=h: (f(x+h)-f(x-h))/2/h

We can do the same with the second derivative:

d2 f ( x ) f ( x + h) − 2 f ( x ) − f ( x − h)
= + O(h) (4.11)
dx2 h2

Listing 4.2: in file: [Link]


1 def DD(f, h=1e-6): # second derivative of f
2 return lambda x, f=f, h=h: (f(x+h)-2.0 * f(x)+f(x-h))/(h * h)

Here is an example:

Listing 4.3: in file: [Link]


1 >>> def f(x): return x * x-5.0 * x
2 >>> f(0)
3 0.0
4 >>> f1 = D(f) # first derivative
5 >>> f1(0)
6 -5.0
7 >>> f2 = DD(f) # second derivative
8 >>> f2(0)
9 2.00000...
10 >>> f2 = D(f1) # second derivative
11 >>> f2(0)
12 1.99999...

Notice how composing the first derivative twice or computing the second
derivative directly yields a similar result.
We could easily derive formulas for higher-order derivatives and imple-
ment them, but they are rarely needed.

4.3.3 Replace nonlinear with linear


Suppose we are interested in the values of f ( x ) = sin( x ) for values of x
between 0 and 0.1:
numerical algorithms 149

1 >>> from math import sin


2 >>> points = [0.01 * i for i in range(0, 11)]
3 >>> for x in points:
4 ... print(x, sin(x), "%.2f" % (abs(x-sin(x))/sin(x) * 100))
5 0.01 0.009999833... 0.00
6 0.02 0.019998666... 0.01
7 0.03 0.029995500... 0.02
8 0.04 0.039989334... 0.03
9 0.05 0.049979169... 0.04
10 0.06 0.059964006... 0.06
11 0.07 0.069942847... 0.08
12 0.08 0.079914693... 0.11
13 0.09 0.089878549... 0.14
14 0.1 0.0998334166... 0.17

Here the first column is the value of x, the second column is the corre-
sponding sin( x ), and the third column is the relative difference (in per-
cent) between x and sin( x ). The difference is always less than 20%; there-
fore, if we are happy with this precision, then we can replace sin( x ) with
x.
This works because any function f ( x ) can be expanded using a Taylor
series. The first order of the Taylor expansion is linear. For values of
x sufficiently close to the expansion point, the function can therefore be
approximated with its Taylor expansion.
Expanding on the previous example, consider the following code:
1 >>> from math import sin
2 >>> points = [0.01 * i for i in range(0, 11)]
3 >>> for x in points:
4 ... s = x - x * x * x/6
5 ... print(x, [Link](x), s, ``%.6f'' % (abs(s-sin(x))/(sin(x)) * 100))
6 0.01 0.009999833... 0.009999... 0.000000
7 0.02 0.019998666... 0.019998... 0.000000
8 0.03 0.029995500... 0.029995... 0.000001
9 0.04 0.039989334... 0.039989... 0.000002
10 0.05 0.049979169... 0.049979... 0.000005
11 0.06 0.059964006... 0.059964... 0.000011
12 0.07 0.069942847... 0.069942... 0.000020
13 0.08 0.079914693... 0.079914... 0.000034
14 0.09 0.089878549... 0.089878... 0.000055
15 0.1 0.0998334166... 0.099833... 0.000083

Notice that the third column s = x − x3 /6 is very close to sin( x ). In fact,


the difference is less than one part in 10, 000 (fourth column). There-
150 annotated algorithms in python

fore, for x ∈ [−1, +1], it is possible to replace the sin( x ) function with
the x − x3 /6 polynomial. Here we just went one step further in the Tay-
lor expansion, replacing the first order with the third order. The error
committed in this approximation is very small.

4.3.4 Transform a problem into a different one


Continuing with the previous example, the polynomial approximation for
the sin function works when x is smaller than 1 but fails when x is greater
than or equal to 1. In this case, we can use the following relations to
reduce the computation of sin( x ) for large x to sin( x ) for 0 < x < 1. In
particular, we can use

sin( x ) = − sin(− x )whenx < 0 (4.12)

to reduce the domain to x ∈ [0, ∞]. We can then use

sin( x ) = sin( x − 2kπ ) k∈N (4.13)

to reduce the domain to x ∈ [0, 2π )

sin( x ) = − sin(2π − x ) (4.14)

to reduce the domain to x ∈ [0, π )

sin( x ) = sin(π − x ) (4.15)

to reduce the domain to x ∈ [0, π/2), and

q
sin( x ) = 1 − sin(π/2 − x )2 (4.16)

to reduce the domain to x ∈ [0, π/4), where the latter is a subset of [0, 1).
numerical algorithms 151

4.3.5 Approximate the true result via iteration


The approximations sin( x ) ≃ x and sin( x ) ≃ x − x3 /6 came from lin-
earizing the function sin( x ) and adding a correction to the previous ap-
proximation, respectively. In general, we can iterate the process of finding
corrections and approximating the true result.
Here is an example of a general iterative algorithm:
1 result=guess
2 loop:
3 compute correction
4 result=result+correction
5 if result sufficiently close to true result:
6 return result

For the sin function:


1 def mysin(x):
2 (s, t) = (0.0, x)
3 for i in range(3, 10, 2): (s, t) = (s+t, -t * x * x/i/(i-1))
4 return s

Where do these formulas come from? How do we decide how many


iterations we need? We address these problems in the next section.

4.3.6 Taylor series


A function f ( x ) : R → R is said to be a real analytical in x̄ if it is continuous
in x = x̄ and all its derivatives exist and are continuous in x = x̄.
When this is the case, the function can be locally approximated with a
local power series:

f (k) ( x̄ )
f ( x ) = f ( x̄ ) + f (0) ( x̄ )( x − x̄ ) + ... + ( x − x̄ )k + Rk (4.17)
n!

The remainder Rk can be proven to be (Taylor"s theorem):

f ( k +1) ( ξ )
Rk = ( x − x̄ )k+1 (4.18)
( k + 1) !

where ξ is a point in between x and x̄. Therefore, if f (k+1) exists and is


152 annotated algorithms in python

limited within a neighborhood D = { x for | x − x̄ | < ϵ}, then

| Rk | < max x∈ D f (k+1) |( x − x̄ )k+1 | (4.19)

If we stop the Taylor expansion at a finite value of k, the preceding formula


gives us the statistical error part of the computational error.
Some Taylor series are very easy to compute:
Exponential for x̄ = 0:

f (x) = ex (4.20)
(1) x
f (x) = e (4.21)
... ... (4.22)
(k) x
f (x) = e (4.23)
1 1
ex = 1 + x + x2 + ... + x k + ... (4.24)
2 k!

Sin for x̄ = 0:

f (x) = sin( x ) (4.25)


(1)
f ( x ) = cos( x ) (4.26)
(2)
f ( x ) = −sin( x ) (4.27)
f (3) ( x ) = −cos( x ) (4.28)
... ... (4.29)
1 (−1)n (2k+1)
sin( x ) = x − x3 + ... + x + ... (4.30)
3! (2k + 1)!

We can show the effects of the various terms:

Listing 4.4: in file: [Link]


1 >>> X = [0.03 * i for i in range(200)]
2 >>> c = Canvas(title="sin(x) approximations")
3 >>> [Link]([(x, [Link](x)) for x in X], legend="sin(x)")
4 <...>
numerical algorithms 153

5 >>> [Link]([(x, x) for x in X[:100]], legend="Taylor 1st")


6 <...>
7 >>> [Link]([(x, x-x ** 3/6) for x in X[:100]], legend="Taylor 5th")
8 <...>
9 >>> [Link]([(x, x-x ** 3/6+x ** 5/120) for x in X[:100]], legend="Taylor 5th")
10 <...>
11 >>> [Link]("images/[Link]")

Figure 4.1: The figure shows the sin function and its approximation using the Taylor
expansion around x = 0 at different orders.

Notice that we can very well expand in Taylor around any other point, for
example, x̄ = π/2, and we get

1 π (−1)n π
sin( x ) = 1 − ( x − )2 + ... + ( x − )(2k) + ... (4.31)
2 2 (2k)! 2

and a plot would show:

Listing 4.5: in file: [Link]


1 >>> a = [Link]/2
2 >>> X = [0.03 * i for i in range(200)]
3 >>> c = Canvas(title="sin(x) approximations")
4 >>> [Link]([(x, [Link](x)) for x in X], legend="sin(x)")
154 annotated algorithms in python

5 <...>
6 >>> [Link]([(x, 1-(x-a) ** 2/2) for x in X[:150]], legend="Taylor 2nd")
7 <...>
8 >>> [Link]([(x, 1-(x-a) ** 2/2+(x-a) ** 4/24) for x in X[:150]], legend="Taylor
4th")
9 <...>
10 >>> [Link]([(x, 1-(x-a) ** 2/2+(x-a) ** 4/24-(x-a) ** 6/720) for x in X[:150]],
legend="Taylor 6th")
11 <...>
12 >>> [Link]("images/[Link]")

Figure 4.2: The figure shows the sin function and its approximation using the Taylor
expansion around x = π/2 at different orders.

Similarly we can expand the cos function around x̄ = 0. Not accidentally,


we would get the same coefficients as the Taylor expansion of the sin
function around x̄ = π/2. In fact, sin( x ) = cos( x − π/2):
numerical algorithms 155

f (x) = cos( x ) (4.32)


(1)
f ( x ) = −sin( x ) (4.33)
f (2) ( x ) = −cos( x ) (4.34)
(3)
f ( x ) = sin( x ) (4.35)
... ... (4.36)
1 (−1)n
cos( x ) = 1 − x2 + ... + x (2k) + ... (4.37)
2 (2k)!

With a simple replacement, it is easy to prove that

eix = cos( x ) + i sin( x ) (4.38)

which will be useful when we talk about Fourier and Laplace transforms.
Now let"s consider the kth term in Taylor expansion of e x . It can be rear-
ranged as a function of the previous (k − 1) − th term:

1 n x 1 x
Tk ( x ) = x = x k−1 = Tk−1 ( x ) (4.39)
k! k ( k − 1) ! k

For x < 0, the terms in the sign have alternating sign and are decreasing
in magnitude; therefore, for x < 0, Rk < Tk+1 (1). This allows for an easy
implementation of the Taylor expansion and its stopping condition:

Listing 4.6: in file: [Link]


1 def myexp(x, precision=1e-6, max_steps=40):
2 if x == 0:
3 return 1.0
4 elif x>0:
5 return 1.0/myexp(-x, precision, max_steps)
6 else:
7 t = s = 1.0 # first term
8 for k in range(1, max_steps):
9 t = t * x/k # next term
10 s = s + t # add next term
11 if abs(t)<precision: return s
12 raise ArithmeticError("no convergence")

This code presents all the features of many of the algorithms we see later
in the chapter:
156 annotated algorithms in python

• It deals with the special case e0 = 1.


• It reduces difficult problems to easier problems (exponential of a posi-
tive number to the exponential of a negative number via e x = 1/e− x ).
• It approximates the “true” solution by iterations.
• The max number of iterations is limited.
• There is a stopping condition.
• It detects failure to converge.
Here is a test of its convergence:

Listing 4.7: in file: [Link]


1 >>> for i in range(10):
2 ... x= 0.1 * i
3 ... assert abs(myexp(x) - [Link](x)) < 1e-4

We can do the same for the sin function:


x2
Tk ( x ) = − T (x) (4.40)
(2k)(2k + 1) k−1
In this case, the residue is always limited by

| Rk | < | x2k+1 | (4.41)

because the derivatives of sin are always sin and cos and their image is
always between [−1, 1].
Also notice that the stopping condition is only true when 0 ≤ x < 1.
Therefore, for other values of x, we must use trigonometric relations to
reduce the problem to a domain where the Taylor series converges.
Hence we write:

Listing 4.8: in file: [Link]


1 def mysin(x, precision=1e-6, max_steps=40):
2 pi = [Link]
3 if x == 0:
4 return 0
5 elif x<0:
6 return -mysin(-x)
numerical algorithms 157

7 elif x>2.0 * pi:


8 return mysin(x % (2.0 * pi))
9 elif x>pi:
10 return -mysin(2.0 * pi - x)
11 elif x>pi/2:
12 return mysin(pi-x)
13 elif x>pi/4:
14 return sqrt(1.0-mysin(pi/2-x) ** 2)
15 else:
16 t = s = x # first term
17 for k in range(1, max_steps):
18 t = t * (-1.0) * x * x/(2 * k)/(2 * k+1) # next term
19 s = s + t # add next term
20 r = x ** (2 * k+1) # estimate residue
21 if r<precision: return s # stopping condition
22 raise ArithmeticError("no convergence")

Here we test it:

Listing 4.9: in file: [Link]


1 >>> for i in range(10):
2 ... x= 0.1 * i
3 ... assert abs(mysin(x) - [Link](x)) < 1e-4

Finally, we can do the same for the cos function:

Listing 4.10: in file: [Link]


1 def mycos(x, precision=1e-6, max_steps=40):
2 pi = [Link]
3 if x == 0:
4 return 1.0
5 elif x<0:
6 return mycos(-x)
7 elif x>2.0 * pi:
8 return mycos(x % (2.0 * pi))
9 elif x>pi:
10 return mycos(2.0 * pi - x)
11 elif x>pi/2:
12 return -mycos(pi-x)
13 elif x>pi/4:
14 return sqrt(1.0-mycos(pi/2-x) ** 2)
15 else:
16 t = s = 1 # first term
17 for k in range(1, max_steps):
18 t = t * (-1.0) * x * x/(2 * k)/(2 * k-1) # next term
19 s = s + t # add next term
20 r = x ** (2 * k) # estimate residue
21 if r<precision: return s # stopping condition
158 annotated algorithms in python

22 raise ArithmeticError("no convergence")

Here is a test of convergence:

Listing 4.11: in file: [Link]


1 >>> for i in range(10):
2 ... x = 0.1 * i
3 ... assert abs(mycos(x) - [Link](x)) < 1e-4

4.3.7 Stopping Conditions


To implement a stopping condition, we have two options. We can look at
the absolute error, defined as

[absolute error] = [approximate value] − [true value] (4.42)

or we can look at the relative error

[relative error] = [absolute error]/[true value] (4.43)

or better, we can consider both. Here is an example of pseudo-code:


1 result = guess
2 loop:
3 compute correction
4 result = result+correction
5 compute remainder
6 if |remainder| < target_absolute_precision return result
7 if |remainder| < target_relative_precision * |result| return result

In the code, we use the computed result as an estimate of the [true value]
and, occasionally, the computed correction is an estimate of the [absolute
error]. The target absolute precision is an input value that we use as an
upper limit for the absolute error. The target relative precision is an input
value we use as an upper limit for the relative error. When absolute error
falls below the target absolute precision or the relative error falls below
the target relative precision, we stop looping and assume the result is
sufficiently precise:
1 def generic_looping_function(guess, ap, rp, ns):
2 result = guess
3 for k in range(ns):
numerical algorithms 159

4 correction = ...
5 result = result+correction
6 remainder = ...
7 if norm(remainder) < max(ap, norm(result) * rp): return result
8 raise ArithmeticError("no convergence")

In the preceding code,


• ap is the target absolute precision.
• rp is the target relative precision.
• ns is the maximum number of steps.
From now on, we will adopt this naming convention.
Consider, for example, a financial algorithm that outputs a dollar amount.
If it converges to a number very close to 1 or 0, the concept of relative
precision loses significance for a result equal to zero, and the algorithm
never detects convergence. In this case, setting an absolute precision of
$1 or 1c is the right thing to do. Conversely, if the algorithm converges to
a very large dollar amount, setting a precision of $1 or 1c may be a too
strong requirement, and the algorithm will take too long to converge. In
this case, setting a relative precision of 1% or 0.1% is the correct thing to
do.
Because in general we do not know in advance the output of the algo-
rithm, we should use both stopping conditions. We should also detect
which of the two conditions causes the algorithm to stop looping and
return, so that we can estimate the uncertainty in the result.

4.4 Linear algebra

In this section, we consider the following algorithms:


• Arithmetic operation among matrices
• Gauss–Jordan elimination for computing the inverse of a matrix A
• Cholesky decomposition for factorizing a symmetric positive definite
matrix A into LLt , where L is a lower triangular matrix
• The Jacobi algorithms for finding eigenvalues
160 annotated algorithms in python

• Fitting algorithms based on linear least squares


We will provide examples of applications.

4.4.1 Linear systems


In mathematics, a system described by a function f is linear if it is addi-
tive:
f ( x + y) = f ( x ) + f (y) (4.44)
and if it is homogeneous,

f (αx ) = α f ( x ) (4.45)

In simpler words, we can say that the output is proportional to the input.
As discussed in the introduction to this chapter, one of the simplest tech-
niques for approximating any unknown system consists of approximating
it with a linear system (and this approximation will be correct for some
system and not for others).
When we try to model a new system, approximating the system with a
linear system is often the first step in describing it in a quantitative way,
even if it may turn out that this is not a good approximation.
This is the same as approximating the function f describing the system
with the first-order Taylor expansions f ( x + h) − f ( x ) = f ′ ( x )h.
For a multidimensional system with input x (now a vector) and output y
(also a vector, not necessarily of the same size as x), we can still approxi-
mate y = f (x) with f (y + h) − y ≃ Ah, yet we need to clarify what this
latter equation means.
Given    
x0 y0
 x1   y1 
x≡ y≡ (4.46)
   
 
 ...   ... 
x n −1 y m −1
numerical algorithms 161

 
a00 a01 ... a0,n−1
 a10 a11 ... a1,n−1 
A≡ (4.47)
 

 ... ... ... ... 
am−1,0 am−1,1 ... am−1,n−1

the following equation means


y = f (x) ≃ Ax (4.48)
which means
y0 = f 0 (( x ) ≃ a00 x0 + a01 x1 + ... + a0,n−1 xn−1 (4.49)
y1 = f 1 (( x ) ≃ a10 x0 + a11 x1 + ... + a1,n−1 xn−1 (4.50)
y2 = f 2 (( x ) ≃ a20 x0 + a21 x1 + ... + a2,n−1 xn−1 (4.51)
... = ... (4.52)
y m −1 = f m−1 (( x ) ≃ am−1,0 x0 + am−1,1 x1 + ...am−1,n−1 xn−1 (4.53)
which says that every output variable y j is approximated with a function
proportional to each of the input variables xi .
A system is linear if the ≃ relations turn out to be exact and can be re-
placed by = symbols.
As a corollary of the basic properties of a linear system discussed earlier,
linear systems have one nice additional property. If we combine two linear
systems y = Ax and z = By, the combined system is also a linear system
z = ( BA) x.
Elementary algebra is defined as a set of numbers (e.g., real numbers) en-
dowed with the ordinary four elementary operations (+, −, ×, /).
Abstract algebra is a generalization of the concept of elementary algebra
to other sets of objects (not necessarily numbers) by definition operations
among them such as addition and multiplication.
Linear algebra is the extension of elementary algebra to matrices (and vec-
tors, which can be seen as special types of matrices) by defining the four
elementary operations among them.
We will implement them in code using Python. In Python, we can imple-
ment a matrix as a list of lists, as follows:
162 annotated algorithms in python

1 >>> A = [[1, 2, 3], [4, 5, 6], [7, 8, 9]]

But such an object (a list of lists) does not have the mathematical proper-
ties we want, so we have to define them.
First, we define a class representing a matrix:

Listing 4.12: in file: [Link]


1 class Matrix(object):
2 def __init__(self, rows, cols=1, fill=0.0):
3 """
4 Constructor a zero matrix
5 Examples:
6 A = Matrix([[1, 2], [3, 4]])
7 A = Matrix([1, 2, 3, 4])
8 A = Matrix(10, 20)
9 A = Matrix(10, 20, fill=0.0)
10 A = Matrix(10, 20, fill=lambda r, c: 1.0 if r == c else 0.0)
11 """
12 if isinstance(rows, list):
13 if isinstance(rows[0], list):
14 [Link] = [[e for e in row] for row in rows]
15 else:
16 [Link] = [[e] for e in rows]
17 elif isinstance(rows, int) and isinstance(cols, int):
18 xrows, xcols = range(rows), range(cols)
19 if callable(fill):
20 [Link] = [[fill(r, c) for c in xcols] for r in xrows]
21 else:
22 [Link] = [[fill for c in xcols] for r in xrows]
23 else:
24 raise RuntimeError("Unable to build matrix from %s" % repr(rows))
25 [Link] = len([Link])
26 [Link] = len([Link][0])

Notice that the constructor takes the number of rows and columns (cols)
of the matrix but also a fill value, which can be used to initialize the
matrix elements and defaults to zero. It can be callable in case we need to
initialize the matrix with row, col dependent values.
The actual matrix elements are stored as a list or array into the data mem-
ber variable. If optimize=True, the data are stored in an array of double
precision floating point numbers (“d”). This optimization will prevent
you from building matrices of complex numbers or matrices of arbitrary
precision decimal numbers.
numerical algorithms 163

Now we define a getter method, a setter method, and a string representa-


tion for the matrix elements:

Listing 4.13: in file: [Link]


1 def __getitem__(A, coords):
2 " x = A[0, 1]"
3 i, j = coords
4 return [Link][i][j]
5

6 def __setitem__(A, coords, value):


7 " A[0, 1] = 3.0 "
8 i, j = coords
9 [Link][i][j] = value
10
11 def tolist(A):
12 " assert(Matrix([[1, 2], [3, 4]]).tolist() == [[1, 2], [3, 4]]) "
13 return [Link]
14

15 def __str__(A):
16 return str([Link])
17

18 def flatten(A):
19 " assert(Matrix([[1, 2], [3, 4]]).flatten() == [1, 2, 3, 4]) "
20 return [A[r, c] for r in range([Link]) for c in range([Link])]
21
22 def reshape(A, n, m):
23 " assert(Matrix([[1, 2], [3, 4]]).reshape(1, 4).tolist() == [[1, 2, 3,
4]]) "
24 if n * m != [Link] * [Link]:
25 raise RuntimeError("Impossible reshape")
26 flat = [Link]()
27 return Matrix(n, m, fill=lambda r, c, m=m, flat=flat: flat[r * m+c])
28
29 def swap_rows(A, i, j):
30 " assert(Matrix([[1, 2], [3, 4]]).swap_rows(1, 0).tolist() == [[3, 4],
[1, 2]]) "
31 [Link][i], [Link][j] = [Link][j], [Link][i]

We also define some convenience functions for constructing the identity


matrix (given its size) and a diagonal matrix (given the diagonal ele-
ments). We make these methods static because they do not act on an
existing matrix.

Listing 4.14: in file: [Link]


1 @staticmethod
2 def identity(rows=1, e=1.0):
164 annotated algorithms in python

3 return Matrix(rows, rows, lambda r, c, e=e: e if r == c else 0.0)


4

5 @staticmethod
6 def diagonal(d):
7 return Matrix(len(d), len(d), lambda r, c, d=d:d[r] if r == c else 0.0)

Now we are ready to define arithmetic operations among matrices. We


start with addition and subtraction:

Listing 4.15: in file: [Link]


1 def __add__(A, B):
2 """
3 Adds A and B element by element, A and B must have the same size
4 Example
5 >>> A = Matrix([[4, 3.0], [2, 1.0]])
6 >>> B = Matrix([[1, 2.0], [3, 4.0]])
7 >>> C = A + B
8 >>> print(C)
9 [[5, 5.0], [5, 5.0]]
10 """
11 n, m = [Link], [Link]
12 if not isinstance(B, Matrix):
13 if n == m:
14 B = [Link](n, B)
15 elif n == 1 or m == 1:
16 B = Matrix([[B for c in range(m)] for r in range(n)])
17 if [Link]!=n or [Link]!=m:
18 raise ArithmeticError("incompatible dimensions")
19 C = Matrix(n, m)
20 for r in range(n):
21 for c in range(m):
22 C[r, c] = A[r, c]+B[r, c]
23 return C
24

25 def __sub__(A, B):


26 """
27 Adds A and B element by element, A and B must have the same size
28 Example
29 >>> A = Matrix([[4.0, 3.0], [2.0, 1.0]])
30 >>> B = Matrix([[1.0, 2.0], [3.0, 4.0]])
31 >>> C = A - B
32 >>> print(C)
33 [[3.0, 1.0], [-1.0, -3.0]]
34 """
35 n, m = [Link], [Link]
36 if not isinstance(B, Matrix):
37 if n == m:
38 B = [Link](n, B)
numerical algorithms 165

39 elif n == 1 or m == 1:
40 B = Matrix(n, m, fill=B)
41 if [Link]!=n or [Link]!=m:
42 raise ArithmeticError("Incompatible dimensions")
43 C = Matrix(n, m)
44 for r in range(n):
45 for c in range(m):
46 C[r, c] = A[r, c]-B[r, c]
47 return C
48 def __radd__(A, B): #B+A
49 return A+B
50 def __rsub__(A, B): #B-A
51 return (-A)+B
52 def __neg__(A):
53 return Matrix([Link], [Link], fill=lambda r, c:-A[r, c])

With the preceding definitions, we can add matrices to matrices, subtract


matrices from matrices, but also add and subtract scalars to and from
matrices and vectors (scalars are interpreted as diagonal matrices when
added to square matrices and as constant vectors when added to vectors).
Here are some examples:

Listing 4.16: in file: [Link]


1 >>> A = Matrix([[1.0, 2.0], [3.0, 4.0]])
2 >>> print(A + A) # calls A.__add__(A)
3 [[2.0, 4.0], [6.0, 8.0]]
4 >>> print(A + 2) # calls A.__add__(2)
5 [[3.0, 2.0], [3.0, 6.0]]
6 >>> print(A - 1) # calls A.__add__(1)
7 [[0.0, 2.0], [3.0, 3.0]]
8 >>> print(-A) # calls A.__neg__()
9 [[-1.0, -2.0], [-3.0, -4.0]]
10 >>> print(5 - A) # calls A.__rsub__(5)
11 [[4.0, -2.0], [-3.0, 1.0]]
12 >>> b = Matrix([[1.0], [2.0], [3.0]])
13 >>> print(b + 2) # calls b.__add__(2)
14 [[3.0], [4.0], [5.0]]

The class Matrix works with complex numbers as well:

Listing 4.17: in file: [Link]


1 >>> A = Matrix([[1, 2], [3, 4]])
2 >>> print(A + 1j)
3 [[(1+1j), 2.0], [3.0, (4+1j)]]

Now we implement multiplication. We are interested in three types of


166 annotated algorithms in python

multiplication: multiplication of a scalar by a matrix (__rmul__), multipli-


cation of a matrix by a matrix (__mul__), and scalar product between two
vectors (also handled by __mul__):

Listing 4.18: in file: [Link]


1 def __rmul__(A, x):
2 "multiplies a number of matrix A by a scalar number x"
3 M = [Link](A)
4 for r in range([Link]):
5 for c in range([Link]):
6 M[r, c] *= x
7 return M
8

9 def __mul__(A, B):


10 "multiplies a number of matrix A by another matrix B"
11 if isinstance(B, (list, tuple)):
12 return (A * Matrix(len(B), 1, fill=lambda r, c:B[r])).nrows
13 elif not isinstance(B, Matrix):
14 return B * A
15 elif [Link] == 1 and [Link] == 1 and [Link] == [Link]:
16 # try a scalar product ;-)
17 return sum(A[r, 0] * B[r, 0] for r in range([Link]))
18 elif [Link]!=[Link]:
19 raise ArithmeticError("Incompatible dimension")
20 M = Matrix([Link], [Link])
21 for r in range([Link]):
22 for c in range([Link]):
23 for k in range([Link]):
24 M[r, c] += A[r, k] * B[k, c]
25 return M

This allows us the following operations:

Listing 4.19: in file: [Link]


1 >>> A = Matrix([[1.0, 2.0], [3.0, 4.0]])
2 >>> print(2 * A) # scalar * matrix
3 [[2.0, 4.0], [6.0, 8.0]]
4 >>> print(A * A) # matrix * matrix
5 [[7.0, 10.0], [15.0, 22.0]]
6 >>> b = Matrix([[1], [2], [3]])
7 >>> print(b * b) # scalar product
8 14
numerical algorithms 167

4.4.2 Examples of linear transformations


In this section, we try to provide an intuitive understanding of two-
dimensional linear transformations.
In the following code, we consider an image (a set of points) containing
a circle and two orthogonal axes. We then apply the following linear
transformations to it:
• A1 , which scales the X-axis
• A2 , which scales the Y-axis
• S, which scales both axes
• B1 , which scales the X-axis and then rotates (R) the image 0.5 rad
• B2 , which is neither a scaling nor a rotation; as it can be seen from the
image, it does not preserve angles

Listing 4.20: in file: [Link]


1 >>> points = [([Link](0.0628 * t), [Link](0.0628 * t)) for t in range(200)]
2 >>> points += [(0.02 * t, 0) for t in range(50)]
3 >>> points += [(0, 0.02 * t) for t in range(50)]
4 >>> Canvas(title="Linear Transformation", xlab="x", ylab="y",
5 ... xrange=(-1, 1), yrange=(-1, 1)).ellipses(points).save("[Link]")
6 >>> def f(A, points, filename):
7 ... data = [(A[0, 0] * x+A[0, 1] * y, A[1, 0] * x+A[1, 1] * y) for (x, y)
in points]
8 ... Canvas(title="Linear Transformation", xlab="x", ylab="y"
9 ... ).ellipses(points).ellipses(data).save(filename)
10 >>> A1 = Matrix([[0.2, 0], [0, 1]])
11 >>> f(A1, points, "[Link]")
12 >>> A2 = Matrix([[1, 0], [0, 0.2]])
13 >>> f(A2, points, "[Link]")
14 >>> S = Matrix([[0.3, 0], [0, 0.3]])
15 >>> f(S, points, "[Link]")
16 >>> s, c = [Link](0.5), [Link](0.5)
17 >>> R = Matrix([[c, -s], [s, c]])
18 >>> B1 = R * A1
19 >>> f(B1, points, "[Link]")
20 >>> B2 = Matrix([[0.2, 0.4], [0.5, 0.3]])
21 >>> f(B2, points, "[Link]")

The same transformations can be expressed more efficiently using


NumPy:
168 annotated algorithms in python

1 >>> import numpy as np


2 >>> t = [Link](0, 2 * [Link], 200)
3 >>> circle = np.column_stack([[Link](t), [Link](t)])
4 >>> xaxis = np.column_stack([[Link](0, 1, 50), [Link](50)])
5 >>> yaxis = np.column_stack([[Link](50), [Link](0, 1, 50)])
6 >>> points = [Link]([circle, xaxis, yaxis])
7 >>> A1 = [Link]([[0.2, 0], [0, 1]])
8 >>> transformed = points @ A1.T # matrix multiplication on all points at once
numerical algorithms 169

Figure 4.3: Example of the effect of different linear transformations on the same set of
points. From left to right, top to bottom, they show stretching along both the X- and
Y-axes, scaling across both axes, a rotation, and a generic transformation that does not
preserve angles.

4.4.3 Matrix inversion and the Gauss–Jordan algorithm


Implementing the inverse of the multiplication (division) is a more chal-
lenging task.
We define A−1 , the inverse of the square matrix A, as that matrix such
that for every vector b, A( x ) = b implies ( x ) = A−1 b. The Gauss–Jordan
algorithm computes A−1 given A.
To implement it, we must first understand how it works. Consider the
following equation:

Ax = b (4.54)
170 annotated algorithms in python

We can rewrite it as:


Ax = Bb (4.55)
where B = 1, the identity matrix. This equation remains true if we multi-
ply both terms by a nonsingular matrix S0 :

S0 Ax = S0 Bb (4.56)

The trick of the Gauss–Jordan elimination consists in finding a series of


matrices S0 , S1 , ..., Sn−1 so that

Sn−1 ...S1 S0 Ax = Sn−1 ...S1 S0 Bb = x (4.57)

Because the preceding expression must be true for every b and because x
is the solution of Ax = b, by definition, Sn−1 . . . S1 S0 B ≡ A−1 .
The Gauss-Jordan algorithm works exactly this way: given A, it computes
A −1 :

Listing 4.21: in file: [Link]


1 def __rtruediv__(A, x):
2 """Computes x/A using Gauss-Jordan elimination where x is a scalar"""
3 n = [Link]
4 if [Link] != n:
5 raise ArithmeticError("matrix not squared")
6 indexes = range(n)
7 A = [Link](A)
8 B = [Link](n, x)
9 for c in indexes:
10 for r in range(c+1, n):
11 if abs(A[r, c])>abs(A[c, c]):
12 A.swap_rows(r, c)
13 B.swap_rows(r, c)
14 p = 0.0 + A[c, c] # trick to make sure it is not integer
15 for k in indexes:
16 A[c, k] = A[c, k]/p
17 B[c, k] = B[c, k]/p
18 for r in range(n):
19 if r == c:
20 continue
21 p = 0.0 + A[r, c] # trick to make sure it is not integer
22 for k in indexes:
23 A[r, k] -= A[c, k] * p
24 B[r, k] -= B[c, k] * p
25 return B
numerical algorithms 171

26
27 def __truediv__(A, B):
28 if isinstance(B, Matrix):
29 return A * (1.0/B) # matrix/matrix
30 else:
31 return (1.0/B) * A # matrix/scalar

Here is an example, and we will see many more applications later:

Listing 4.22: in file: [Link]


1 >>> A = Matrix([[1, 2], [4, 9]])
2 >>> print(1/A)
3 [[9.0, -2.0], [-4.0, 1.0]]
4 >>> print(A/A)
5 [[1.0, 0.0], [0.0, 1.0]]
6 >>> print(A/2)
7 [[0.5, 1.0], [2.0, 4.5]]

4.4.4 Transposing a matrix


Another operation that we will need is transposition:

Listing 4.23: in file: [Link]


1 @property
2 def T(A):
3 """Transposed of A"""
4 return Matrix([Link], [Link], fill=lambda r, c: A[c, r])

Notice the new matrix is defined with the number of rows and columns
switched from matrix A. Notice that in Python, a property is a method
that is called like an attribute, therefore without the () notation. This can
be used as follows:

Listing 4.24: in file: [Link]


1 >>> A = Matrix([[1, 2], [3, 4]])
2 >>> print(A.T)
3 [[1, 3], [2, 4]]

For later use, we define two functions to check whether a matrix is sym-
metrical or zero within a given precision.
Another typical transformation for matrices of complex numbers is the
Hermitian operation, which is a transposition combined with complex
conjugation of the elements:
172 annotated algorithms in python

Listing 4.25: in file: [Link]


1 @property
2 def H(A):
3 """Hermitian of A"""
4 return Matrix([Link], [Link], fill=lambda r, c: A[c, r].conj())

In later algorithms we will need to check whether a matrix is symmetrical


(or almost symmetrical given precision) or zero (or almost zero):

Listing 4.26: in file: [Link]


1 def is_almost_symmetric(A, ap=1e-6, rp=1e-4):
2 if [Link] != [Link]: return False
3 for r in range([Link]):
4 for c in range(r):
5 delta = abs(A[r, c]-A[c, r])
6 if delta>ap and delta>max(abs(A[r, c]), abs(A[c, r])) * rp:
7 return False
8 return True
9
10 def is_almost_zero(A, ap=1e-6, rp=1e-4):
11 for r in range([Link]):
12 for c in range([Link]):
13 delta = abs(A[r, c]-A[c, r])
14 if delta>ap and delta>max(abs(A[r, c]), abs(A[c, r])) * rp:
15 return False
16 return True

4.4.5 Solving systems of linear equations


Linear algebra is fundamental for solving systems of linear equations such
as the following:

x0 + 2x1 + 2x2 = 3 (4.58)


4x0 + 4x1 + 2x2 = 6 (4.59)
4x0 + 6x1 + 4x2 = 10 (4.60)

This can be rewritten using the equivalent linear algebra notation:

Ax = b (4.61)
numerical algorithms 173

where    
1 2 2 3
A= 4 and b= 6  (4.62)
   
4 2 
4 6 4 10

The solution of the equation can now be written as


x = A −1 b (4.63)

We can easily solve the system with our Python library:

Listing 4.27: in file: [Link]


1 >>> A = Matrix([[1, 2, 2], [4, 4, 2], [4, 6, 4]])
2 >>> b = Matrix([[3], [6], [10]])
3 >>> x = (1/A) * b
4 >>> print(x)
5 [[-1.0], [3.0], [-1.0]]

Notice that b is a column vector and therefore


1 >>> b = Matrix([[3], [6], [10]])

but not
1 >>> b = Matrix([[3, 6, 10]]) # wrong

We can also obtain a column vector by performing a transposition of a


row vector:
1 >>> b = Matrix([[3, 6, 10]]).T

Using NumPy, linear systems are solved more efficiently:


1 >>> import numpy as np
2 >>> A = [Link]([[1, 2, 2], [4, 4, 2], [4, 6, 4]], dtype=float)
3 >>> b = [Link]([3, 6, 10], dtype=float)
4 >>> x = [Link](A, b)
5 >>> print(x)
6 [-1. 3. -1.]
7 >>> # Matrix inverse (when needed):
8 >>> A_inv = [Link](A)

4.4.6 Norm and condition number again


By norm of a vector, we often refer to the 2-norm defined using the
Pythagoras theorem: r
|| x ||2 = ∑ xi2 (4.64)
i
174 annotated algorithms in python

For a vector, we can define the p-norm as a generalization of the 2-norm:

!1
p
|| x || p ≡ ∑ abs(xi ) p
(4.65)
i

We can extend the notation of a norm to any function that maps a vector
into a vector, as follows:

|| f || p ≡ maxx || f ( x )|| p /|| x || p (4.66)

An immediate application is to functions implemented as linear transfor-


mations:

|| A|| p ≡ maxx || Ax || p /|| x || p (4.67)

This can be difficult to compute in the general case, but it reduces to a


simple formula for the 1-norm:

|| A||1 ≡ max j ∑ abs( Aij ) (4.68)


i

The 2-norm is difficult to compute for a matrix, but the 1-norm provides
an approximation. It is computed by adding up the magnitude of the
elements per each column and finding the maximum sum.
This allows us to define a generic function to compute the norm of lists,
matrices/vectors, and scalars:

Listing 4.28: in file: [Link]


1 def norm(A, p=1):
2 if isinstance(A, (list, tuple)):
3 return sum(abs(x) ** p for x in A) ** (1.0/p)
4 elif isinstance(A, Matrix):
5 if [Link] == 1 or [Link] == 1:
6 return sum(norm(A[r, c]) ** p \
7 for r in range([Link]) \
8 for c in range([Link])) ** (1.0/p)
9 elif p == 1:
numerical algorithms 175

10 return max([sum(norm(A[r, c]) \


11 for r in range([Link])) \
12 for c in range([Link])])
13 else:
14 raise NotImplementedError
15 else:
16 return abs(A)

In NumPy, norms are computed directly:


1 >>> import numpy as np
2 >>> a = [Link]([1.0, 2.0, 3.0])
3 >>> [Link](a, ord=1) # 1-norm of a vector
4 6.0
5 >>> [Link](a, ord=2) # 2-norm of a vector
6 3.741...
7 >>> A = [Link]([[1, 2], [3, 4]])
8 >>> [Link](A, ord=1) # 1-norm of a matrix
9 6.0
10 >>> [Link](A, p=1) # condition number
11 21.0

Now we can implement a function that computes the condition number


for ordinary functions as well as for linear transformations represented
by a matrix:

Listing 4.29: in file: [Link]


1 def condition_number(f, x=None, h=1e-6):
2 if callable(f) and not x is None:
3 return D(f, h)(x) * x/f(x)
4 elif isinstance(f, Matrix): # if is the Matrix
5 return norm(f) * norm(1/f)
6 else:
7 raise NotImplementedError

Here are some examples:

Listing 4.30: in file: [Link]


1 >>> def f(x): return x * x-5.0 * x
2 >>> print(round(condition_number(f, 1), 2))
3 0.75
4 >>> A = Matrix([[1, 2], [3, 4]])
5 >>> print(round(condition_number(A), 2))
6 21.0

Having the norm for matrices also allows us to extend the definition of
convergence of a Taylor series to a series of matrices:
176 annotated algorithms in python

Listing 4.31: in file: [Link]


1 def exp(x, ap=1e-6, rp=1e-4, ns=40):
2 if isinstance(x, Matrix):
3 t = s = [Link]([Link])
4 for k in range(1, ns):
5 t = t * x/k # next term
6 s = s + t # add next term
7 if norm(t)<max(ap, norm(s) * rp): return s
8 raise ArithmeticError("no convergence")
9 elif type(x) == type(1j):
10 return [Link](x)
11 else:
12 return [Link](x)

Listing 4.32: in file: [Link]


1 >>> A = Matrix([[1, 2], [3, 4]])
2 >>> print(exp(A))
3 [[51.96..., 74.73...], [112.10..., 164.07...]]

