17-04-2026

6201CMD30303125RPT14 MD

PHYSICS

1) A thin copper wire of length ℓ metre increases in length by 2% when heated through 10°C. What
is percentage increase in area when a square copper sheet of length ℓ metre is heated through 10°C
:

(1) 2%
(2) 4%
(3) 8%
(4) 10%

2) A body is moved along a straight line by a machine delivering constant power. The distance
moved by the body in time t is proportional to:

(1) t1/2
(2) t3/4
(3) t3/2
(4) t2

3) 1 kg apple gives 25 kJ energy to a monkey. How much height he can climb by using this energy if
its efficiency is 40%. (Mass of monkey = 25kg and g = 10 m/s2)

(1) 20m
(2) 4m
(3) 30m
(4) 40m

4) Collision between two objects is perfectly inelastic & mass of each block is 2 Kg. Then loss in

kinetic energy of system will be.

(1) 325 J
(2) 350 J
(3) 450 J
(4) 50 J

5) A particle attached to a string as shown in figure performs vertical circular motion. Match
column-1 with column-2.

Column-1 Column-2

(A) (P) Body will move on arc

Body will complete the

(B) (Q)
circle

Body will move on

(C) (R)
semicircle
(1) A → P, B → Q, C → R
(2) A → R, B → Q, C → Q
(3) A → Q, B → R, C → P
(4) A → P, B → R, C → Q

6) A ball of mass (m) 0.5 kg is attached to the end of a string having length (L) 0.5 m. The ball is
rotated on a horizontal circular path about vertical axis. The maximum tension that the string can
bear is 324 N. The maximum possible value of angular velocity of ball (in radian/s) is :-

(1) 9
(2) 18
(3) 27
(4) 36

7) A particle executing SHM is represented by y = a sin (πt). At what time (in second) does its kinetic
energy equal to its potential energy :-

(1) 0.1
(2) 0.2
(3) 0.25
(4) 0.3

8) A mass m is suspended separately by two different springe of K1 and K2 gives the time period t1
and t2 respectively. If same mass m is connected by both spring connected in parallel then new time
period t is given by relation. :-

(1) t = t1 + t2
(2)

(3)
(4)

9) The frequency of a turning fork A is 2% more than the frequency of a standard turning fork. The
frequency of another fork B is 3% less than the frequency of a standard turning fork. If 6 beat/s are
heard when the two turning forks A and B are excited, the frequency A is :

(1) 120 Hz
(2) 122.4 Hz
(3) 116.4 Hz
(4) 130 Hz

10) A student measures the diameter of a wire using screw gauge with pitch 0.5 mm and total 50
divisions on its circular scale. The main scale reading is 3.0 mm and 24th circular scale coincides
with reference line. He then measured length of wire using vernier caliper of least count 0.1 mm,
with main scale reading 6 cm and coinciding VSD is 7th. From above data the estimated volume of
wire upto correct number of significant figures is (Assume no zero error).

(1) 0.500 cm3

(2) 0.900 cm3
(3) 3.24 cm3
(4) 3.6 cm3

11) A uniform metre scale of mass 60 g is pivoted on edge of knife at 48 cm. A 30 g mass is
suspended at 20 cm and 50 g mass at 80 cm. The position where a 40 g mass should be placed so as
to balance the scale is :-

(1) 12 cm
(2) 26 cm
(3) 36 cm
(4) 56 cm

12) In a resonance tube, at temperature of 20°C, first resonance occurred at 25 cm length of air
column. The new resonance length (in cm) at 50°C is nearly : (Assume variation of speed of sound v
with temperature t as v = 331 + 0.6t)

(1) 26
(2) 27
(3) 30
(4) 32

13) If a body A of mass 1kg is thrown with u at angle 30° to the horizontal and another body B of
mass 2kg is thrown with the same speed at an angle of 60° to the horizontal, then
(1)

(2)

(3)

(4) All of these

14) Three slabs of equal area and thickness are arranged as shown in the figure. Find the value of T1

and T2 in steady state :-

(1) 68°C & 52°C

(2) 62°C & 58°C
(3) 60°C & 50°C
(4) 50°C & 30°C

15) One mole of an ideal gas at temperature T1 expands slowly according to the law P/V = constant.
Its final temperature is T2. The work done by the gas is:-

(1) R(T2 – T1)

(2) 2R(T2 – T1)

(3)

(4)

16) In the two systems as shown, what should be the value of mass M so that expansions in the two

springs is same?