4.4.7 Cholesky factorization


A matrix is said to be positive definite if x t Ax > 0 for every x ̸= 0.
If a matrix is symmetric and positive definite, then there exists a lower
triangular matrix L such that A = LLt . A lower triangular matrix is a
matrix that has zeros above the diagonal elements.
The Cholesky algorithm takes a matrix A as input and returns the matrix
L:

Listing 4.33: in file: [Link]


1 def Cholesky(A):
2 if not is_almost_symmetric(A):
3 raise ArithmeticError("not symmetric")
4 L = [Link](A)
5 for k in range([Link]):
6 if L[k, k]<=0:
7 raise ArithmeticError("not positive definite")
8 p = L[k, k] = [Link](L[k, k])
9 for i in range(k+1, [Link]):
10 L[i, k] /= p
11 for j in range(k+1, [Link]):
12 p=float(L[j, k])
13 for i in range(k+1, [Link]):
14 L[i, j] -= p * L[i, k]
15 for i in range([Link]):
numerical algorithms 177

16 for j in range(i+1, [Link]):


17 L[i, j]=0
18 return L

Here we provide an example and a check that indeed A = LLt :

Listing 4.34: in file: [Link]


1 >>> A = Matrix([[4, 2, 1], [2, 9, 3], [1, 3, 16]])
2 >>> L = Cholesky(A)
3 >>> is_almost_zero(A - L * L.T)
4 True

The Cholesky algorithm fails if and only if the input matrix is not sym-
metric or not positive definite, therefore it can be used to check whether
a symmetric matrix is positive definite.
Consider for example a generic covariance matrix A. It is supposed to be
positive definite, but sometimes it is not, because it is computed incor-
rectly by taking different subsets of the data to compute Aij , A jk , and Aik .
The Cholesky algorithm provides an algorithm to check whether a matrix
is positive definite:

Listing 4.35: in file: [Link]


1 def is_positive_definite(A):
2 if not is_almost_symmetric(A):
3 return False
4 try:
5 Cholesky(A)
6 return True
7 except Exception:
8 return False

Another application of the Cholesky is in generating vectors x with prob-


ability distribution

 
1
p(x) ∝ exp − xt A−1 x (4.69)
2
where A is a symmetric and positive definite matrix. In fact, if A = LLt ,
then  
1 −1 t −1
p(x) ∝ exp − ( L x) ( L x) (4.70)
2
178 annotated algorithms in python

and with a change of variable u = L−1 x, we obtain


 
1 t
p(x) ∝ exp − u u (4.71)
2

and
1 2 1 2 1 2
p(x) ∝ e− 2 u0 e− 2 u1 e− 2 u2 ... (4.72)
Therefore the ui components are Gaussian random variables.
In summary, given a covariance matrix A, we can generate random vectors
x or random numbers with the same covariance simply by doing
1 def RandomList(A):
2 L = Cholesky(A)
3 while True:
4 u = Matrix([[[Link](0, 1)] for c in range([Link])])
5 yield (L * u).flatten()

Here is an example of how to use it:


1 >>> A = Matrix([[1.0, 0.1], [0.2, 3.0]])
2 >>> for k, v in enumerate(RandomList(A)):
3 ... print(v)

The RandomList is a generator. You can iterate over it. The yield keyword
is used like return, except the function will return a generator.
Using NumPy, the Cholesky decomposition and correlated random vector
generation are built-in:
1 >>> import numpy as np
2 >>> A = [Link]([[1.0, 0.1], [0.2, 3.0]])
3 >>> L = [Link](A)
4 >>> samples = L @ [Link](2, 1000) # 1000 correlated random vectors

4.4.8 Modern portfolio theory


Modern portfolio theory [34] is an investment approach that tries to max-
imize return given a fixed risk. Many different metrics have been pro-
posed. One of them is the Sharpe ratio.
For a stock or a portfolio with an average return r and risk σ, the Sharpe
ratio is defined as
Sharpe(r, σ ) ≡ (r − r̄ )/σ (4.73)
numerical algorithms 179

Here r̄ is the current risk-free investment rate. Usually the risk is mea-
sured as the standard deviation of its daily (or monthly or yearly) return.
Consider the stock price pit of stock i at time t and its arithmetic daily
return rit = ( pi,t+1 − pit )/pit given a risk-free interest equal to r̄.
For each stock, we can compute the average return and average risk (vari-
ance of daily returns) and display it in a risk-return plot as we did in
chapter 2.
We can try to build arbitrary portfolios by investing in multiple stocks at
the same time. Modern portfolio theory states that there is a maximum
Sharpe ratio and there is one portfolio that corresponds to it. It is called
the tangency portfolio.
A portfolio is identified by fractions of $1 invested in each stock in the
portfolio. Our goal is to determine the tangent portfolio.
If we assume that daily returns for the stocks are Gaussian, then the solv-
ing algorithm is simple.
All we need is to compute the average return for each stock, defined as

ri = 1/T ∑ rit (4.74)


t

and the covariance matrix


1
Aij =
T ∑(rit − ri )(r jt − r j ) (4.75)
t

Modern portfolio theory tells us that the tangent portfolio is given by

x = A−1 (r − r̄1) (4.76)

The inputs of the formula are the covariance matrix (A), a vector or arith-
metic returns for the assets in the portfolio (r), the risk free rate (r̄). The
output is a vector (x) whose elements are the percentages to be invested
in each asset to obtain a tangency portfolio. Notice that some elements of
x can be negative and this corresponds to short position (sell, not buy, the
asset).
Here is the algorithm:
180 annotated algorithms in python

Listing 4.36: in file: [Link]


1 def Markowitz(mu, A, r_free):
2 """Assess Markowitz risk/return.
3 Example:
4 >>> cov = Matrix([[0.04, 0.006, 0.02],
5 ... [0.006, 0.09, 0.06],
6 ... [0.02, 0.06, 0.16]])
7 >>> mu = Matrix([[0.10], [0.12], [0.15]])
8 >>> r_free = 0.05
9 >>> x, ret, risk = Markowitz(mu, cov, r_free)
10 >>> print(x)
11 [0.556634..., 0.275080..., 0.1682847...]
12 >>> print(ret, risk)
13 0.113915... 0.186747...
14 """
15 x = Matrix([[0.0] for r in range([Link])])
16 x = (1/A) * (mu - r_free)
17 x = x/sum(x[r, 0] for r in range([Link]))
18 portfolio = [x[r, 0] for r in range([Link])]
19 portfolio_return = mu * x
20 portfolio_risk = sqrt(x * (A * x))
21 return portfolio, portfolio_return, portfolio_risk

Here is an example. We consider three assets (0, 1, 2) with the following


covariance matrix:
1 >>> cov = Matrix([[0.04, 0.006, 0.02],
2 ... [0.006, 0.09, 0.06],
3 ... [0.02, 0.06, 0.16]])

and the following expected returns (arithmetic returns, not log returns,
because the former are additive, whereas the latter are not):
1 >>> mu = Matrix([[0.10], [0.12], [0.15]])

Given the risk-free interest rate


1 >>> r_free = 0.05

we compute the tangent portfolio (highest Sharpe ratio), its return, and
its risk with one function call:
1 >>> x, ret, risk = Markowitz(mu, cov, r_free)
2 >>> print(x)
3 [0.5566343042071198, 0.27508090614886727, 0.16828478964401297]
4 >>> ret, risk
5 0.113915857605 0.186747095412
6 >>> (ret-r_free).risk
7 0.34225891152
8 >>> for r in range(3): print((mu[r, 0]-r_free)/sqrt(cov[r, r]))
numerical algorithms 181

9 0.25
10 0.233333333333
11 0.25

The same portfolio optimization using NumPy:


1 >>> import numpy as np
2 >>> cov = [Link]([[0.04, 0.006, 0.02],
3 ... [0.006, 0.09, 0.06],
4 ... [0.02, 0.06, 0.16]])
5 >>> mu = [Link]([0.10, 0.12, 0.15])
6 >>> r_free = 0.05
7 >>> x = [Link](cov, mu - r_free)
8 >>> x = x / [Link]()
9 >>> portfolio_return = mu @ x
10 >>> portfolio_risk = [Link](x @ cov @ x)
11 >>> print(x)
12 [0.5566... 0.2750... 0.1682...]
13 >>> print(portfolio_return, portfolio_risk)
14 0.1139... 0.1867...

Investing 55% in asset 0, 27% in asset 1, and 16% in asset 2, the resulting
portfolio has an expected return of 11.39% and a risk of 18.67%, which
corresponds to a Sharpe ratio of 0.34, much higher than 0.25, 0.23, and
0.23 for the individual assets.
Notice that the tangency portfolio is not the only one with the highest
Sharpe ratio (return for unit of risk). In fact, any linear combination of
the tangency portfolio with a risk-free asset (putting money in the bank)
has the same Sharpe ratio. For any target risk, one can find a linear
combination of the risk-free asset and the tangent portfolio that has a
better Sharpe ratio than any other possible portfolio comprising the same
assets.
If we call α the fraction of the money to invest in the tangency portfolio
and 1 − α the fraction to keep in the bank at the risk free rate, the resulting
combined portfolio has return:

αx · r + (1 − α)r̄ (4.77)

and risk
182 annotated algorithms in python


α xt Ax (4.78)

We can determine α by deciding how much risk we are willing to take,


and these formulas tell us the optimal portfolio for that amount of risk.

4.4.9 Linear least squares, χ2


Consider a set of data points ( x J , y j ) = (t j , o j ± do j ). We want to fit them
with a linear combination of linear independent functions f i so that

c0 f 0 (t0 ) + c1 f 1 (t0 ) + c2 f 2 (t0 ) + ... = e0 ≃ o0 ± do0 (4.79)


c0 f 0 (t1 ) + c1 f 1 (t1 ) + c2 f 2 (t1 ) + ... = e1 ≃ o1 ± do1 (4.80)
c0 f 0 (t2 ) + c1 f 1 (t2 ) + c2 f 2 (t2 ) + ... = e2 ≃ o2 ± do2 (4.81)
... = ... (4.82)

We want to find the {ci } that minimizes the sum of the squared distances
between the actual “observed” data o j and the predicted “expected” data
e j , in units of do j . This metric is called χ2 in general [35]. An algorithm
that minimizes the χ2 and is linear in the ci coefficients (our case here) is
called linear least squares or linear regression.

2
ej − oj
2
χ = ∑ do j
(4.83)
j

If we define the matrix A and B as

f 0 ( t0 ) f 1 ( t0 ) f 2 ( t0 )
   
o0
do0 do0 do0 ... do0
 f 0 ( t1 ) f 1 ( t1 ) f 2 ( t1 )   o1 

do1 do1 do1 ...   do1

A= f 0 ( t2 ) f 1 ( t2 ) f 2 ( t2 )
 b= o2
 (4.84)
... 
   
 do2 do2 do2  do2 
... ... ... ... ...

then the problem is reduced to


numerical algorithms 183

min χ2 = min | Ac − b|2 (4.85)


c c
= min( Ac − b)t ( Ac − b) (4.86)
c
= min(ct At Ax − 2bt Ac + bt b) (4.87)
c

This is the same as solving the following equation:

∇c (ct At Ax − 2ct At b + bt b) = 0 (4.88)


t t
A Ac − A b = 0 (4.89)

Its solution is

c = ( A t A ) −1 ( A t b ) (4.90)

The following algorithm implements a fitting function based on the pre-


ceding procedure. It takes as input a list of functions f i and a list of points
p j = (t j , o j , do j ) and returns three objects—a list with the c coefficients, the
value of χ2 for the best fit, and the fitting function:

Listing 4.37: in file: [Link]


1 def fit_least_squares(points, f):
2 """
3 Computes c_j for best linear fit of y[i] \pm dy[i] = fitting_f(x[i])
4 where fitting_f(x[i]) is \sum_j c_j f[j](x[i])
5

6 parameters:
7 - a list of fitting functions
8 - a list with points (x, y, dy)
9

10 returns:
11 - column vector with fitting coefficients
12 - the chi2 for the fit
13 - the fitting function as a lambda x: ....
14 """
15 def eval_fitting_function(f, c, x):
16 if len(f) == 1: return c * f[0](x)
17 else: return sum(func(x) * c[i, 0] for i, func in enumerate(f))
184 annotated algorithms in python

18 A = Matrix(len(points), len(f))
19 b = Matrix(len(points))
20 for i in range([Link]):
21 weight = 1.0/points[i][2] if len(points[i])>2 else 1.0
22 b[i, 0] = weight * float(points[i][1])
23 for j in range([Link]):
24 A[i, j] = weight * f[j](float(points[i][0]))
25 c = (1.0/(A.T * A)) * (A.T * b)
26 chi = A * c-b
27 chi2 = norm(chi, 2) ** 2
28 fitting_f = lambda x, c=c, f=f, q=eval_fitting_function: q(f, c, x)
29 cs = [c] if isinstance(c, float) else [Link]()
30 return cs, chi2, fitting_f
31

32 # examples of fitting functions


33 def POLYNOMIAL(n):
34 return [(lambda x, p=p: x ** p) for p in range(n+1)]
35 CONSTANT = POLYNOMIAL(0)
36 LINEAR = POLYNOMIAL(1)
37 QUADRATIC = POLYNOMIAL(2)
38 CUBIC = POLYNOMIAL(3)
39 QUARTIC = POLYNOMIAL(4)

In NumPy, least squares fitting is available directly:


1 >>> import numpy as np
2 >>> points = [(k, 5 + 0.8*k + 0.3*k*k + [Link](k), 2) for k in range(100)]
3 >>> x = [Link]([p[0] for p in points], dtype=float)
4 >>> y = [Link]([p[1] for p in points], dtype=float)
5 >>> dy = [Link]([p[2] for p in points], dtype=float)
6 >>> # Build design matrix for quadratic fit, weighted by 1/dy
7 >>> A = np.column_stack([np.ones_like(x), x, x**2]) / dy[:, None]
8 >>> b = y / dy
9 >>> c, residuals, rank, sv = [Link](A, b, rcond=None)
10 >>> # Or simply use [Link] for polynomial fits:
11 >>> c_poly = [Link](x, y, deg=2, w=1.0/dy)

The same fit can be performed using scikit-learn. All scikit-learn es-
timators follow the fit/predict pattern: we create a model object, call
[Link](X, y) to train it on feature matrix X and target vector y, and
then call [Link](X_new) to generate predictions for new data. This
uniform interface applies to every estimator in the library—linear regres-
sion, neural networks, decision trees, support vector machines, and so
on—making it easy to swap models without changing the surrounding
code. The feature matrix X is always two-dimensional (rows are samples,
columns are features), while y is a one-dimensional target vector.
numerical algorithms 185

1 >>> import numpy as np


2 >>> from sklearn.linear_model import LinearRegression
3 >>> from [Link] import PolynomialFeatures
4 >>> x = [Link](100, dtype=float).reshape(-1, 1) # column vector
5 >>> y = 5 + 0.8*[Link]() + 0.3*[Link]()**2 + [Link]([Link]())
6 >>> # PolynomialFeatures transforms x into [1, x, x^2]
7 >>> poly = PolynomialFeatures(degree=2)
8 >>> X = poly.fit_transform(x)
9 >>> model = LinearRegression()
10 >>> [Link](X, y) # train the model
11 >>> y_pred = [Link](X) # predict on same or new data
12 >>> print(model.coef_) # fitted coefficients

As an example, we can use it to perform a polynomial fit: given a set of


points, we want to find the coefficients of a polynomial that best approxi-
mate those points.
In other words, we want to find the ci such that, given t j and o j ,

c0 + c1 t10 + c2 t20 + ... = e0 ≃ o0 ± do0 (4.91)


c0 + c1 t11 + c2 t21 + ... = e1 ≃ o1 ± do1 (4.92)
c0 + c1 t12 + c2 t22 + ... = e2 ≃ o2 ± do2 (4.93)
... ... (4.94)
(4.95)

Here is how we can generate some random points and solve the problem
for a polynomial of degree 2 (or quadratic fit):

Listing 4.38: in file: [Link]


1 >>> points = [(k, 5+0.8 * k+0.3 * k * k+[Link](k), 2) for k in range(100)]
2 >>> a, chi2, fitting_f = fit_least_squares(points, QUADRATIC)
3 >>> for p in points[-10:]:
4 ... print(p[0], round(p[1], 2), round(fitting_f(p[0]), 2))
5 90 2507.89 2506.98
6 91 2562.21 2562.08
7 92 2617.02 2617.78
8 93 2673.15 2674.08
9 94 2730.75 2730.98
10 95 2789.18 2788.48
11 96 2847.58 2846.58
12 97 2905.68 2905.28
13 98 2964.03 2964.58
14 99 3023.5 3024.48
15 >>> Canvas(title="polynomial fit", xlab="t", ylab="e(t), o(t)"
186 annotated algorithms in python

16 ... ).errorbar(points[:10], legend="o(t)"


17 ... ).plot([(p[0], fitting_f(p[0])) for p in points[:10]], legend="e(t)"
18 ... ).save("images/[Link]")

Fig. 4.4 is a plot of the first 10 points compared with the best fit:

Figure 4.4: Random data with their error bars and the polynomial best fit.

We can also define a χ2do f = χ2 /( N − 1) where N is the number of c


parameters determined by the fit. A value of χ2do f ≃ 1 indicates a good
fit. In general, the smaller χ2do f , the better the fit. A large value of χ2do f
is a symptom of poor modeling (the assumptions of the fit are wrong),
whereas a value χ2do f much smaller than 1 is a symptom of an overestimate
of the errors do j (or perhaps manufactured data).

4.4.10 Trading and technical analysis


In finance, technical analysis is an empirical discipline that consists of fore-
casting the direction of prices through the study of patterns in historical
data (in particular, price and volume). As an example, we implement a
simple strategy that consists of the following steps:
numerical algorithms 187

• We fit the adjusted closing price for the previous seven days and use
our fitting function to predict the adjusted close for the next day.
• If we have cash and predict the price will go up, we buy the stock.
• If we hold the stock and predict the price will go down, we sell the
stock.

Listing 4.39: in file: [Link]


1 class Trader:
2 def model(self, window):
3 "the forecasting model"
4 # we fit last few days quadratically
5 points = list(enumerate(window))
6 a, chi2, fitting_f = fit_least_squares(points, QUADRATIC)
7 # and we extrapolate tomorrow"s price
8 tomorrow_prediction = fitting_f(len(points))
9 return tomorrow_prediction
10

11 def strategy(self, history, ndays=7):


12 "the trading strategy"
13 if len(history)<ndays:
14 return
15 else:
16 today_close = history[-1]
17 tomorrow_prediction = [Link](history[-ndays:])
18 return "buy" if tomorrow_prediction>today_close else "sell"
19
20 def simulate(self, data, cash=1000.0, shares=0.0, daily_rate=0.03/360):
21 "find fitting parameters that optimize the trading strategy"
22 for t in range(len(data)):
23 suggestion = [Link](data[:t])
24 today_close = data[t-1]
25 # and we buy or sell based on our strategy
26 if cash>0 and suggestion == "buy":
27 # we keep track of finances
28 shares_bought = int(cash/today_close)
29 shares += shares_bought
30 cash -= shares_bought * today_close
31 elif shares>0 and suggestion == "sell":
32 cash += shares * today_close
33 shares = 0.0
34 # we assume money in the bank also gains an interest
35 cash *=[Link](daily_rate)
36 # we return the net worth
37 return cash + shares * data[-1]

Now we back test the strategy using fake financial data. We can generate
188 annotated algorithms in python

fake financial data with this function:

Listing 4.40: in file: [Link]


1 def fake_stock_prices(start_price=100, average_return=0.05, volatility=0.30,
days=100):
2 daily_volatility = volatility/[Link](250)
3 daily_return = average_return/250
4 s = [[Link](0, daily_volatility) for d in range(days-1)]
5 mu = daily_return - sum(s)/(days-1)
6 v = [start_price]
7 for item in s:
8 [Link](v[-1] * [Link](mu + item))
9 return v

Listing 4.41: in file: [Link]


1 >>> initial_cash = 1000
2 >>> data = fake_stock_prices(average_return=0.05)
3 >>> final_cash = Trader().simulate(data, cash=initial_cash)
4 >>> naive_profit = initial_cash * ([Link](0.05) - 1)
5 >>> strategy_profit = final_cash - initial_cash

If strategy_profit > naive_profit then our strategy outperforms the naive


buy and hold strategy.
Using NumPy, the fake stock price generation is vectorized:
1 >>> import numpy as np
2 >>> def fake_stock_prices_np(start_price=100, average_return=0.05,
3 ... volatility=0.30, days=100):
4 ... daily_vol = volatility / [Link](250)
5 ... daily_ret = average_return / 250
6 ... s = [Link](0, daily_vol, days - 1)
7 ... mu = daily_ret - [Link]()
8 ... log_returns = [Link]([[0], [Link](mu + s)])
9 ... return start_price * [Link](log_returns)

Of course, we can always engineer a strategy based on historical data that


will outperform holding the stock, but past performance is never a guarantee
of future performance.
According to the definition from [Link], “technical analysts be-
lieve that the historical performance of stocks and markets is an indication
of future performance.”
The efficacy of both technical and fundamental analysis is disputed by
the efficient-market hypothesis, which states that stock market prices are
numerical algorithms 189

essentially unpredictable [36].


It is easy to extend the previous class to implement other strategies and
back test them.

4.4.11 Eigenvalues and the Jacobi algorithm


Given a matrix A, an eigenvector is defined as a vector x such that Ax
is proportional to x. The proportionality factor is called an eigenvalue, e.
One matrix may have many eigenvectors xi and associated eigenvalues ei :

Axi = ei xi (4.96)

For example:
! !
1 -2 -1
A= and xi = (4.97)
1 4 1

! ! !
1 -2 -1 -1
∗ = 3∗ (4.98)
1 4 1 1

In this case, xi is an eigenvector and the corresponding eigenvalue is e = 3.


Some eigenvalues may be zero (ei = 0), which means the matrix A is
singular. A matrix is singular if it maps a nonzero vector into zero.
Given a square matrix A, if the space generated by the linear indepen-
dent eigenvalues has the same dimensionality as the number of rows (or
columns) of A, then its eigenvalues are real and the matrix can we written
as

A = UDU t (4.99)
where D is a diagonal matrix with eigenvalues on the diagonal Dii = ei
and U is a matrix whose column i is the xi eigenvalue.
The following algorithm is called the Jacobi algorithm. It takes as input a
symmetric matrix A and returns the matrix U and a list of corresponding
eigenvalues e, sorted from smallest to largest:
190 annotated algorithms in python

Listing 4.42: in file: [Link]


1 def sqrt(x):
2 try:
3 return [Link](x)
4 except ValueError:
5 return [Link](x)
6

7 def Jacobi_eigenvalues(A, checkpoint=False):


8 """Returns U end e so that A=U * diagonal(e) * transposed(U)
9 where i-column of U contains the eigenvector corresponding to
10 the eigenvalue e[i] of A.
11
12 from [Link]
13 """
14 def maxind(M, k):
15 j=k+1
16 for i in range(k+2, [Link]):
17 if abs(M[k, i])>abs(M[k, j]):
18 j=i
19 return j
20 n = [Link]
21 if n!=[Link]:
22 raise ArithmeticError("matrix not squared")
23 indexes = range(n)
24 S = Matrix(n, n, fill=lambda r, c: float(A[r, c]))
25 E = [Link](n)
26 state = n
27 ind = [maxind(S, k) for k in indexes]
28 e = [S[k, k] for k in indexes]
29 changed = [True for k in indexes]
30 iteration = 0
31 while state:
32 if checkpoint: checkpoint("rotating vectors (%i) ..." % iteration)
33 m=0
34 for k in range(1, n-1):
35 if abs(S[k, ind[k]])>abs(S[m, ind[m]]): m=k
36 pass
37 k, h = m, ind[m]
38 p = S[k, h]
39 y = (e[h]-e[k])/2
40 t = abs(y)+sqrt(p * p+y * y)
41 s = sqrt(p * p+t * t)
42 c = t/s
43 s = p/s
44 t = p * p/t
45 if y<0: s, t = -s, -t
46 S[k, h] = 0
47 y = e[k]
numerical algorithms 191

48 e[k] = y-t
49 if changed[k] and y == e[k]:
50 changed[k], state = False, state-1
51 elif (not changed[k]) and y!=e[k]:
52 changed[k], state = True, state+1
53 y = e[h]
54 e[h] = y+t
55 if changed[h] and y == e[h]:
56 changed[h], state = False, state-1
57 elif (not changed[h]) and y!=e[h]:
58 changed[h], state = True, state+1
59 for i in range(k):
60 S[i, k], S[i, h] = c * S[i, k]-s * S[i, h], s * S[i, k]+c * S[i, h]
61 for i in range(k+1, h):
62 S[k, i], S[i, h] = c * S[k, i]-s * S[i, h], s * S[k, i]+c * S[i, h]
63 for i in range(h+1, n):
64 S[k, i], S[h, i] = c * S[k, i]-s * S[h, i], s * S[k, i]+c * S[h, i]
65 for i in indexes:
66 E[k, i], E[h, i] = c * E[k, i]-s * E[h, i], s * E[k, i]+c * E[h, i]
67 ind[k], ind[h]=maxind(S, k), maxind(S, h)
68 iteration+=1
69 # sort vectors
70 for i in range(1, n):
71 j=i
72 while j>0 and e[j-1]>e[j]:
73 e[j], e[j-1] = e[j-1], e[j]
74 E.swap_rows(j, j-1)
75 j-=1
76 # normalize vectors
77 U = Matrix(n, n)
78 for i in indexes:
79 norm = sqrt(sum(E[i, j] ** 2 for j in indexes))
80 for j in indexes: U[j, i] = E[i, j]/norm
81 return U, e

Here is an example that shows, for a particular case, the relation between
the input, A, of the output of the U, e of the Jacobi algorithm:

Listing 4.43: in file: [Link]


1 >>> import random
2 >>> A = Matrix(4, 4)
3 >>> for r in range([Link]):
4 ... for c in range(r, [Link]):
5 ... A[r, c] = A[c, r] = [Link](10, 10)
6 >>> U, e = Jacobi_eigenvalues(A)
7 >>> is_almost_zero(U * [Link](e) * U.T-A)
8 True
192 annotated algorithms in python

In NumPy, eigenvalue decomposition is built-in and highly optimized


(using LAPACK):
1 >>> import numpy as np
2 >>> A = [Link]([[1, -2], [1, 4]], dtype=float)
3 >>> eigenvalues, eigenvectors = [Link](A) # for symmetric matrices
4 >>> # For general matrices use [Link](A)
5 >>> # Verify: A = U @ diag(e) @ U.T
6 >>> [Link](eigenvectors @ [Link](eigenvalues) @ eigenvectors.T, A)
7 True

Eigenvalues can be used to filter noise out of data and find hidden depen-
dencies in data. Following are some examples.

4.4.12 Principal component analysis


One important application of the Jacobi algorithm is for principal compo-
nent analysis (PCA). This is a mathematical procedure that converts a set
of observations of possibly correlated vectors into a set of uncorrelated
vectors called principal components.
Here we consider, as an example, the time series of the adjusted arithmetic
returns for the S&P100 stocks that we downloaded and stored in chapter
2.
Each time series is a vector. We know they are not independent because
there are correlations. Our goal is to model each time series and a vec-
tor plus noise where the vector is the same for all series. We also want
find that vector that has maximal superposition with the individual time
series, the principal component.
First, we compute the correlation matrix for all the stocks. This is a non-
trivial task because we have to make sure that we only consider those
days when all stocks were traded.

Listing 4.44: in file: [Link]


1 def compute_correlation_matrix(v):
2 """Input is a list of lists where some elements can be missing (None)"""
3 m = len(v)
4 n = len(v[0])
5 mus = [sum(v[i][k] for k in range(n))/n for i in range(m)]
6 var = [sum(v[i][k] ** 2 for k in range(n))/n - mus[i] ** 2 for i in range(m)
]
numerical algorithms 193

7 corr = Matrix(m, m, fill=lambda i, j: \


8 (sum(v[i][k] * v[j][k] for k in range(1, n))/n - mus[i] * mus[j])/
\
9 [Link](var[i] * var[j]))
10 return corr

Using NumPy, correlation matrices and PCA are straightforward:


1 >>> import numpy as np
2 >>> v = [Link](stocks) # shape (m, n): m time series of length n
3 >>> corr = [Link](v) # correlation matrix
4 >>> eigenvalues, eigenvectors = [Link](corr)

Alternatively, scikit-learn provides a dedicated PCA implementation:


1 >>> from [Link] import PCA
2 >>> pca = PCA()
3 >>> [Link](v.T) # transpose: samples as rows
4 >>> pca.explained_variance_ratio_

We use the preceding function to compute the correlation and pass it as


input to the Jacobi algorithm and plot the output eigenvalues:

Listing 4.45: in file: [Link]


1 >>> stocks = [fake_stock_prices() for i in range(5)]
2 >>> corr = compute_correlation_matrix(stocks)
3 >>> U, e = Jacobi_eigenvalues(corr)
4 >>> Canvas(title="Fake Stock Correlations", xlab="i", ylab="e[i]"
5 ... ).plot([(i, ei) for i, ei, in enumerate(e)]
6 ... ).save("images/[Link]")

The image shows that one eigenvalue, the last one, is much larger than
the others. It tells us that the data series have something in common. In
fact, the arithmetic returns for stock j at time t can be written as

rit = β i pt + αit (4.100)


where p is the principal component given by

pt = ∑ Un−1,j r jt (4.101)
i
βi = ∑ rit pt (4.102)
t
αit = rit − β i pt (4.103)
194 annotated algorithms in python

Figure 4.5: Eigenvalues of the correlation matrix for 5 fake stocks stocks, sorted by their
magnitude.

Here p is the vector of adjusted arithmetic returns that better correlates


with the returns of the individual assets and therefore best represents the
market. The β i coefficient tells us how much ri overlaps with p; α, at first
approximation, measures leftover noise.

4.5 Sparse matrix inversion

Sometimes we have to invert matrices that are very large, and the Gauss-
Jordan algorithm fails. Yet, if the matrix is sparse, in the sense that most
of its elements are zeros, then two algorithms come to our rescue: the
minimum residual and the biconjugate gradient (for which we consider a
variant called the stabilized bi-conjugate gradient).
We will also assume that the matrix to be inverted is given in some im-
plicit algorithmic as y = f (x) because this is always the case for sparse
matrices. There is no point to storing all its elements because most of
them are zero.
numerical algorithms 195

4.5.1 Minimum residual


Given a linear operator f , the Krylov space spanned by a vector x is de-
fined as

K ( f , y, i ) = {y, f (y), f ( f (y)), f ( f ( f (y))), ( f i )(y)} (4.104)


The minimum residual [37] algorithm works by solving x = f −1 (y) itera-
tively. At each iteration, it computes a new orthogonal basis vector qi for
the Krylov space K ( f , y, i ) and computes the coefficients αi that project xi
into component i of the Krylov space:

xi = y + α1 q1 + α2 q2 + ... + αi qi ∈ K ( f , y, i + 1) (4.105)

which minimizes the norm of the residue defined as:

r = f ( xi ) − y (4.106)

Therefore limi→∞ f ( xi ) = y. If a solution to the original problem exists,


ignoring precision issues, the minimum residual converges to it, and the
residue decreases at each iteration.
Notice that in the following code, x and y are exchanged because we
adopt the convention that y is the output and x is the input:

Listing 4.46: in file: [Link]


1 import copy
2

3 def invert_minimum_residual(f, x, ap=1e-4, rp=1e-4, ns=200):


4 y = [Link](x)
5 r = x-1.0 * f(x)
6 for k in range(ns):
7 q = f(r)
8 alpha = (q * r)/(q * q)
9 y = y + alpha * r
10 r = r - alpha * q
11 residue = sqrt((r * r)/[Link])
12 if residue<max(ap, norm(y) * rp): return y
13 raise ArithmeticError("no convergence")
196 annotated algorithms in python

4.5.2 Stabilized biconjugate gradient


The stabilized biconjugate gradient [38] method is also based on con-
structing a Krylov subspace and minimizing the same residue as in the
minimum residual algorithm, yet it is faster than the minimum residual
and has a smoother convergence than other conjugate gradient methods:

Listing 4.47: in file: [Link]


1 def invert_bicgstab(f, x, ap=1e-4, rp=1e-4, ns=200):
2 y = [Link](x)
3 r = x - 1.0 * f(x)
4 q = r
5 p = 0.0
6 s = 0.0
7 rho_old = alpha = omega = 1.0
8 for k in range(ns):
9 rho = q * r
10 beta = (rho/rho_old) * (alpha/omega)
11 rho_old = rho
12 p = beta * p + r - (beta * omega) * s
13 s = f(p)
14 alpha = rho/(q * s)
15 r = r - alpha * s
16 t = f(r)
17 omega = (t * r)/(t * t)
18 y = y + omega * r + alpha * p
19 residue=sqrt((r * r)/[Link])
20 if residue<max(ap, norm(y) * rp): return y
21 r = r - omega * t
22 raise ArithmeticError("no convergence")

Notice that the minimum residual and the stabilized biconjugate gradient,
if they converge, converge to the same value.
SciPy provides optimized sparse solvers that handle these cases effi-
ciently:
1 >>> import numpy as np
2 >>> from scipy import sparse
3 >>> from [Link] import spsolve, bicgstab as sp_bicgstab
4 >>> # Build a sparse matrix (e.g., tridiagonal)
5 >>> n = 100
6 >>> A = [Link]([-1, 2, -1], [-1, 0, 1], shape=(n, n), format='csc')
7 >>> b = [Link](n)
8 >>> x = spsolve(A, b) # direct sparse solver
9 >>> x2, info = sp_bicgstab(A, b) # iterative BiCGSTAB solver
numerical algorithms 197

As an example, consider the following. We take a picture using a cam-


era, but we take the picture out of focus. The image is represented
by a set of m2 pixels. The defocusing operation can be modeled as a
first approximation with a linear operator acting on the “true” image, x,
and turning it into an “out of focus” image, y. We can store the pixels
in a one-dimensional vector (both for x and y) as opposed to a matrix
by mapping the pixel (r, c) into vector component i using the relation
(r, c) = (i/m, i%m).
Hence we can write

y = Ax (4.107)

Here the linear operator A represents the effects of the lens, which trans-
forms one set of pixels into another.
We can model the lens as a sequence of β smearing operators:

A = Sβ (4.108)

where a smearing operator is a next neighbor interaction among pixels:

Sij = (1 − α/4)δi,j + αδi,j±1 + αδi,j±m (4.109)

Here α and β are smearing coefficients. When α = 0 or β = 0, the lens


has no effect, and A = I. The value of α controls how much the value
of light at point i is averaged with the value at its four neighbor points:
left (j − 1), right (j + 1), top (j + m), and bottom (j − m). The coefficient β
determines the width of the smearing radius. The larger the values of β
and α, the more out of focus is the original image.
In the following code, we generate an image x and filter it through a lens
operator smear, obtaining a smeared image y. We then use the sparse ma-
trix inverter to reconstruct the original image x given the smeared image
y. We use the color2d plotting function to represent the images:
198 annotated algorithms in python

Listing 4.48: in file: [Link]


1 >>> m = 30
2 >>> x = Matrix(m * m, 1, fill=lambda r, c:(r//m in(10, 20) or r%m in(10, 20))
and 1. or 0.)
3 >>> def smear(x):
4 ... alpha, beta = 0.4, 8
5 ... for k in range(beta):
6 ... y = Matrix([Link], 1)
7 ... for r in range(m):
8 ... for c in range(m):
9 ... y[r * m+c, 0] = (1.0-alpha/4) * x[r * m+c, 0]
10 ... if c<m-1: y[r * m+c, 0] += alpha * x[r * m+c+1, 0]
11 ... if c>0: y[r * m+c, 0] += alpha * x[r * m+c-1, 0]
12 ... if r<m-1: y[r * m+c, 0] += alpha * x[r * m+c+m, 0]
13 ... if c>0: y[r * m+c, 0] += alpha * x[r * m+c-m, 0]
14 ... x = y
15 ... return y
16 >>> y = smear(x)
17 >>> z = invert_minimum_residual(smear, y, ns=1000)
18 >>> y = [Link](m, m)
19 >>> Canvas(title="Defocused image").imshow([Link]()).save("images/defocused.
png")
20 >>> Canvas(title="refocus image").imshow([Link]()).save("images/[Link]"
)

Figure 4.6: An out-of-focus image (left) and the original image (image) computed from
the out-of-focus one, using sparse matrix inversion.

When the Hubble telescope was first put into orbit, its mirror was not
installed properly and caused the telescope to take pictures out of focus.
Until the defect was physically corrected, scientists were able to fix the
images using a similar algorithm.
numerical algorithms 199

4.6 Solvers for nonlinear equations

In this chapter, we are concerned with the problem of solving in x the


equation of one variable:

f (x) = 0 (4.110)

4.6.1 Fixed-point method


It is always possible to reformulate f ( x ) = 0 as g( x ) = x using, for exam-
ple, one of the following definitions:
• g( x ) = f ( x )/c + x for some constant c
• g( x ) = f ( x )/q( x ) + x for some q( x ) > 0 at the solution of f ( x ) = 0
We start at x0 , an arbitrary point in the domain, and close to the solution
we seek. We compute

x1 = g ( x0 ) (4.111)
x2 = g ( x1 ) (4.112)
x3 = g ( x2 ) (4.113)
... = ... (4.114)

We can compute the distance between xi and x as

| xi − x | = | g( xi−1 ) − g( x )| (4.115)
= | g( x ) + g”(ξ )( xi−1 − x ) − g( x )| (4.116)
= | g”(ξ )|| xi−1 − x | (4.117)

where we use de l"Hopital rule and ξ is a point in between x and xi−1 .


If the magnitude of the first derivative of g, | g”|, is less than 1 in a neigh-
borhood of x, and if x0 is in such a neighborhood, then

| xi − x | = | g”(ξ )|| xi−1 − x | < | xi−1 − x | (4.118)

The xi series will get closer and closer to the solution x.


200 annotated algorithms in python

Here is the process implemented into an algorithm:

Listing 4.49: in file: [Link]


1 def solve_fixed_point(f, x, ap=1e-6, rp=1e-4, ns=100):
2 def g(x): return f(x)+x # f(x)=0 <=> g(x)=x
3 Dg = D(g)
4 for k in range(ns):
5 if abs(Dg(x)) >= 1:
6 raise ArithmeticError("error D(g)(x)>=1")
7 (x_old, x) = (x, g(x))
8 if k>2 and norm(x_old-x)<max(ap, norm(x) * rp):
9 return x
10 raise ArithmeticError("no convergence")

And here is an example:

Listing 4.50: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)/10
2 >>> round(solve_fixed_point(f, 1.0, rp=0), 4)
3 2.0

4.6.2 Bisection method


The goal of the bisection [39] method is to solve f ( x ) = 0 when the func-
tion is continuous and it is known to change sign in between x = a and
x = b. The bisection method is the continuous equivalent of the binary
search algorithm seen in chapter 3. The algorithm iteratively finds the
middle point of the domain x = (b + a)/2, evaluates the function there,
and decides whether the solution is on the left or the right, thus reducing
the size of the domain from ( a, b) to ( a, x ) or ( x, b), respectively:

Listing 4.51: in file: [Link]


1 def solve_bisection(f, a, b, ap=1e-6, rp=1e-4, ns=100):
2 fa, fb = f(a), f(b)
3 if fa == 0: return a
4 if fb == 0: return b
5 if fa * fb > 0:
6 raise ArithmeticError("f(a) and f(b) must have opposite sign")
7 for k in range(ns):
8 x = (a+b)/2
9 fx = f(x)
10 if fx == 0 or norm(b-a)<max(ap, norm(x) * rp): return x
11 elif fx * fa < 0: (b, fb) = (x, fx)
12 else: (a, fa) = (x, fx)
numerical algorithms 201

13 raise ArithmeticError("no convergence")

Here is how to use it:

Listing 4.52: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(solve_bisection(f, 1.0, 3.0), 4)
3 2.0

SciPy provides optimized root-finding and minimization methods:


1 >>> from [Link] import brentq, minimize_scalar
2 >>> def f(x): return (x-2) * (x-5)
3 >>> brentq(f, 1.0, 3.0) # root finding
4 2.0
5 >>> minimize_scalar(f, bracket=(1, 3, 5)).x # minimization
6 3.5

4.6.3 Newton method


The Newton [40] algorithm also solves f ( x ) = 0. It is faster (on aver-
age) than the bisection method because it makes the additional assump-
tion that the function is also differentiable. This algorithm starts from an
arbitrary point x0 and approximates the function at that point with its
first-order Taylor expansion

f ( x ) ≃ f ( x0 ) + f ′ ( x0 )( x − x0 ) (4.119)

and solves it exactly:

f ( x0 )
f ( x ) = 0 → x = x0 − (4.120)
f ′ ( x0 )

thus finding a new and better estimate for the solution. The algorithm
iterates the preceding equation, and when it converges, it approximates
the exact solution better and better:

Listing 4.53: in file: [Link]


1 def solve_newton(f, x, ap=1e-6, rp=1e-4, ns=20):
2 x = float(x) # make sure it is not int
3 for k in range(ns):
4 (fx, Dfx) = (f(x), D(f)(x))
5 if norm(Dfx) < ap:
6 raise ArithmeticError("unstable solution")
202 annotated algorithms in python

7 (x_old, x) = (x, x-fx/Dfx)


8 if k>2 and norm(x-x_old)<max(ap, norm(x) * rp): return x
9 raise ArithmeticError("no convergence")

The algorithm is guaranteed to converge if | f ′ ( x )| > 1 in some neighbor-


hood of the solution and if the starting point is in this neighborhood. It
may also converge if this condition is not true. It is likely to fail when
| f ′ ( x )| ≃ 0 is in the neighborhood of the solution or the starting point
because the terms fx/Dfx would become very large.
Here is an example:

Listing 4.54: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(solve_newton(f, 1.0), 4)
3 2.0

4.6.4 Secant method


The secant method is very similar to the Newton method, except that
f ′ ( x ) is replaced by a numerical estimate computed using the current
point x and the previous point visited by the algorithm:

f ( x i ) − f ( x i −1 )
f ′ ( xi ) = (4.121)
x i − x i −1
f (x )
xi +i = xi − ′ i (4.122)
f ( xi )

As the algorithm approaches the exact solution, the numerical derivative


becomes a better and better approximation for the derivative:

Listing 4.55: in file: [Link]


1 def solve_secant(f, x, ap=1e-6, rp=1e-4, ns=20):
2 x = float(x) # make sure it is not int
3 (fx, Dfx) = (f(x), D(f)(x))
4 for k in range(ns):
5 if norm(Dfx) < ap:
6 raise ArithmeticError("unstable solution")
7 (x_old, fx_old, x) = (x, fx, x-fx/Dfx)
8 if k>2 and norm(x-x_old)<max(ap, norm(x) * rp): return x
9 fx = f(x)
10 Dfx = (fx-fx_old)/(x-x_old)
11 raise ArithmeticError("no convergence")
numerical algorithms 203

Here is an example:

Listing 4.56: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(solve_secant(f, 1.0), 4)
3 2.0

4.7 Optimization in one dimension

While a solver is an algorithm that finds x such that f ( x ) = 0, an op-


timization algorithm is one that finds the maximum or minimum of the
function f ( x ). If the function is differentiable, this is achieved by solving
f ′ ( x ) = 0.
For this reason, if the function is differentiable twice, we can simply re-
name all previous solvers and replace f ( x ) with f ′ ( x ) and f ′ ( x ) with
f ′′ ( x ).

4.7.1 Bisection method

Listing 4.57: in file: [Link]


1 def optimize_bisection(f, a, b, ap=1e-6, rp=1e-4, ns=100):
2 return solve_bisection(D(f), a, b , ap, rp, ns)

Here is an example:

Listing 4.58: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(optimize_bisection(f, 2.0, 5.0), 4)
3 3.5

4.7.2 Newton method

Listing 4.59: in file: [Link]


1 def optimize_newton(f, x, ap=1e-6, rp=1e-4, ns=20):
2 x = float(x) # make sure it is not int
3 (f, Df) = (D(f), DD(f))
4 for k in range(ns):
5 (fx, Dfx) = (f(x), Df(x))
6 if Dfx == 0: return x
7 if norm(Dfx) < ap:
204 annotated algorithms in python

8 raise ArithmeticError("unstable solution")


9 (x_old, x) = (x, x-fx/Dfx)
10 if norm(x-x_old)<max(ap, norm(x) * rp): return x
11 raise ArithmeticError("no convergence")

Listing 4.60: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(optimize_newton(f, 3.0), 3)
3 3.5

4.7.3 Secant method


As in the Newton case, the secant method can also be used to find ex-
trema, by replacing f with f ′ :

Listing 4.61: in file: [Link]


1 def optimize_secant(f, x, ap=1e-6, rp=1e-4, ns=100):
2 x = float(x) # make sure it is not int
3 (f, Df) = (D(f), DD(f))
4 (fx, Dfx) = (f(x), Df(x))
5 for k in range(ns):
6 if fx == 0: return x
7 if norm(Dfx) < ap:
8 raise ArithmeticError("unstable solution")
9 (x_old, fx_old, x) = (x, fx, x-fx/Dfx)
10 if norm(x-x_old)<max(ap, norm(x) * rp): return x
11 fx = f(x)
12 Dfx = (fx - fx_old)/(x-x_old)
13 raise ArithmeticError("no convergence")

Listing 4.62: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(optimize_secant(f, 3.0), 3)
3 3.5

4.7.4 Golden section search


If the function we want to optimize is continuous but not differentiable,
then the previous algorithms do not work. In this case, there is one al-
gorithm that comes to our rescue, the golden section [41] search. It is
similar to the bisection method, with one caveat; in the bisection method,
at each point, we need to know if a function changes sign in between two
points, therefore two points are all we need. If instead we are looking for
numerical algorithms 205

a max or min, we need to know if the function is concave or convex in


between those two points. This requires one extra point in between the
two. So while the bisection method only needs one point in between [ a, b],
the golden search needs two points, x1 and x2 , in between [ a, b], and from
them it can determine whether the extreme is in [ a, x2 ] or in [ x1 , b]. This
is also represented pictorially in fig. 4.7. The two points are chosen in an
optimal way so that at the next iteration, one of the two points can be
recycled by leaving the ratio between x1 − a and b − x2 fixed and equal to
1:

Listing 4.63: in file: [Link]


1 def optimize_golden_search(f, a, b, ap=1e-6, rp=1e-4, ns=100):
2 a, b=float(a), float(b)
3 tau = (sqrt(5.0)-1.0)/2.0
4 x1, x2 = a+(1.0-tau) * (b-a), a+tau * (b-a)
5 fa, f1, f2, fb = f(a), f(x1), f(x2), f(b)
6 for k in range(ns):
7 if f1 > f2:
8 a, fa, x1, f1 = x1, f1, x2, f2
9 x2 = a+tau * (b-a)
10 f2 = f(x2)
11 else:
12 b, fb, x2, f2 = x2, f2, x1, f1
13 x1 = a+(1.0-tau) * (b-a)
14 f1 = f(x1)
15 if k>2 and norm(b-a)<max(ap, norm(b) * rp): return b
16 raise ArithmeticError("no convergence")

Here is an example:

Listing 4.64: in file: [Link]


1 >>> def f(x): return (x-2) * (x-5)
2 >>> round(optimize_golden_search(f, 2.0, 5.0), 3)
3 3.5

4.8 Functions of many variables

To be able to work with functions of many variables, we need to introduce


the concept of the partial derivative:

∂ f (x) f ( x + hi ) − f ( x − hi )
= lim (4.123)
∂xi h →0 2h
206 annotated algorithms in python

Figure 4.7: Pictorial representation of the golden search method. If the function is
concave ( f ′′ ( x ) > 0), then knowledge of the function in 4 points (a, x1 , x2 , b) permits us
to determine whether a minimum is between [ a, x2 ] or between [ x1 , b].
.

where hi is a vector with components all equal to zero but hi = h > 0.


We can implement it as follows:

Listing 4.65: in file: [Link]


1 def partial(f, i, h=1e-4):
2 def df(x, f=f, i=i, h=h):
3 x = list(x) # make copy of x
4 x[i] += h
5 f_plus = f(x)
6 x[i] -= 2 * h
7 f_minus = f(x)
8 if isinstance(f_plus, (list, tuple)):
9 return [(f_plus[i]-f_minus[i])/(2 * h) for i in range(len(f_plus))]
10 else:
11 return (f_plus-f_minus)/(2 * h)
12 return df

Similarly to D(f), we have implemented it in such a way that partial(f,


i) returns a function that can be evaluated at any point x. Also notice
that the function f may return a scalar, a matrix, a list, or a tuple. The
if condition allows the function to deal with the difference between two
lists or tuples.
Here is an example:
numerical algorithms 207

Listing 4.66: in file: [Link]


1 >>> def f(x): return 2.0 * x[0]+3.0 * x[1]+5.0 * x[1] * x[2]
2 >>> df0 = partial(f, 0)
3 >>> df1 = partial(f, 1)
4 >>> df2 = partial(f, 2)
5 >>> x = (1, 1, 1)
6 >>> round(df0(x), 4), round(df1(x), 4), round(df2(x), 4)
7 (2.0, 8.0, 5.0)

For symbolic partial derivatives, SymPy computes exact results:


1 >>> import sympy
2 >>> x0, x1, x2 = [Link]('x0 x1 x2')
3 >>> f = 2.0 * x0 + 3.0 * x1 + 5.0 * x1 * x2
4 >>> [Link](f, x0), [Link](f, x1), [Link](f, x2)
5 (2.0, 5.0*x2 + 3.0, 5.0*x1)

4.8.1 Jacobian, gradient, and Hessian


A generic function f ( x0 , x1 , x2 , ...) of multiple variables x = ( x0 , x1 , x2 , ..)
can be expanded in Taylor series to the second order as

f ( x0 , x1 , x2 , ...) = f ( x̄0 , x̄1 , x̄2 , ...) + (4.124)


∂ f (x̄)
∑ ∂xi (xi − x̄i ) + (4.125)
i
1 ∂2 f
∑ 2 ∂xi ∂x j (x̄)(xi − x̄i )(x j − x̄ j ) + ... (4.126)
ij

We can rewrite the above expression in terms of the vector x as follows:

1
f (x) = f (x̄) + ∇ f (x̄)(x − x̄) + (x − x̄)t H f (x̄)(x − x̄) + ... (4.127)
2
where we introduce the gradient vector

 
∂ f ( x )/∂x0
 ∂ f ( x )/∂x1 
∇ f (x) ≡  (4.128)
 
∂ f ( x )/∂x2

 
...
208 annotated algorithms in python

and the Hessian matrix

∂2 f ( x )/∂x0 ∂x0 ∂2 f ( x )/∂x0 ∂x1 ∂2 f ( x )/∂x0 ∂x2


 
...
 ∂2 f ( x )/∂x1 ∂x0 ∂2 f ( x )/∂x1 ∂x1 ∂2 f ( x )/∂x1 ∂x2 ... 
H f (x) ≡ 
 
∂2 f ( x )/∂x2 ∂x0 ∂2 f ( x )/∂x2 ∂x1 ∂2 f ( x )/∂x2 ∂x2

 ... 
... ... ... ...
(4.129)
Given the definition of partial, we can compute the gradient and the Hes-
sian using the two functions

Listing 4.67: in file: [Link]


1 def gradient(f, x, h=1e-4):
2 return Matrix(len(x), 1, fill=lambda r, c: partial(f, r, h)(x))
3

4 def hessian(f, x, h=1e-4):


5 return Matrix(len(x), len(x), fill=lambda r, c: partial(partial(f, r, h), c,
h)(x))

Here is an example:

Listing 4.68: in file: [Link]


1 >>> def f(x): return 2.0 * x[0]+3.0 * x[1]+5.0 * x[1] * x[2]
2 >>> print(gradient(f, x=(1, 1, 1)))
3 [[1.999999...], [7.999999...], [4.999999...]]
4 >>> print(hessian(f, x=(1, 1, 1)))
5 [[0.0, 0.0, 0.0], [0.0, 0.0, 5.000000...], [0.0, 5.000000..., 0.0]]

When dealing with functions returning multiple values like

f (x) = ( f 0 (x), f 1 (x), f 2 (x), ...) (4.130)

we need to Taylor expand each component:

   
f 0 (x) f 0 (x̄) + ∇ f0 (x − x̄) + ...
 f 1 (x)   f 1 (x̄) + ∇ f1 (x − x̄) + ... 
f (x) =  = (4.131)
   
f 2 (x) f 2 (x̄) + ∇ f2 (x − x̄) + ...

   
... ...

which we can rewrite as


numerical algorithms 209

f (x) = f (x̄) + J f (x̄)(x − x̄) + ... (4.132)

where J f is called Jacobian and is defined as

 
∂ f 0 ( x )/∂x0 ∂ f 0 ( x )/∂x1 ∂ f 0 ( x )/∂x2 ...
 ∂ f 1 ( x )/∂x0 ∂ f 1 ( x )/∂x1 ∂ f 1 ( x )/∂x2 ... 
Jf ≡  (4.133)
 
∂ f 2 ( x )/∂x0 ∂ f 2 ( x )/∂x1 ∂ f 2 ( x )/∂x2

 ... 
... ... ... ...

which we can implement as follows:

Listing 4.69: in file: [Link]


1 def jacobian(f, x, h=1e-4):
2 partials = [partial(f, c, h)(x) for c in range(len(x))]
3 return Matrix(len(partials[0]), len(x), fill=lambda r, c: partials[c][r])

Here is an example:

Listing 4.70: in file: [Link]


1 >>> def f(x): return (2.0 * x[0]+3.0 * x[1]+5.0 * x[1] * x[2], 2.0 * x[0])
2 >>> print(jacobian(f, x=(1, 1, 1)))
3 [[1.9999999..., 7.999999..., 4.9999999...], [1.9999999..., 0.0, 0.0]]

SymPy can compute exact Jacobians symbolically:


1 >>> import sympy
2 >>> x0, x1, x2 = [Link]('x0 x1 x2')
3 >>> f0 = 2.0*x0 + 3.0*x1 + 5.0*x1*x2
4 >>> f1 = 2.0*x0
5 >>> J = [Link]([f0, f1]).jacobian([x0, x1, x2])
6 >>> [Link]([(x0, 1), (x1, 1), (x2, 1)])
7 Matrix([[2.0, 8.0, 5.0], [2.0, 0, 0]])

4.8.2 Newton method (solver)


We can now solve eq. 4.132 iteratively as we did for the one-dimensional
Newton solver with only one change—the first derivative of f is replaced
by the Jacobian:

Listing 4.71: in file: [Link]


1 def solve_newton_multi(f, x, ap=1e-6, rp=1e-4, ns=20):
2 """
210 annotated algorithms in python

3 Computes the root of a multidimensional function f near point x.


4

5 Parameters
6 f is a function that takes a list and returns a scalar
7 x is a list
8

9 Returns x, solution of f(x)=0, as a list


10 """
11 n = len(x)
12 x = Matrix(len(x))
13 for k in range(ns):
14 fx = Matrix(f([Link]()))
15 J = jacobian(f, [Link]())
16 if norm(J) < ap:
17 raise ArithmeticError("unstable solution")
18 (x_old, x) = (x, x-(1.0/J) * fx)
19 if k>2 and norm(x-x_old)<max(ap, norm(x) * rp): return [Link]()
20 raise ArithmeticError("no convergence")

Here is an example:

Listing 4.72: in file: [Link]


1 >>> def f(x): return [x[0]+x[1], x[0]+x[1] ** 2-2]
2 >>> solve_newton_multi(f, x=(0, 0))
3 [1.0..., -1.0...]

SciPy provides optimized multidimensional root finders:


1 >>> from [Link] import fsolve
2 >>> def f(x): return [x[0]+x[1], x[0]+x[1]**2-2]
3 >>> fsolve(f, x0=[0, 0])
4 array([ 1., -1.])

4.8.3 Newton method (optimize)


As for the one-dimensional case, we can approximate f (x) with its Taylor
expansion at the first order,

1
f (x) = f (x̄) + ∇ f (x̄)(x − x̄) + (x − x̄)t H f (x̄)(x − x̄) (4.134)
2
set its derivative to zero, and solve it, thus obtaining

x = x̄ − H − 1
f ∇f (4.135)

which constitutes the core of the multidimensional Newton optimizer:


numerical algorithms 211

Listing 4.73: in file: [Link]


1 def optimize_newton_multi(f, x, ap=1e-6, rp=1e-4, ns=20):
2 """
3 Finds the extreme of multidimensional function f near point x.
4

5 Parameters
6 f is a function that takes a list and returns a scalar
7 x is a list
8
9 Returns x, which maximizes of minimizes f(x)=0, as a list
10 """
11 x = Matrix(list(x))
12 for k in range(ns):
13 (grad, H) = (gradient(f, [Link]()), hessian(f, [Link]()))
14 if norm(H) < ap:
15 raise ArithmeticError("unstable solution")
16 (x_old, x) = (x, x-(1.0/H) * grad)
17 if k>2 and norm(x-x_old)<max(ap, norm(x) * rp): return [Link]()
18 raise ArithmeticError("no convergence")

Listing 4.74: in file: [Link]


1 >>> def f(x): return (x[0]-2) ** 2+(x[1]-3) ** 2
2 >>> optimize_newton_multi(f, x=(0, 0))
3 [2.0, 3.0]

SciPy provides optimized multidimensional minimizers:


1 >>> from [Link] import minimize
2 >>> def f(x): return (x[0]-2)**2 + (x[1]-3)**2
3 >>> result = minimize(f, x0=[0, 0], method='Newton-CG',
4 ... jac=lambda x: [2*(x[0]-2), 2*(x[1]-3)])
5 >>> result.x
6 array([2., 3.])

4.8.4 Improved Newton method (optimize)


We can further improve the Newton multidimensional optimizer by us-
ing the following technique. At each step, if the next guess does not
reduce the value of f , we revert to the previous point, and we perform
a one-dimensional Newton optimization along the direction of the gradi-
ent. This method greatly increases the stability of the multidimensional
Newton optimizer:

Listing 4.75: in file: [Link]


1 def optimize_newton_multi_imporved(f, x, ap=1e-6, rp=1e-4, ns=20, h=10.0):
2 """
212 annotated algorithms in python

3 Finds the extreme of multidimensional function f near point x.


4

5 Parameters
6 f is a function that takes a list and returns a scalar
7 x is a list
8

9 Returns x, which maximizes of minimizes f(x)=0, as a list


10 """
11 x = Matrix(list(x))
12 fx = f([Link]())
13 for k in range(ns):
14 (grad, H) = (gradient(f, [Link]()), hessian(f, [Link]()))
15 if norm(H) < ap:
16 raise ArithmeticError("unstable solution")
17 (fx_old, x_old, x) = (fx, x, x-(1.0/H) * grad)
18 fx = f([Link]())
19 while fx>fx_old: # revert to steepest descent
20 (fx, x) = (fx_old, x_old)
21 norm_grad = norm(grad)
22 (x_old, x) = (x, x - grad/norm_grad * h)
23 (fx_old, fx) = (fx, f([Link]()))
24 h = h/2
25 h = norm(x-x_old) * 2
26 if k>2 and h/2<max(ap, norm(x) * rp): return [Link]()
27 raise ArithmeticError("no convergence")

4.9 Nonlinear fitting

Finally, we have all the ingredients to implement a very generic fitting


function that will work linear and nonlinear least squares.
Here we consider a generic experiment or simulated experiment that gen-
erates points of the form ( xi , yi ± δyi ). Our goal is to minimize the χ2
defined as
y − f ( xi , a, b) 2
χ2 (a, b) = ∑ i (4.136)
i
δyi
where the function f is known but depends on unknown parameters a =
( a0 , a1 , ...) and b = (b0 , b1 , ...). In terms of these parameters, the function
f can be written as follows:

f ( x, a, b) = ∑ a j f j (x, b) (4.137)
j
numerical algorithms 213

Here is an example:

f ( x, a, b) = a0 e−b0 x + a1 e−b1 x + a2 e−b2 x + ... (4.138)

The goal of our algorithm is to efficiently determine the parameters a and


b that minimize the χ2 .
We proceed by defining the following two quantities:

 
y0 / δy0
 y1 / δy1 
z= (4.139)
 
y2 / δy2

 
...

and

 
f 0 ( x0 , b)/δy0 f 1 ( x0 , b)/δy0 f 2 ( x0 , b)/δy0 ...
 f 0 ( x1 , b)/δy1 f 1 ( x1 , b)/δy1 f 2 ( x1 , b)/δy1 ... 
A(b) =   (4.140)
 
 f 0 ( x2 , b)/δy2 f 1 ( x2 , b)/δy2 f 2 ( x2 , b)/δy2 ... 
... ... ... ...

In terms of A and z, the χ2 can be rewritten as

χ2 (a, b) = | A(b)a − z|2 (4.141)

We can minimize this function in a using the linear least squares algo-
rithm, exactly:

a ( b ) = ( A ( b ) A ( b ) t ) −1 ( A ( b ) t z ) (4.142)

We define a function that returns the minimum χ2 for a fixed input b:

g(b) = min χ2 (a, b) = χ2 (a(b), b) = | A(b)a(b) − z|2 (4.143)


a

Therefore we have reduced the original problem to a simple problem by


reducing the number of unknown parameters from Na + Nb to Nb .
214 annotated algorithms in python

The following code takes as input the data as a list of ( xi , yi , δyi ), a list
of functions (or a single function), and a guess for the b values. If the fs
argument is not a list but a single function, then there is no a to compute,
and the function proceeds by minimizing the χ2 using the improved New-
ton optimizer (the one-dimensional or the improved multidimensional
one, as appropriate). If the argument b is missing, then the fitting pa-
rameters are all linear, and the algorithm reverts to regular linear least
squares. Otherwise, run the more complex algorithm described earlier:

Listing 4.76: in file: [Link]


1 def fit(data, fs, b=None, ap=1e-6, rp=1e-4, ns=200, constraint=None):
2 if not isinstance(fs, (list, tuple)):
3 def g(b, data=data, f=fs, constraint=constraint):
4 chi2 = sum(((y-f(b, x))/dy) ** 2 for (x, y, dy) in data)
5 if constraint: chi2+=constraint(b)
6 return chi2
7 if isinstance(b, (list, tuple)):
8 b = optimize_newton_multi_imporved(g, b, ap, rp, ns)
9 else:
10 b = optimize_newton(g, b, ap, rp, ns)
11 return b, g(b, data, constraint=None)
12 elif not b:
13 a, chi2, ff = fit_least_squares(data, fs)
14 return a, chi2
15 else:
16 na = len(fs)
17 def core(b, data=data, fs=fs):
18 A = Matrix([[fs[k](b, x)/dy for k in range(na)] \
19 for (x, y, dy) in data])
20 z = Matrix([[y/dy] for (x, y, dy) in data])
21 a = (1/(A.T * A)) * (A.T * z)
22 chi2 = norm(A * a-z) ** 2
23 return [Link](), chi2
24 def g(b, data=data, fs=fs, constraint=constraint):
25 a, chi2 = core(b, data, fs)
26 if constraint:
27 chi += constraint(b)
28 return chi2
29 b = optimize_newton_multi_imporved(g, b, ap, rp, ns)
30 a, chi2 = core(b, data, fs)
31 return a+b, chi2

Here is an example:
1 >>> data = [(i, i+2.0 * i ** 2+300.0/(i+10), 2.0) for i in range(1, 10)]
2 >>> fs = [(lambda b, x: x), (lambda b, x: x * x), (lambda b, x: 1.0/(x+b[0]))]
numerical algorithms 215

3 >>> ab, chi2 = fit(data, fs, [5])


4 >>> print(ab, chi2)
5 [0.999..., 2.000..., 300.000..., 10.000...] ...

SciPy provides curve_fit for nonlinear fitting:


1 >>> import numpy as np
2 >>> from [Link] import curve_fit
3 >>> x = [Link](1, 10, dtype=float)
4 >>> y = x + 2.0*x**2 + 300.0/(x + 10)
5 >>> dy = np.full_like(x, 2.0)
6 >>> def model(x, a, b, c, d): return a*x + b*x**2 + c/(x + d)
7 >>> popt, pcov = curve_fit(model, x, y, sigma=dy, p0=[1, 1, 100, 5])
8 >>> print(popt) # [1., 2., 300., 10.]

In the preceding implementation, we added a somewhat mysterious argu-


ment constraint. This is a function of b, and its output gets added to the
value of χ2 , which we are minimizing. By choosing the appropriate func-
tion, we can set constraints about the expected values b. These constraints
represent a priori knowledge about the parameters, that is, knowledge
that does not come from the data being fitted.
For example, if we know that bi must be close to some b̄i with some
uncertainty δbi , then we can use
1 def constraint(b, bar_b, delta_b):
2 return sum(((b[i]-bar_b[i])/delta_b[i]) ** 2 for i in range(len(b)))

and pass the preceding function as a constraint. From a practical effect,


this stabilizes our fit. From a theoretical point of view, the b̄i are the priors
of Bayesian statistics.

4.10 Integration

Consider the integral of f ( x ) for x in domain [ a, b], which we normally


represent as

Z b
I= f ( x )dx (4.144)
a
and which measures the area under the curve y = f ( x ) delimited on the
left by x = a and on the right by x = b.
As we did in the previous subsection, we can approximate the possible
216 annotated algorithms in python

Figure 4.8: Visual representation of the concept of an integral as the area under a curve.

values taken by x as discrete values x ≡ hi, where h = (b − a)/n. At those


values, the function f evaluates to f i ≡ f (hi ). Thus the integral can be
approximated as a sum of trapezoids:

i <n
h
In ≃ ∑ 2 ( f i + f i +1 ) (4.145)
i =0

Figure 4.9: Visual representation of the trapezoid method for numerical integration.

If a function is discontinuous only in a finite number of points in the


domain [ a, b], then the following limit exists:

lim In → I (4.146)
n→∞

We can implement the naive integration as a function of N as follows:


numerical algorithms 217

Listing 4.77: in file: [Link]


1 def integrate_naive(f, a, b, n=20):
2 """
3 Integrates function, f, from a to b using the trapezoidal rule
4 >>> from math import sin
5 >>> integrate(sin, 0, 2)
6 1.416118...
7 """
8 a, b= float(a), float(b)
9 h = (b-a)/n
10 return h/2 * (f(a)+f(b))+h * sum(f(a+h * i) for i in range(1, n))

And here we implement the limit by doubling the number of points until
convergence is achieved:

Listing 4.78: in file: [Link]


1 def integrate(f, a, b, ap=1e-4, rp=1e-4, ns=20):
2 """
3 Integrates function, f, from a to b using the trapezoidal rule
4 converges to precision
5 """
6 I = integrate_naive(f, a, b, 1)
7 for k in range(1, ns):
8 I_old, I = I, integrate_naive(f, a, b, 2 ** k)
9 if k>2 and norm(I-I_old)<max(ap, norm(I) * rp): return I
10 raise ArithmeticError("no convergence")

We can test the convergence as follows:

Listing 4.79: in file: [Link]


1 >>> from math import sin, cos
2 >>> integrate_naive(sin, 0, 3, n=2)
3 1.6020...
4 >>> integrate_naive(sin, 0, 3, n=4)
5 1.8958...
6 >>> integrate_naive(sin, 0, 3, n=8)
7 1.9666...
8 >>> integrate(sin, 0, 3)
9 1.9899...
10 >>> 1.0-cos(3)
11 1.9899...

4.10.1 Quadrature
In the previous integration, we divided the domain [ a, b] into subdomains,
and we computed the area under the curve f in each subdomain by ap-
218 annotated algorithms in python

proximating it with a trapezoid; for example, we approximated the func-


tion in between xi and xi+1 with a straight line. We can do better by
approximating the function with a polynomial of arbitrary degree n and
then compute the area in the subdomain by explicitly integrating the poly-
nomial.
This is the basic idea of quadrature. For a subdomain delimited by (0, 1),
we can impose
Z 1
1dx =h = ∑ ci (i/n)0 (4.147)
0 i
Z 1
xdx = h2 /2 = ∑ ci (i/n)1 (4.148)
0 i
... ... ... (4.149)
Z 1
x n−1 dx = hn /n = ∑ ci (i/n)2 (4.150)
0 i

where ci are coefficients to be determined:

Listing 4.80: in file: [Link]


1 class QuadratureIntegrator:
2 """
3 Calculates the integral of the function f from points a to b
4 using n Vandermonde weights and numerical quadrature.
5 """
6 def __init__(self, order=4):
7 h =1.0/(order-1)
8 A = Matrix(order, order, fill = lambda r, c: (c * h) ** r)
9 s = Matrix(order, 1, fill = lambda r, c: 1.0/(r+1))
10 w = (1/A) * s
11 self.w = w
12 def integrate(self, f, a, b):
13 w = self.w
14 order = len([Link])
15 h = float(b-a)/(order-1)
16 return (b-a) * sum(w[i, 0] * f(a+i * h) for i in range(order))
17

18 def integrate_quadrature_naive(f, a, b, n=20, order=4):


19 a, b = float(a), float(b)
20 h = float(b-a)/n
21 q = QuadratureIntegrator(order=order)
22 return sum([Link](f, a+i * h, a+i * h+h) for i in range(n))

Here is an example of usage:


numerical algorithms 219

Listing 4.81: in file: [Link]


1 >>> from math import sin
2 >>> integrate_quadrature_naive(sin, 0, 3, n=2, order=2)
3 1.602...
4 >>> integrate_quadrature_naive(sin, 0, 3, n=2, order=3)
5 1.993...
6 >>> integrate_quadrature_naive(sin, 0, 3, n=2, order=4)
7 1.991...

SciPy provides optimized numerical integration routines:


1 >>> from scipy import integrate
2 >>> from math import sin
3 >>> result, error = [Link](sin, 0, 3)
4 >>> print(round(result, 4))
5 1.9899
6 >>> # For fixed-order quadrature:
7 >>> integrate.fixed_quad(sin, 0, 3, n=4)
8 (1.9899..., None)
220 annotated algorithms in python

4.11 Fourier transforms

A function with a domain over a finite interval [ a, b] can be approximated


with a vector. For example, consider a function f ( x ) with domain [0, T ].
We can sample the function at points xk = a + (b − a)k/N and represent
the discretized function with a vector

u f ≡ {c f ( x0 ), c f ( x1 ), c f ( x2 ), ...c f ( x N )} (4.151)
p
where c is an arbitrary constant that we choose to be c = (b − a)/N.
This choice simplifies our later algebra. Summarizing, we define
r
b−a
ufk ≡ f ( xk ) (4.152)
N

Given any two functions, we can define their scalar product as the limit
of N → ∞ of the scalar product between their corresponding vectors:

b−a
f · g ≡ lim u f · u g = lim
N →∞ N →∞ N ∑ f ( xk ) g( xk ) (4.153)
k

Using the definition of integral, it can be proven that, in the limit N → ∞,


this is equivalent to

Z b
f ·g= f ( x ) g( x )dx (4.154)
a

This is because we have chosen c such that c2 is the width of a rectangle


in the Riemann integration.
From now on, we will omit the f subscript in u and simply use different
letters for vectors representing different sampled functions (u, v, b, etc.).
Because we are interested in numerical algorithms, we will keep N finite
and work with the sum instead of the integral.
Given a fixed N, we can always find N vectors b0 , b1 ...b N1 that are linearly
independent, normalized, and orthogonal, that is,
numerical algorithms 221

bi · b j = ∑ bik bik = δij (4.155)


k

Here b jk is the k component of vector b j and δij is the Kroneker delta


defined as 0 when i ̸= j and 1 when i == j.
Any set of vectors {b j } meeting the preceding condition is called an or-
thonormal basis. Any other vector u can be represented by its projections
over the basis vectors:

ui = ∑ v j bji (4.156)
i

where v j is the projection of u along b j , which can be computed as

vj = ∑ ui bji (4.157)
i

In fact, by direct substitution, we obtain

vj = ∑ uk bjk (4.158)
k
= ∑(∑ vi bik )bjk (4.159)
k i
= ∑ vi (∑ bik bjk ) (4.160)
i k
= ∑ vi δij (4.161)
i
= vj (4.162)

In other words, once we have a basis of vectors, the vector u can be rep-
resented in terms of the vector v of v j coefficients and, conversely, v can
be computed from u; u and v contain the same information.
The transformation from u to v, and vice versa, is a linear transformation.
We call T + the transformation from u to v and T − its inverse:
222 annotated algorithms in python

v = T + (u) u = T − (v) (4.163)

From the definition, and without attempting any optimization, we can


implement these operators as follows:
1 def transform(u, b):
2 return [sum(u[k] * bi[k] for k in range(len(u))) for bi in b]
3

4 def antitransform(v, b):


5 return [sum(v[i] * bi[k] for i, bi in enumerate(b)) for k in range(len(v))]

Here is an example of usage:


1 >>> def make_basis(N):
2 >>> return [[1 if i == j else 0 for i in range(N)] for j in range(N)]
3 >>> b = make_basis(4)
4 >>> b
5 [[1, 0, 0, 0], [0, 1, 0, 0], [0, 0, 1, 0], [0, 0, 0, 1]]
6 >>> u = [1.0, 2.0, 3.0, 4.0]
7 >>> v = transform(u, b)
8 >>> antitransform(v, b)
9 [1.0, 2.0, 3.0, 4.0]

Of course, this example is trivial because of the choice of basis which


makes v the same as u. Yet our argument works for any basis bi . In
particular, we can make the following choice:

1
b ji = √ e2πIij/N (4.164)

where I is the imaginary unit. With this choice, the T + and T − functions
become

1
vj =
FT +
N− 2 ∑ ui e2πIij/N (4.165)
i
1
ui =
FT −
N− 2 ∑ v j e−2πIij/N (4.166)
j

and they take the names of Fourier transform and anti-transform [42],
respectively; we can implement them as follows:
numerical algorithms 223

1 from cmath import exp as cexp


2

3 def fourier(u, sign=1):


4 N, D = len(u), range(len(u))
5 coeff, omega = 1.0/sqrt(N), 2.0 * pi * sign * (1j)/N
6 return [sum(coeff * u[i] * cexp(omega * i * j) for i in D) for j in D]
7
8 def anti_fourier(v):
9 return fourier(v, sign=-1)

Here 1j is the Python notation for I and cexp is the exponential function
for complex numbers.
NumPy provides a highly optimized FFT implementation:
1 >>> import numpy as np
2 >>> u = [Link]([1.0, 2.0, 3.0, 4.0])
3 >>> v = [Link](u) / [Link](len(u)) # forward Fourier transform
4 >>> u_back = [Link](v) * [Link](len(u)) # inverse transform
5 >>> [Link](u, u_back.real)
6 True

Notice how the transformation works even when u is a vector of complex


numbers.
Something special happens when u is real:

Re(v j ) = + Re(v N − j−1 ) (4.167)


Im(v j ) = − Im(v N − j−1 ) (4.168)

We can speed up the code even more using recursion and by observing
that if N is a power of 2, then

1
vj = N− 2 ∑ u2i e2πI (2i) j/N + (4.169)
i
1
N− 2 ∑ u2i+1 e2πI (2i+1) j/N (4.170)
i
1
= 2− 2 (veven
j + e2πj/N veven
j ) (4.171)

where veven
j is the Fourier transform of the even terms and vodd
j is the
Fourier transform of the odd terms.
224 annotated algorithms in python

The preceding recursive expression can be implemented using dynamic


programming, thus obtaining
1 from cmath import exp as cexp
2

3 def fast_fourier(u, sign=1):


4 N, sqrtN, D = len(u), sqrt(len(u)), range(len(u))
5 v = [ui/sqrtN for ui in u]
6 k = N/2
7 while k:
8 omega = cexp(2.0 * pi * 1j * k/N)
9 for i in D:
10 j = i ^ k
11 if i < k:
12 ik, jk = int(i/k), int(j/k)
13 v[i], v[j] = v[i]+(omega ** ik) * v[j], v[i]+(omega ** jk) * v[j
]
14 k/=2
15 return v
16

17 def fast_anti_fourier(v):
18 return fast_fourier(v, sign=-1)

This implementation of the Fourier transform is equivalent to the previ-


ous one in the sense that it produces the same result (up to numerical
issues), but it is faster as it runs in Θ( N log2 N ) versus Θ( N 2 ) of the naive
implementation. Here i ^ j is a binary operator, specifically a XOR. For
each binary digit of i, it returns a flipped bit if the corresponding bit in j
is 1. For example:
1 i : 10010010101110
2 j : 00010001000010
3 i^j: 10000011001110

4.12 Differential equations

In this section, we deal specifically with differential equations of the fol-


lowing form:

a0 f ( x ) + a1 f ′ ( x ) + a2 f ′′ ( x ) + ... = g( x ) (4.172)

where f ( x ) is an unknown function to be determined; f ′ , f ′′ , and so on,


are its derivatives; ai are known input coefficients; and g( x ) is a known
numerical algorithms 225

input function:

f ′′ ( x ) − 4 f ′ ( x ) + f ( x ) = sin( x ) (4.173)

In this case, a2 ( x ) = 1, a1 ( x ) = −4, a0 ( x ) = 1, and g( x ) = sin( x ).


This can be solved using Fourier transforms by observing that if the
Fourier transform of f ( x ) is f˜(y), then the Fourier transform of f ′ ( x )
is iy f˜(y).
Hence, if we Fourier transform both the left and right side of

∑ ak f (k) ( x ) = g ( x ) (4.174)
k

we obtain

(∑ ak (iy)k ) f˜(y) = g̃(y) (4.175)


k

therefore f ( x ) is the anti-Fourier transform of

g̃(y)
f˜(y) = (4.176)
(∑k ak (iy)k )

In one equation, the solution of eq. 4.172 is

f ( x ) = T − ( T + ( g)/(∑ ak (iy)k )) (4.177)


k

This is fine and useful when the Fourier transformations are easy to com-
pute.
A more practical numerical solution is the following. We define

yi ( x ) ≡ f (i ) ( x ) (4.178)

and we rewrite the differential equation as


226 annotated algorithms in python

y”0 = y1 (4.179)
y”1 = y2 (4.180)
y”2 = y3 (4.181)
... ... (4.182)
y” N −1 = y N = ( g( x ) − ∑ ak yk ( x ))/a N ( x ) (4.183)
k< N

or equivalently

y” = F (y) (4.184)

where

 
y1

 y2 

F (y) = y +  y3 (4.185)
 

 
 ... 
( g( x ) − ∑k< N ak ( x )yk ( x ))/a N ( x )

The naive solution is due to Euler:

y( x + h) = y( x ) + hF (y, x ) (4.186)

The solution is found by iterating the latest equation. Here h is an arbi-


trary discretization step. Euler"s method works even if the ak coefficients
depend on x.
Although the Euler integrator works in theory, its systematic error adds
up and does not disappear in the limit h → 0. More accurate integra-
tors are the Runge–Kutta and the Adams–Bashforth. In the fourth-order
Runge–Kutta, the classical Runge–Kutta method, we also solve the differen-
tial equation by iteration, except that eq. 4.186 is replaced with

y( x + h) = y( x ) + h/6(k1 + 2k2 + 2k3 + k4 ) (4.187)


numerical algorithms 227

where

k1 = F (y, x ) (4.188)
k2 = F (y + hk1 /2, x + h/2) (4.189)
k3 = F (y + hk2 /2, x + h/2) (4.190)
k4 = F (y + hk3 , x + h) (4.191)

SciPy provides ODE solvers including Runge–Kutta methods:


1 >>> import numpy as np
2 >>> from [Link] import solve_ivp
3 >>> # Example: y'' - 4y' + y = sin(x), rewritten as a system
4 >>> def F(x, y): return [y[1], 4*y[1] - y[0] + [Link](x)]
5 >>> sol = solve_ivp(F, [0, 10], y0=[0, 1], method='RK45', dense_output=True)
6 >>> x = [Link](0, 10, 100)
7 >>> y = [Link](x)[0] # solution f(x) evaluated at 100 points
5
Probability and Statistics

5.1 Probability

Probability derives from the Latin probare (to prove or to test). The word
probably means roughly “likely to occur” in the case of possible future
occurrences or “likely to be true” in the case of inferences from evidence.
See also probability theory.
What mathematicians call probability is the mathematical theory we use
to describe and quantify uncertainty. In a larger context, the word prob-
ability is used with other concerns in mind. Uncertainty can be due to
our ignorance, deliberate mixing or shuffling, or due to the essential ran-
domness of Nature. In any case, we measure the uncertainty of events on
a scale from zero (impossible events) to one (certain events or no uncer-
tainty).
There are three standard ways to define probability:
• (frequentist) Given an experiment and a set of possible outcomes S, the
probability of an event A ⊂ S is computed by repeating the experiment
N times, counting how many times the event A is realized, NA , then
taking the limit
N
Prob( A) ≡ lim A (5.1)
N →∞ N

This definition actually requires that one performs an experiment, if


230 annotated algorithms in python

not an infinite, then a number of times.