(1)

(2)
(3)

(4)

17) Which of the pairs of have different dimensional formula :

(1) Work and Torque

(2) Angular momentum and Planck's constant
(3) Tension and surface tension
(4) Angle and refractive index

18) A ceiling fan is rotating about its own axis with uniform angular velocity ω. The electric current

is switched off then due to constant opposing torque its angular velocity is reduced to as it
completes 40 rotations. The number of rotations further it makes before coming to rest is :-

(1) 10
(2) 20
(3) 5
(4) 15

19) Two bodies of mass 100 kg and 104 kg are lying one meter apart. At what distance from 100 kg
body will the intensity of gravitational field be zero ?

(1)

(2)

(3)

(4)

20) A soap bubble in vacuum has a radius of 12 cm and another soap bubble in vacuum has a radius
of 5 cm. If the two bubbles coalesce to form a single bubble under isothermal conditions, then the
radius of the new bubble is :

(1) 17 cm
(2) 15 cm
(3) 13 cm
(4) 11 cm

21) If two soap bubbles of different radii are connected by a tube :

(1) Air flows from bigger bubble to smaller bubble till the sizes become equal.
(2) Air flows from bigger bubble to smaller bubble till the sizes are interchanged.
(3) Air flows from smaller bubble to bigger.
(4) There is no flow of air

22) A cylinder of fixed capacity 44.8 litre constains monatomic gas at standard temperature and
pressure. The amount of heat required to raise temperature of cylinder by 10°C will be –

(1) R
(2) 10 R
(3) 20 R
(4) 30 R

23) When heat energy of 1500 J is supplied to a gas the external work done by the gas is 525 J. What
is the increase in its internal energy.

(1) 875 J
(2) 975 J
(3) 1075 J
(4) 1175 J

24) Coefficient of linear expansion of Metallic wire of simple pendulum based clock is α = 10–4/°C.
This clock is calibrated at 30°C temperature and it is used at 50°C temperature. Then fractional
change in time period will be

(1) 0.01
(2) 0.001
(3) 0.003
(4) 0.02

25) ABC is equilateral triangle of side 2m. If E = 10 N/C then VA – VB is-

(1) 10V
(2) –10V
(3) 20V
(4) –20V

26) A soap bubble is charged to a potential of 16V. Its radius is then doubled. The potential of bubble
now will be :-

(1) 16V
(2) 8V
(3) 4V
(4) 2V
27) Value of resistance R in the figure is –

(1) 6Ω
(2) 8Ω
(3) 10Ω
(4) 12Ω

28) In the meter bridge, the balancing length AB = 20 cm. The unknown resistance x is equal to –

(1) 0.25 Ω
(2) 0.8 Ω
(3) 0.2 Ω
(4) 0.16 Ω

29) If two bulbs, whose resistances are in the ratio of 1 : 2 are connected in series, the power
dissipated in them has the ratio of –

(1) 2 : 1
(2) 1 : 4
(3) 1 : 1
(4) 1 : 2

30) The output power in a real step-up transformer is :-

(1) greater than the input power.

(2) equal to the input power.
(3) maintained even during the power cut.
(4) less than the input power.

31) Find out the thickness of the slab such that light ray retrace its path after reflection from mirror
of radius of curvature 40 cm ?