• (a priori) Given an experiment and a set of possible outcomes S with
cardinality c(S), the probability of an event A ⊂ S is defined as

c( A)
Prob( A) ≡ (5.2)
c(S)
This definition is ambiguous because it assumes that each “atomic”
event x ∈ S has the same a priori probability and therefore the def-
inition itself is circular. Nevertheless we use this definition in many
practical circumstances. What is the probability that when rolling a
dice we will get an even number? The space of possible outcomes is
S = {1, 2, 3, 4, 5, 6} and A = {2, 4, 6} therefore Prob( A) = c( A)/c(S) =
3/6 = 1/2. This analysis works for an ideal die and ignores the fact
that a real dice may be biased. The former definition takes into account
this possibility, whereas the latter does not.
• (axiomatic definition) Given an experiment and a set of possible out-
comes S, the probability of an event A ⊂ S is a number Prob( A) ∈ [0, 1]
that satisfies the following conditions: Prob(S) = 1; Prob( A1 ∪ A2 ) =
Prob( A1 ) + Prob( A2 ) if A1 ∩ A2 = 0.
In some sense, probability theory is a physical theory because it applies
to the physical world (this is a nontrivial fact). While the axiomatic defi-
nition provides the mathematical foundation, the a priori definition pro-
vides a method to make predictions based on combinatorics. Finally the
frequentist definition provides an experimental technique to confront our
predictions with experiment (is our dice a perfect dice, or is it biased?).
We will differentiate between an “atomic” event defined as an event that
can be realized by a single possible outcome of our experiment and a
general event defined as a subset of the space of all possible outcomes. In
the case of a dice, each possible number (from 1 to 6) is an event and is
also an atomic event. The event of getting an even number is an event but
not an atomic event because it can be realized in three possible ways.
The axiomatic definition makes it easy to prove theorems, for example,
If S = A ∪ Ac and A ∩ Ac = 0 then Prob( A) = 1 − Prob( Ac )
probability and statistics 231

Python has a module called random that can generate random numbers,
and we can use it to perform some experiments. Let"s simulate a dice
with six possible outcomes. We can use the frequentist definition:

Listing 5.1: in file: [Link]


1 >>> import random
2 >>> S = [1, 2, 3, 4, 5, 6]
3 >>> def Prob(A, S, N=1000):
4 ... return float(sum([Link](S) in A for i in range(N)))/N
5 >>> Prob([6], S)
6 0.166
7 >>> Prob([1, 2], S)
8 0.308

Here Prob(A) computes the probability that the event is set A using N=1000
simulated experiments. The [Link] function picks one of the
choices at random with equal probability.
We can compute the same quantity using the a priori definition:

Listing 5.2: in file: [Link]


1 >>> def Prob(A, S): return float(len(A))/len(S)
2 >>> Prob([6], S)
3 0.16666666666666666
4 >>> Prob([1, 2], S)
5 0.3333333333333333

As stated before, the latter is more precise because it produces results for
an “ideal” dice while the frequentist"s approach produces results for a
real dice (in our case, a simulated dice).

5.1.1 Conditional probability and independence


We define Prob( A| B) as the probability of event A given event B, and we
write
Prob( AB)
Prob( A| B) ≡ (5.3)
Prob( B)
where Prob( AB) is the probability that A and B both occur and Prob( B) is
the probability that B occurs. Note that if Prob( A| B) = Prob( A), then we
say that A and B are independent. From eq.(5.3) we conclude Prob( AB) =
Prob( A)Prob( B); therefore the probability that two independent events
occur is the product of the probability that each individual event occurs.
232 annotated algorithms in python

We can experiment with conditional probability using Python. Let"s con-


sider two dices, X and Y. The space of all possible outcomes is given by
S2 = S × S. And we are interested in the probability of the second die
giving a 6 given that the first dice is also a 6:

Listing 5.3: in file: [Link]


1 >>> def cross(u, v): return [(i, j) for i in u for j in v]
2 >>> def Prob_conditional(A, B, S): return Prob(cross(A, B), cross(S, S))/Prob(B,
S)
3 >>> Prob_conditional([6], [6], S)
4 0.16666666666666666

Because we are only considering cases in which the second die is 6, we


will pretend that when the second die is 1 through 5 didn"t occur. Not sur-
prisingly, we find that Prob_conditional([6], [6], S) produces the same
result as Prob([6], S) because the two dices are independent.
In fact, we say that two sets of events A and B are independent if and only
if P( A| B) = P( A).

5.1.2 Discrete random variables


If S is in the space of all possible outcomes of an experiment and we
associate an integer number X to each element of S, we say that X is a
discrete random variable. If X is a discrete variable, we define p( x ), the
probability mass function or distribution, as the probability that X = x:

p( x ) ≡ Prob( X = x ) (5.4)

We also define the expectation value of any function of a discrete random


variable f ( X ) as
E[ f ( X )] ≡ ∑ f ( xi ) p( xi ) (5.5)
i
where i loops all possible variables xi of the random variable X.
For example, if X is the random variable associated with the outcome of
rolling a dice, p( x ) = 1/6 if x = 1, 2, 3, 4, 5 or 6 and p( x ) = 0 otherwise:

1
E[ X ] = ∑ xi p ( xi ) = ∑ xi
6
= 3.5 (5.6)
i xi ∈{1,2,3,4,5,6}
probability and statistics 233

and
1
E[( X − 3.5)2 ] = ∑(xi − 3.5)2 p(xi ) = ∑ ( xi − 3.5)2
6
= 2.9167
i xi ∈{1,2,3,4,5,6}
(5.7)
We call E[ X ] the mean of X and usually denote it with µ X . We call E[( X −
µ X )2 ] the variance of X and denote it with σX2 . Note that
σX = E[ X 2 ] − E[ X ]2 (5.8)

For discrete random variables, we can implement these definitions as fol-


lows:

Listing 5.4: in file: [Link]


1 def E(f, S): return float(sum(f(x) for x in S))/(len(S) or 1)
2 def mean(X): return E(lambda x:x, X)
3 def variance(X): return E(lambda x:x ** 2, X) - E(lambda x:x, X) ** 2
4 def sd(X): return sqrt(variance(X))

As an example, let"s consider a simple bet on a dice. We roll the dice once
and win $20 if the dice returns 6; we lose $5 otherwise:

Listing 5.5: in file: [Link]


1 >>> S = [1, 2, 3, 4, 5, 6]
2 >>> mean(S)
3 3.5
4 >>> sd(S)
5 1.707...
6 >>> def payoff(x): return 20.0 if x == 6 else -5.0
7 >>> E(payoff, S)
8 -0.83333...

The average expected payoff is −0.83..., which means that on average, we


should expect to lose 83 cents at this game.
Using NumPy, these statistical functions operate directly on arrays:
1 >>> import numpy as np
2 >>> S = [Link]([1, 2, 3, 4, 5, 6])
3 >>> [Link](S)
4 3.5
5 >>> [Link](S)
6 1.707...
7 >>> payoff = [Link](S == 6, 20.0, -5.0)
8 >>> [Link](payoff)
9 -0.8333...
234 annotated algorithms in python

5.1.3 Continuous random variables


If S is the space of all possible outcomes of an experiment and we associate
a real number X with each element of S, we say that X is a continuous
random variable. We also define a cumulative distribution function F ( x ) as
the probability that X ≤ x:

F ( x ) ≡ Prob( X ≤ x ) (5.9)

If S is a continuous set and X is a continuous random variable, then we


define a probability density or distribution p( x ) as

dF ( x )
p( x ) ≡ (5.10)
dx
and the probability that X falls into an interval [ a, b] can be computed as
Z b
Prob( a ≤ X ≤ b) = p( x )dx (5.11)
a

We also define the expectation value of any function of a random variable


f ( X ) as Z ∞
E[ f ( X )] = f ( x ) p( x )dx (5.12)
−∞

For example, if X is a uniform random variable (probability density p( x )


equal to 1 if x ∈ [0, 1], equal to 0 otherwise)
Z ∞ Z 1
1
E[ X ] = xp( x )dx = xdx = (5.13)
−∞ 0 2
and
Z ∞ Z 1
1 1 1 1
E[( X − )2 ] = ( x − )2 p( x )dx = ( x2 − x + )dx = (5.14)
2 −∞ 2 0 4 12

We call E[ X ] the mean of X and usually denote it with µ X . We call E[( X −


µ X )2 ] the variance of X and denote it with σX2 . Note that

σX2 = E[ X 2 ] − E[ X ]2 (5.15)
probability and statistics 235

By definition,
F (∞) ≡ Prob( X ≤ ∞) = 1 (5.16)
therefore Z ∞
Prob(−∞ ≤ X ≤ ∞) = p( x )dx = 1 (5.17)
−∞
The distribution p is always normalized to 1.
Moreover,

Z ∞
E[ aX + b] = ( ax + b) p( x )dx (5.18)
−∞
Z ∞ Z ∞
= a xp( x )dx + b p( x )dx (5.19)
−∞ −∞
= aE[ X ] + b (5.20)

therefore E[ X ] is a linear operator.


One important consequence of all these formulas is that if we have a
function f and a domain [ a, b], we can compute its integral by choosing p
to be a uniform distribution with values exclusively between a and b:

Z ∞ Z b
1
E[ f ] = f ( x ) p( x )dx = f ( x )dx (5.21)
−∞ b−a a

We can also compute the same integral by using the definition of expec-
tation value for a discrete distribution:

1
E[ f ] = ∑ f ( xi ) p ( xi ) = N ∑ f ( xi ) (5.22)
xi xi

where xi are N random points drawn from the uniform distribution p


defined earlier. In fact, in the large N limit,

Z ∞ Z b
1 1
lim
N →∞ N
∑ f ( xi ) = −∞
f ( x ) p( x )dx =
b−a a
f ( x )dx (5.23)
xi

We can verify the preceding relation numerically for a special case:


236 annotated algorithms in python

Listing 5.6: in file: [Link]


1 >>> from math import sin, pi
2 >>> def integrate_mc(f, a, b, N=1000):
3 ... return sum(f([Link](a, b)) for i in range(N))/N * (b-a)
4 >>> integrate_mc(sin, 0, pi, N=10000)
5 2.00....

This is the simplest case of Monte Carlo integration, which is the subject
of a following chapter.

5.1.4 Covariance and correlations


Given two random variables, X and Y, we define the covariance (cov) and
the correlation (corr) between them as

cov( X, Y ) ≡ E[( X − µ X )(Y − µY )] = E[ XY ] − E[ X ] E[Y ] (5.24)


corr( X, Y ) ≡ cov( X, Y )/(σX σY ) (5.25)

Applying the definitions:


Z Z
E[ XY ] = xyp( x, y)dxdy (5.26)
Z Z
= xyp( x ) p(y)dxdy (5.27)
Z  Z 
= xp( x )dx yp(y)dy (5.28)

= E [ X ] E [Y ] (5.29)

therefore
cov( X, Y ) = E[ XY ] − E[ X ] E[Y ] = 0 (5.30)

Therefore
σX2 +Y = σX2 + σY2 + 2cov( X, Y ) (5.31)
and if X and Y are independent, then cov( X, Y ) = corr( X, Y ) = 0.
Notice that the reverse is not true. Even if the correlation and the covari-
ance are zero, X and Y may be dependent.
probability and statistics 237

Moreover,

cov( X, Y ) = E[( X − µ X )(Y − µY )] (5.32)


= E[( X − µ X )(± X ∓ µ X )] (5.33)
= ± E[( X − µ X )( X − µ X )] (5.34)
= ±σX2 (5.35)

Therefore, if X and Y are completely correlated or anti-correlated (Y =


± X), then cov( X, Y ) = ±σX2 and corr( X, Y ) = ±1. Notice that the corre-
lation lies always in the range [−1, 1].
Finally, notice that for uncorrelated random variables Xi ,

E [ ∑ a i Xi ] = ∑ a i E [ Xi ] (5.36)
i i
E[(∑ Xi )2 ] = ∑ E[Xi2 ] (5.37)
i i

We can define covariance and correlation for discrete distributions:

Listing 5.7: in file: [Link]


1 def covariance(X, Y):
2 return sum(X[i] * Y[i] for i in range(len(X)))/len(X) - mean(X) * mean(Y)
3 def correlation(X, Y):
4 return covariance(X, Y)/sd(X)/sd(Y)

NumPy computes covariance and correlation directly:


1 >>> import numpy as np
2 >>> X = [Link]([1.0, 2.0, 3.0, 4.0])
3 >>> Y = [Link]([2.0, 4.0, 5.0, 7.0])
4 >>> [Link](X, Y, bias=True) # covariance matrix
5 array([[1.25 , 1.625],
6 [1.625, 2.6875]])
7 >>> [Link](X, Y) # correlation matrix
8 array([[1. , 0.88660..],
9 [0.88660.., 1. ]])
238 annotated algorithms in python

5.1.5 Strong law of large numbers


If X1 , X2 , ...Xn are a sequence of independent and identically distributed
random variables with E[ Xi ] = µ and finite variance, then
X1 + X2 + ... + Xn
lim =µ (5.38)
n→∞ n

This theorem means that “the average of the results obtained from a large
number of trials should be close to the expected value, and will tend to
become closer as more trials are performed.” The name of this law is due
to Poisson [43].

5.1.6 Central limit theorem


This is one of the most important theorems concerning distributions [44]:
if X1 , X2 , ...Xn are a sequence of random variables with finite means, µi ,
and finite variance, σi2 , then

i< N
1
Y = lim
N →∞ N ∑ Xi (5.39)
i =0

follows a Gaussian distribution with mean and variance:


i< N
1
µ = lim
N →∞ N ∑ µi (5.40)
i =0
i< N
1
σ2 = lim
N →∞ N ∑ σi2 (5.41)
i =0

We can numerically verify this for the simple case in which Xi are uniform
random variables with mean equal to 0:

Listing 5.8: in file: [Link]


1 >>> def added_uniform(n): return sum([[Link](-1, 1) for i in range(n)])/
n
2 >>> def make_set(n, m=10000): return [added_uniform(n) for j in range(m)]
3 >>> Canvas(title="Central Limit Theorem", xlab="y", ylab="p(y)"
4 ... ).hist(make_set(1), legend="N=1").save("images/[Link]")
5 >>> Canvas(title="Central Limit Theorem", xlab="y", ylab="p(y)"
6 ... ).hist(make_set(2), legend="N=2").save("images/[Link]")
probability and statistics 239

7 >>> Canvas(title="Central Limit Theorem", xlab="y", ylab="p(y)"


8 ... ).hist(make_set(4), legend="N=4").save("images/[Link]")
9 >>> Canvas(title="Central Limit Theorem", xlab="y", ylab="p(y)"
10 ... ).hist(make_set(8), legend="N=8").save("images/[Link]")

Using NumPy, the same demonstration is vectorized:


1 >>> import numpy as np
2 >>> def make_set_np(n, m=10000):
3 ... return [Link](-1, 1, (m, n)).mean(axis=1)
4 >>> samples = make_set_np(8)
5 >>> print([Link](samples), [Link](samples)) # mean near 0, std shrinks with n

Figure 5.1: Example of distributions for sums of 1, 2, 4, and 8 uniform random variables.
The more random variables are added, the better the result approximates a Gaussian
distribution.

This theorem is of fundamental importance for stochastic calculus. Notice


that the theorem does not apply when the Xi follow distributions that do
not have a finite mean or a finite variance.
Distributions that do not follow the central limit are called Levy distribu-
tions. They are characterized by fat tails for the form
240 annotated algorithms in python

1
p( x ) ∼ , 0<α<2 (5.42)
x →∞ | x |1+ α

An example is the Pareto distribution.

5.1.7 Error in the mean


One consequence of the Central Limit Theorem is a useful formula for
evaluating the error in the mean. Let"s consider the case of N repeated
experiments with outcomes Xi . Let"s also assume that each Xi is supposed
to be equal to an unknown value µ, but in practice, Xi = µ + ε, where ε is
a random variable with Gaussian distribution centered at zero. One could
estimate µ by µ = E[ X ] = N1 Σi Xi . In this case, statistical error in the mean
is given by r
σ2
δµ = (5.43)
N
N Σ i ( Xi
1
where σ2 = E[( X − µ)2 ] = − µ )2 .

5.2 Combinatorics and discrete random variables

Often, to compute the probability of discrete random variables, one has


to confront the problem of calculating the number of possible finite out-
comes of an experiment. Often this problem is solved by combinatorics.

5.2.1 Different plugs in different sockets


If we have n different plugs and m different sockets; in how many ways
can we place the plugs in the sockets?
• Case 1, n ≥ m. All sockets will be filled. We consider the first socket,
and we can select any of the n plugs (n combinations). We consider
the second socket, and we can select any of the remaining n − 1 plugs
(n − 1 combinations), and so on, until we are left with no free sockets
and n − m unused plugs; therefore there are

n!/(n − m)! = n(n − 1)(n − 2)...(n − m + 1) (5.44)


probability and statistics 241

combinations.
• Case 2, n ≤ m. All plugs have to be used. We consider the first plug,
and we can select any of the m sockets (m combinations). We consider
the second plug, and we can select any of the remaining m − 1 sockets
(m − 1 combinations), and so on, until we are left with no spare plugs
and m − n free sockets; therefore there are

m!/(m − n)! = m(m − 1)(m − 2)...(m − n + 1) (5.45)

combinations. Note that if m = n then case 1 and case 2 agree, as


expected.

5.2.2 Equivalent plugs in different sockets


If we have n equivalent plugs and m different sockets, in how many ways
can we place the plugs in the sockets?
• Case 1, n ≥ m. All sockets will be filled. We cannot distinguish one
combination from the other because all plugs are the same. There is
only one combination.
• Case 2, n ≤ m. All plugs have to be used but not all sockets. There are
m!/(m − n)! ways to fill the sockets with different plugs, and there are
n! ways to arrange the plugs within the same filled sockets. Therefore
there are  
m m!
= (5.46)
n (m − n)!n!
ways to place n equivalent plugs into m different sockets. Note that if
m=n  
n n!
= =1 (5.47)
n (n − n)!n!
in agreement with case 1.
Here is another example. A club has 20 members and has to elect a
president, a vice president, a secretary, and a treasurer. In how many
different ways can they select the four officeholders? Think of each office
as a socket and each person as a plug; therefore the number combination
is 20!/(20 − 4)! ≃ 1. 2 × 105 .
242 annotated algorithms in python

5.2.3 Colored cards


We have 52 cards, 26 black and 26 red. We shuffle the cards and pick
three.
• What is the probability that they are all red?
26 25 24 2
Prob(3red) = × × = (5.48)
52 51 50 17

• What is the probability that they are all black?


2
Prob(3black ) = Prob(3red) = (5.49)
17

• What is the probability that they are not all black or all red?

Prob(mixture) = 1 − Prob(3red ∪ 3black) (5.50)


= 1 − Prob(3red) − Prob(3black) (5.51)
2
= 1−2 (5.52)
17
13
= (5.53)
17

Here is an example of how we can simulate the deck of cards using Python
to compute an answer to the last questions:

Listing 5.9: in file: [Link]


1 >>> def make_deck(): return [color for i in range(26) for color in ("red", "
black")]
2 >>> def make_shuffled_deck(): return [Link](make_deck())
3 >>> def pick_three_cards(): return make_shuffled_deck()[:3]
4 >>> def simulate_cards(n=1000):
5 ... counter = 0
6 ... for k in range(n):
7 ... c = pick_three_cards()
8 ... if not (c[0] == c[1] and c[1] == c[2]): counter += 1
9 ... return float(counter)/n
10 >>> simulate_cards()

5.2.4 Gambler"s fallacy


The typical error in computing probabilities is mixing a priori probability
with information about past events. This error is called the gambler"s
probability and statistics 243

fallacy [45]. For example, we consider the preceding problem. We see the
first two cards, and they are both red. What is the probability that the
third one is also red?
• Wrong answer: The probability that they are all red is Prob(3red) =
2/17; therefore the probability that the third one is also 2/17.
• Correct answer: Because we know that the first two cards are red,
the third card must belong to a set of (26 black cards + 24 red cards);
therefore the probability that it is red is

24 12
Prob(red) = = (5.54)
24 + 26 25
6
Random Numbers and Distributions

In the previous chapters, we have seen how using the Python random mod-
ule, we can generate uniform random numbers. This module can also
generate random numbers following other distributions. The point of this
chapter is to understand how random numbers are generated.

6.1 Randomness, determinism, chaos and order

Before we proceed further, there are four important concepts that should
be defined because of their implications:
• Randomness is the characteristic of a process whose outcome is un-
predictable (e.g., at the moment I am writing this sentence, I cannot
predict the exact time and date when you will be reading it).
• Determinism is the characteristic of a process whose outcome can be
predicted from the initial conditions of the system (e.g., if I throw a ball
from a known position, at a known velocity and in a known direction,
I can predict—calculate—its entire future trajectory).
• Chaos is the emergence of randomness from order [46] (e.g., if I am on
the top of a hill and I throw the ball in a vertical direction, I cannot
predict on which side of the hill it is going to end up). Even if the
equations that describe a phenomenon are known and are determinis-
tic, it may happen that a small variation in the initial conditions causes
246 annotated algorithms in python

a large difference in the possible deterministic evolution of the system.


Therefore the outcome of a process may depend on a tiny variation
of the initial parameters. These variations may not be measurable in
practice, thus making the process unpredictable and chaotic. Chaos is
generally regarded as a characteristic of some differential equations.
• Order is the opposite of chaos. It is the emergence of regular and
reproducible patterns from a process that, in itself, may be random or
chaotic (e.g., if I keep throwing my ball in a vertical direction from
the top of a hill and I record the final location of the ball, I eventually
find a regular pattern, a probability distribution associated with my
experiment, which depends on the direction of the wind, the shape of
the hill, my bias in throwing the ball, etc.).
These four concepts are closely related, and they do not necessarily come
in opposite pairs as one would expect.
A deterministic process may cause chaos. We can use chaos to gener-
ate randomness (we will see examples when covering random number
generation). We can study randomness and extract its ordered properties
(probability distributions), and we can use randomness to solve determin-
istic problems (Monte Carlo) such as computing integrals and simulating
a system.

6.2 Real randomness

Note that randomness does not necessarily come from chaos. Random-
ness exists in nature [47][48]. For example, a radioactive atom “decays”
into a different atom at some random point in time. For example, an
atom of carbon 14 decays into nitrogen 14 by emitting an electron and a
neutrino
14 14 −
6 C −→7 N + e + νe (6.1)

at some random time t; t is unpredictable. It can be proven that the


randomness in the nuclear decay time is not due to any underlying deter-
ministic process. In fact, constituents of matter are described by quantum
physics, and randomness is a fundamental characteristic of quantum sys-
random numbers and distributions 247

tems. Randomness is not a consequence of our ignorance.


This is not usually the case for macroscopic systems. Typically the ran-
domness we observe in some macroscopic systems is not always a con-
sequence of microscopic randomness. Rather, order and determinism
emerge from the microscopic randomness, while chaos originates from
the complexity of the system.
Because randomness exists in nature, we can use it to produce random
numbers with any desired distribution. In particular, we want to use the
randomness in the decay time of radioactive atoms to produce random
numbers with uniform distribution. We assemble a system consisting of
many atoms, and we record the time when we observe atoms decay:

t0 , t1 , t2 , t3 , t4 , t5 , ... (6.2)

One could study the probability distribution of the ti and find that it
follows an exponential probability distribution like

Prob(ti = t) = λe−λt (6.3)

where t0 = 1/λ is the decay time characteristic of the particular type of


atom. One characteristic of this distribution is that it is a memoryless
process: ti does not depend on ti−1 and therefore the probability that
ti > ti−1 is the same as the probability that ti < ti−1 .

6.2.1 Memoryless to Bernoulli distribution


Given the sequence {ti } with exponential distribution, we can build a
random sequence of zeros and ones (Bernoulli distribution) by applying
the following formula, known as the Von Neumann procedure [49]:
(
1 if ti > ti−1
xi = (6.4)
0 otherwise

Note that the procedure can be applied to map any random sequence into
a Bernoulli sequence even if the numbers in the original sequence do not
248 annotated algorithms in python

follow an exponential distribution, as long as ti is independent of t j for


any j < i (memoryless distribution).

6.2.2 Bernoulli to uniform distribution


To map a Bernoulli distribution into a uniform distribution, we need to
determine the precision (resolution in number of bits) of the numbers we
wish to generate. In this example, we will assume 8 bits.
We can think of each number as a point in a [0, 1) segment. We gener-
ate the uniform number by making a number of choices: we break the
segment in two and, according to the value of the binary digit (0 or 1),
we select the first part or the second part and repeat the process on the
subsegment. Because at each stage we break the segment into two parts
of equal length and we select one or the other with the same probability,
the final distribution of the selected point is uniform. As an example, we
consider the Bernoulli sequence

01011110110101010111011010 (6.5)

and we perform the following steps:


• break the sequence into chunks of 8 bits

01011110-11010101-01110110-..... (6.6)

• map each chunk a0 a1 a2 a3 a4 a5 a6 a7 into x = ∑kk< 8


=0 ak /2
k +1 thus obtain-

ing:

0.3671875 − 0.83203125 − 0.4609375 − ... (6.7)

A uniform random number generator is usually the first step toward


building any other random number generator.
Other physical processes can be used to generate real random numbers
using a similar process. Some microprocessors can generate random num-
bers from random temperature fluctuations. An unpredictable source of
randomness is called an entropy source.
random numbers and distributions 249

6.3 Entropy generators

The Linux/Unix operating system provides its own entropy source acces-
sible via “/dev/urandom.” This data source is available in Python via
[Link]().

Here we define a class that can access this entropy source and use it to
generate uniform random numbers. It follows the same process outlined
for the radioactive days:
1 class URANDOM(object):
2 def __init__(self, data=None):
3 if data: open("/dev/urandom", "wb").write(str(data))
4 def random(self):
5 n = 16
6 random_bytes = [Link](n)
7 random_integer = sum(ord(random_bytes[k]) * 256 ** k for k in range(n))
8 random_float = float(random_integer)/256 ** n

Notice how the constructor allows us to further randomize the data by


contributing input to the entropy source. Also notice how the random()
method reads 16 bytes from the stream (using [Link]()), converts each
into 8-bit integers, combines them into a 128-bit integer, and then converts
it to a float by dividing by 25616 .

6.4 Pseudo-randomness

In many cases we do not have a physical device to generate random num-


bers, and we require a software solution. Software is deterministic, the
outcome is reproducible, therefore it cannot be used to generate random-
ness, but it can generate pseudo-randomness. The outputs of pseudo
random number generators are not random, yet they may be considered
random for practical purposes. John von Neumann observed in 1951 that
“anyone who considers arithmetical methods of producing random digits
is, of course, in a state of sin.” (For attempts to generate “truly random”
numbers, see the article on hardware random number generators.) Never-
theless, pseudo random numbers are a critical part of modern computing,
from cryptography to the Monte Carlo method for simulating physical
systems.
250 annotated algorithms in python

Pseudo random numbers are relatively easy to generate with software,


and they provide a practical alternative to random numbers. For some
applications, this is adequate.

6.4.1 Linear congruential generator


Here is probably the simplest possible pseudo random number generator:

xi = ( axi−1 + c)modm (6.8)


yi = xi /m (6.9)

With the choice a = 65539, c = 0, and m = 231 , this generator is called


RANDU. It is of historical importance because it is implemented in the
C rand() function. The RANDU generator is particularly fast because the
modulus can be implemented using the finite 32-bit precision.
Here is a possible implementation for c = 0:

Listing 6.1: in file: [Link]


1 class MCG(object):
2 def __init__(self, seed, a=66539, m=2 ** 31):
3 self.x = seed
4 self.a, self.m = a, m
5 def next(self):
6 self.x = (self.a * self.x) % self.m
7 return self.x
8 def random(self):
9 return float([Link]())/self.m

which we can test with


1 >>> randu = MCG(seed=1071914055)
2 >>> for i in range(10): print([Link]())
3 ...

The output numbers “look” random but are not truly random. Running
the same code with the same seed generates the same output. Notice the
following:
• PRNGs are typically implemented as a recursive expression that, given
xi−1 , produces xi .
random numbers and distributions 251

• PRNGs have to start from an initial value, x0 , called the seed. A typical
choice is to set the seed equal to the number of seconds from the con-
ventional date and time “Thu Jan 01 01:00:00 1970.” This is not always
a good choice.
• PRNGs are periodic. They generate numbers in a finite set and then
they repeat themselves. It is desirable to have this set as large as possi-
ble.
• PRNGs depend on some parameters (e.g., a and m). Some parameter
choices lead to trivial random number generators. In general, some
choices are better than others, and a few are optimal. In particular,
the values of a and m determine the period of the random number
generator. An optimal choice is the one with the longest period.
For a linear congruential generator, because of the mod operation, the pe-
riod is always less than or equal to m. When c is nonzero, the period is
equal to m only if c and m are relatively prime, a − 1 is divisible by all
prime factors of m, and a − 1 is a multiple of 4 when m is a multiple of 4.
In the case of RANDU, the period is m/4. A better choice is using a = 75
and m = 231 − 1 (known as the Marsenne prime number) because it can
be proven that m is in fact the period of the generator:

xi = (75 xi−1 )mod(231 − 1) (6.10)

Here are some examples of MCG used by various systems:


Source m a c
Numerical Recipes 232 1664525 1013904223
glibc (used by GCC) 232 1103515245 12345
Apple CarbonLib 31
2 −1 16807 0
[Link] 248 25214903917 11
When c is set to zero, a linear congruential generator is also called a
multiplicative congruential generator.
252 annotated algorithms in python

6.4.2 Defects of PRNGs


The non-randomness of pseudo random number generators manifests it-
self in at least two different ways:
• The sequence of generated numbers is periodic, therefore only a finite
set of numbers can come out of the generator, and many of the numbers
will never be generated. This is not a major problem if the period is
much larger (some order of magnitude) than the number of random
numbers needed in the Monte Carlo computation.
• The sequence of generated numbers presents bias in the form of “pat-
terns.” Sometimes these patterns are evident, sometimes they are not
evident. Patterns exist because the pseudo random numbers are not
random but are generated using a recursive formula. The existence of
these patterns may introduce a bias in Monte Carlo computations that
use the generator. This is a nasty problem, and the implications depend
on the specific case.
An example of pattern/bias is discussed in ref. [51] and can be seen in
fig. 6.1.

6.4.3 Multiplicative recursive generator


Another modification of the multiplicative congruential generator is the
following:

xi = ( a1 xi−1 + a2 xi−2 + ... + ak xi−k )modm (6.11)

The advantage of this generator is that if m is prime, the period of this


type of generator can be as big as mk − 1. This is much larger than a
simple multiplicative congruential generator.
An example is a1 = 107374182, a2 = a3 = a4 = 0, a5 = 104480, and
m = 231 − 1, where the period is

(231 − 1)5 − 1 ≃ 4.56 × 1046 (6.12)


random numbers and distributions 253

Figure 6.1: In this plot, each three consecutive random numbers (from RANDU) are
interpreted as ( x, y, z) coordinates of a random point. The image clearly shows the
points are not distributed at random. Image from ref. [51].

6.4.4 Lagged Fibonacci generator


xi = ( xi− j + xi−k )modm (6.13)

This is similar to the multiplicative recursive generator earlier. If m is


prime and j ̸= k, the period can be as large as mk − 1.

6.4.5 Marsaglia"s add-with-carry generator


xi = ( xi− j + xi−k + ci )modm (6.14)

where c1 = 0 and ci = 1 if ( xi−1− j + xi−1−k + ci−1 ) < m, 0

6.4.6 Marsaglia"s subtract-and-borrow generator


xi = ( xi− j − xi−k − ci )modm (6.15)

where k > j > 0, c1 = 0, and ci = 1 if ( xi−1− j − xi−1−k − ci−1 ) < 0, 0


otherwise.
254 annotated algorithms in python

6.4.7 Lüscher"s generator


The Marsaglia"s subtract-and-borrow is a very popular generator, but it is
known to have some problems. For example, if we construct vector

vi = ( xi , xi+1 , ..., xi+k ) (6.16)

and the coordinates of the point vi are numbers closer to each other then
the coordinates of the point vi+k are also close to each other. This indicates
that there is an unwanted correlation between the points xi , xi+1 , ..., xi+k .
Lüscher observed [50] that the Marsaglia"s subtract-and-borrow is equiv-
alent to a chaotic discrete dynamic system, and the preceding correlation
dies off for points that distance themselves more than k. Therefore he pro-
posed to modify the generator as follows: instead of taking all xi numbers,
read k successive elements of the sequence, discard p − k numbers, read k
numbers, and so on. The number p has to be chosen to be larger than k.
When p = k, the original Marsaglia generator is recovered.

6.4.8 Knuth"s polynomial congruential generator


xi = ( axi2−1 + bxi−1 + c)modm (6.17)

This generator takes the form of a more complex function. It makes it


harder to guess one number in the sequence from the following numbers;
therefore it finds applications in cryptography.
Another example is the Blum, Blum, and Shub generator:

xi = xi2−1 modm (6.18)

6.4.9 PRNGs in cryptography


Random numbers find many applications in cryptography. For example,
consider the problem of generating a random password, a digital signa-
ture, or random encryption keys for the Diffie–Hellmann and the RSA
encryption schemes.
random numbers and distributions 255

A cryptographically secure pseudo random number generator (CSPRNG)


is a pseudo random number generator (PRNG) with properties that make
it suitable for use in cryptography.
In addition to the normal requirements for a PRNG (that its output should
pass all statistical tests for randomness) a CSPRNG must have two addi-
tional properties:
• It should be difficult to predict the output of the CSPRNG, wholly or
partially, from examining previous outputs.
• It should be difficult to extract all or part of the internal state of the
CSPRNG from examining its output.
Most PRNGs are not suitable for use as CSPRNGs. They must appear
random in statistical tests, but they are not designed to resist determined
mathematical reverse engineering.
CSPRNGs are designed explicitly to resist reverse engineering. There
are a number of examples of CSPRNGs. Blum, Blum, and Shub has the
strongest security proofs, though it is slow.
Many pseudo random number generators have the form

xi = f ( xi−1 , xi−2 , ..., xi−k ) (6.19)

For example, the next random number depends on the past k numbers.
Requirements for CSPRNGs used in cryptography are that
• Given xi−1 , xi−2 , ..., xi−k , xi can be computed in polynomial time, while
• Given xi , xi−2 , ..., xi−k , xi−1 must not be computable in polynomial time.
The first requirement means that the PRNG must be fast. The second
requirement means that if a malicious agent discovers a random number
used as a key, he or she cannot easily compute all previous keys generated
using the same PRNG.

6.4.10 Inverse congruential generator


xi = ( axi−−11 + c)modm (6.20)
256 annotated algorithms in python

where xi−−11 is the multiplicative inverse of xi−1 modulo m, for example,


xi−1 xi−−11 = 1modm.

6.4.11 Marsenne twister


One of the best PRNG algorithms (because of its long period, uniform
distribution, and speed) is the Marsenne twister, which produces a 53-bit
random number, and it has a period of 219937 − 1 (this number is 6002
digits long!). The Python random module uses the Marsenne twister. Al-
though discussing the inner working of this algorithm is beyond the scope
of these notes, we provide a pure Python implementation of the Marsenne
twister:

Listing 6.2: in file: [Link]


1 class MarsenneTwister(object):
2 """
3 based on:
4 Knuth 1981, The Art of Computer Programming
5 Vol. 2 (2nd Ed.), pp102]
6 """
7 def __init__(self, seed=4357):
8 self.w = [] # the array for the state vector
9 [Link](seed & 0xffffffff)
10 for i in range(1, 625):
11 [Link]((69069 * self.w[i-1]) & 0xffffffff)
12 [Link] = i
13 def random(self):
14 w = self.w
15 wi = [Link]
16 N, M, U, L = 624, 397, 0x80000000, 0x7fffffff
17 K = [0x0, 0x9908b0df]
18 y = 0
19 if wi >= N:
20 for kk in range((N-M) + 1):
21 y = (w[kk]&U)|(w[kk+1]&L)
22 w[kk] = w[kk+M] ^ (y >> 1) ^ K[y & 0x1]
23

24 for kk in range(kk, N):


25 y = (w[kk]&U)|(w[kk+1]&L)
26 w[kk] = w[kk+(M-N)] ^ (y >> 1) ^ K[y & 0x1]
27 y = (w[N-1]&U)|(w[0]&L)
28 w[N-1] = w[M-1] ^ (y >> 1) ^ K[y & 0x1]
29 wi = 0
30 y = w[wi]
random numbers and distributions 257

31 wi += 1
32 y ^= (y >> 11)
33 y ^= (y << 7) & 0x9d2c5680
34 y ^= (y << 15) & 0xefc60000
35 y ^= (y >> 18)
36 return (float(y)/0xffffffff )

In the above code, numbers starting with 0x are represented in hexadec-


imal notation. The symbols &, ^, <<, and >> are bitwise operators. & is a
binary AND, ^ is a binary exclusive XOR, << shifts all bits to the left and
>> shifts all bits to the right. We refer to the Python official documentation
for details.

6.5 Parallel generators and independent sequences

It is often necessary to generate many independent sequences.


For example, you may want to generate streams or random numbers in
parallel using multiple machines and processes, and you need to ensure
that the streams do not overlap.
A common mistake is to generate the sequences using the same generator
with different seeds. This is not a safe procedure because it is not obvious
if the seed used to generate one sequence belongs to the sequence gener-
ated by the other seed. The two sequences of random numbers are not
independent, but they are merely shifted in respect to each other.
For example, here are two RANDU sequences generated with different
but dependent seeds:

seed 1071931562 50554362


y0 0.252659081481 0.867315522395
y1 0.0235412092879 0.992022250779
y2 0.867315522395 0.146293803118 (6.21)
y3 0.992022250779 0.949562561698
y4 0.146293803118 0.380731142126
y5 ... ...

Note that the second sequence is the same as the first but shifted by two
lines.
258 annotated algorithms in python

Three standard techniques for generating independent sequences are non-


overlapping blocks, leapfrogging, and Lehmer trees.

6.5.1 Non-overlapping blocks


Let"s consider one sequence of pseudo random numbers:

x0 , x1 , ..., xk , xk+1 , ..., x2k , x2k+1 , ..., x3k , x3k+1 , ..., (6.22)

One can break it into subsequences of k numbers:

x0 , x1 , ..., xk−1 (6.23)


xk , xk+1 , ..., x2k−1 (6.24)
x2k , x2k+1 , ..., x3k−1 (6.25)
... (6.26)

If the original sequence is created with a multiplicative congruential gen-


erator
xi = axi−1 modm (6.27)
the subsequences can be generated independently because

xnk−1 = ank−1 x0 modm (6.28)

if the seed of the arbitrary sequence is xnk , xnk+1 , ..., xnk−1 . This is partic-
ularly convenient for parallel computers where one computer generates
the seeds for the subsequences and the processing nodes, independently,
generated the subsequences.

6.5.2 Leapfrogging
Another and probably more popular technique is leapfrogging. Let"s con-
sider one sequence of pseudo random numbers:

x0 , x1 , ..., xk , xk+1 , ..., x2k , x2k+1 , ..., x3k , x3k+1 , ..., (6.29)
random numbers and distributions 259

One can break it into subsequences of k numbers:

x0 , xk , x2k , x3k , ... (6.30)


x1 , x1+k , x1+2k , x1+3k , ... (6.31)
x2 , x2+k , x2+2k , x2+3k , ... (6.32)
... (6.33)

The seeds x1 , x2 , ..xk−1 are generated from x0 , and the independent se-
quences can be generated independently using the formula

xi+k = ak xi modm (6.34)

Therefore leapfrogging is a viable technique for parallel random number


generators.
Here is an example of a usage of leapfrog:

Listing 6.3: in file: [Link]


1 def leapfrog(mcg, k):
2 a = mcg.a ** k % mcg.m
3 return [MCG([Link](), a, mcg.m) for i in range(k)]

Here is an example of usage:


1 >>> generators=leapfrog(MCG(m), 3)
2 >>> for k in range(3):
3 ... for i in range(5):
4 ... x=generators[k].random()
5 ... print(k, "\t", i, "\t", x)

The Marsenne twister algorithm implemented in [Link] has leapfrog-


ging built in. In fact, the module includes a [Link](n) method
that allows us to efficiently skip n numbers.

6.5.3 Lehmer trees


Lehmer trees are binary trees, generated recursively, where each node
contains a random number. We start from the root containing the seed,
x0 , and we append two children containing, respectively,

xiL = ( a L xi−1 + c L )modm (6.35)


xiR = ( a R xi−1 + c R )modm (6.36)
260 annotated algorithms in python

then, recursively, append nodes to the children.

6.6 Generating random numbers from a given distribution

In this section and the next, we provide examples of distributions other


than uniform and algorithms to generate numbers using these distribu-
tions. The general strategy consists of finding ways to map uniform ran-
dom numbers into numbers following a different distribution. There are
two general techniques for mapping uniform into nonuniform random
numbers:
• accept–reject (applies to both discrete and continuous distributions)
• inversion methods (applies to continuous distributions only)
Consider the problem of generating a random number x from a given
distribution p( x ). The accept–reject method consists of generating x using a
different distribution, g( x ), and a uniform random number, u, between 0,
1. If u < p( x )/Mg( x ) (M is the max of p( x )/g( x )), then x is the desired
random number following distribution p( x ). If not, try another number.
To visualize why this works, imagine graphing the distribution p of the
random variable x onto a large rectangular board and throwing darts at
it, the coordinates of the dart being ( x, u). Assume that the darts are
uniformly distributed around the board. Now take off (reject) all of the
darts that are outside the curve. The remaining darts will be distributed
uniformly within the curve, and the x-positions of these darts will be
distributed according to the random variable"s density. This is because
there is the most room for the darts to land where the curve is highest
and thus the probability density is greatest.
The g distribution is nothing but a shape so that all darts we throw are
below it. There are two particular cases. In one case, g = p, we only throw
darts below the p that we want; therefore we accept them all. This is the
most efficient case, but it is not of practical interest because it means the
accept–reject is not doing anything, as we already know now to generate
numbers according to p. The other case is g( x ) = constant. This means
we generate the x uniformly before the accept–reject. This is equivalent to
random numbers and distributions 261

throwing the darts everywhere on the square board, without even trying
to be below the curve p.
The inversion method instead is more efficient but requires some math. It
states that if F ( x ) is a cumulative distribution function and u is a uniform
random number between 0 and 1, then x = F −1 (u) is a random number
with distribution p( x ) = f ′ ( x ). For those distributions where F can be
expressed in analytical terms and inverted, the inversion method is the
best way to generate random numbers. An example is the exponential
distribution.
We will create a new class RandomSource that includes methods to generate
the random number.

6.6.1 Uniform distribution


The uniform distributions are simple probability distributions which, in
the discrete case, can be characterized by saying that all possible values
are equally probable. In the continuous case, one says that all intervals of
the same length are equally probable.
There are two types of uniform distribution: discrete and continuous.
Here we consider the discrete case as we implement it into a randint
method:

Listing 6.4: in file: [Link]


1 class RandomSource(object):
2 def __init__(self, generator=None):
3 [Link] = generator or random
4 def random(self):
5 return [Link]()
6 def randint(self, a, b):
7 return int(a+(b-a+1) * [Link]())

Notice that the random RandomSource constructor expects a generator such


as MCG, MarsenneTwister, or simply random (default value). The random()
method is a proxy method for the equivalent method of the underlying
generator object.
We can use randint to generate a random choice from a finite set when
262 annotated algorithms in python

each option has the same probability:

Listing 6.5: in file: [Link]


1 def choice(self, S):
2 return S[[Link](0, len(S)-1)]

6.6.2 Bernoulli distribution


The Bernoulli distribution, named after Swiss scientist James Bernoulli, is
a discrete probability distribution that takes value 1 with probability of
success p and value 0 with probability of failure q = 1 − p:

 
 p
 if k = 1 

p(k) ≡ 1− p if k = 0 (6.37)
 
 0 if not k ∈ {0, 1} 

A Bernoulli random variable has an expected value of p and variance of


pq.
We implement it by adding a corresponding method to the RandomSource
class:

Listing 6.6: in file: [Link]


1 def bernoulli(self, p):
2 return 1 if [Link]()<p else 0

6.6.3 Biased dice and table lookup


A generalization of the Bernoulli distribution is a distribution in which
we have a finite set of choices, each with an associated probability.
The table can be a list of tuples (value, probability) or a dictionary of
value:probability:

Listing 6.7: in file: [Link]


1 def lookup(self, table, epsilon=1e-6):
2 if isinstance(table, dict): table = [Link]()
3 u = [Link]()
4 for key, p in table:
5 if u<p+epsilon:
6 return key
7 u = u - p
random numbers and distributions 263

8 raise ArithmeticError("invalid probability")

Let"s say we want a random number generator that can only produce the
outcome 0, 1 or 2 with known probabilities:

Prob( X = 0) = 0.50 (6.38)


Prob( X = 1) = 0.23 (6.39)
Prob( X = 2) = 0.27 (6.40)

Because the probability of the possible outcomes are rational numbers


(fractions), we can proceed as follows:
1 >>> def test_lookup(nevents=100, table=[(0, 0.50), (1, 0.23), (2, 0.27)]):
2 ... g = RandomSource()
3 ... f=[0, 0, 0]
4 ... for k in range(nevents):
5 ... p=[Link](table)
6 ... print(p, end='')
7 ... f[p]=f[p]+1
8 ... print
9 ... for i in range(len(table)):
10 ... f[i]=float(f[i])/nevents
11 ... printprint("frequency[%i]=%f" % (i, f[i]))

which produces the following output:


1 0 1 2 0 0 0 2 2 2 2 2 0 0 0 2 1 1 2 0 0 2 1 2 0 1
2 0 0 0 0 0 0 0 0 0 0 1 2 2 0 0 1 2 2 0 0 1 0 0 1 0
3 0 0 0 0 0 2 2 0 2 0 2 0 0 0 0 2 1 2 0 2 0 2 0 0 0
4 0 0 0 2 2 0 0 0 0 2 1 1 0 2 0 0 0 0 0 1 0 1 0 0 0
5 frequency[0]=0.600000
6 frequency[1]=0.140000
7 frequency[2]=0.260000

Eventually, by repeating the experiment many more times, the frequencies


of 0, 1 and 2 will approach the input probabilities.
Given the output frequencies, what is the probability that they are com-
patible with the input frequency? The answer to this question is given by
the χ2 and its distribution. We discuss this later in the chapter.
In some sense, we can think of the table lookup as an application of
the linear search. We start with a segment of length 1, and we break
it into smaller contiguous intervals of length Prob( X = 0), Prob( X =
1), ..., Prob( x = n − 1) so that ∑ Prob( X = i ) = 1. We then generate a
264 annotated algorithms in python

random point on the initial segment, and we ask in which of the n inter-
vals it falls. The table lookup method linearly searches the interval.
This technique is Θ(n), where n is the number of outcomes of the com-
putation. Therefore it becomes impractical if the number of cases is large.
In this case, we adopt one of the two possible techniques: the Fishman–
Yarberry method or the accept–reject method.

6.6.4 Fishman–Yarberry method


The Fishman–Yarberry [52] (F-Y) method is an improvement over the
naive table lookup that runs in O(⌈log2 n⌉). As the naive table lookup
is an application of the linear search, the F-Y is an application of the bi-
nary search.
Let"s assume that n = 2t is an exact power of 2. If this is not the case, we
can always reduce to this case by adding new values to the lookup table
corresponding to 0 probability. The basic data structure behind the F-Y
method is an array of arrays aij built according to the following rules:
• ∀ j ≥ 0, a0j = Prob( X = x j )
• ∀ j ≥ 0 and i > 0, aij = ai−1,2j + ai−1,2j+1
Note that 0 ≤ i < t and ∀i ≥ 0, 0 ≤ j < 2t−i , where t = log2 n. The array
of arrays a can be represented as follows:

 
a00 a01 a02 ... a0,n−1
 ... ... ... ... 
aij =  (6.41)
 
at−2,0 at−2,1 at−2,2 at−2,3

 
at−1,0 at−1,1
In other words, we can say that
• aij represents the probability

Prob( X = x j ) (6.42)

• a1j represents the probability

Prob( X = x2j orX = x2j+1 ) (6.43)


random numbers and distributions 265

• a4j represents the probability

Prob( X = x4j or X = x4j+1 or X = x4j+2 or X = x4j+3 ) (6.44)

• aij represents the probability

Prob( X ∈ { xk |2i j ≤ k < 2i ( j + 1)}) (6.45)

This algorithm works like the binary search, and at each step, it confronts
the uniform random number u with aij and decides if u falls in the range
{ xk |2i j ≤ k < 2i ( j + 1)} or in the complementary range { xk |2i ( j + 1) ≤
k < 2i ( j + 2)} and decreases i.
Here is the algorithm implemented as a class member function. The con-
structor of the class creates an array a once and for all. The method
discrete_map maps a uniform random number u into the desired discrete
integer:
1 class FishmanYarberry(object):
2 def __init__(self, table=[[0, 0.2], [1, 0.5], [2, 0.3]]):
3 t=log(len(table), 2)
4 while t!=int(t):
5 [Link]([0, 0.0])
6 t=log(len(table), 2)
7 t=int(t)
8 a=[]
9 for i in range(t):
10 [Link]([])
11 if i == 0:
12 for j in range(2 ** t):
13 a[i].append(table[j, 1])
14 else:
15 for j in range(2 ** (t-i)):
16 a[i].append(a[i-1][2 * j]+a[i-1][2 * j+1])
17 [Link]=table
18 self.t=t
19 self.a=a
20

21 def discrete_map(self, u):


22 i=int(self.t)-1
23 j=0
24 b=0
25 while i>0:
26 if u>b+self.a[i][j]:
27 b=b+self.a[i][j]
266 annotated algorithms in python

28 j=2 * j+2
29 else:
30 j=2 * j
31 i=i-1
32 if u>b+self.a[i][j]:
33 j=j+1
34 return [Link][j][0]

6.6.5 Binomial distribution


The binomial distribution is a discrete probability distribution that de-
scribes the number of successes in a sequence of n independent experi-
ments, each of which yields success with probability p. Such a success–
failure experiment is also called a Bernoulli experiment.
A typical example is the following: 7% of the population are left-handed.
You pick 500 people randomly. How likely is it that you get 30 or more
left-handed? The number of left-handed you pick is a random variable X
that follows a binomial distribution with n = 500 and p = 0.07. We are
interested in the probability Prob( X = 30).
In general, if the random variable X follows the binomial distribution
with parameters n and p, the probability of getting exactly k successes is
given by

 
n k
p(k ) = Prob( X = k ) ≡ p (1 − p ) n − k (6.46)
k
for k = 0, 1, 2, ..., n.
The formula can be understood as follows: we want k successes (pk ) and
n − k failures ((1 − p)n−k ). However, the k successes can occur anywhere
among the n trials, and there are (nk) different ways of distributing k suc-
cesses in a sequence of n trials.
The mean is µ X = np, and the variance is σX2 = np(1 − p).
If X and Y are independent binomial variables, then X + Y is again a
binomial variable; its distribution is
 
n X + nY k
p(k ) = Prob( X = k ) = p (1 − p ) n − k (6.47)
k
random numbers and distributions 267

We can generate random numbers following binomial distribution using


a table lookup with table
 
n k
table[k] = Prob( X = k ) = p (1 − p ) n − k (6.48)
k

For large n, it may be convenient to avoid storing the table and use the for-
mula directly to compute its elements on a need-to-know basis. Moreover,
because the table is accessed sequentially by the table lookup algorithm,
one may just notice that the current recursive relation holds:

Prob( X = 0) = (1 − p ) n (6.49)
n p
Prob( X = k + 1) = Prob( X = k ) (6.50)
k+11− p

This allows for a very efficient implementation:

Listing 6.8: in file: [Link]


1 def binomial(self, n, p, epsilon=1e-6):
2 u = [Link]()
3 q = (1.0-p) ** n
4 for k in range(n+1):
5 if u<q+epsilon:
6 return k
7 u = u - q
8 q = q * (n-k)/(k+1) * p/(1.0-p)
9 raise ArithmeticError("invalid probability")

6.6.6 Negative binomial distribution


In probability theory, the negative binomial distribution is the probability
distribution of the number of trials n needed to get a fixed (nonrandom)
number of successes k in a Bernoulli process. If the random variable
X is the number of trials needed to get r successes in a series of trials
where each trial has probability of success p, then X follows the negative
binomial distribution with parameters r and p:

n−1 k
 
p(n) = Prob( X = n) = p (1 − p ) n − k (6.51)
k−1

Here is an example:
268 annotated algorithms in python

John, a kid, is required to sell candy bars in his neighborhood to raise


money for a field trip. There are thirty homes in his neighborhood, and
he is told not to return home until he has sold five candy bars. So the
boy goes door to door, selling candy bars. At each home he visits, he has
a 0.4 probability of selling one candy bar and a 0.6 probability of selling
nothing.
• What"s the probability of selling the last candy bar at the nth house?

n−1
 
p(n) = 0.45 0.6n−5 (6.52)
4

• What"s the probability that he finishes on the tenth house?


 
9
p(10) = 0.45 0.65 = 0.10 (6.53)
4

• What"s the probability that he finishes on or before reaching the eighth


house? Answer: To finish on or before the eighth house, he must finish
at the fifth, sixth, seventh, or eighth house. Sum those probabilities:

∑ p(i ) = 0.1737 (6.54)


i =5,6,7,8

• What"s the probability that he exhausts all houses in the neighborhood


without selling the five candy bars?

1− ∑ p(i ) = 0.0015 (6.55)


i =5,..,30

As with the binomial distribution, we can find an efficient recursive for-


mula for the negative binomial distribution:

Prob( X = k ) = pk (6.56)
n
Prob( X = n + 1) = (1 − p)Prob( X = n) (6.57)
n−k+1

This allows for a very efficient implementation:


random numbers and distributions 269

Listing 6.9: in file: [Link]


1 def negative_binomial(self, k, p, epsilon=1e-6):
2 u = [Link]()
3 n = k
4 q = p ** k
5 while True:
6 if u<q+epsilon:
7 return n
8 u = u - q
9 q = q * n/(n-k+1) * (1-p)
10 n = n + 1
11 raise ArithmeticError("invalid probability")

Notice once again that, unlike the binomial case, here k is fixed, not n,
and the random variable has a minimum value of k but no upper bound.

6.6.7 Poisson distribution


The Poisson distribution is a discrete probability distribution discovered
by Simëon-Denis Poisson. It describes a random variable X that counts,
among other things, the number of discrete occurrences (sometimes called
arrivals) that take place during a time interval of given length. The prob-
ability that there are exactly x occurrences (x being a natural number
including 0, k = 0, 1, 2, ...) is

λk
p(k ) = Prob( X = k ) = e−λ (6.58)
k!

The Poisson distribution arises in connection with Poisson processes. It


applies to various phenomena of discrete nature (i.e., those that may hap-
pen 0, 1, 2, 3, ..., times during a given period of time or in a given area)
whenever the probability of the phenomenon happening is constant in
time or space. The Poisson distribution differs from the other distribu-
tions considered in this chapter because it is different than zero for any
natural number k rather than for a finite set of k values.
Examples include the following:
• The number of unstable nuclei that decayed within a given period of
time in a piece of radioactive substance.
• The number of cars that pass through a certain point on a road during
270 annotated algorithms in python

a given period of time.


• The number of spelling mistakes a secretary makes while typing a sin-
gle page.
• The number of phone calls you get per day.
• The number of times your web server is accessed per minute.
• The number of roadkill you find per mile of road.
• The number of mutations in a given stretch of DNA after a certain
amount of radiation.
• The number of pine trees per square mile of mixed forest.
• The number of stars in a given volume of space.
The limit of the binomial distribution with parameters n and p = λ/n, for
n approaching infinity, is the Poisson distribution:

λ n−k
 k 
λk

n! λ 1
1− ≃ e−λ + O ( ) (6.59)
(n − k)!k! n n k! n

Intuitively, the meaning of λ is the following:


Let"s consider a unitary time interval T and divide it into n subintervals
of the same size. Let pn be the probability of one success occurring in a
single subinterval. For T fixed when n → ∞, pn → 0 but the limit

lim pn (6.60)
n→∞

is finite. This limit is λ.


We can use the same technique adopted for the binomial distribution and
observe that for Poisson,

Prob( X = 0) = e − λ (6.61)
λ
Prob( X = k + 1) = Prob( X = k ) (6.62)
k+1
therefore the preceding algorithm can be modified into
random numbers and distributions 271

Figure 6.2: Example of Poisson distribution.

Listing 6.10: in file: [Link]


1 def poisson(self, lamb, epsilon=1e-6):
2 u = [Link]()
3 q = exp(-lamb)
4 k=0
5 while True:
6 if u<q+epsilon:
7 return k
8 u = u - q
9 q = q * lamb/(k+1)
10 k = k+1
11 raise ArithmeticError("invalid probability")

Note how this algorithm may take an arbitrary amount of time to generate
a Poisson distributed random number, but eventually it stops. If u is very
close to 1, it is possible that errors due to finite machine precision cause
the algorithm to enter into an infinite loop. The +ε term can be used to
correct this unwanted behavior by choosing ε relatively small compared
with the precision required in the computation, but larger than machine
precision.
272 annotated algorithms in python

6.7 Probability distributions for continuous random vari-


ables

6.7.1 Uniform in range


A typical problem is generating random integers in a given range [ a, b],
including the extreme. We can map uniform random numbers yi ∈ (0, 1)
into integers by using the formula

hi = a + ⌊(b − a + 1)yi ⌋ (6.63)

Listing 6.11: in file: [Link]


1 def uniform(self, a, b):
2 return a+(b-a) * [Link]()

6.7.2 Exponential distribution


The exponential distribution is used to model Poisson processes, which
are situations in which an object initially in state A can change to state
B with constant probability per unit time λ. The time at which the state
actually changes is described by an exponential random variable with
parameter λ. Therefore the integral from 0 to T over p(t) is the probability
that the object is in state B at time T.
The probability mass function is given by

p( x ) = λe−λx (6.64)

The exponential distribution may be viewed as a continuous counterpart


of the geometric distribution, which describes the number of Bernoulli
trials necessary for a discrete process to change state. In contrast, the
exponential distribution describes the time for a continuous process to
change state.
Examples of variables that are approximately exponentially distributed
are as follows:
• the time until you have your next car accident
random numbers and distributions 273

• the time until you get your next phone call


• the distance between mutations on a DNA strand
• the distance between roadkill
An important property of the exponential distribution is that it is memo-
ryless: the chance that an event will occur s seconds from now does not
depend on the past. In particular, it does not depend on how much time
we have been waiting already. In a formula we can write this condition as

Prob( X > s + t| X > t) = Prob( X > s) (6.65)

Any process satisfying the preceding condition is a Poisson process. The


number of events per time unit is given by the Poisson distribution, and
the time interval between consecutive events is described by the exponen-
tial distribution.

Figure 6.3: Example of exponential distribution.

The exponential distribution can be generated using the inversion


method. The scope is to determine a function x = f (u) that maps a uni-
274 annotated algorithms in python

formly distributed variable u into a continuous random variable x with


probability mass function p( x ) = λe−λx .
According to the inversion method, we proceed by computing F:
Z x
F(x) = p(y)dy = 1 − e−λx (6.66)
0

and we then invert u = F ( x ), thus obtaining

1
x=− log(1 − u) (6.67)
λ
Now notice that if u is uniform, 1 − u is also uniform; therefore we can
further simplify:
1
x = − log u (6.68)
λ

We implement as follows:

Listing 6.12: in file: [Link]


1 def exponential(self, lamb):
2 return -log([Link]())/lamb

This is an important distribution, and Python has a function for it:


1 [Link](lamb)

6.7.3 Normal/Gaussian distribution


The normal distribution (also known as Gaussian distribution) is an ex-
tremely important probability distribution considered in statistics. Here
is the probability mass function:

1 ( x − µ )2

p( x ) = √ e 2σ2 (6.69)
σ 2π

where E[ X ] = µ and E[( x − µ)2 ] = σ2 .


The standard normal distribution is the normal distribution with a mean
of 0 and a standard deviation of 1. Because the graph of its probability
density resembles a bell, it is often called the bell curve.
The Gaussian distribution has two important properties:
random numbers and distributions 275

• The average of many independent random variables with finite mean


and finite variance tends to be a Gaussian distribution.
• The sum of two independent Gaussian random variables with means
µ1 and µ2 and variances σ12 and σ22 is also a Gaussian random variable
with mean µ = µ1 + µ2 and variance σ2 = σ12 + σ22 .

Figure 6.4: Example of Gaussian distribution.

There is no way to map a uniform random number into a Gaussian num-


ber but there is an algorithm to generate two independent Gaussian ran-
dom numbers (y1 and y2 ) using two independent uniform random num-
bers (x1 and x2 ):
• computing v1 = 2x1 − 1, v2 = 2x2 − 1 and s = v21 + v22
• if s > 1 start again
p p
• y1 = v1 (−2/s) log s and y2 = v2 (−2/s) log s

Listing 6.13: in file: [Link]


1 def gauss(self, mu=0.0, sigma=1.0):
2 if hasattr(self, "other") and [Link]:
3 this, other = [Link], None
276 annotated algorithms in python

4 else:
5 while True:
6 v1 = [Link](-1, 1)
7 v2 = [Link](-1, 1)
8 r = v1 * v1+v2 * v2
9 if r<1: break
10 this = sqrt(-2.0 * log(r)/r) * v1
11 [Link] = sqrt(-2.0 * log(r)/r) * v1
12 return mu+sigma * this

Note how the first time the method next is called, it generates two Gaus-
sian numbers (this and other), stores other, and returns this. Every other
time, the method next is called if other is stored, and it returns a number;
otherwise it recomputes this and other again.
To map a random Gaussian number y with mean 0 and standard deviation
1 into another Gaussian number y′ with mean µ and standard deviation
σ,
y′ = µ + yσ (6.70)
We used this relation in the last line of the code.
This is also an important distribution, and Python has a function for it:
1 [Link](mu, sigma)

Given a Gaussian random variable with mean µ and standard deviation


σ, it is often useful to know how many standard deviations a correspond
to a confidence c defined as

Z µ+ aσ
c= p( x )dx (6.71)
µ− aσ

The following algorithm generates a table of a versus c given µ and σ:

Listing 6.14: in file: [Link]


1 def confidence_intervals(mu, sigma):
2 """Computes the normal confidence intervals"""
3 CONFIDENCE=[
4 (0.68, 1.0),
5 (0.80, 1.281551565545),
6 (0.90, 1.644853626951),
7 (0.95, 1.959963984540),
8 (0.98, 2.326347874041),
9 (0.99, 2.575829303549),
random numbers and distributions 277

10 (0.995, 2.807033768344),
11 (0.998, 3.090232306168),
12 (0.999, 3.290526731492),
13 (0.9999, 3.890591886413),
14 (0.99999, 4.417173413469)
15 ]
16 return [(a, mu-b * sigma, mu+b * sigma) for (a, b) in CONFIDENCE]

6.7.4 Pareto distribution


The Pareto distribution, named after the economist Vilfredo Pareto, is a
power law probability distribution that coincides with social, scientific,
geophysical, actuarial, and many other types of observable phenomena.
Outside the field of economics, it is sometimes referred to as the Bradford
distribution. Its cumulative distribution function is

 x α
m
F ( x ) ≡ Prob( X < x ) = 1 − (6.72)
x

Figure 6.5: Example of Pareto distribution.

It can be implemented as follows using the inversion method:


278 annotated algorithms in python

Listing 6.15: in file: [Link]


1 def pareto(self, alpha, xm):
2 u = [Link]()
3 return xm * (1.0-u) ** (-1.0/alpha)

The Python function to generate Pareto distributed random numbers is


1 xm * [Link](alpha)

The Pareto distribution is an example of Levy distribution. The Central


Limit theorem does not apply to it.

6.7.5 In and on a circle


We can generate a random point ( x, y) uniformly distributed on a circle
by generating a random angle.

x = cos(2πu) (6.73)
y = sin(2πu) (6.74)

Listing 6.16: in file: [Link]


1 def point_on_circle(self, radius=1.0):
2 angle = 2.0 * pi * [Link]()
3 return radius * [Link](angle), radius * [Link](angle)

We can generate a random point uniformly distributed inside a circle


by generating, independently, the x and y coordinates of points inside a
square and rejecting those outside the circle:

Listing 6.17: in file: [Link]


1 def point_in_circle(self, radius=1.0):
2 while True:
3 x = [Link](-radius, radius)
4 y = [Link](-radius, radius)
5 if x * x+y * y < radius * radius:
6 return x, y

6.7.6 In and on a sphere


A random point ( x, y, z) uniformly distributed on a sphere of radius 1 is
obtained by generating three uniform random numbers u1 , u2 , u3 ,; com-
random numbers and distributions 279

pute vi = 2ui − 1, and if v21 + v22 + v23 ≤ 1,


q
x = v1 / v21 + v22 + v23 (6.75)
q
y = v2 / v21 + v22 + v23 (6.76)
q
z = v3 / v21 + v22 + v23 (6.77)

else start again.

Listing 6.18: in file: [Link]


1 def point_in_sphere(self, radius=1.0):
2 while True:
3 x = [Link](-radius, radius)
4 y = [Link](-radius, radius)
5 z = [Link](-radius, radius)
6 if x * x+y * y * z * z < radius * radius:
7 return x, y, z
8

9 def point_on_sphere(self, radius=1.0):


10 x, y, z = self.point_in_sphere(radius)
11 norm = [Link](x * x+y * y+z * z)
12 return x/norm, y/norm, z/norm

6.8 Resampling

So far we always generated random numbers by modeling the random


variable (e.g., uniform, or exponential, or Pareto) and using an algorithm
to generate possible values of the random variables.
We now introduce a different methodology, which we will need later
when talking about the bootstrap method. If we have a population S
of equally distributed events and we need to generate an event from the
same distribution as the population, we can simply draw a random ele-
ment from the population. In Python, this is done with
1 >>> S = [1, 2, 3, 4, 5, 6]
2 >>> [Link](S)

We can therefore generate a sample of random events by repeating this


procedure. This is called resampling [53]:

Listing 6.19: in file: [Link]


280 annotated algorithms in python

1 def resample(S, size=None):


2 return [[Link](S) for i in range(size or len(S))]

6.9 Binning

Binning is the process of dividing a space of possible events into partitions


and counting how many events fall into each partition. We can bin the
numbers generated by a pseudo random number generator and measure
the distribution of the random numbers.
Let"s consider the following program:
1 def bin(generator, nevents, a, b, nbins):
2 # create empty bins
3 bins=[]
4 for k in range(nbins):
5 [Link](0)
6 # fill the bins
7 for i in range(nevents):
8 x=[Link]()
9 if x>=a and x<=b:
10 k=int((x-a)/(b-a) * nbins)
11 bins[k]=bins[k]+1
12 # normalize bins
13 for i in range(nbins):
14 bins[i]=float(bins[i])/nevents
15 return bins
16
17 def test_bin(nevents=1000, nbins=10):
18 bins=bin(MCG(time()), nevents, 0, 1, nbins)
19 for i in range(len(bins)):
20 print(i, bins[i])
21

22 >>> test_bin()

NumPy provides histogram for efficient binning:


1 >>> import numpy as np
2 >>> samples = [Link](0, 1, 1000)
3 >>> counts, edges = [Link](samples, bins=10, range=(0, 1))
4 >>> frequencies = counts / len(samples)

It produces the following output:


1 i frequency[i]
2 0 0.101
3 1 0.117
4 2 0.092
random numbers and distributions 281

5 3 0.091
6 4 0.091
7 5 0.122
8 6 0.096
9 7 0.102
10 8 0.090
11 9 0.098

Note that
• all bins have the same size 1/nbins;
• the size of the bins is normalized, and the sum of the values is 1
• the distribution of the events into bins approaches the distribution of
the numbers generated by the random number generator
As an experiment, we can do the same binning on a larger number of
events,
1 >>> test_bin(100000)

which produces the following output:


1 i frequency[i]
2 0 0.09926
3 1 0.09772
4 2 0.10061
5 3 0.09894
6 4 0.10097
7 5 0.09997
8 6 0.10056
9 7 0.09976
10 8 0.10201
11 9 0.10020

Note that these frequencies differ from 0.1 for less than 3%, whereas some
of the preceding numbers differ from 0.11 for more than 20%.
7
Monte Carlo Simulations

7.1 Introduction

Monte Carlo methods are a class of algorithms that rely on repeated ran-
dom sampling to compute their results, which are otherwise determinis-
tic.

7.1.1 Computing π
The standard way to compute π is by applying the definition: π is the
length of a semicircle with a radius equal to 1. From the definition, one
can derive an exact formula:

π = 4 arctan 1 (7.1)

The arctan has the following Taylor series expansion:1 :

x2i+1
arctan x = ∑ (−1)i 2i + 1 (7.8)
i =0
1 Taylor expansion:
1 ′′ 1
f ( x ) = f (0) + f ′ (0) x + f (0) x2 + ... + f (i) (0) x2 + .... (7.2)
2! i!
284 annotated algorithms in python

and one can approximate π to arbitrary precision by computing the sum


4
π= ∑ (−1)i 2i + 1 (7.9)
i =0

We can use the program


1 def pi_Taylor(n):
2 pi=0
3 for i in range(n):
4 pi=pi+4.0/(2 * i+1) * (-1) ** i
5 print(i, pi)
6

7 >>> pi_Taylor(1000)

which produces the following output:


1 0 4.0
2 1 2.66666...
3 2 3.46666...
4 3 2.89523...
5 4 3.33968...
6 ...
7 999 3.14..

A better formula is due to Plauffe,

 
1 4 2 1 1
π=∑ i − − − (7.10)
i =0 16
8i + 1 8i + 4 8i + 5 8i + 6

which we can implement as follows: we can use the program


1 from decimal import Decimal
2

3 def pi_Plauffe(n):

and if f ( x ) = arctan x then:


d arctan x 1
f ′ (x) = = → f ′ (0) = 1 (7.3)
dx 1 + x2
d2 arctan x d 1 2x
f ′′ ( x ) = = =− (7.4)
d2 x dx 1 + x2 (1 + x 2 )2
... (7.5)
(2i )!
f (2i+1) ( x ) = (−1)i + x... → f (2i+1) (0) = (−1)(2i )! (7.6)
(1 + x2 )2i+1
f (2i) ( x ) = x... → f (2i) (0) = 0 (7.7)
monte carlo simulations 285

4 pi=Decimal(0)
5 a, b, c, d = Decimal(4), Decimal(2), Decimal(1), Decimal(1)/Decimal(16)
6 for i in range(n):
7 i8 = Decimal(8) * i
8 pi=pi+(d ** i) * (a/(i8+1)-b/(i8+4)-c/(i8+5)-c/(i8+6))
9 return pi
10 >>> pi_Plauffe(1000)

The preceding formula works and converges very fast and already in 100
iterations produces

π = 3.1415926535897932384626433... (7.11)

There is a different approach based on the fact that π is also the area of a
circle of radius 1. We can draw a square or area containing a quarter of a
circle of radius 1. We can randomly generate points ( x, y) with uniform
distribution inside the square and check if the points fall inside the circle.
The ratio between the number of points that fall in the circle over the
total number of points is proportional to the area of the quarter of a circle
(π/4) divided by the area of the square (1).
Here is a program that implements this strategy:
1 from random import *
2

3 def pi_mc(n):
4 pi=0
5 counter=0
6 for i in range(n):
7 x=random()
8 y=random()
9 if x ** 2 + y ** 2 < 1:
10 counter=counter+1
11 pi=4.0 * float(counter)/(i+1)
12 print(i, pi)
13

14 pi_mc(1000)

The output of the algorithm is shown in fig. 7.1.


The convergence rate in this case is very slow, and this algorithm is of no
practical value, but the methodology is sound, and for some problems,
this method is the only one feasible.
Let"s summarize what we have done: we have formulated our problem
286 annotated algorithms in python

Figure 7.1: Convergence of pi_mc.

(compute π) as the problem of computing an area (the area of a quarter


of a circle), and we have computed the area using random numbers. This
is a particular example of a more general technique known as a Monte
Carlo integration. In fact, the computation of an area is equivalent to the
problem of computing an integral.
Sometimes the formula is not known, or it is too complex to compute
reliably, hence a Monte Carlo solution becomes preferable.

7.1.2 Simulating an online merchant


Let"s consider an online merchant. A website is visited many times a day.
From the logfile of the web application, we determine that the average
number of visitors in a day is 976, the number of visitors is Gaussian
distributed, and the standard deviation is 352. We also observe that each
visitor has a 5% probability of purchasing an item if the item is in stock
and a 2% probability to buy an item if the item is not in stock.
The merchant sells only one type of item that costs $100 per unit. The
monte carlo simulations 287

merchant maintains N items in stock. The merchant pays $30 a day to


store each unit item in stock. What is the optimal N to maximize the
average daily income of the merchant?
This problem cannot easily be formulated analytically or reduced to the
computation of an integral, but it can easily be simulated.
In particular, we simulate many days and, for each day i, we start with N
items in stock, and we loop over each simulated visitor. If the visitor finds
an item in stock, he buys it with a 5% probability (producing an income
of $70), whereas if the item is not in stock, he buys it with 2% probability
(producing an income of $100). At the end of each day, we pay $30 for
each item remaining in stock.
Here is a program that takes N (the number of items in stock) and d (the
number of simulated days) and computes the average daily income:
1 def simulate_once(N):
2 profit = 0
3 loss = 30 * N
4 instock = N
5 for j in range(int(gauss(976, 352))):
6 if instock>0:
7 if random()<0.05:
8 instock=instock-1
9 profit = profit + 100
10 else:
11 if random()<0.02:
12 profit = profit + 100
13 return profit-loss
14

15 def simulate_many(N, ap=1, rp=0.01, ns=1000):


16 s = 0.0
17 for k in range(1, ns):
18 x = simulate_once(N)
19 s += x
20 mu = s/k
21 if k>10 and mu-mu_old<max(ap, rp * mu):
22 return mu
23 else:
24 mu_old = mu
25 raise ArithmeticError("no convergence")

By looping over different N (items in stock), we can compute the average


daily income as a function of N:
288 annotated algorithms in python

1 >>> for N in range(0, 100, 10):


2 >>> print(N, simulate_many(N, ap=100))

The program produces the following output:


1 n income
2 0 1955
3 10 2220
4 20 2529
5 30 2736
6 40 2838
7 50 2975
8 60 2944
9 70 2711
10 80 2327
11 90 2178

From this we deduce that the optimal number of items to carry in stock is
about 50. We could increase the resolution and precision of the simulation
by increasing the number of simulated days and reducing the step of the
amount of items in stock.
Note that the statement gauss(976, 352) generates a random floating point
number with a Gaussian distribution centered at 976 and standard devia-
tion equal to 352, whereas the statement
1 if random()<0.05:

ensures that the subsequent block is executed with a probability of 5%.


The basic ingredients of every Monte Carlo simulation are here: (1) a func-
tion that simulates the system once and uses random variables to model
unknown quantities; (2) a function that repeats the simulation many times
to compute an average.
Any Monte Carlo solver comprises the following parts:
• A generator of random numbers (such as we have discussed in the
previous chapter)
• A function that uses the random number generator and can simulate
the system once (we will call x the result of each simulate once)
• A function that calls the preceding simulation repeatedly and averages
the results until they converge µ = N1 ∑ xi
monte carlo simulations 289

• A function to estimate the accuracy of the result and determine when


to stop the simulation, δµ < precision

7.2 Error analysis and the bootstrap method

The result of any MC computation is an average:

1
µ=
N ∑ xi (7.12)

The error on this average can be estimated using the formula

s  
σ 1 1
δµ = √ =
N N N ∑ xi2 − µ2 (7.13)

This formula assumes the distribution of the xi is Gaussian. Using this


formula, we can compute a 68% confidence level for the MC computation
of π, shown in fig. 7.2.

Figure 7.2: Convergence of π.


290 annotated algorithms in python

The purpose of the bootstrap [54] algorithm is computing the error in an


average µ = (1/N ) ∑ xi without making the assumption that the xi are
Gaussian.
The first step of the bootstrap methodology consists of computing the
average not only on the initial sample { xi } but also on many data samples
obtained by resampling the original data. If the number of elements N of
the original sample were infinity, the average on each other sample would
be the same. Because N is finite, each of these means produces slightly
different results:

1
∑ xi
[k]
µk = (7.14)
N
[k]
where xi is the ith element of resample k and µk is the average of that
resample.
The second step of the bootstrap methodology consists of sorting the µk
and finding two values µ− and µ+ that with a given percentage of the
means follows in between those two values. The given percentage is the
confidence level, and we set it to 68%.
Here is the complete algorithm:

Listing 7.1: in file: [Link]


1 def bootstrap(x, confidence=0.68, nsamples=100):
2 """Computes the bootstrap errors of the input list."""
3 def mean(S): return float(sum(x for x in S))/len(S)
4 means = [mean(resample(x)) for k in range(nsamples)]
5 [Link]()
6 left_tail = int(((1.0-confidence)/2) * nsamples)
7 right_tail = nsamples-1-left_tail
8 return means[left_tail], mean(x), means[right_tail]

Here is an example of usage:


1 >>> S = [[Link](2, 1) for k in range(100)]
2 >>> bootstrap(S)
3 (1.7767055865879007, 1.8968778392283303, 2.003420362236985)

In this example, the output consists of µ− , µ, and µ+ .


Using NumPy, the bootstrap is vectorized:
monte carlo simulations 291

1 >>> import numpy as np


2 >>> S = [Link](2, 1, 100)
3 >>> resamples = [Link](S, size=(100, len(S)), replace=True)
4 >>> means = [Link](axis=1)
5 >>> [Link]()
6 >>> left, right = int(0.16 * 100), int(0.84 * 100)
7 >>> print(means[left], [Link](), means[right])

Because S contains 100 random Gaussian numbers, with average 2 and


standard deviation 1, we expect µ to be close to 2. We get 1.89. The boot-
strap tells us that with 68% probability, the true average of these numbers
is indeed between 1.77 and 2.00. The uncertainty (2.00 − 1.77)/2 = 0.12

is compatible with σ/ 100 = 1/10 = 0.10.

7.3 A general purpose Monte Carlo engine

We can now combine everything we have seen so far into a generic pro-
gram that can be used to perform the most generic Monte Carlo compu-
tation/simulation:

Listing 7.2: in file: [Link]


1 class MCEngine:
2 """
3 Monte Carlo Engine parent class.
4 Runs a simulation many times and computes average and error in average.
5 Must be extended to provide the simulate_once method
6 """
7 def simulate_once(self):
8 raise NotImplementedError
9
10 def simulate_many(self, ap=0.1, rp=0.1, ns=1000):
11 [Link] = []
12 s1=s2=0.0
13 [Link]=False
14 for k in range(1, ns):
15 x = self.simulate_once()
16 [Link](x)
17 s1 += x
18 s2 += x * x
19 mu = float(s1)/k
20 variance = float(s2)/k-mu * mu
21 dmu = sqrt(variance/k)
22 if k>10:
23 if abs(dmu)<max(ap, abs(mu) * rp):
292 annotated algorithms in python

24 [Link] = True
25 break
26 [Link]()
27 return bootstrap([Link])

The preceding class has two methods:


• simulate_once is not implemented because the class is designed to be
subclassed, and the method is supposed to be implemented for each
specific computation.
• simulate_manyis the part that stays the same; it calls simulate_once re-
peatedly, computes average and error analysis, checks convergence,
and computes bootstrap error for the result.
It is also useful to have a function, which we call var (aka value at risk [55]),
which computes a numerical value so that the output of a given percent-
age of the simulations falls below that value:

Listing 7.3: in file: [Link]


1 def var(self, confidence=95):
2 index = int(0.01 * len([Link]) * confidence+0.999)
3 if len([Link])-index < 5:
4 raise ArithmeticError("not enough data, not reliable")
5 return [Link][index]

Now, as a first example, we can recompute π using this class:


1 >>> class PiSimulator(MCEngine):
2 ... def simulate_once(self):
3 ... return 4.0 if ([Link]() ** 2+[Link]() ** 2)<1 else 0.0
4 ...
5 >>> s = PiSimulator()
6 >>> s.simulate_many()
7 (2.1818181818181817, 2.909090909090909, 3.6363636363636362)

Our engine finds that the value of π with 68% confidence level is between
2.18 and 3.63, with the most likely value of 2.90. Of course, this is incor-
rect, because it generates too few samples, but the bounds are correct, and
that is what matters.