(1) 6 cm
(2) 3 cm
(3) 2 cm
(4) 1 cm

32) A beam of light of λ = 600 nm from a distant source falls on a single slit 1mm wide and the
resulting diffraction pattern is observed on a screen 2m away. The distance between first dark and
central bright fringe is :-

(1) 1.2 cm
(2) 1.2 mm
(3) 2.4 cm
(4) 2.4 mm

33) If the energy of a particle is reduced to one forth, then the percentage increases in its De-Broglie
wavelength will be :-

(1) 41%
(2) 141%
(3) 100%
(4) 71%

34) If in a p–n junction, a square signal of peak to peak voltage 10 V is applied, as shown.

then the output across RL will be :-

(1)

(2)
(3)

(4)

35) Light of two different frequencies whose photons have energies 2.5eV and 8.5eV respectively
illuminate a metallic surface whose work function is 1eV successively. Ratio of maximum speed of
emitted electrons will be :-

(1) 1 : 4
(2)
(3)
(4)

36) A particle of mass 2 kg in projected with an initial velocity 10 m/s at an angle of projection 30°
with the horizontal. The average torque acting on the projectile between the time at which it is
projected and the time at which it strikes the ground about the point of projection (in N-m) is :-

(1)
(2)
(3)
(4) None

37) A uniform metre scale of mass 1kg is placed on table such that a part of the scale is beyond the
edge. If a body of mass 0.25 kg is hung at the end of the scale then the minimum length of scale that
should lie on the table so that it does not tilt is :-

(1) 20 cm
(2) 40 cm
(3) 60 cm
(4) None

38) When one mole of monatomic gas is mixed with one mole of a another gas x, then the equivalent

value of γ for the mixture is , neglecting vibrational mode. The number of degrees of freedom for
the gas x is :

(1) 3
(2) 6
(3) 5
(4) 7

39) A slab of material of dielectric constant k has the same area A as the plates of a parallel plate

capacitor, and has thickness , where d is the separation between the plates. The capacitance
when the slab is inserted between the plates is-

(1)

(2)

(3)

(4)

40) Two bar magnets of same length and cross sectional area but having magnetic moments of M &
3M are joined with like poles together and suspended by a string. The time of oscillation of this
assembly in magnetic field of strength B is 9 sec. Then the time period of oscillation, if the polarity of
one of the magnets is changed and the combination is again made to oscillate in the same field is :

(1) 9 sec
(2) 4.5 sec
(3) 9 sec

(4)
sec

41) An inductor of 5 H inductance carries a current of 2A, to prevent sparking when the circuit is
broke capacitor of 10 μF is connected across inductor. The voltage rating of capacitor is -

(1) 1414 V
(2) 4040 V
(3) 14.14 V
(4) 40.40 V

42) If the electric field associated with a radiation of frequency 10 MHz is E = 10 sin(kx –ωt) ,
then its energy density is _____Jm–3.
[ε0 = 8.85 × 10–12 C2N–1m–2]

(1) 4.425 × 10–16

(2) 6.26 × 10–14
(3) 8.85 × 10–16
(4) 8.85 × 10–14

43) A real image is formed by a concave mirror is 4.5 times the size of the object If the mirror is 20
cm from the object its focal length is :-

(1)

(2)
(3)

(4)

44) In a double slit experiment the two slits are 1mm apart and the screen is placed 1m away. A
monochromatic light of wavelength 500 nm is used. Find out distance between third bright and fifth
dark fringe :-

(1) 0.50 mm
(2) 7.5 mm
(3) 0.75 mm
(4) 1.5 mm

45) For a closed organ pipe, match the entries of column I with the entries of coloum II.

Column-I Column-II
Third overtone
frequency is x times
(A) t h e f u n d a m e n t a l (P) 3
frequency. Here x is
equal to
Number of nodes in
(B) (Q) 4
second overtone
Number of antinodes
(C) (R) 5
in second overtone
(S) None
(1) A → S, B → P, C → P
(2) A → R, B → P, C → Q
(3) A → P, B → R, C → Q
(4) A → R, B → P, C → P

CHEMISTRY

1) How much energy would be required by an electron which is moving from ground state to Ist
excited state of Li+2 ion :-