7.3.1 Value at risk


Let"s consider a business subject to random losses, for example, a large
bank subject to theft from employees. Here we will make the following
monte carlo simulations 293

reasonable assumptions (which have been verified with data):


• There is no correlation between individual events.
• There is no correlation between the time when a loss event occurs and
the amount of the loss.
• The time interval between losses is given by the exponential distribu-
tion (this is a Poisson process).
• The distribution of the loss amount is a Pareto distribution (there is a
fat tail for large losses).
• The average number of losses is 10 per day.
• The minimum recorded loss is $5000. The average loss is $15, 000.
Our goal is to simulate one year of losses and to determine
• The average total yearly loss
• How much to save to make sure that in 95% of the simulated scenarios,
the losses can be covered without going broke
From these assumptions, we determine that the λ = 10 for the exponential
distribution and xm = 3000 for the Pareto distribution. The mean of the
Pareto distribution is αxm /(α − 1) = 15, 000, from which we determine
that α = 1.5.
We can answer the first questions (the average total loss) simply multiply-
ing the average number of losses per year, 52 × 5, by the number of losses
in one day, 10, and by the average individual loss, $15, 000, thus obtaining

[average yearly loss] = $39, 000, 000 (7.15)

To answer the second question, we would need to study the width of the
distribution. The problem is that, for α = 1.5, the standard deviation of
the Pareto distribution is infinity, and analytical methods do not apply.
We can do it using a Monte Carlo simulation:

Listing 7.4: in file: [Link]


1 from nlib import *
294 annotated algorithms in python

2 import random
3

4 class RiskEngine(MCEngine):
5 def __init__(self, lamb, xm, alpha):
6 [Link] = lamb
7 [Link] = xm
8 [Link] = alpha
9 def simulate_once(self):
10 total_loss = 0.0
11 t = 0.0
12 while t<260:
13 dt = [Link]([Link])
14 amount = [Link] * [Link]([Link])
15 t += dt
16 total_loss += amount
17 return total_loss
18

19 def main():
20 s = RiskEngine(lamb=10, xm=5000, alpha=1.5)
21 print(s.simulate_many(rp=1e-4, ns=1000))
22 print([Link](95))
23

24 main()

This produces the following output:


1 (38740147.179054834, 38896608.25084647, 39057683.35621854)
2 45705881.8776

The output of simulate_many should be compatible with the true result


(defined as the result after an infinite number of iterations and at infinite
precision) within the estimated statistical error.
The output of the var function answers our second questions: We have to
save $45, 705, 881 to make sure that in 95% of cases our losses are covered
by the savings.

7.3.2 Network reliability


Let"s consider a network represented by a set of nnodes nodes and nlinks
bidirectional links. Information packets travel on the network. They can
originate at any node (start) and be addressed to any other node (stop).
Each link of the network has a probability p of transmitting the packet
(success) and a probability (1 − p) of dropping the packet (failure). The
probability p is in general different for each link of the network.
monte carlo simulations 295

We want to compute the probability that a packet starting in start finds a


successful path to reach stop. A path is successful if, for a given simula-
tion, all links in the path succeed in carrying the packet.
The key trick in solving this problem is in finding the proper representa-
tion for the network. Since we are not requiring to determine the exact
path but only proof of existence, we use the concept of equivalence classes.
We say that two nodes are in the same equivalence class if and only if
there is a successful path that connects the two nodes.
The optimal data structure to implement equivalence classes is DisjSets,
discussed in chapter 3.
To simulate the system, we create a class Network that extends MCEngine. It
has a simulate_once method that tries to send a packet from start to stop
and simulates the network once. During the simulation each link of the
network may be up or down with given probability. If there is a path con-
necting the start node to the stop node in which all links of the network
are up, then the packet transfer succeeds. We use the DisjointSets to rep-
resent sets of nodes connected together. If there is a link up connecting a
node from a set to a node in another set, then the two sets are joined. If,
in the end, the start and stop nodes are found to belong to the same set,
then there is a path and simulate_once returns 1, otherwise it returns 0.

Listing 7.5: in file: [Link]


1 from nlib import *
2 import random
3
4 class NetworkReliability(MCEngine):
5 def __init__(self, n_nodes, start, stop):
6 [Link] = []
7 self.n_nodes = n_nodes
8 [Link] = start
9 [Link] = stop
10 def add_link(self, i, j, failure_probability):
11 [Link]((i, j, failure_probability))
12 def simulate_once(self):
13 nodes = DisjointSets(self.n_nodes)
14 for i, j, pf in [Link]:
15 if [Link]()>pf:
16 [Link](i, j)
296 annotated algorithms in python

17 return [Link](i, j)
18

19 def main():
20 s = NetworkReliability(100, start=0, stop=1)
21 for k in range(300):
22 s.add_link([Link](0, 99),
23 [Link](0, 99),
24 [Link]())
25 print(s.simulate_many())
26

27 main()

7.3.3 Critical mass


Here we consider the simulation of a chain reaction in a fissile material,
for example, the uranium in a nuclear reactor [56]. We assume a material
is in a spherical shape of known radius. At each point there is a probabil-
ity of a nuclear fission, which we model as the emission of two neutrons.
Each of the two neutrons travels and hits an atom, thus causing another
fission. The two neutrons are emitted in random opposite directions and
travel a distance given by the exponential distribution. The new fissions
may occur inside material itself or outside. If outside, they are ignored. If
the number of fission events inside the material grows exponentially with
time, we have a self-sustained chain reaction; otherwise, we do not.
Fig. 7.3 provides a representation of the process.

Figure 7.3: Example of chain reaction within a fissile material. If the mass is small, most
of the decay products escape (left, sub-criticality), whereas if the mass exceeds a certain
critical mass, there is a self-sustained chain reaction (right).
monte carlo simulations 297

Figure 7.4: Probability of chain reaction in uranium.

Here is a possible implementation of the process. We store each event


that happens inside the material in a queue (events). For each simulation,
the queue starts with one event, and from it we generate two more, and
so on. If the new events happen inside the material, we place the new
events back in the queue. If the size of the queue shrinks to zero, then
we are subcritical. If the size of the queue grows exponentially, we have
a self-sustained chain reaction. We detect this by measuring the size of
the queue and whether it exceeds a threshold (which we arbitrarily set to
200). The average free flight distance for a neutron in uranium is 1.91 cm.
We use this number in our simulation. Given the radius of the material,
simulate_once returns 1.0 if it detects a chain reaction and 0.0 if it does
not. The output of simulate_many is the probability of a chain reaction:

Listing 7.6: in file: [Link]


1 from nlib import *
2 import math
3 import random
4

5 class NuclearReactor(MCEngine):
298 annotated algorithms in python

6 def __init__(self, radius, mean_free_path=1.91, threshold=200):


7 [Link] = radius
8 [Link] = 1.0/mean_free_path
9 [Link] = threshold
10 def point_on_sphere(self):
11 while True:
12 x, y, z = [Link](), [Link](), [Link]()
13 d = [Link](x * x+y * y+z * z)
14 if d<1: return (x/d, y/d, z/d) # project on surface
15 def simulate_once(self):
16 p = (0, 0, 0)
17 events = [p]
18 while events:
19 event = [Link]()
20 v = self.point_on_sphere()
21 d1 = [Link]([Link])
22 d2 = [Link]([Link])
23 p1 = (p[0]+v[0] * d1, p[1]+v[1] * d1, p[2]+v[2] * d1)
24 p2 = (p[0]-v[0] * d2, p[1]-v[1] * d2, p[2]-v[2] * d2)
25 if p1[0] ** 2+p1[1] ** 2+p1[2] ** 2 < [Link]:
26 [Link](p1)
27 if p2[0] ** 2+p2[1] ** 2+p2[2] ** 2 < [Link]:
28 [Link](p2)
29 if len(events) > [Link]:
30 return 1.0
31 return 0.0
32

33 def main():
34 s = NuclearReactor(MCEngine)
35 data = []
36 [Link] = 0.01
37 while [Link]<21:
38 r = s.simulate_many(ap=0.01, rp=0.01, ns=1000, nm=100)
39 [Link](([Link], r[1], (r[2]-r[0])/2))
40 [Link] *= 1.2
41 c = Canvas(title="Critical Mass", xlab="Radius", ylab="Probability Chain
Reaction")
42 [Link](data).errorbar(data).save("[Link]")
43

44 main()

Fig. 7.4 shows the output of the program, the probability of a chain reac-
tion as function of the size of the uranium mass. We find a critical radius
between 2 cm and 10 cm, which corresponds to a critical mass between 0.5
kg and 60 kg. The official number is 15 kg for uranium 233 and 60 kg for
uranium 235. The lesson to learn here is that it is not safe to accumulate
too much fissile material together. This simulation can be easily tweaked
monte carlo simulations 299

to determine the thickness of a container required to shield a radioactive


material.

7.4 Monte Carlo integration

7.4.1 One-dimensional Monte Carlo integration


Let"s consider a one-dimensional integral
Z b
I= f ( x )dx (7.16)
a

Let"s now determine two functions g( x ) and p( x ) such that

p( x ) = 0 for x ∈ [−∞, a] ∪ [n, ∞] (7.17)

and Z +∞
p( x )dx = 1 (7.18)
−∞
and
g( x ) = f ( x )/p( x ) (7.19)

We can interpret p( x ) as a probability mass function and


Z +∞ Z b
E[ g( X )] = g( x ) p( x )dx = f ( x )dx = I (7.20)
−∞ a

Therefore we can compute the integral by computing the expectation


value of the function g( X ), where X is a random variable with a distri-
bution (probability mass function) p( x ) different from zero in [ a, b] gener-
ated.
An obvious, although not in general an optimal choice, is
( )
1/(b − a) if x ∈ [ a, b]
p( x ) ≡ (7.21)
0 otherwise
g( x ) ≡ (b − a) f ( x )

so that X is just a uniform random variable in [ a, b]. Therefore


i< N
1
I = E [ g( X )] =
N ∑ g ( xi ) (7.22)
i =0
300 annotated algorithms in python

This means that the integral can be evaluated by generating N random


points xi with uniform distribution in the domain, evaluating the inte-
grand (the function f ) on each point, averaging the results, and multiply-
ing the average by the size of the domain (b − a).
Naively, the error on the result can be estimated by computing the vari-
ance
1 i< N
N i∑
σ2 = [ g( xi ) − ⟨ g⟩]2 (7.23)
=0
with
i< N
1
⟨ g⟩ =
N ∑ g ( xi ) (7.24)
i =0

and the error on the result is given by:


r
σ2
δI = (7.25)
N
The larger the set of sample points N, the lower the variance and the error.
The larger N, the better E[ g( X )] approximates the correct result I.
Here is a program in Python:

Listing 7.7: in file: [Link]


1 class MCIntegrator(MCEngine):
2 def __init__(self, f, a, b):
3 self.f = f
4 self.a = a
5 self.b = b
6 def simulate_once(self):
7 a, b, f = self.a, self.b, self.f
8 x = a+(b-a) * [Link]()
9 g = (b-a) * f(x)
10 return g
11
12 def main():
13 s = MCIntegrator(f=lambda x: [Link](x), a=0, b=1)
14 print(s.simulate_many())
15

16 main()

This technique is very general and can be extended to almost any integral
assuming the integrand is smooth enough on the integration domain.
monte carlo simulations 301

The choice (7.21) is not always optimal because the integrand may be very
small in some regions of the integration domain and very large in other
regions. Clearly some regions contribute more than others to the average,
and one would like to generate points with a probability mass function
that is as close as possible to the original integrand. Therefore we should
choose a p( x ) according to the following conditions:
• p( x ) is very similar and proportional to f ( x )
Rx
• given F ( x ) = −∞ p( x )dx, F −1 ( x ) can be computed analytically.
Any choice for p( x ) that makes the integration algorithm converge faster
with less calls to simulate_once is called a variance reduction technique.

7.4.2 Two-dimensional Monte Carlo integration


The technique described earlier can easily be extended to two-
dimensional integrals:
Z
I= f ( x0 , x1 )dx0 dx1 (7.26)
D
where D is some two-dimensional domain. We determine two functions
g( x0 , x1 ) and p0 ( x0 ), p1 ( x1 ) such that
p0 ( x0 ) = 0 or p1 ( x1 ) = 0 for x ∈
/D (7.27)
and Z
p0 ( x0 ) p1 ( x1 )dx0 dx1 = 1 (7.28)
and
f ( x0 , x1 )
g ( x0 , x1 ) = (7.29)
p0 ( x0 ) p1 ( x1 )

We can interpret p( x0 , x1 ) as a probability mass function for two indepen-


dent random variables X0 and X1 and
Z Z
E[ g( X0 , X1 )] = g( x0 , x1 ) p0 ( x0 ) p1 ( x1 )dx = f ( x0 , x1 )dx0 dx1 = I
D
(7.30)
Therefore
i< N
1
I = E[ g( X0 , X1 )] =
N ∑ g( xi0 , xi1 ) (7.31)
i =0
302 annotated algorithms in python

7.4.3 n-dimensional Monte Carlo integration


The technique described earlier can also be extended to n-dimensional
integrals Z
I= f ( x0 , ..., xn−1 )dx0 ...dxn−1 (7.32)
D
where D is some n-dimensional domain identified by a function
domain( x0 , ..., xn−1 ) equal to 1 if x = ( x0 , ..., xn−1 ) is in the domain, 0
otherwise. We determine two functions g( x0 , ..., xn−1 ) and p( x0 , ..., xn−1 )
such that
p( x0 , ..., xn−1 ) = 0 for x ∈
/D (7.33)
and Z
p( x0 , ..., xn−1 )dx0 ...dxn−1 = 1 (7.34)

and
g( x0 , ..., xn−1 ) = f ( x0 , ..., xn−1 )/p( x0 , ..., xn−1 ) (7.35)

We can interpret p( x0 , ..., xn−1 ) as a probability mass function for n inde-


pendent random variables X0 ...Xn−1 and
Z
E[ g( X0 , ..., Xn−1 )] = g( x0 , ..., xn−1 ) p( x0 , ..., xn−1 )dx (7.36)
Z
= f ( x0 , ..., xn−1 )dx0 ...dxn−1 = I (7.37)
D

Therefore
i< N
1
I = E[ g( X0 , .., Xn−1 )] =
N ∑ g ( xi ) (7.38)
i =0

where for every point xi is a tuple ( xi0 , xi1 , ..., xi,n−1 ).


As an example, we consider the integral
Z 1 Z 1 Z 1 Z 1
I= dx0 dx1 dx2 dx3 sin( x0 + x1 + x2 + x3 ) (7.39)
0 0 0 0

Here is the Python code:


1 >>> class MCIntegrator(MCEngine):
2 ... def simulate_once(self):
3 ... volume = 1.0
monte carlo simulations 303

4 ... while True:


5 ... x = [[Link]() for d in range(4)]
6 ... if sum(xi ** 2 for xi in x)<1: break
7 ... return volume * self.f(x)
8 >>> s = MCIntegrator()
9 >>> s.f = lambda x: [Link](x[0]+x[1]+x[2]+x[3])
10 >>> s.simulate_many()

Using NumPy, Monte Carlo integration is vectorized:


1 >>> import numpy as np
2 >>> N = 100000
3 >>> x = [Link]((N, 4))
4 >>> mask = [Link](x**2, axis=1) < 1
5 >>> values = [Link](x[mask].sum(axis=1))
6 >>> integral = [Link]()
7 >>> error = [Link]() / [Link]([Link]())

7.5 Stochastic, Markov, Wiener, and processes

A stochastic process [57] is a random function, for example, a function that


maps a variable n with domain D into Xn , where Xn is a random vari-
able with domain R. In practical applications, the domain D over which
the function is defined can be a time interval (and the stochastic is called
a time series) or a region of space (and the stochastic process is called a
random field). Familiar examples of time series include random walks [58];
stock market and exchange rate fluctuations; signals such as speech, au-
dio, and video; or medical data such as a patient"s EKG, EEG, blood
pressure, or temperature. Examples of random fields include static im-
ages, random topographies (landscapes), or composition variations of an
inhomogeneous material.
Let"s consider a grasshopper moving on a straight line, and let Xn be the
position of the grasshopper at time t = n∆t . Let"s also assume that at time
0, X0 = 0. The position of the grasshopper at each future (t > 0) time is
unknown. Therefore it is a random variable.
We can model the movements of the grasshopper as follows:

X n +1 = X n + µ + ε n ∆ x (7.40)
where ∆ x is a fixed step and ε n is a random variable whose distribution
304 annotated algorithms in python

depends on the model; µ is a constant drift term (think of wind pushing


the grasshopper in one direction). It is clear that Xn+1 only depends on
Xn and ε n ; therefore the probability distribution of Xn+1 only depends on
Xn and the probability distribution of ε n , but it does not depend on the
past history of the grasshopper"s movements at times t < n∆t . We can
write the statement by saying that

Prob( Xn+1 = x |{ Xi } for i ≤ n) = Prob( Xn+1 = x | Xn ) (7.41)

A process in which the probability distribution of its future state only


depends on the present state and not on the past is called a Markov pro-
cess [59].
To complete our model, we need to make additional assumptions about
the probability distribution of ε n . We consider the two following cases:
• ε n is a random variable with a Bernoulli distribution (ε n = +1 with
probability p and ε n = −1 with probability 1 − p).
• ε n is a random variable with a normal (Gaussian) distribution with
2
probability mass function p(ε) = e−ε /2 . Notice that the previous case
(Bernoulli) is equivalent to this case (Gaussian) over long time intervals
because the sum of many independent Bernoulli variables approaches
a Gaussian distribution.
A continuous time stochastic process (when ε n is a continuous random
number) is called a Wiener process [60].
The specific case when ε n is a Gaussian random variable is called an Ito
process [61]. An Ito process is also a Wiener process.

7.5.1 Discrete random walk (Bernoulli process)


Here we assume a discrete random walk: ε n equal to +1 with probability
p and equal to −1 with probability 1 − p. We consider discrete time in-
tervals of equal length ∆t ; at each time step, if ε n = +1, the grasshopper
moves forward one unit (∆ x ) with probability p, and if ε n = −1, he moves
backward one unit (−∆ x ) with probability 1 − p.
monte carlo simulations 305

For a total n steps, the probability of moving n+ steps in a positive direc-


tion and n− = n − n+ in a negative direction is given by

n!
p n + (1 − p ) n − n + (7.42)
n+ !(n − n+ )!

The probability of going from a = 0 to b = k∆ x > 0 in a time t = n∆t > 0


corresponds to the case when

n = n + + ni (7.43)
k = n+ − n− (7.44)

that solved in n+ gives n+ = (n + k )/2, and therefore the probability of


going from 0 to k in time t = n∆t is given by

n!
Prob(n, k ) = p(n+k)/2 (1 − p)(n−k)/2 (7.45)
((n + k)/2)!((n − k)/2)!

Note that n + k has to be even, otherwise it is not possible for the


grasshopper to reach k∆ x in exactly n steps.
For large n, the following distribution in k/n tends to a Gaussian distri-
bution.

7.5.2 Random walk: Ito process


Let"s assume an Ito process for our random walk: ε n is normally (Gaus-
sian) distributed. We consider discrete time intervals of equal length ∆t ,
2
at each time step if ε n = ε with probability mass function p(ε) = e−ε /2 .
It turns out that eq.(7.40) gives

i <n
Xn = nµ + ∆ x ∑ εi (7.46)
i =0

Therefore the location of the random walker at time t = n∆t is given by


the sum of n normal (Gaussian) random variables:

1 2 / (2n∆2 )
p ( Xn ) = p e−(Xn −nµ) x (7.47)
2πn∆2x
306 annotated algorithms in python

Notice how the mean and the variance of Xn are both proportional to n,

whereas the standard deviation is proportional to n.

Z b
1 2 2
Prob( a ≤ Xn ≤ b ) = p e−(Xn −nµ) /(2n∆x ) dx (7.48)
2πn∆ x 2 a
Z (b−nµ)/(√n∆ x )
1 2
= √ √ e− x /2 dx (7.49)
2π ( a−nµ)/( n∆ x )
b − nµ a − nµ
= erf( √ ) − erf( √ ) (7.50)
n∆ x n∆ x

7.6 Option pricing

A European call option is a contract that depends on an asset S. The


contract gives the buyer of the contract the right (the option) to buy S at
a fixed price A some time in the future, even if the actual price S may
be different. The actual current price of the asset is called the spot price.
The buyer of the option hopes that the price of the asset, St , will exceed
A, so that he will be able to buy it at a discount, sell it at market price,
and make a profit. The seller of the option hopes this does not happen,
so he earns the full sale price. For the buyer of the option, the worst case
scenario is not to be able to recover the price paid for the option, but there
is no best case because, hypothetically, he can make an arbitrarily large
profit. For the seller, it is the opposite. He has an unlimited liability.
In practice, a call option allows a buyer to sell risk (the risk of the price
of S going up) to the seller. He pays a price for it, the cost of the option.
This is a form of insurance. There are two types of people who trade
options: those who are willing to pay to get rid of risk (because they need
the underlying asset and want it at a guaranteed price) and those who
simply speculate (buy risk and sell insurance). On average, speculators
make money because, if they sell many options, risk averages out, and
they collect the premiums (the cost of the options).
The European option has a term or expiration, τ. It can only be exercised
at expiration. The amount A is called the strike price.
monte carlo simulations 307

The value at expiration of a European call option is


max(Sτ − A, 0) (7.51)

Its present value is therefore

max(Sτ − A, 0)e−rτ (7.52)

where r is the risk-free interest rate. This value corresponds to how much
we would have to borrow today from a bank so that we can repay the
bank at time τ with the profit from the option.
All our knowledge about the future spot price x = Sτ of the underlying
asset can be summarized into a probability mass function pτ ( x ). Under
the assumption that pτ ( x ) is known to both the buyer and the seller of
the option, it has to be that the averaged net present value of the option is
zero for any of the two parties to want to enter into the contract. Therefore
Z +∞
Ccall = e−rτ max( x − A, 0) pτ ( x )dx (7.53)
−∞

Similarly, we can perform the same computations for a put option. A put
option gives the buyer the option to sell the asset on a given day at a fixed
price. This is an insurance against the price going down instead of going
up. The value of this option at expiration is

max( A − Sτ , 0) (7.54)

and its pricing formula is

Z +∞
C put = e−rτ max( A − x, 0) pτ ( x )dx (7.55)
−∞

Also notice that Ccall − C put = S0 − Ae−rτ . This relation is called the
call-put parity.
Our goal is to model pτ ( x ), the distribution of possible prices for the
underlying asset at expiration of the option, and compute the preceding
integrals using Monte Carlo.
308 annotated algorithms in python

7.6.1 Pricing European options: Binomial tree


To price an option, we need to know pτ (Sτ ). This means we need to
know something about the future behavior of the price Sτ of the under-
lying asset S (a stock, an index, or something else). In absence of other
information (crystal ball or illegal insider"s information), one may try to
gather information from a statistical analysis of the past historic data com-
bined with a model of how the price Sτ evolves as a function of time. The
most typical model is the binomial model, which is a Wiener process. We
assume that the time evolution of the price of the asset X is a stochastic
process similar to a random walk. We divide time into intervals of size
∆t , and we assume that in each time interval τ = n∆t , the variation in the
asset price is

S n +1 = Sn u with probability p (7.56)


S n +1 = Sn d with probability 1 − p (7.57)

where u > 1 and 0 < d < 1 are measures for historic data. It follows that
for τ = n∆t , the probability that the spot price of the asset at expiration is
Su ui dn−i is given by

 
n i
Prob(Sτ = Su ui dn−i ) = p (1 − p ) n −i (7.58)
i
and therefore
i ≤n  
1 n i
Ccall = e−rτ
n ∑ i
p (1 − p)n−i max(Su ui dn−i − A, 0) (7.59)
i =0

and
i ≤n  
1 n i
C put = e −rτ
n ∑ i
p (1 − p)n−i max( A − Su ui dn−i , 0) (7.60)
i =0

The parameters of this model are u, d and p, and they must be determined
from historical data. For example,
monte carlo simulations 309

er∆t − d
p = (7.61)
u−d

∆t
u = eσ (7.62)

−σ ∆t
d = e (7.63)

where ∆t is the length of the time interval, r is the risk-free rate, and σ is
the volatility of the asset, that is, the standard deviation of the log returns.
Here is a Python code to simulate an asset price using a binomial tree:
1 def BinomialSimulation(S0, u, d, p, n):
2 data=[]
3 S=S0
4 for i in range(n):
5 [Link](S)
6 if uniform()<p:
7 S=u * S
8 else:
9 S=d * S
10 return data

Using NumPy, many price paths can be simulated at once:


1 >>> import numpy as np
2 >>> def BinomialSimulation_np(S0, u, d, p, n, npaths=10000):
3 ... moves = [Link]([Link]((npaths, n)) < p, u, d)
4 ... return S0 * [Link](moves, axis=1)

The function takes the present spot value, S0 , of the asset, the values of u, d
and p, and the number of simulation steps and returns a list containing
the simulated evolution of the stock price. Note that because of the exact
formulas, eqs.(7.59) and (7.60), one does not need to perform a simulation
unless the underlying asset is a stock that pays dividends or we want to
include some other variable in the model.
This method works fine for European call options, but the method is not
easy to generalize to other options, when it depends on the path of the
asset (e.g., the asset is a stock that pays dividends). Moreover, to increase
precision, one has to decrease ∆t or redo the computation from the begin-
ning.
The Monte Carlo method that we see next is slower in the simple cases
310 annotated algorithms in python

but is more general and therefore more powerful.

7.6.2 Pricing European options: Monte Carlo


Here we adopt the Black–Scholes model assumptions. We assume that the
time evolution of the price of the asset X is a stochastic process similar
to a random walk [62]. We divide time into intervals of size ∆t , and we
assume that in each time interval t = n∆t , the log return is a Gaussian
random variable:
S
log n+1 = gauss(µ∆t , σ ∆t )
p
(7.64)
Sn

There are three parameters in the preceding equation:


• ∆t is the time step we use in our discretization. ∆t is not a physical
parameter; it has nothing to do with the asset. It has to do with the
precision of our computation. Let"s assume that ∆t = 1 day.
• µ is a drift term, and it represents the expected rate of return of the
asset over a time scale of one year. It is usually set equal to the risk-free
rate.
• σ is called volatility, and it represents the number of stochastic fluctua-
tions of the asset over a time interval of one year.
Notice that this model is equivalent to the previous binomial model for
large time intervals, in the same sense as the binomial distribution for
large values of n approximates the Gaussian distribution. For large T,
converge to the same result.
Notice how our assumption that log-return is Gaussian is different and
not compatible with Markowitz"s assumption of modern portfolio theory
(the arithmetic return is Gaussian). In fact, log returns and arithmetic
returns cannot both be Gaussian. It is therefore incorrect to optimize a
portfolio using MPT when the portfolio includes options priced using
Black–Scholes. The price of an individual asset cannot be negative, there-
fore its arithmetic return cannot be negative and it cannot be Gaussian.
Conversely, a portfolio that includes both short and long positions (the
holder is the buyer and seller of options) can have negative value. A
monte carlo simulations 311

change of sign in a portfolio is not compatible with the Gaussian log-


return assumption.
If we are pricing a European call option, we are only interested in ST and
not in St for 0 < t < T; therefore we can choose ∆t = T. In this case, we
obtain

ST = S0 exp(r T ) (7.65)

and

(r − µT )2
 
p(r T ) ∝ exp − T 2 (7.66)
2σ T

This allows us to write the following:

Listing 7.8: in file: [Link]


1 from nlib import *
2

3 class EuropeanCallOptionPricer(MCEngine):
4 def simulate_once(self):
5 T = self.time_to_expiration
6 S = self.spot_price
7 R_T = [Link]([Link] * T, [Link] * sqrt(T))
8 S_T = S * exp(r_T)
9 payoff = max(S_T-[Link], 0)
10 return self.present_value(payoff)
11

12 def present_value(self, payoff):


13 daily_return = self.risk_free_rate/250
14 return payoff * exp(-daily_return * self.time_to_expiration)
15
16 def main():
17 pricer = EuropeanCallOptionPricer()
18 # parameters of the underlying
19 pricer.spot_price = 100 # dollars
20 [Link] = 0.12/250 # daily drift term
21 [Link] = 0.30/sqrt(250) # daily variance
22 # parameters of the option
23 [Link] = 110 # dollars
24 pricer.time_to_expiration = 90 # days
25 # parameters of the market
26 pricer.risk_free_rate = 0.05 # 5% annual return
27
312 annotated algorithms in python

28 result = pricer.simulate_many(ap=0.01, rp=0.01) # precision: 1c or 1%


29 print(result)
30

31 main()

7.6.3 Pricing any option with Monte Carlo


An option is a contract, and one can write a contract with many different
clauses. Each of them can be implemented into an algorithm. Yet we can
group them into three different categories:
• Non-path-dependent: They depend on the price of the underlying asset
at expiration but not on the intermediate prices of the asset (path).
• Weakly path-dependent: They depend on the price of the underlying
asset and events that may happen to the price before expiration, but
they do not depend on when the events exactly happen.
• Strongly path-dependent: They depend on the details of the time vari-
ation of price of the underlying asset before expiration.
Because non-path-dependent options do not depend on details, it is often
possible to find approximate analytical formulas for pricing the option.
For weakly path-dependent options, usually the binomial tree approach of
the previous section is a preferable approach. The Monte Carlo approach
applies to the general case, for example, that of strongly path-dependent
options.
We will use our MCEngine to implement a generic option pricer.
First we need to recognize the following:
• The value of an option at expiration is defined by a payoff function f ( x )
of the spot price of the asset at the expiration date. The fact that a call
option has payoff f ( x ) = max( x − A, 0) is a convention that defined the
European call option. A different type of option will have a different
payoff function f ( x ).
• The more accurately we model the underlying asset, the more accu-
rate will be the computed value of the option. Some options are more
sensitive than others to our modeling details.
monte carlo simulations 313

Note one never models the option. One only models the underlying asset.
The option payoff is given. We only choose the most efficient algorithm
based on the model and the option:

Listing 7.9: in file: [Link]


1 from nlib import *
2

3 class GenericOptionPricer(MCEngine):
4 def simulate_once(self):
5 S = self.spot_price
6 path = [S]
7 for t in range(self.time_to_expiration):
8 r = [Link](dt=1.0)
9 S = S * exp(r)
10 [Link](S)
11 return self.present_value([Link](path))
12
13 def model(self, dt=1.0):
14 return [Link]([Link] * dt, [Link] * sqrt(dt))
15
16 def present_value(self, payoff):
17 daily_return = self.risk_free_rate/250
18 return payoff * exp(-daily_return * self.time_to_expiration)
19

20 def payoff_european_call(self, path):


21 return max(path[-1]-[Link], 0)
22 def payoff_european_put(self, path):
23 return max(path[-1]-[Link], 0)
24 def payoff_exotic_call(self, path):
25 last_5_days = path[-5]
26 mean_last_5_days = sum(last_5_days)/len(last_5_days)
27 return max(mean_last_5_days-[Link], 0)
28

29 def main():
30 pricer = GenericOptionPricer()
31 # parameters of the underlying
32 pricer.spot_price = 100 # dollars
33 [Link] = 0.12/250 # daily drift term
34 [Link] = 0.30/sqrt(250) # daily variance
35 # parameters of the option
36 [Link] = 110 # dollars
37 pricer.time_to_expiration = 90 # days
38 [Link] = pricer.payoff_european_call
39 # parameters of the market
40 pricer.risk_free_rate = 0.05 # 5% annual return
41

42 result = pricer.simulate_many(ap=0.01, rp=0.01) # precision: 1c or 1%


314 annotated algorithms in python

43 print(result)
44

45 main()

This code allows us to price any option simply by changing the payoff
function.
Using NumPy, many paths can be simulated simultaneously:
1 >>> import numpy as np
2 >>> npaths, nsteps = 100000, 90
3 >>> S0, mu, sigma, r, K = 100, 0.12/250, 0.30/[Link](250), 0.05, 110
4 >>> log_returns = [Link](mu, sigma, (npaths, nsteps))
5 >>> paths = S0 * [Link]([Link](log_returns, axis=1))
6 >>> payoffs = [Link](paths[:, -1] - K, 0)
7 >>> price = [Link](-r/250 * nsteps) * [Link]()
8 >>> error = [Link](-r/250 * nsteps) * [Link]() / [Link](npaths)

One can also change the model for the underlying using different as-
sumptions. For example, a possible choice is that of including a model
for market crashes, and on random days, separated by intervals given
by the exponential distribution, assume a negative jump that follows the
Pareto distribution (similar to the losses in our previous risk model). Of
course, a change of the model requires a recalibration of the parameters.

7.7 Markov chain Monte Carlo (MCMC) and Metropolis

Until this point, all our simulations were based on independent random
variables. This means that we were able to generate each random num-
ber independently of the others because all the random variables were
uncorrelated. There are cases when we have the following problem.
We have to generate x = x0 , x1 , ..., xn−1 , where x0 , x1 , ..., xn−1 are n corre-
lated random variables whose probability mass function

p(x) = p( x0 , x1 , ..., xn−1 ) (7.67)

cannot be factored, as in p( x0 , x1 , ..., xn−1 ) = p( x0 ) p( x1 )...p( xn−1 ). Con-


sider for example the simple case of generating two random numbers x0
and x1 both in [0, 1] with probability mass function p( x0 , x1 ) = 6( x0 − x1 )2
R1R1
(note that 0 0 6p( x0 , x1 )dx0 dx1 = 1, as it should be).
In the case where each of the xi has a Gaussian distribution and the only
monte carlo simulations 315

Figure 7.5: Price for a European call option for different spot prices and different values
of σ.

dependence between xi and x j is their correlation, the solution was al-


ready examined in a previous section about the Cholesky algorithm. Here
we examine the most general case.
The Metropolis algorithm provides a general and simpler solution to this
problem. It is not always the most efficient, but more sophisticated algo-
rithms are nothing but refinements and extensions of its simple idea.
Let"s formulate the problem once more: we want to generate x =
x0 , x1 , ..., xn−1 where x0 , x1 , ..., xn−1 are n correlated random variables
whose probability mass function is given by

p(x) = p( x0 , x1 , ..., xn−1 ) (7.68)

The procedure works as follows:


1 Start with a set of independent random numbers x (0) =
(0) (0) (0)
( x0 , x1 , ..., xn−1 ) in the domain.
2 Generate another set of independent random numbers x(i+1) =
316 annotated algorithms in python

( i +1) ( i +1) ( i +1)


( x0 , x1 , ..., xn−1 ) in the domain. This can be done by an arbi-
trary random function Q(x(i) ). The only requirement for this function
Q is that the probability of moving from a current point x to a new
point y be the same as that of moving from a current point y to a new
point x.
3 Generate a uniform random number z.
4 If p(x(i+1) )/p(x(i) ) < z, then x(i+1) = x(i) .
5 Go back to step 2.
The set of random numbers x(i) generated in this way for large values of
i will have a probability mass function given by p(x).
Here is a possible implementation in Python:
1 def metropolis(p, q, x=None):
2 while True:
3 x_old=x
4 x = q(x)
5 if p(x)/p(x_old)<[Link]()
6 x=x_old
7 yield x
8

9 def P(x):
10 return 6.0 * (x[0]-x[1]) ** 2
11

12 def Q(x):
13 return [[Link](), [Link]()]
14

15 for i, x in enumerate(metropolis(P, Q)):


16 print(x)
17 if i == 100: break

In this example, Q is the function that generates random points in the


domain (in the example, [0, 1] × [0, 1]), and P is an example probability
p( x ) = 6( x0 − x1 )2 . Notice we used the Python yield function instead of
return. This means the function is a generator and we can loop over its
returned (yielded) values without having to generate all of them at once.
They are generated as needed.
Notice that the Metropolis algorithm can generate (and will generate) re-
peated values. This is because the next random vector x is highly cor-
monte carlo simulations 317

related with the previous vector. For this reason, it is often necessary to
de-correlate metropolis values by skipping some of them:
1 def metropolis_decorrelate(p, q, x=None, ds=100):
2 k = 0
3 for x in metropolis(p, q, x):
4 k += 1
5 if k % ds == ds-1:
6 yield x

The value of ds must be fixed empirically. The value of ds which is large


enough to make the next vector independent from the previous one is
called decorrelation length. This generator works as the previous one. For
example:
1 for i, x in enumerate(metropolis_decorrelate(P, Q)):
2 print(x)
3 if i == 100: break

7.7.1 The Ising model


A typical example of application of the Metropolis is the Ising model.
This model describes a spin system, for example, a ferromagnet. A spin
system consists of a regular crystalline structure, and each vertex is an
atom. Each atom is a small magnet, and its magnetic orientation can be
+1 or −1. Each atom interacts with the external magnetic field and with
the magnetic field of its six neighbors (think about the six faces of a cube).
We use the index i to label an atom and si its spin.
The entire system has a total energy given by

E ( s ) = − ∑ si h − ∑ si s j (7.69)
i ij|distij =1

where h is the external magnetic field, the first sum is over all spin sites,
and the second is about all couples of next neighbor sites. In the absence
of spin-spin interaction, only the first term contributes, and the energy is
lower when the direction of the si (their sign) is the same as h. In absence
of h, only the second term contributes. The contribution to each couple of
spins is positive if their sign is the opposite, and negative otherwise.
318 annotated algorithms in python

In the absence of external forces, each system evolves toward the state
of minimum energy, and therefore, for a spin system, each spin tends to
align itself in the same direction as its neighbors and in the same direction
as the external field h.
Things change when we turn on heat. Feeding energy to the system
makes the atoms vibrate and the spins randomly flip. The higher the
temperature, the more they randomly flip.
The probability of finding the system in a given state s at a given temper-
ature T is given by the Boltzmann distribution:

 
E(s)
p(s) = exp − (7.70)
KT
where K is the Boltzmann constant.
We can now use the Metropolis algorithm to generate possible states of
the system s compatible with a given temperature T and measure the
effects on the average magnetization (the average spin) as a function of T
and possibly an external field h.
Also notice that in the case of the Boltzmann distribution,

E(s) − E(s”)
 
p(s”)
= exp (7.71)
p(s) KT

only depends on the change in energy. The Metropolis algorithm gives us


the freedom to choose a function Q that changes the state of the system and
depends on the current state. We can choose such a function so that we
only try to flip one spin at a time. In this case, the P algorithm simplifies
because we no longer need to compute the total energy of the system at
each iteration, but only the variation of energy due to the flipping of that
one spin.
Here is the code for a three-dimensional spin system:

Listing 7.10: in file: [Link]


1 import random
2 import math
monte carlo simulations 319

3 from nlib import Canvas, mean, sd


4

5 class Ising:
6 def __init__(self, n):
7 self.n = n
8 self.s = [[[1 for x in range(n)] for y in range(n)]
9 for z in range(n)]
10 [Link] = n ** 3
11
12 def __getitem__(self, point):
13 n = self.n
14 x, y, z = point
15 return self.s[(x+n)%n][(y+n)%n][(z+n)%n]
16

17 def __setitem__(self, point, value):


18 n = self.n
19 x, y, z = point
20 self.s[(x+n)%n][(y+n)%n][(z+n)%n] = value
21

22 def step(self, t, h):


23 n = self.n
24 x, y, z = [Link](0, n-1), [Link](0, n-1), [Link]
(0, n-1)
25 neighbors = [(x-1, y, z), (x+1, y, z), (x, y-1, z), (x, y+1, z), (x, y,
z-1), (x, y, z+1)]
26 dE = -2.0 * self[x, y, z] * (h+sum(self[xn, yn, zn] for xn, yn, zn in
neighbors))
27 if dE > t * [Link]([Link]()):
28 self[x, y, z] = -self[x, y, z]
29 [Link] += 2 * self[x, y, z]
30 return [Link]
31
32 def simulate(steps=100):
33 ising = Ising(n=10)
34 data = {}
35 for h in range(0, 11): # external magnetic field
36 data[h] = []
37 for t in range(1, 11): # temperature, in units of K
38 m = [[Link](t=t, h=h) for k in range(steps)]
39 mu = mean(m) # average magnetization
40 sigma = sd(m)
41 data[h].append((t, mu, sigma))
42 return data
43

44 def main(name="[Link]"):
45 data = simulate(steps = 10000)
46 canvas = Canvas(xlab="temperature", ylab="magnetization")
47 for h in data:
48 color = "#%.2x0000" % (h * 25)
320 annotated algorithms in python

49 [Link](data[h]).plot(data[h], color=color)
50 [Link](name)
51

52 main()

Using NumPy, the spin lattice can be stored and updated more efficiently:
1 >>> import numpy as np
2 >>> n = 10
3 >>> s = [Link]((n, n, n), dtype=int)
4 >>> def ising_step_np(s, t, h):
5 ... x, y, z = [[Link](0, n) for _ in range(3)]
6 ... neighbors = (s[(x-1)%n, y, z] + s[(x+1)%n, y, z] +
7 ... s[x, (y-1)%n, z] + s[x, (y+1)%n, z] +
8 ... s[x, y, (z-1)%n] + s[x, y, (z+1)%n])
9 ... dE = -2.0 * s[x, y, z] * (h + neighbors)
10 ... if dE > t * [Link]([Link]()):
11 ... s[x, y, z] *= -1
12 ... return [Link]()

Fig. 7.6 shows how the spins tend to align in the direction of the external
magnetic field, but the larger the temperature (left to right), the more
random they are, and the average magnetization tends to zero. The higher
the external magnetic field (bottom to top curves), the longer it takes for
the transition from order (aligned spins) to chaos (random spins).
Fig. 7.7 shows the two-dimensional section of some random three-
dimensional states for different values of the temperature. One can clearly
see that the lower the temperature, the more the spins are aligned, and
the higher the temperature, the more random they are.

7.8 Simulated annealing

Simulated annealing is an application of Monte Carlo to solve optimiza-


tion problems. It is best understood within the context of the Ising model.
When the temperature is lowered, the system tends toward the state of
minimum energy. At high temperature, the system fluctuates randomly
and moves in the space of all possible states. This behavior is not specific
to the Ising model. Hence, for any system for which we can define an
energy, we can find its minimum energy state, by starting in a random
state and slowly lowering the temperature as we evolve the simulation.
The system will find a minimum. There may be more than one minimum,
monte carlo simulations 321

Figure 7.6: Average magnetization as a function of the temperature for a spin system.

and one may need to repeat the procedure multiple times from different
initial random states and compare the solutions. This process takes the
name of annealing in analogy with the industrial process for removing
impurities from metals: heat, cool slowly, repeat.
We can apply this process to any system for which we want to minimize a
function f ( x ) of multiple variables. We just have to think of x as the state
s and of f as the energy E. This analogy is purely semantic because the
quantity we want to minimize is not necessarily an energy in the physical
sense.
Simulated annealing does not assume the function is differentiable or con-
tinuous in its variables.

7.8.1 Protein folding


In the following we apply simulated annealing to the problem of fold-
ing of a protein. A protein is a sequence of amino-acids. It is normally
unfolded, and amino-acids are on a line. When placed in water, it folds.
322 annotated algorithms in python

Figure 7.7: Random Ising states (2D section of 3D) for different temperatures.

This is because some amino-acids are hydrophobic (repel water) and some
are hydrophilic (like contact with water), therefore the protein tries to ac-
quire a three-dimensional shape that minimizes the surface of hydropho-
bic amino-acids in contact with water [63]. This is represented graphically
in fig. 7.8.

Figure 7.8: Schematic example of protein folding. The white circles are hydrophilic
amino-acids. The black ones are hydrophobic.

Here we assume only two types of amino-acids (H for hydrophobic and P


for hydrophilic), and we assume each amino acid is a cube, that all cubes
have the same size, and that each two consecutive amino-acids are con-
nected at a face. These assumptions greatly simplify the problem because
they limit the possible solid angles to six possible values (0: up, 1: down,
2: right, 3: left, 4: front, 5: back). Our goal is arranging the cubes to
minimize the number of faces of hydrophobic cubes that are exposed to
water:
monte carlo simulations 323

Listing 7.11: in file: [Link]


1 import random
2 import math
3 import copy
4 from nlib import *
5
6 class Protein:
7

8 moves = {0:(lambda x, y, z: (x+1, y, z)),


9 1:(lambda x, y, z: (x-1, y, z)),
10 2:(lambda x, y, z: (x, y+1, z)),
11 3:(lambda x, y, z: (x, y-1, z)),
12 4:(lambda x, y, z: (x, y, z+1)),
13 5:(lambda x, y, z: (x, y, z-1))}
14

15 def __init__(self, aminoacids):


16 [Link] = aminoacids
17 [Link] = [0] * (len(aminoacids)-1)
18 [Link] = self.compute_folding([Link])
19 [Link] = self.compute_energy([Link])
20

21 def compute_folding(self, angles):


22 folding = {}
23 x, y, z = 0, 0, 0
24 k = 0
25 folding[x, y, z] = [Link][k]
26 for angle in angles:
27 k += 1
28 xn, yn, zn = [Link][angle](x, y, z)
29 if (xn, yn, zn) in folding: return None # impossible folding
30 folding[xn, yn, zn] = [Link][k]
31 x, y, z = xn, yn, zn
32 return folding
33
34 def compute_energy(self, folding):
35 E = 0
36 for x, y, z in folding:
37 aminoacid = folding[x, y, z]
38 if aminoacid == "H":
39 for face in range(6):
40 if not [Link][face](x, y, z) in folding:
41 E = E + 1
42 return E
43

44 def fold(self, t):


45 while True:
46 new_angles = [Link]([Link])
47 n = [Link](1, len([Link])-2)
324 annotated algorithms in python

48 new_angles[n] = [Link](0, 5)
49 new_folding = self.compute_folding(new_angles)
50 if new_folding: break # found a valid folding
51 new_energy = self.compute_energy(new_folding)
52 if ([Link]-new_energy) > t * [Link]([Link]()):
53 [Link] = new_angles
54 [Link] = new_folding
55 [Link] = new_energy
56 return [Link]
57

58 def main():
59 aminoacids = ''.join([Link]("HP") for k in range(20))
60 protein = Protein(aminoacids)
61 t = 10.0
62 while t>1e-5:
63 [Link](t = t)
64 print([Link], [Link])
65 t = t * 0.99 # cool
66

67 main()

The moves dictionary is a dictionary of functions. For each solid angle


(0–5), moves[angle] is a function that maps x, y, z, the coordinates of an
amino acid, to the coordinates of the cube at that solid angle.
The annealing procedure is performed in the main function. The fold
procedure is the same step as the Metropolis step. The purpose of the
while loop in the fold function is to find a valid fold for the accept–reject
step. Some folds are invalid because they are not physical and would
require two amino-acids to occupy the same portion of space. When this
happens, the compute_folding method returns None, indicating that one
must try a different folding.
8
Parallel Algorithms

Consider a program that performs the following computation:


1 y = f(x)
2 z = g(x)

In this example, the function g( x ) does not depend on the result of the
function f ( x ), and therefore the two functions could be computed inde-
pendently and in parallel.
Often large problems can be divided into smaller computational prob-
lems, which can be solved concurrently (“in parallel”) using different pro-
cessing units (CPUs, cores). This is called parallel computing. Algorithms
designed to work in parallel are called parallel algorithms.
In this chapter, we will refer to a processing unit as a node and to the
code running on a node as a process. A parallel program consists of
many processes running on as many nodes. It is possible for multiple
processes to run on one and the same computing unit (node) because of
the multitasking capabilities of modern CPUs, but that is not true parallel
computing. We will use an emulator, PSim, which does exactly that.
Programs can be parallelized at many levels: bit level, instruction level,
data, and task parallelism. Bit-level parallelism is usually implemented in
hardware. Instruction-level parallelism is also implemented in hardware
in modern multi-pipeline CPUs. Data parallelism is usually referred to as
326 annotated algorithms in python

SIMD. Task parallelism is also referred to as MIMD.


Historically, parallelism was found in applications in high-performance
computing, but today it is employed in many devices, including common
cell phones. The reason is heat dissipation. It is getting harder and harder
to improve speed by increasing CPU frequency because there is a physical
limit to how much we can cool the CPU. So the recent trend is keeping
frequency constant and increasing the number of processing units on the
same chip.
Parallel architectures are classified according to the level at which the
hardware supports parallelism, with multicore and multiprocessor com-
puters having multiple processing elements within a single machine,
while clusters, MPPs, and grids use multiple computers to work on the
same task. Specialized parallel computer architectures are sometimes
used alongside traditional processors for accelerating specific tasks.
Optimizing an algorithm to run on a parallel architecture is not an easy
task. Details depend on the type of parallelism and details of the archi-
tecture.
In this chapter, we will learn how to classify architectures, compute run-
ning times of parallel algorithms, and measure their performance and
scaling.
We will learn how to write parallel programs using standard program-
ming patterns, and we will use them as building blocks for more complex
algorithms.
For some parts of this chapter, we will use a simulator called PSim, which
is written in Python. Its performances will only scale on multicore ma-
chines, but it will allow us to emulate various network topologies.

8.1 Parallel architectures

8.1.1 Flynn taxonomy


Parallel computer architecture classifications are known as Flynn"s taxon-
omy [64] and are due to the work of Michael J. Flynn in 1966.
parallel algorithms 327

Flynn identified the following architectures:


• Single instruction, single data stream (SISD)
A sequential computer that exploits no parallelism in either the in-
struction or data streams. A single control unit (CU) fetches a single
instruction stream (IS) from memory. The CU then generates appropri-
ate control signals to direct single processing elements (PE) to operate
on a single data stream (DS), for example, one operation at a time.
Examples of SISD architecture are the traditional uniprocessor ma-
chines like a PC (currently manufactured PCs have multiple proces-
sors) or old mainframes.
• Single instruction, multiple data streams (SIMD) A computer that
exploits multiple data streams against a single instruction stream to
perform operations that may be naturally parallelized (e.g., an array
processor or GPU).
• Multiple instruction, single data stream (MISD)
Multiple instructions operate on a single data stream. This is an un-
common architecture that is generally used for fault tolerance. Het-
erogeneous systems operate on the same data stream and must agree
on the result. Examples include the now retired Space Shuttle flight
control computer.
• Multiple instruction, multiple data streams (MIMD) Multiple au-
tonomous processors simultaneously executing different instructions
on different data. Distributed systems are generally recognized to be
MIMD architectures, either exploiting a single shared memory space
(using threads) or a distributed memory space (using a message-
passing protocol such as MPI).
MIMD can be further subdivided into the following:
• Single program, multiple data (SPMD) Multiple autonomous proces-
sors simultaneously executing the same program but at independent
points not synchronously (as in the SIMD case). SPMD is the most
common style of parallel programming.
328 annotated algorithms in python

• Multiple program, multiple data (MPMD) Multiple autonomous pro-


cessors simultaneously operating at least two independent programs.
Typically such systems pick one node to be the “host” (“the ex-
plicit host/node programming model”) or “manager” (the “manager–
worker” strategy), which runs one program that farms out data to all
the other nodes, which all run a second program. Those other nodes
then return their results directly to the manager. The Map-Reduce pat-
tern also falls under this category.
An embarrassingly parallel workload (or embarrassingly parallel prob-
lem) is one for which little or no effort is required to separate the problem
into a number of parallel tasks. This is often the case where there exists
no dependency (or communication) between those parallel tasks.
The manager–worker node strategy, when workers do not need to com-
municate with each other, is an example of an “embarrassingly parallel”
problem.

8.1.2 Network topologies


In the MIMD case, multiple copies of the same problem run concurrently
(on different data subsets and branching differently, thus performing dif-
ferent instructions) on different processing units, and they exchange in-
formation using a network. How fast they can communicate depends on
the network characteristics identified by the network topology and the
latency and bandwidth of the individual links of the network.
Normally we classify network topologies based on the following taxon-
omy:
• Completely connected: Each node is connected by a directed link to
each other node.
• Bus topology: All nodes are connected to the same single cable. Each
computer can therefore communicate with each other computer using
one and the same bus cable. The limitation of this approach is that
the communication bandwidth is limited by the bandwidth of the ca-
ble. Most bus networks only allow two machines to communicate with
parallel algorithms 329

each other at one time (with the exception of one too many broad-
cast messages). While two machines communicate, the others are stuck
waiting. The bus topology is the most inexpensive but also slow and
constitutes a single point of failure.
• Switch topology (star topology): In local area networks with a switch
topology, each computer is connected via a direct link to a central de-
vice, usually a switch, and it resembles a star. Two computers can
communicate using two links (to the switch and from the switch). The
central point of failure is the switch. The switch is usually intelligent
and can reroute the messages from any computer to any other com-
puter. If the switch has sufficient bandwidth, it can allow multiple
computers to talk to each other at the same time. For example, for a 10
Gbit/s links and an 80 Gbit/s switch, eight computers can talk to each
other (in pairs) at the same time.
• Mesh topology: In a mesh topology, computers are assembled into an
array (1D, 2D, etc.), and each computer is connected via a direct link to
the computers immediately close (left, right, above, below, etc.). Next
neighbor communication is very fast because it involves a single link
and therefore low latency. For two computers not physically close to
communicate, it is necessary to reroute messages. The latency is pro-
portional to the distance in links between the computers. Some meshes
do not support this kind of rerouting because the extra logic, even if
unused, may be cause for extra latency. Meshes are ideal for solving
numerical problems such as solving differential equations because they
can be naturally mapped into this kind of topology.
• Torus topology: Very similar to a mesh topology (1D, 2D, 3D, etc.),
except that the network wraps around the edges. For example, in one
dimension node, i is connected to (i + 1)%p, where p is the total num-
ber of nodes. A one-dimensional torus is called a ring network.
• Tree network: The tree topology looks like a tree where the computer
may be associated with every tree node or every leaf only. The tree
links are the communication link. For a binary tree, each computer
only talks to its parent and its two children nodes. The root node is
330 annotated algorithms in python

special because it has no parent node.


Tree networks are ideal for global operations such as broadcasting and
for sharing IO devices such as disks. If the IO device is connected to the
root node, every other computer can communicate with it using only
log p links (where p is the number of computers connected). Moreover,
each subset of a tree network is also a tree network. This makes it easy
to distribute subtasks to different subsets of the same architecture.
• Hypercube: This network assumes 2d nodes, and each node corre-
sponds to a vertex of a hypercube. Nodes are connected by direct
links, which correspond to the edges of the hypercube. Its importance
is more academic than practical, although some ideas from hypercube
networks are implemented in some algorithms.
If we identify each node on the network with a unique integer number
called its rank, we write explicit code to determine if two nodes i and j
are connected for each network topology:

Listing 8.1: in file: [Link]


1 import math
2 import functools
3 import os
4 import pickle
5 import time
6

7 def BUS(i, j):


8 return True
9

10 def SWITCH(i, j):


11 return True
12
13 def MESH1(p):
14 return lambda i, j, p=p: (i - j) ** 2 == 1
15
16 def TORUS1(p):
17 return lambda i, j, p=p: (i - j + p) % p == 1 or (j - i + p) % p == 1
18
19 def MESH2(p):
20 q = int([Link](p) + 0.1)
21 return lambda i, j, q=q: (
22 (i % q - j % q) ** 2, (i / q - j / q) ** 2) in [(1, 0), (0, 1)]
23

24 def TORUS2(p):
parallel algorithms 331

25 q = int([Link](p) + 0.1)
26 return lambda i, j, q=q: (
27 ((i % q - j % q + q) % q, (i / q - j / q + q) % q)
28 in [(0, 1), (1, 0)]
29 or
30 ((j % q - i % q + q) % q, (j / q - i / q + q) % q)
31 in [(0, 1), (1, 0)]
32 )
33
34 def TREE(i, j):
35 return i == int((j - 1) / 2) or j == int((i - 1) / 2)

8.1.3 Network characteristics


• Number of links
• Diameter: The max distance between any two nodes measured as a
minimum number of links connecting them. Smaller diameter means
smaller latency. The diameter is proportional to the maximum time it
takes for a message go from one node to another.
• Bisection width: The minimum number of links one has to cut to turn
the network into two disjoint networks. Higher bisection width means
higher reliability of the network.
• Arc connectivity: The number of different paths (non-overlapping and
of minimal length) connecting any two nodes. Higher connectivity
means higher bandwidth and higher reliability.
Here are values of this parameter for each type of network:
Network Links Diameter Width
completely connected p( p − 1)/2 1 p−1
switch p 2 1
1D mesh p−1 p−1 1
1 n −1 2
nD mesh n ( p n − 1) p n n p3
p
1D torus p 2 2
n n1
nD torus np 2p 2n
p
hypercube 2 log2 p log2 p log2 p
tree p−1 log2 p 1
Most actual supercomputers implement a variety of taxonomies and
332 annotated algorithms in python

Figure 8.1: Examples of network topologies.

topologies simultaneously. A modern supercomputer has many nodes,


each node has many CPUs, each CPU has many cores, and each core im-
plements SIMD instructions. Each core has it own cache, each CPU has
its own cache, and each node has its own memory shared by all threads
running on that one node. Nodes communicate with each other using
multiple networks (typically a multidimensional mesh for point-to-point
communications and a tree network for global communication and gen-
eral disk IO).
This makes writing parallel programs very difficult. Parallel programs
must be optimized for each specific architecture.

8.2 Parallel metrics

8.2.1 Latency and bandwidth


The time it takes for a message of size m (in bytes) over a wire can be
broken into two components: a fixed overall time that does not depend on
the size of the message, called latency (and indicated with ts ), and a time
proportional to the message size, called inverse bandwidth (and indicated
with tw ).
Think of a pipe of length L and section s, and you want to pump m
liters of water through the pipe at velocity v. From the moment you start
parallel algorithms 333

pumping, it takes L/v seconds before the water starts arriving at the other
end of the pipe. From that moment, it will take m/sv for all the water to
arrive at its destination. In this analogy, L/v is the latency ts , sv is the
bandwidth, and tw = 1/sv.
The total time to send the message (or the water) is

T (m) = ts + tw m (8.1)

From now on, we will use T1 (n) to refer to the nonparallel running time
of an algorithm as a function of its input m. We will use Tp (n) to refer to
its running time with p parallel processes.
As a practical case, in the following example, we consider a generic algo-
rithm with the following parallel and nonparallel running times:

T1 (n) = t a n2 (8.2)
Tp (n) = t a n2 /p + 2p(ts + tw n/p) (8.3)

These formulas may come for example from the problem of multiplying
a matrix times a vector.
Here t a is the time to perform one elementary instruction; ts and tw are
the latency and inverse bandwidth. The first term of Tp is nothing but
T1 /p, while the second term is an overhead due to communications.
Typically ts >> tw >> t a . In the following plots, we will always assume
t a = 1, ts = 0.2, and tw = 0.1. With these assumptions, fig. 8.2 shows
how Tp changes with input size and number of parallel processes. Notice
that while for small p, Tp decreases ∝ 1/p, for large p, the communication
overhead dominates over computation. This overhead is our example and
is dominated by the latency contribution, which grows with p.

8.2.2 Speedup
The speedup is defined as
334 annotated algorithms in python

Figure 8.2: Tp as a function of input size n and number of processes p.

T1 (n)
S p (n) = (8.4)
Tp (n)
where T1 is the time it takes to run the algorithm on an input of size
n on one processing unit (e.g., node), and Tp is the time it takes to run
the same algorithm on the same input using p nodes in parallel. Fig. 8.3
shows an example of speedup. When communication overhead domi-
nates, speedup decreases.

8.2.3 Efficiency
The efficiency is defined as

S p (n) T (n)
E p (n) = = 1 (8.5)
p pTp (n)
Notice that in case of perfect parallelization (impossible), Tp = T1 /p, and
therefore E p (n) = 1. Fig. 8.4 shows an example of efficiency. When
parallel algorithms 335

Figure 8.3: S p as a function of input size n and number of processes p.

communication overhead dominates, efficiency drops. Notice efficiency


is always less than 1. We do not write parallel algorithms because they
are more efficient. They are always less efficient and more costly than the
nonparallel ones. We do it because we want the result sooner, and there
is an economic value in it.

8.2.4 Isoefficiency
Given a value of efficiency that we choose as target, E, and a given number
of nodes, p, we ask what is the maximum size of a problem that we can
solve. The answer is found by solving for n the following equation:

E p (n) = E (8.6)
For example Tp , we obtain

1
Ep = =E (8.7)
1 + 2p2 (t 2
s + tw n/p ) / ( n t a )
336 annotated algorithms in python

Figure 8.4: E p as a function of input size n and number of processes p.

which solved in n yields


tw E
n≃2 p (8.8)
ta 1 − E
Isoefficiency curves for different values of E are shown in fig. 8.5. For our
example problem, n is proportional to p. In general, this is not true, but n
is monotonic in p.

8.2.5 Cost
The cost of a computation is equal to the time it takes to run on each node,
multiplied by the number of nodes involved in the computation:

C p (n) = pTp (n) (8.9)

Notice that in general

dC p (n)
= αT1 (n) > 0 (8.10)
dp
parallel algorithms 337

Figure 8.5: Isoefficiency curves for different values of the target efficiency.

This means that for a fixed problem size n, the more an algorithm is par-
allelized, the more it costs to run it (because it gets less and less efficient).

8.2.6 Cost optimality


With the preceding disclaimer, we define cost optimality as the choice of
p (as a function of n), which makes the cost scale proportional to T1 (n):

pTp (n) ∝ T1 (n) (8.11)

Or in other words, looking for the p(n) such that

lim p(n) Tp(n) (n)/T1 (n) = const. ̸= 0 (8.12)


n→∞
338 annotated algorithms in python

Figure 8.6: C p as a function of input size n and a number of processes p.

8.2.7 Amdahl"s law


Consider an algorithm that can be parallelized, but one fraction α of its
total sequential running time αT1 cannot be parallelized. That means that
Tp = αT1 + (1 − α) T1 /p, and this yields [65]

1 1
Sp = < (8.13)
α + (1 − α)/p α

Therefore the speedup is theoretically limited.

8.3 Message passing

Consider the following Python program:


1 def f():
2 if [Link](): print(True)
3 else: print(False)
4 f()

The output of the current program is


parallel algorithms 339

1 True
2 False

The function fork creates a copy of the current process (a child). The
parent process returns the ID of the child process, and the child process
returns 0. Therefore the if condition is both true and false, just on differ-
ent processes.
The source of PSim is include in the [Link] file.

Listing 8.2: in file: [Link]


1 class PSim(object):
2 def __init__(self, p, topology=SWITCH, logfilename=None):
3 """
4 forks p-1 processes and creates p * p
5 """
6 [Link] = logfilename and open(logfilename, "w")
7 [Link] = topology
8 [Link]("START: creating %i parallel processes\n" % p)
9 [Link] = p
10 [Link] = {}
11 for i in range(p):
12 for j in range(p):
13 [Link][i, j] = [Link]()
14 [Link] = 0
15 for i in range(1, p):
16 if not [Link]():
17 [Link] = i
18 break
19 [Link]("START: done.\n")
20

21 def log(self, message):


22 """
23 logs the message into self._logfile
24 """
25 if [Link] != None:
26 [Link](message)
27
28 def send(self, j, data):
29 """
30 sends data to process #j
31 """
32 if not [Link]([Link], j):
33 raise RuntimeError("topology violation")
34 self._send(j, data)
35

36 def _send(self, j, data):


340 annotated algorithms in python

37 """
38 sends data to process #j ignoring topology
39 """
40 if j < 0 or j >= [Link]:
41 [Link]("process %i: send(%i, ...) failed!\n" %
42 ([Link], j))
43 raise Exception
44 [Link]("process %i: send(%i, %s) starting...\n" %
45 ([Link], j, repr(data)))
46 s = [Link](data)
47 [Link]([Link][[Link], j][1], [Link](str(len(s)), 10))
48 [Link]([Link][[Link], j][1], s)
49 [Link]("process %i: send(%i, %s) success.\n" %
50 ([Link], j, repr(data)))
51
52 def recv(self, j):
53 """
54 returns the data received from process #j
55 """
56 if not [Link]([Link], j):
57 raise RuntimeError("topology violation")
58 return self._recv(j)
59
60 def _recv(self, j):
61 """
62 returns the data received from process #j ignoring topology
63 """
64 if j < 0 or j >= [Link]:
65 [Link]("process %i: recv(%i) failed!\n" % ([Link], j))
66 raise RuntimeError
67 [Link]("process %i: recv(%i) starting...\n" % ([Link], j))
68 try:
69 size = int([Link]([Link][j, [Link]][0], 10))
70 s = [Link]([Link][j, [Link]][0], size)
71 except Exception as e:
72 [Link]("process %i: COMMUNICATION ERROR!!!\n" % ([Link]))
73 raise e
74 data = [Link](s)
75 [Link]("process %i: recv(%i) done.\n" % ([Link], j))
76 return data

An instance of the class PSim is an object that can be used to determine


the total number of parallel processes, the rank of each running process,
to send messages to other processes, and to receive messages from them.
It is usually called a communicator; send and recv represent the simplest
type of communication pattern, point-to-point communication.
parallel algorithms 341

A PSim program starts by importing and creating an instance of the PSim


class. The constructor takes two arguments, the number of parallel pro-
cesses you want and the network topology you want to emulate. Before
returning the PSim instance, the constructor makes p − 1 copies of the run-
ning process and creates sockets connecting each two of them. Here is
a simple example in which we make two parallel processes and send a
message from process 0 to process 1:
1 from psim import *
2
3 comm = PSim(2, SWITCH)
4 if [Link] == 0:
5 [Link](1, "Hello World")
6 elif [Link] == 1:
7 message = [Link](0)
8 print(message)

Here is a more complex example that creates p = 10 parallel processes,


and node 0 sends a message to each one of them:
1 from psim import *
2

3 p = 10
4
5 comm = PSim(p, SWITCH)
6 if [Link] == 0:
7 for other in range(1, p):
8 [Link](other, "Hello %s" % p)
9 else:
10 message = [Link](0)
11 print(message)

Following is a more complex example that implements a parallel scalar


product. The process with rank 0 makes up two vectors and distributes
pieces of them to the other processes. Each process computes a part of
the scalar product. Of course, the scalar product runs in linear time, and
it is very inefficient to parallelize it, yet we do it for didactic purposes.

Listing 8.3: in file: psim_scalar.py


1 import random
2 from psim import PSim
3

4 def scalar_product_test1(n, p):


5 comm = PSim(p)
6 h = n/p
342 annotated algorithms in python

7 if [Link] == 0:
8 a = [[Link]() for i in range(n)]
9 b = [[Link]() for i in range(n)]
10 for k in range(1, p):
11 [Link](k, a[k * h:k * h+h])
12 [Link](k, b[k * h:k * h+h])
13 else:
14 a = [Link](0)
15 b = [Link](0)
16 scalar = sum(a[i] * b[i] for i in range(h))
17 if [Link] == 0:
18 for k in range(1, p):
19 scalar += [Link](k)
20 print(scalar)
21 else:
22 [Link](0, scalar)
23

24 scalar_product_test(10, 2)

Using NumPy, the scalar product is a single operation:


1 >>> import numpy as np
2 >>> a = [Link](n)
3 >>> b = [Link](n)
4 >>> scalar = [Link](a, b) # or equivalently: a @ b

Most parallel algorithms follow a similar pattern. One process has access
to IO. That process reads and scatters the data. The other processes per-
form their part of the computation; the results are reduced (aggregated)
and sent back to the root process. This pattern may be repeated by multi-
ple functions, perhaps in loops. Different functions may handle different
data structure and may have different communication patterns. The one
thing that must be constant throughout the run is the number of processes
because one wants to pair each process with one computing unit.
In the following, we implement a parallel version of the mergesort. At
each step, the code splits the problem into two smaller problems. Half of
the problem is solved by the process that performed the split and assigns
the other half to an existing free process. When there are no more free
processes, it reverts to the nonparallel mergesort step. The merge function
here is the same as the nonparallel mergesort of chapter 3.

Listing 8.4: in file: psim_mergesort.py


1 import random
parallel algorithms 343

2 from psim import PSim


3

4 def mergesort(A, x=0, z=None):


5 if z is None: z = len(A)
6 if x<z-1:
7 y = int((x+z)/2)
8 mergesort(A, x, y)
9 mergesort(A, y, z)
10 merge(A, x, y, z)
11

12 def merge(A, x, y, z):


13 B, i, j = [], x, y
14 while True:
15 if A[i]<=A[j]:
16 [Link](A[i])
17 i=i+1
18 else:
19 [Link](A[j])
20 j=j+1
21 if i == y:
22 while j<z:
23 [Link](A[j])
24 j=j+1
25 break
26 if j == z:
27 while i<y:
28 [Link](A[i])
29 i=i+1
30 break
31 A[x:z]=B
32

33 def mergesort_test(n, p):


34 comm = PSim(p)
35 if [Link] == 0:
36 data = [[Link]() for i in range(n)]
37 [Link](1, data[n/2:])
38 mergesort(data, 0, n/2)
39 data[n/2:] = [Link](1)
40 merge(data, 0, n/2, n)
41 print(data)
42 else:
43 data = [Link](0)
44 mergesort(data)
45 [Link](0, data)
46

47 mergesort_test(20, 2)

More interesting patterns are global communication patterns imple-


344 annotated algorithms in python

mented on top of send and recv. Subsequently, we discuss the most com-
mon: broadcast, scatter, collect, and reduce. Our implementation is not
the most efficient, but it is the simplest. In principle, there should be a
different implementation for each type of network topology to take ad-
vantage of its features.

8.3.1 Broadcast
The simplest type of broadcast is the one-2-all, which consists of one pro-
cess (source) sending a message (value) to every other process. A more
complex broadcast is when each process broadcasts a message simultane-
ously and each node receives the list of values ordered by the rank of the
sender:

Listing 8.5: in file: [Link]


1
2 def one2all_broadcast(self, source, value):
3 [Link](
4 "process %i: BEGIN one2all_broadcast(%i, %s)\n"
5 % ([Link], source, repr(value))
6 )
7 if [Link] == source:
8 for i in range(0, [Link]):
9 if i != source:
10 self._send(i, value)
11 else:
12 value = self._recv(source)
13 [Link](
14 "process %i: END one2all_broadcast(%i, %s)\n"
15 % ([Link], source, repr(value))
16 )
17 return value
18
19 def all2all_broadcast(self, value):
20 [Link]("process %i: BEGIN all2all_broadcast(%s)\n" %
21 ([Link], repr(value)))
22 vector = self.all2one_collect(0, value)
23 vector = self.one2all_broadcast(0, vector)
24 [Link]("process %i: END all2all_broadcast(%s)\n" %
25 ([Link], repr(value)))
26 return vector

We have implemented the all-to-all broadcast using a trick. We collected


all values and sent them to the node with rank 0 (via a function collect),
parallel algorithms 345

and then we did a one-to-all broadcast of the entire list from node 0.
In general, the implementation depends on the topology of the available
network.
Here is an example of an application of broadcasting:
1 from psim import *
2

3 p = 10
4

5 comm = PSim(p, SWITCH)


6 message = "Hello World" if [Link] == 0 else None
7 message = comm.one2all_broadcast(0, message)
8 print(message)

Notice how before the broadcast, only the process with rank 0 has knowl-
edge of the message. After broadcast, all nodes are aware of it. Also
notice that one2all_broadcast is a global communication function, and all
processes must call it. Its first argument is the rank of the broadcasting
process (0), while the second argument is the message to be broadcasted
(only the value from node 0 is actually used).

8.3.2 Scatter and collect


The all-to-one collect pattern works as follows. Every process sends a
value to process destination, which receives the values in a list ordered
according to the rank of the senders:

Listing 8.6: in file: [Link]


1

2 def one2all_scatter(self, source, data):


3 [Link](
4 "process %i: BEGIN all2one_scatter(%i, %s)\n"
5 % ([Link], source, repr(data))
6 )
7 if [Link] == source:
8 h, remainder = divmod(len(data), [Link])
9 if remainder:
10 h += 1
11 for i in range([Link]):
12 self._send(i, data[i * h : i * h + h])
13 vector = self._recv(source)
14 [Link](
15 "process %i: END all2one_scatter(%i, %s)\n"
346 annotated algorithms in python

16 % ([Link], source, repr(data))


17 )
18 return vector
19
20 def all2one_collect(self, destination, data):
21 [Link](
22 "process %i: BEGIN all2one_collect(%i, %s)\n"
23 % ([Link], destination, repr(data))
24 )
25 self._send(destination, data)
26 if [Link] == destination:
27 vector = [self._recv(i) for i in range([Link])]
28 else:
29 vector = []
30 [Link](
31 "process %i: END all2one_collect(%i, %s)\n"
32 % ([Link], destination, repr(data))
33 )
34 return vector

Here is a revised version of the previous scalar product example using


scatter:

Listing 8.7: in file: psim_scalar2.py


1 import random
2 from psim import PSim
3

4 def scalar_product_test2(n, p):


5 comm = PSim(p)
6 a = b = None
7 if [Link] == 0:
8 a = [[Link]() for i in range(n)]
9 b = [[Link]() for i in range(n)]
10 a = comm.one2all_scatter(0, a)
11 b = comm.one2all_scatter(0, b)
12
13 scalar = sum(a[i] * b[i] for i in range(len(a)))
14

15 scalar = comm.all2one_reduce(0, scalar)


16 if [Link] == 0:
17 print(scalar)
18
19 scalar_product_test2(10, 2)
parallel algorithms 347

8.3.3 Reduce
The all-to-one reduce pattern is very similar to the collect, except that the
destination does not receive the entire list of values but some aggregated
information about the values. The aggregation must be performed using
a commutative binary function f ( x, y) = f (y, x ). This guarantees that the
reduction from the values go down in any order and thus are optimized
for different network topologies.
The all-to-all reduce is similar to reduce, but every process will get the re-
sult of the reduction, not just one destination node. This may be achieved
by an all-to-one reduce followed by a one-to-all broadcast:

Listing 8.8: in file: [Link]


1

2 def all2one_reduce(self, destination, value, op=lambda a, b: a + b):


3 [Link]("process %i: BEGIN all2one_reduce(%s)\n" %
4 ([Link], repr(value)))
5 self._send(destination, value)
6 if [Link] == destination:
7 result = [Link](
8 op, [self._recv(i) for i in range([Link])])
9 else:
10 result = None
11 [Link]("process %i: END all2one_reduce(%s)\n" %
12 ([Link], repr(value)))
13 return result
14

15 def all2all_reduce(self, value, op=lambda a, b: a + b):


16 [Link]("process %i: BEGIN all2all_reduce(%s)\n" %
17 ([Link], repr(value)))
18 result = self.all2one_reduce(0, value, op)
19 result = self.one2all_broadcast(0, result)
20 [Link]("process %i: END all2all_reduce(%s)\n" %
21 ([Link], repr(value)))
22 return result

And here are some examples of a reduce operation that can be passed to
the op argument of the all2one_reduce and all2all_reduce methods:

Listing 8.9: in file: [Link]


1 @staticmethod
2 def sum(x, y):
3 return x + y
4
348 annotated algorithms in python

5 @staticmethod
6 def mul(x, y):
7 return x * y
8
9 @staticmethod
10 def max(x, y):
11 return max(x, y)
12

13 @staticmethod
14 def min(x, y):
15 return min(x, y)

Graph algorithms can also be parallelized, for example, the Prim algo-
rithm. One way to do it is to represent the graph using an adjacency
matrix where term i, j corresponds to the link between vertex i and vertex
j. The term can be None if the link does not exist. Any graph algorithm, in
some order, loops over the vertices and over the neighbors. This step can
be parallelized by assigning different columns of the adjacency matrix to
different computing processes. Each process only loops over some of the
neighbors of the vertex being processed. Here is an example of the Prim
algorithm:

Listing 8.10: in file: psim_prim.py


1 from psim import PSim
2 import random
3
4 def random_adjacency_matrix(n):
5 A = []
6 for r in range(n):
7 [Link]([0] * n)
8 for r in range(n):
9 for c in range(0, r):
10 A[r][c] = A[c][r] = [Link](1, 100)
11 return A
12

13 # NumPy equivalent:
14 # import numpy as np
15 # def random_adjacency_matrix_np(n):
16 # A = [Link](1, 100, (n, n))
17 # A = (A + A.T) // 2 # make symmetric
18 # np.fill_diagonal(A, 0) # zero diagonal
19 # return A
20
21 class Vertex(object):
22 def __init__(self, path=[0, 1, 2]):
parallel algorithms 349

23 [Link] = path
24

25 def weight(path=[0, 1, 2], adjacency=None):


26 return sum(adjacency[path[i-1]][path[i]] for i in range(1, len(path)))
27

28 def bb(adjacency, p=1):


29 n = len(adjacency)
30 comm = PSim(p)
31 Q = []
32 path = [0]
33 [Link](Vertex(path))
34 bound = float("inf')
35 optimal = None
36 local_vertices = comm.one2all_scatter(0, range(n))
37 while True:
38 if [Link] == 0:
39 vertex = [Link]() if Q else None
40 else:
41 vertex = None
42 vertex = comm.one2all_broadcast(0, vertex)
43 if vertex is None:
44 break
45 P = []
46 for k in local_vertices:
47 if not k in [Link]:
48 new_path = [Link]+[k]
49 new_path_length = weight(new_path, adjacency)
50 if new_path_length<bound:
51 if len(new_path) == n:
52 new_path.append(new_path[0])
53 new_path_length = weight(new_path, adjacency)
54 if new_path_length<bound:
55 bound = new_path_length # bcast
56 optimal = new_path # bcast
57 else:
58 new_vertex = Vertex(new_path)
59 [Link](new_vertex) # fix this
60 print(new_path, new_path_length)
61 x = (bound, optimal)
62 x = comm.all2all_reduce(x, lambda a, b: min(a, b))
63 (bound, optimal) = x
64

65 P = comm.all2one_collect(0, P)
66 if [Link] == 0:
67 for item in P:
68 Q+=item
69 return optimal, bound
70
71
350 annotated algorithms in python

72 m = random_adjacency_matrix(5)
73 print(bb(m, p=2))

8.3.4 Barrier
Another global communication pattern is the barrier. It forces all pro-
cesses when they reach the barrier to stop and wait until all the other
processes have reached the barrier. Think of runners gathering at the
starting line of a race; when all the runners are there, the race can start.
Here we implement it using a simple all-to-all broadcast:

Listing 8.11: in file: [Link]


1 def barrier(self):
2 [Link]("process %i: BEGIN barrier()\n" % ([Link]))
3 self.all2all_broadcast(0)
4 [Link]("process %i: END barrier()\n" % ([Link]))
5 return

The use of barrier is usually a symptom of bad code because it forces


parallel processes to wait for other processes without data actually being
transferred.

8.3.5 Global running times


In the following table, we compute the order of growth or typical running
times for the most common network topologies for typical communication
algorithms:
parallel algorithms 351

Network Send/Recv One2All Bcast Scatter


completely connected 1 1 1
switch 2 log p 2p
1D mesh p−1 p−1 p2
1 √
2D mesh 2( p 2 − 1) p p2
1
3D mesh 3( p − 1)
3 p1/3 p2
1D torus p/2 p/2 p2
1 √
2D torus 2p 2 p/2 p2
1
3D torus 3/2p 3 p1/3 /2 p2
hypercube log p log2 p p
tree log p log p p
It is obvious that the completely connected is the fastest network but also
the most expensive to build. The tree is a cheap compromise. The switch
tends to be faster for arbitrary point-to-point communication, but the
switch comes to a premium. Multidimensional meshes and toruses be-
come cost-effective when solving problems that are naturally defined on
a grid because they only require next neighbor interaction.

8.4 mpi4py

The Psim emulator does not provide any actual speedup unless you have
multiple cores or processors to execute the forked processes. A better
approach would be to use mpi4py [66] because it allows running different
processes on different machines on a network. mpi4py is a Python inter-
face to the message passing interface (MPI). MPI is a standard protocol
and API for interprocess communications. Its API are equivalent one by
one to those of PSim, except that they have different names and different
signatures.
Here is an example of using mpi4py:
1 from mpi4py import MPI
2

3 comm = MPI.COMM_WORLD
4 rank = comm.Get_rank()
5

6 if rank == 0:
352 annotated algorithms in python

7 message = "Hello World"


8 [Link](message, dest=1, tag=11)
9 elif rank == 1:
10 message = [Link](source=0, tag=11)
11 print(message)

The comm object of class MPI.COMM_WORLD plays a similar role as the PSim
object of the previous section. The MPI send and recv functions are very
similar to the PSim equivalent ones, except that they require details about
the type of the data being transferred and a communication tag. The tag
allows node A to send multiple messages to B and allows B to receive
them out of order. PSim does not allow tags.

8.5 Master-Worker and Map-Reduce

Map-Reduce [67] is a framework for processing highly distributable prob-


lems across huge data sets using a large number of computers (nodes).
The group of computers is collectively referred to as a cluster (if all nodes
use the same hardware) or a grid (if the nodes use different hardware). It
comprises two steps:
“Map” (implemented here in a function mapfn): The master node takes the
input data, partitions it into smaller subproblems, and distributes individ-
ual pieces of the data to worker nodes. A worker node may do this again
in turn, leading to a multilevel tree structure. The worker node processes
the smaller problem, computes a result, and passes that result back to its
master node.
“Reduce” (implemented here in a function reducefn): The master node
collects the partial results from all the subproblems and combines them
in some way to compute the answer to the problem it needs.
Map-Reduce allows for distributed processing of the map and reduction
operations. Provided each mapping operation is independent of the oth-
ers, all maps can be performed in parallel—though in practice, it is limited
by the number of independent data sources and/or the number of CPUs
near each source. Similarly, a set of “reducers” can perform the reduction
phase, provided all outputs of the map operation that share the same key
parallel algorithms 353

are presented to the same reducer at the same time.


While this process can often appear inefficient compared to algorithms
that are more sequential, Map-Reduce can be applied to significantly
larger data sets than “commodity” servers can handle—a large server
farm can use Map-Reduce to sort a petabyte of data in only a few hours,
which would require much longer in a monolithic or single process sys-
tem.
Parallelism also offers some possibility of recovering from partial failure
of servers or storage during the operation: if one mapper or reducer fails,
the work can be rescheduled—assuming the input data are still available.
Map-Reduce comprises two main functions: mapfn and reducefn. mapfn
takes a (key, value) pair of data with a type in one data domain and
returns a list of (key, value) pairs in a different domain:

mapfn(k1, v1) → (k2, v2) (8.14)

The mapfn function is applied in parallel to every item in the input data
set. This produces a list of (k2, v2) pairs for each call. After that, the
Map-Reduce framework collects all pairs with the same key from all lists
and groups them together, thus creating one group for each one of the
different generated keys. The reducefn function is then applied in parallel
to each group, which in turn produces a collection of values in the same
domain:
reducefn(k2, [list of v2]) → (k2, v3) (8.15)
The values returned by reducefn are then collected into a single list. Each
call to reducefn can produce one, none, or multiple partial results. Thus
the Map-Reduce framework transforms a list of (key, value) pairs into a
list of values. It is necessary but not sufficient to have implementations of
the map and reduce abstractions to implement Map-Reduce. Distributed
implementations of Map-Reduce require a means of connecting the pro-
cesses performing the mapfn and reducefn phases.
Here is a nonparallel implementation that explains the data workflow
better:
1 def mapreduce(mapper, reducer, data):
354 annotated algorithms in python

2 """
3 >>> def mapfn(x): return x%2, 1
4 >>> def reducefn(key, values): return len(values)
5 >>> data = list(range(100))
6 >>> mapreduce(mapfn, reducefn, data)
7 {0: 50, 1: 50}
8 """
9 partials = {}
10 results = {}
11 for item in data:
12 key, value = mapper(item)
13 if not key in partials:
14 partials[key]=[value]
15 else:
16 partials[key].append(value)
17 for key, values in [Link]():
18 results[key] = reducer(key, values)
19 return results

And here is an example we can use to find how many random DNA
strings contain the subsequence “ACTA”:
1 >>> from random import choice
2 >>> strings = [''.join(choice("ATGC") for i in range(10))
3 ... for j in range(100)]
4 >>> def mapfn(string): return ("ACCA" in string, 1)
5 >>> def reducefn(check, values): return len(values)
6 >>> print(mapreduce(mapfn, reducefn, strings))
7 {False: ..., True: ...}

The important thing about the preceding code is that there are two loops
in Map-Reduce. Each loop consists of executing tasks (map tasks and
reduce tasks) which are independent from each other (all the maps are
independent, all the reduce are independent, but the reduce depend on
the maps). Because they are independent, they can be executed in parallel
and by different processes.
A simple and small library that implements the map-reduce algorithm
in Python is mincemeat [68]. The workers connect and authenticate to the
server using a password and request tasks to executed. The server accepts
connections and assigns the map and reduce tasks to the workers.
The communication is performed using asynchronous sockets, which
means neither workers nor the master is ever in a wait state. The code
is event based, and communication only happens when a socket connect-
parallel algorithms 355

ing the master to a worker is ready for a write (task assignment) or a read
(task completed).
The code is also failsafe because if a worker closes the connection prema-
turely, the task is reassigned to another worker.
Function mincemeat uses the python libraries asyncore and asynchat to im-
plement the communication patterns, for which we refer to the Python
documentation.
Here is an example of a mincemeat program:
1 import mincemeat
2 from random import choice
3

4 strings = [''.join(choice("ATGC") for i in range(10)) for j in range(100)]


5 def mapfn(k1, string): yield ("ACCA" in string, 1)
6 def reducefn(k2, values): return len(values)
7
8 s = [Link]()
9 [Link] = mapfn
10 [Link] = reducefn
11 [Link] = dict(enumerate(strings))
12 results = s.run_server(password="changeme")
13 print(results)

Notice that in mincemeat, the data source is a list of key value dictionaries
where the values are the ones to be processed. The key is also passed
to the mapfn function as first argument. Moreover, the mapfn function can
return more than one value using yield. This syntactical notation makes
minemeat more flexible.

Execute this script on the server:


1 > python mincemeat_example.py

Run [Link] as a worker on a client:


1 > python [Link] -p changeme [server address]

You can run more than one worker, although for this example the server
will terminate almost immediately.
Function mincemeat works fine for many applications, but sometimes one
wishes for a more powerful tool that provides faster communications,
support for arbitrary languages, and better scalability tools and monitor-
356 annotated algorithms in python

ing tools. An example in Python is disco. A standard tool, written in Java


but supporting Python, is Hadoop.

8.6 pyOpenCL

Nvidia should be credited for bringing GPU computing to the mass mar-
ket. They have developed the CUDA [69] framework for GPU program-
ming. CUDA programs consist of two parts: a host and a kernel. The
host deploys the kernel on the available GPU core, and multiple copies of
the kernel run in parallel.
Nvidia, AMD, Intel, and ARM have created the Kronos Group, and to-
gether they have developed the Open Common Language framework
(OpenCL [70]), which borrows many ideas from CUDA and promises
more portability. OpenCL supports Intel/AMD CPUs, Nvidia/ATI GPU,
ARM chips, and the LLVM virtual machine.
OpenCL is a C99 dialect. In OpenCL, like in CUDA, there is a host pro-
gram and a kernel. Multiple copies of the kernel are queued and run in
parallel on available devices. Kernels running on the same device have
access to a shared memory area as well as local memory areas.
A typical OpenCL program has the following structure:
1 find available devices (GPUs, CPUs)
2 copy data from host to device
3 run N copies of this kernel code on the device
4 copy data from device to host

Usually the kernel is written in C99, while the host is written in C++. It is
also possible to write the host code in other languages, including Python.
Here we will use the pyOpenCL [4] module for programming the host using
Python. This produces no significant loss of performance compared to
C++ because the actual computation is performed by kernel, not by the
host. It is also possible to write the kernels using Python using a library
called Clyther [71] but this is not discussed here.
First of all we implement a class Device class in terms of pyOpenCL API
which will make our later code more readable.
parallel algorithms 357

Listing 8.12: in file: [Link]


1 import numpy
2 import pyopencl as pcl
3

4 class Device(object):
5 flags = pcl.mem_flags
6 def __init__(self):
7 [Link] = pcl.create_some_context()
8 [Link] = [Link]([Link])
9 def buffer(self, source=None, size=0, mode=pcl.mem_flags.READ_WRITE):
10 if source is not None: mode = mode|pcl.mem_flags.COPY_HOST_PTR
11 buffer = [Link]([Link], mode, size=size, hostbuf=source)
12 return buffer
13 def retrieve(self, buffer, shape=None, dtype=numpy.float32):
14 output = [Link](shape or [Link]//4, dtype=dtype)
15 pcl.enqueue_copy([Link], output, buffer)
16 return output
17 def compile(self, kernel):
18 return [Link]([Link], kernel).build()

Here [Link] is the device context, [Link] is the device queue. The
functions buffer, retrieve, and compile map onto the corresponding py-
OpenCL functions Buffer, enqueue_copy, and Program but use a simpler
syntax. For more details, we refer to the official pyOpenCL documentation.

8.6.1 A first example with PyOpenCL


pyOpenCL uses numpy multidimensional arrays to store data. For example,
here is a numpy example that performs the scalar product between two
vectors, u and v:
1 import numpy as npy
2

3 size = 10000
4 u = [Link](size).astype(npy.float32)
5 v = [Link](size).astype(npy.float32)
6 w = [Link](n, dtype=numpy.float32)
7
8 for i in range(0, n):
9 w[i] = u[i] + v[i];
10
11 assert [Link](w - (u + v)) == 0

The program works as follows:


• It creates two numpy arrays u and v of given size and filled with random
358 annotated algorithms in python

numbers.
• It creates another numpy array w of the same size filled with zeros.
• It loops over all indices of w and adds, term by term, u and v storing
the result into w.
• It checks the result using the numpy linalg submodule.
Our goal is to parallelize the part of the computation performed in the
loop. Notice that our parallelization will not make the code faster because
this is a linear algorithm, and algorithms linear in the input are never
faster when parallelized because the communication has the same order
of growth as the algorithm itself:

Listing 8.13: in file: opencl_example1.py


1 import numpy as npy
2 from device import Device
3

4 n = 100000
5 u = [Link](n).astype(npy.float32)
6 v = [Link](n).astype(npy.float32)
7

8 device = Device()
9 u_buffer = [Link](source=u)
10 v_buffer = [Link](source=v)
11 w_buffer = [Link](size=[Link])
12
13 kernels = [Link](
14 """
15 __kernel void sum(__global const float * u,
16 __global const float * v,
17 __global float * w) {
18 int i = get_global_id(0);
19 w[i] = u[i] + v[i];
20 }
21 """
22 )
23
24 [Link]([Link], [n], None, u_buffer, v_buffer, w_buffer)
25 w = [Link](w_buffer)
26
27 assert [Link](w - (u + v)) == 0

This program performs the following steps in addition to the original


non-OpenCL code: it declares a device object; it declares a buffer for each
parallel algorithms 359

of the vectors u, v, and w; it declares and compiles the kernel; it runs the
kernel; it retrieves the result.
The device object encapsulate the kernel(s) and a queue for kernel sub-
mission.
The line:
1 [Link](..., [n], ...)

submits to the queue n instances of the sum kernel. Each kernel instance
can retrieve its own ID using the function get_global_id(0). Notice that a
kernel must be declared with the __kernel prefix. Arguments that are to
be shared by all kernels must be __global.

8.6.2 Laplace solver


In this section we implement a two-dimensional Laplace solver. A three-
dimensional generalization is straightforward. In particular, we want to
solve the following differential equation known as a Laplace equation:

(∂2x + ∂2y )u( x, y) = q( x, y) (8.16)

Here q is the input and u is the output.


This equation originates, for example, in electrodynamics. In this case,
q is the distribution of electric charge in space and u is the electrostatic
potential.
As we did in chapter 3, we proceed by discretizing the derivatives:

∂2x u( x, y) = (u( x − h, y) − 2u( x, y) + u( x + h, y))/h2 (8.17)


∂2y u( x, y) = (u( x, y − h) − 2u( x, y) + u( x, y + h))/h 2
(8.18)

Substitute them into eq. 8.16 and solve the equation in u( x, y). We obtain

u( x, y) = 1/4(u( x − h, y) + u( x + h, y) + u( x, y − h) + u( x, y + h) − h2 q( x, y))
(8.19)
360 annotated algorithms in python

We can therefore solve eq. 8.16 by iterating eq. 8.19 until convergence. The
initial value of u will not affect the solution, but the closer we can pick it
to the actual solution, the faster the convergence.
The procedure we utilized here for transforming a differential equation
into an iterative procedure is a general one and applies to other differen-
tial equations as well. The iteration proceeds very much as the fixed point
solver also examined in chapter 3.
Here is an implementation using ocl:

Listing 8.14: in file: opencl_laplace.py


1 from random import randint, choice
2 import numpy
3 from canvas import Canvas
4 from device import Device
5

6 n = 300
7 q = [Link]((n, n), dtype=numpy.float32)
8 u = [Link]((n, n), dtype=numpy.float32)
9 w = [Link]((n, n), dtype=numpy.float32)
10

11 for k in range(n):
12 q[randint(1, n - 1), randint(1, n - 1)] = choice((-1, +1))
13

14 device = Device()
15 q_buffer = [Link](source=q, mode=[Link].READ_ONLY)
16 u_buffer = [Link](source=u)
17 w_buffer = [Link](source=w)
18
19

20 kernels = [Link](
21 """
22 __kernel void solve(__global float * w,
23 __global const float * u,
24 __global const float * q) {
25 int x = get_global_id(0);
26 int y = get_global_id(1);
27 int xy = y * WIDTH + x, up, down, left, right;
28 if(y!=0 && y!=WIDTH-1 && x!=0 && x!=WIDTH-1) {
29 up=xy+WIDTH; down=xy-WIDTH; left=xy-1; right=xy+1;
30 w[xy] = 1.0/4.0 * (u[up]+u[down]+u[left]+u[right] - q[xy]);
31 }
32 }
33 """.replace(
34 "WIDTH", str(n)
parallel algorithms 361

35 )
36 )
37

38 for k in range(1000):
39 [Link]([Link], [n, n], None, w_buffer, u_buffer, q_buffer)
40 (u_buffer, w_buffer) = (w_buffer, u_buffer)
41
42 u = [Link](u_buffer, shape=(n, n))
43
44 Canvas().imshow(u).save(filename="[Link]")

Figure 8.7: The image shows the output of the Laplace program and represents the
two-dimensional electrostatic potential for a random charge distribution.
9
Appendices

9.1 Appendix A: Math Review and Notation

9.1.1 Symbols

∞ infinity
∧ and
∨ or
∩ intersection
∪ union
∈ element or In (9.1)
∀ for each
∃ exists
⇒ implies
: such that
iff if and only if

9.1.2 Set theory


Important sets
364 annotated algorithms in python

0 empty set
N natural numbers {0, 1, 2, 3, ...}
N+ positive natural numbers {1, 2, 3, ...}
Z all integers {..., -3, -2, -1, 0, 1, 2, 3, ...} (9.2)
R all real numbers
R+ positive real numbers (not including 0)
R0 positive numbers including 0

Set operations
A, B and C are some generic sets.
• Intersection
A ∩ B ≡ { x : x ∈ A and x ∈ B} (9.3)

• Union
A ∪ B ≡ { x : x ∈ A or x ∈ B} (9.4)

• Difference
A − B ≡ { x : x ∈ A and x ∈
/ B} (9.5)

Set laws
• Empty set laws

A∪0 = A (9.6)
A∩0 = 0 (9.7)

• Idempotency laws

A∪A = A (9.8)
A∩A = A (9.9)

• Commutative laws

A∪B = B∪A (9.10)


A∩B = B∩A (9.11)
appendices 365

• Associative laws

A ∪ (B ∪ C) = (A ∪ B) ∪ C (9.12)
A ∩ (B ∩ C) = (A ∩ B) ∩ C (9.13)

• Distributive laws

A ∩ (B ∪ C) = (A ∩ B) ∪ (A ∩ C) (9.14)
A ∪ (B ∩ C) = (A ∪ B) ∩ (A ∪ C) (9.15)

• Absorption laws

A ∩ (A ∪ B) = A (9.16)
A ∪ (A ∩ B) = A (9.17)

• DeMorgan laws

A − (B ∪ C) = (A − B) ∩ (A − C) (9.18)
A − (B ∩ C) = (A − B) ∪ (A − C) (9.19)

More set definitions


• A is a subset of B iff ∀ x ∈ A, x ∈ B
• A is a proper subset of B iff ∀ x ∈ A, x ∈ B and ∃ x ∈ B , x ∈
/A
• P = {Si , i = 1, ..., N } (a set of sets Si ) is a partition of A iff S1 ∪ S2 ∪
... ∪ S N = A and ∀i, j, Si ∩ S j = 0
• The number of elements in a set A is called the cardinality of set A.
• cardinality(N)=countable infinite (∞)
• cardinality(R)=uncountable infinite (∞) !!!
Relations
• A Cartesian Product is defined as

A × B = {( a, b) : a ∈ A and b ∈ B} (9.20)
366 annotated algorithms in python

• A binary relation R between two sets A and B is a subset of their


Cartesian product.
• A binary relation is transitive if aRb and bRc implies aRc
• A binary relation is symmetric if aRb implies bRa
• A binary relation is reflexive if aRa if always true for each a.
Examples:
• a < b for a ∈ A and b ∈ B is a relation (transitive)
• a > b for a ∈ A and b ∈ B is a relation (transitive)
• a = b for a ∈ A and b ∈ B is a relation (transitive, symmetric and
reflexive)
• a ≤ b for a ∈ A and b ∈ B is a relation (transitive, and reflexive)
• a ≥ b for a ∈ A and b ∈ B is a relation (transitive, and reflexive)
• A relation R that is transitive, symmetric and reflexive is called an
equivalence relation and is often indicated with the notation a ∼ b.
An equivalence relation is the same as a partition.
Functions
• A function between two sets A and B is a binary relation on A × B
and is usually indicated with the notation f : A 7−→ B
• The set A is called domain of the function.
• The set B is called codomain of the function.
• A function maps each element x ∈ A into an element f ( x ) = y ∈ B
• The image of a function f : A 7−→ B is the set B ′ = {y ∈ B : ∃ x ∈
A, f ( x ) = y } ⊆ B
• If B ′ is B then a function is said to be surjective.
• If for each x and x ′ in A where x ̸= x ′ implies that f ( x ) ̸= f ( x ′ ) (e.g.,
if not two different elements of A are mapped into different element in
B ) the function is said to be a bijection.
appendices 367

• A function f : A 7−→ B is invertible if it exists a function g : B 7−→ A


such that for each x ∈ A, g( f ( x )) = x and y ∈ B , f ( g(y)) = y. The
function g is indicated with f −1 .
• A function f : A 7−→ B is a surjection and a bijection iff f is an invert-
ible function.
Examples:
• f (n) ≡ nmod2 with domain N and codomain N is not a surjection nor
a bijection.
• f (n) ≡ nmod2 with domain N and codomain {0, 1} is a surjection but
not a bijection
• f ( x ) ≡ 2x with domain N and codomain N is not a surjection but is a
bijection (in fact it is not invertible on odd numbers)
• f ( x ) ≡ 2x with domain R and codomain R is not a surjection and is a
bijection (in fact it is invertible)

9.1.3 Logarithms
If x = ay with a > 0, then y = loga x with domain x ∈ (0, ∞) and
codomain y = (−∞, ∞). If the base a is not indicated, the natural log
a = e = 2. 7183... is assumed.
Properties of logarithms:
log x
loga x = (9.21)
log a
log xy = (log x ) + (log y) (9.22)
x
log = (log x ) − (log y) (9.23)
y
log x n = n log x (9.24)

9.1.4 Finite sums


Definition
368 annotated algorithms in python

i <n
∑ f (i ) ≡ f (0) + f (1) + ... + f (n − 1) (9.25)
i =0

Properties
• Linearity I

i ≤n i <n
∑ f (i ) = ∑ f (i ) + f ( n ) (9.26)
i =0 i =0
i ≤b i ≤b i<a
∑ f (i ) = ∑ f (i ) − ∑ f (i ) (9.27)
i=a i =0 i =0

• Linearity II

! !
i <n i <n i <n
∑ a f (i) + bg(i) = a ∑ f (i ) +b ∑ g (i ) (9.28)
i =0 i =0 i =0

Proof:
i <n
∑ a f (i) + bg(i) = ( a f (0) + bg(0)) + ... + ( a f (n − 1) + bg(n − 1))
i =0
= a f (0) + ... + a f (n − 1) + bg(0) + ... + bg(n − 1)
= a ( f (0) + ... + f (n − 1)) + b ( g(0) + ... + g(n − 1))
! !
i <n i <n
= a ∑ f (i ) +b ∑ g (i ) (9.29)
i =0 i =0

Examples:
appendices 369

i <n
∑c = cn for any constant c (9.30)
i =0
i <n
1
∑i =
2
n ( n − 1) (9.31)
i =0
i <n
1
∑ i2 =
6
n(n − 1)(2n − 1) (9.32)
i =0
i <n
1 2
∑ i3 =
4
n ( n − 1)2 (9.33)
i =0
i <n
xn − 1
∑ xi =
x−1
(geometric sum) (9.34)
i =0
i <n
1 1
∑ i (i + 1) = 1−
n
(telescopic sum) (9.35)
i =0

9.1.5 Limits (n → ∞)
In this section we will only deal with limits (n → ∞) of positive functions.

f (n)
lim =? (9.36)
n→∞ g(n)

First compute limits of the numerator and denominator separately:

lim f (n) = a (9.37)


n→∞
lim g(n) = b (9.38)
n→∞

• If a ∈ R and b ∈ R+ then
f (n) a
lim = (9.39)
n→∞ g(n) b

• If a ∈ R and b = ∞ then
f (x)
lim =0 (9.40)
x →∞ g( x )
370 annotated algorithms in python

• If ( a ∈ R+ and b = 0) or ( a = ∞ and b ∈ R)

f (n)
lim =∞ (9.41)
n→∞ g(n)

• If ( a = 0 and b = 0) or ( a = ∞ and b = ∞) use de l"Hopital rule

f (n) f ′ (n)
lim = lim ′ (9.42)
n→∞ g(n) n→∞ g (n )

and start again!


• Else ... the limit does not exist (typically oscillating functions or non-
analytic functions).
For any a ∈ R or a = ∞

f (n) g(n)
lim = a ⇒ lim = 1/a (9.43)
n→∞ g(n) n → ∞ f (n)

Table of derivatives

f (x) f ′ (x)
c 0
ax n anx n−1
1 (9.44)
log x x
ex ex
ax a x log a
x n log x, n > 0 x n−1 (n log x + 1)

Practical rules to compute derivatives


appendices 371

d
( f ( x ) + g( x )) = f ′ ( x ) + g′ ( x ) (9.45)
dx
d
( f ( x ) − g( x )) = f ′ ( x ) − g′ ( x ) (9.46)
dx
d
( f ( x ) g( x )) = f ′ ( x ) g( x ) + f ( x ) g′ ( x ) (9.47)
dx 
f ′ (x)

d 1
= − (9.48)
dx f ( x ) f ( x )2
f ′ (x) f ( x ) g′ ( x )
 
d f (x)
= − (9.49)
dx g( x ) g( x ) g ( x )2
d
f ( g( x )) = f ′ ( g( x )) g′ ( x ) (9.50)
dx
appendices 373
Index

O, 72 AVL tree, 99 class, 47


Ω, 72 Canvas, 63
Θ, 72 B-tree, 100 CashFlow, 50
χ2 , 182 bandwidth, 332 Chromosome, 136
ω, 72 barrier, 350 Cluster, 127
o, 72 Bayesian statistics, 215 Complex, 47
__add__, 48 Bernoulli process, 304 Device, 356
__div__, 48 beta, 193 DisjointSets, 105
__getitem__, 48, 163 bi-conjugate gradient, FinancialTransaction,
__init__, 48 196 50
__mul__, 48 binary representation, 27 FishmanYarberry, 265
__setitem__, 48, 163 binary search, 98 Ising, 318
__sub__, 48 binary tree, 98 MarsenneTwister, 256
binning, 280 Matrix, 162
binomial tree, 308 MCEngine, 291
a priori, 215
bisection method, 200, MCIntegrator, 300
absolute error, 158
203 Memoize, 87
abstract algebra, 161
bisection width, 331 NetworkReliability, 295
accept-reject, 260
bootstrap, 289 NeuralNetwork, 131
alpha, 193
breadth-first search, 102 NuclearReactor, 297
Amdahls law, 338
broadcast, 344 PeristentDictionary, 57
API, 23
bus network, 328 PersistentDictionary,
approximations, 151
56
arc connectivity, 331
PiSimulator, 292
array, 31 C++, 24
Protein, 322
artificial intelligence, 124 Cantors argument, 138
PSim, 339
ASCII, 30 cash flow, 50
QuadratureIntegrator,
asynchat, 352 chaos, 141, 245
218
asyncore, 352 Cholesky, 176
376 annotated algorithms in python

RandomSource, 261 determinism, 245 Exception, 41


Trader, 187 diameter of network, 331 EXP, 138
URANDOM, 249 dict, 35 expectation value, 232,
clique, 101 Dijkstra, 110 234
closures, 44 dir, 24
clustering, 124 discrete knapsack, 120 Fibonacci series, 86
cmath, 52 discrete random variable, [Link], 51
collect, 345 232 [Link], 51
color2d, 62 disjoint sets, 104 [Link], 51
combinatorics, 240 distribution finally, 41
communicator, 340 Bernoulli, 247 finite differences, 146
complete graph, 101 binomial, 266 fitting, 182
complex, 30 circle, 278 fixed point method, 199
computational error, 144 exponential, 272 float, 27
condition number, 142, Gaussian, 274 Flynn classification, 326
173 memoryless, 247 for, 38
confidence intervals, 276 normal, 274 functional, 147
connected graph, 101 pareto, 277
continuous knapsack, 119 Poisson, 269 Gödels theorem, 140
continuous random vari- sphere, 278 Gauss-Jordan, 169
able, 234 uniform, 248 genetic algorithms, 136
correlation, 192 divide and conquer, 84 global alignment, 117
cost of computation, 336 DNA, 115 golden section search,
cost optimality, 337 double, 27 204
critical points, 141 dynamic programming, Gradient, 207
CUDA, 356 84 graph loop, 101
cumulative distribution graphs, 100
function, 234 efficiency, 334 greedy algorithms, 85,
cycle, 100 eigenvalues, 189 111
eigenvectors, 189
data error, 144 elementary algebra, 161 heap, 94
databases, 56 elif, 40 help, 24
date, 53 else, 40 Hessian, 207
datetime, 53 encode, 30 hierarchical clustering,
decimal, 27 entropy, 114 124
decorrelation, 316 entropy source, 248 hist, 62
def, 43 error analysis, 142 Huffman encoding, 111
degree of a graph, 101 error in the mean, 240 hypercube network, 328
dendrogram, 126 error propagation, 144
depth-first search, 103 Euler method, 226 if, 40
derivative, 146 except, 41 image manipulation, 197
index 377

import, 51 Markov process, 303 network reliability, 294


Input/Output, 51 Markowitz, 178 network topologies, 328
int, 26 master, 352 neural network, 129
integration master theorem, 81 Newton optimization,
Monte Carlo, 299 math, 52 203
numerical, 215 matplotlib, 62 Newton optimizer
quadrature, 217 matrix multi-dimensional, 210
trapezoid, 215 addition, 164 Newton solver, 201
inversion method, 260 condition number, 173 multidimensional, 209
Ising model, 317 diagonal, 163 non-linear equations, 199
isoefficiency, 335 exponential, 175 NP, 138
Ito process, 305 identity, 163 NPC, 138
inversion, 169 nuclear reactor, 296
Jacobi, 189 multiplication, 165
Jacobian, 207 norm, 173 OpenCL, 356
Java, 24 positive definite, 176 operator overloading, 48
json, 55 subtraction, 164 optimization, 203
symmetric, 172 Options, 306
k-means, 124 transpose, 171 order, 245
k-tree, 100 MCEngine, 291 order or growth, 72
Kruskal, 106 mean, 233 os, 53
memoization, 86 [Link], 53
lambda, 46, 47 memoize_persistent, 88 [Link], 53
latency, 332 mergesort, 79
Levy distributions, 239 parallel, 342 P, 138
linear algebra, 159 mesh network, 328 parallel
linear approximation, 148 message passing, 338 scalar product, 341
linear equations, 172 Metropolis algorithm, parallel algorithms, 325
linear least squares, 182 314 parallel architectures, 326
linear transformation, MIMD, 326 partial derivative, 205
167 minimum residual, 195 path, 100
links, 100 minimum spanning tree, payoff, 312
list, 31 106 pickle, 55
list comprehension, 32 Modern Portfolio Theory, plot, 62
long, 26 178 point-to-point, 339
longest common subse- Monte Carlo, 283 pop, 90
quence, 115 mpi4py, 351 positive definite, 176
MPMD, 327 present value, 49
machine learning, 124 principal component
map-reduce, 352 namespace, 43 analysis, 192
Markov chain, 314 Needleman–Wunsch, 117 priority queue, 94, 96
378 annotated algorithms in python

probability, 229, 234 set, 36 systematic error, 144


probability density, 234 Shannon-Fano, 111 systems, 172
propagated data error, Sharpe ratio, 178
144 SIMD, 326 tangency portfolio, 178
protein folding, 320, 322 simulate annealing, 320 Taylor series, 151
PSim emulator, 330, 339 single-source shortest Taylor Theorem, 151
push, 90 paths, 110 technical analysis, 186
Python, 23 SISD, 326 time, 53, 54
smearing, 197 total error, 144
radioactive decay, 246 sort trading strategy, 186
radioactive decays, 296 countingsort, 93 tree network, 328
random, 51 heapsort, 94 trees, 94
random walk, 304 insertion, 72 try, 41
randomness, 245 merge, 79 tuple, 33
recurrence relations, 79 quicksort, 92 twos complement, 27
recursion, 79 sparse matrix, 194 type, 25
recv, 339 speedup, 333
reduce, 347 SPMD, 327
Unicode, 30
Regression, 182 sqlite, 56
urllib, 55
relative error, 158 stable problems, 141
UTF8, 30
resampling, 279 stack, 90
return, 43 standard deviation, 233
Runge–Kutta method, statistical error, 144 value at risk, 292
226 statistics, 229 variance, 233
stochastic process, 303 vertices, 100
scalar product, 165 stopping conditions, 158
scatter, 62, 345 str, 30 walk, 100
scope, 43 switch network, 328 well-posed problems, 141
secant method, 202, 204 sys, 53 while, 40
seed, 250 [Link], 53 Wiener process, 303
send, 339 worker, 352
Bibliography

[1] [Link]
[2] Travis Oliphant, “A Guide to NumPy”. Vol.1. USA: Trelgol Pub-
lishing (2006)
[3] [Link]
[4] Andreas Klöckner et al “Pycuda and pyopencl: A scripting-
based approach to gpu run-time code generation.” Parallel
Computing 38.3 (2012) pp 157-174
[5] [Link]
[6] [Link]
[7] [Link]
[8] [Link]
[9] [Link]
[10] [Link]
[11] [Link]
[12] Stefan Behnel et al., “Cython: The best of both worlds.” Com-
puting in Science & Engineering 13.2 (2011) pp 31-39
[13] Donald Knuth, “The Art of Computer Programming, Volume
3”, Addison-Wesley, (1997). ISBN 0-201-89685-0
[14] Thomas H. Cormen, Charles E. Leiserson, Ronald L. Rivest, and
380 annotated algorithms in python

Clifford Stein, “Introduction to Algorithms”, Second Edition.


MIT Press and McGraw-Hill (2001). ISBN 0-262-03293-7
[15] J.W.J. Williams, J. W. J. “Algorithm 232 - Heapsort”, Communi-
cations of the ACM 7 (6) (1964) pp 347–348
[16] E. F. Moore, “The shortest path through a maze”, in Proceedings
of the International Symposium on the Theory of Switching,
Harvard University Press (1959) pp 285–292
[17] Charles Pierre Trémaux (1859–1882) École Polytechnique of
Paris (1876). re-published in the Annals academic, March 2011
– ISSN: 0980-6032
[18] Joseph Kruskal, “On the Shortest Spanning Subtree of a Graph
and the Traveling Salesman Problem”, in Proceedings of the
American Mathematical Society, Vol.7, N.1 (1956) pp 48–50
[19] R. C. Prim, “Shortest connection networks and some generaliza-
tions” in Bell System Technical Journal, 36 (1957) pp 1389–1401
[20] M. Farach-Colton et al., “Mathematical Support for Molecular
Biology”, DIMACS: Series in Discrete Mathematics and Theo-
retical Computer Science (1999) Volume 47. ISBN:0-8218-0826-5
[21] B. Korber et al., “Timing the Ancestor of the HIV-1 Pandemic
Strains”, Science (9 Jun 2000) Vol.288 no.5472.
[22] E. W. Dijkstra, “A note on two problems in connexion
with graphs”. Numerische Mathematik 1, 269–271 (1959).
DOI:10.1007/BF01386390
[23] C. E. Shannon, “A Mathematical Theory of Communication”.
Bell System Technical Journal 27 (1948) pp 379–423
[24] R. M. Fano, “The transmission of information”, Technical Report
No. 65 MIT (1949)
[25] D. A. Huffman, “A Method for the Construction of Minimum-
Redundancy Codes”, Proceedings of the I.R.E., (1952) pp
1098–1102
bibliography 381

[26] Bergroth and H. Hakonen and T. Raita, “A Survey of Longest


Common Subsequence Algorithms”. SPIRE (IEEE Computer
Society) 39–48 (2000). DOI:10.1109/SPIRE.2000.878178. ISBN:0-
7695-0746-8
[27] Saul Needleman and Christian Wunsch, “A general method ap-
plicable to the search for similarities in the amino acid sequence
of two proteins”. Journal of Molecular Biology 48 (3) (1970) pp
443–53. DOI:10.1016/0022-2836(70)90057-4
[28] Tobias Dantzig, “Numbers: The Language of Science”, 1930.
[29] V. Estivill-Castro, “Why so many clustering algorithms”,
ACM SIGKDD Explorations Newsletter 4 (2002) pp 65.
DOI:10.1145/568574.568575
[30] J. J. Hopfield, “Neural networks and physical systems with
emergent collective computational abilities”, Proc. Natl. Acad.
Sci. USA Vol. 79 (1982) pp 2554-2558
[31] Nils Aall Barricelli, Nils Aall, “Symbiogenetic evolution pro-
cesses realized by artificial methods”, Methodos (1957) pp
143–182
[32] Michael Garey and David Johnson, “Computers and Intractabil-
ity: A Guide to the Theory of NP-Completeness”, San Francisco:
W. H. Freeman and Company (1979). ISBN:0-7167-1045-5
[33] Douglas R. Hofstadter, “Gödel, Escher, Bach: An Eternal Golden
Braid”, Basic Books (1979). ISBN:0-465-02656-7
[34] Harry Markowitz, “Foundations of portfolio theory”, The Jour-
nal of Finance 46.2 (2012) pp 469-477
[35] P. E. Greenwood and M. S. Nikulin, “A guide to chi-squared
testing”. Wiley, New York (1996). ISBN:0-471-55779-X
[36] Andrew Lo and Jasmina Hasanhodzic, “The Evolution of
Technical Analysis: Financial Prediction from Babylonian
Tablets to Bloomberg Terminals”, Bloomberg Press (2010).
ISBN:1576603490
382 annotated algorithms in python

[37] Y. Saad and M.H. Schultz, “GMRES: A generalized minimal


residual algorithm for solving nonsymmetric linear systems”,
SIAM J. Sci. Stat. Comput. 7 (1986). DOI:10.1137/0907058
[38] H. A. Van der Vorst, “Bi-CGSTAB: A Fast and Smoothly Con-
verging Variant of Bi-CG for the Solution of Nonsymmetric Lin-
ear Systems”. SIAM J. Sci. and Stat. Comput. 13 (2) (1992) pp
631–644. DOI:10.1137/0913035
[39] Richard Burden and Douglas Faires, “2.1 The Bisection Algo-
rithm”, Numerical Analysis (3rd ed.), PWS Publishers (1985).
ISBN:0-87150-857-5
[40] Michiel Hazewinkel, “Newton method”, Encyclopedia of Math-
ematics, Springer (2001). ISBN:978-1-55608-010-4
[41] Mordecai Avriel and Douglas Wilde, “Optimality proof for the
symmetric Fibonacci search technique”, Fibonacci Quarterly 4
(1966) pp 265–269 MR:0208812
[42] Loukas Grafakos, “Classical and Modern Fourier Analysis”,
Prentice-Hall (2004). ISBN:0-13-035399-X
[43] S.D. Poisson, “Probabilité des jugements en matière criminelle
et en matière civile, précédées des règles générales du calcul des
probabilitiés”, Bachelier (1837)
[44] A. W. Van der Vaart, “Asymptotic statistics”, Cambridge Uni-
versity Press (1998). ISBN:978-0-521-49603-2
[45] Jonah Lehrer, “How We Decide”, Houghton Mifflin Harcourt
(2009). ISBN:978-0-618-62011-1
[46] Edward N. Lorenz, “Deterministic non-periodic flow”. Jour-
nal of the Atmospheric Sciences 20 (2) (1963) pp 130–141.
DOI:10.1175/1520-0469
[47] Ian Hacking, “19th-century Cracks in the Concept of Determin-
ism”, Journal of the History of Ideas, 44 (3) (1983) pp 455-475
JSTOR:2709176
bibliography 383

[48] F. Cannizzaro, G. Greco, S. Rizzo, E. Sinagra, “Results of the


measurements carried out in order to verify the validity of the
poisson-exponential distribution in radioactive decay events”.
The International Journal of Applied Radiation and Isotopes 29
(11) (1978) pp 649. DOI:10.1016/0020-708X(78)90101-1
[49] Yuval Perez, “Iterating Von Neumann"s Procedure for Extract-
ing Random Bits”. The Annals of Statistics 20 (1) (1992) pp
590–597
[50] Martin Luescher, “A Portable High-Quality Random Number
Generator for Lattice Field Theory Simulations”, Comput. Phys.
Commun. 79 (1994) pp 100-110
[51] [Link]
PoorStatisticalQualitiesForTheRANDURandomNumberGenerator

[52] G. S. Fishman, “Grouping observations in digital simulation”,


Management Science 24 (1978) pp 510-521
[53] P. Good, “Introduction to Statistics Through Resampling Meth-
ods and R/S-PLUS”, Wiley (2005). ISBN:0-471-71575-1
[54] J. Shao and D. Tu, “The Jackknife and Bootstrap”, Springer-
Verlag (1995)
[55] Paul Wilmott, “Paul Wilmott Introduces Quantitative Finance”,
Wiley 92005). ISBN:978-0-470-31958-1
[56] [Link]
pubs/[Link]
[57] S. M. Ross, “Stochastic Processes”, Wiley (1995). ISBN:978-0-471-
12062-9
[58] Révész Pal, “Random walk in random and non random envi-
ronments”, World Scientific (1990)
[59] A.A. Markov. “Extension of the limit theorems of probability
theory to a sum of variables connected in a chain”. reprinted
in Appendix B of R. Howard. “Dynamic Probabilistic Systems”,
384 annotated algorithms in python

Vol.1, John Wiley and Sons (1971)


[60] W. Vervaat, “A relation between Brownian bridge and Brownian
excursion”. Ann. Prob. 7 (1) (1979) pp 143–149 JSTOR:2242845
[61] Kiyoshi Ito, “On stochastic differential equations”, Memoirs,
American Mathematical Society 4, 1–51 (1951)
[62] Steven Shreve, “Stochastic Calculus for Finance II: Continuous
Time Models”, Springer (2008) pp 114. ISBN:978-0-387-40101-0
[63] Sorin Istrail and Fumei Lam, “Combinatorial Algorithms for
Protein Folding in Lattice Models: A Survey of Mathematical
Results” (2009)
[64] Michael Flynn, “Some Computer Organizations and Their Ef-
fectiveness”. IEEE Trans. Comput. C–21 (9) (1972) pp 948–960.
DOI:10.1109/TC.1972.5009071
[65] Gene Amdahl, “Validity of the Single Processor Approach to
Achieving Large-Scale Computing Capabilities”, AFIPS Confer-
ence Proceedings (30) (1967) pp 483–485
[66] [Link]
[67] Jeffrey Dean and Sanjay Ghemawat. 2008. MapReduce: sim-
plified data processing on large clusters. Commun. ACM
51, 1 (January 2008), 107-113. DOI=10.1145/1327452.1327492
[Link]
[68] [Link]
[69] Erik Lindholm et al., “NVIDIA Tesla: A unified graphics and
computing architecture.” Micro, IEEE 28.2 (2008) pp 39-55.
[70] Aaftab Munshi, “OpenCL: Parallel Computing on the GPU and
CPU.” SIGGRAPH, Tutorial (2008).
[71] [Link]

You might also like