(1) 40.8 eV
(2) 10.2 eV
(3) 51 eV
(4) 91.8 eV

2) An electron in ground state of hydrogen atom absorbs energy equal to ionisation energy of Li+2
ion. The wavelength of emitted electron is:-

(1) 5.08 A°
(2) 1.17 A°
(3) 4.33 nm
(4) 13.51 A°

3) N2 and H2 are taken as 1 : 3 molar ratio in a closed vessel to attained the following equilibrium
N2(g) + 3H2(g) ⇌ 2NH3(g)
Find KP for reaction, if total pressure at equilibrium is 2P and is P/3 :-

(1)

(2)

(3)

(4) None of these

4) Calculate the pH of 4 × 10–3 M, Y(OH)2 solution assuming the first dissociation to be 100% and
second dissociation to be 50% :-

(1) 11.78
(2) 9.9
(3) 2.5
(4) 2.22

5)

Kw of water is 1 × 10–12 at 363 K. Which of the following statements is incorrect about pure water ?

(1) pKw of water is 12.

(2) pH of water is 6
(3) water is neutral at 90°C
(4) water is acidic at 90°C

6) What is the equivalent mass of As2S3 in the following reaction : (Molar mass of As2S3 = M)
As2S3 + NO3– + H+ → As2O5 + NO2– + SO3 + H2O

(1) M/4
(2) M/24
(3) M/28
(4) M/12

7) The difference between heats of reaction at constant pressure and at constant volume for the
reaction 2C6H6(l) + 15O2(g) → 12CO2(g) + 6H2O(l) at 25°C in kJ is :-

(1) +7.43
(2) +3.72
(3) –7.43
(4) –3.72
8) Assertion : C2 is paramagnetic.
Reason : Last electron filled in A.B.M.O.

(1) Both Assertion & Reason are True & the Reason is a correct explanation of the Assertion.
(2) Both Assertion & Reason are True but Reason is not a correct explanation of the Assertion.
(3) Assertion is True but the Reason is False.
(4) Both Assertion & Reason are false.

9) How many of the following molecules having unequal bond length:

PCl5, IF7, XeF4, SF4, CℓF3, XeF2, CH4, ,

(1) 5
(2) 4
(3) 6
(4) 1

10) Correct order of bond energy will be-

(1) F2 > Cl2 > Br2 > I2

(2) Cl2 > F2 > Br2 > I2
(3) Cl2 > Br2 > F2 > I2
(4) I2 > Br2 > Cl2 > F2

11) The correct electronic configuration of element having Atomic number 46 ?

(1) [Kr] 5s24d8

(2) [Kr] 5s14d9
0
(3) [Kr] 5s 4d10
(4) [Kr] 5s14d10

12) Which of the following can react with NaOH ?

(1) CO
(2) CaO
(3) BeO
(4) KOH

13) In carius method of estimation of halogen 0.15g of an organic compound gave 0. 12g of AgBr.
Find out the percentage of bromine in the compound :-

(1) 34.04%
(2) 58.20%
(3) 9.24 %
(4) 0.12 %

14) Match the following homologous pair :-

 Column-I Column-II

(A) CH3CH2NHCH2CH3 (P) CH3CH2NHCH3

(B) (Q)

(C) (R)

(D) (S)

(1) (P)-(A), (Q)-(B), (R)-(D), (S)-(C)

(2) (P)-(C), (Q)-(D), (R)-(B), (S)-(A)
(3) (P)-(A), (Q)-(D), (R)-(B), (S)-(C)
(4) (P)-(C), (Q)-(B), (R)-(D), (S)-(A)

15) Match List I with List II

List I List II
Colour imparted to
Elements
the flame
A K I Brick Red
B Ca II Violet
C Sr III Apple Green
D Ba IV Crimson Red
Choose the correct answer from the options given below:
(1) A-II, B-I, C-III, D-IV
(2) A-II, B-IV, C-I, D-III
(3) A-II, B-I, C-IV, D-III
(4) A-IV, B-III, C-II, D-I

16) The logarithm of equilibrium constant (log k) for the reaction is

;
;

(1) 6
(2) 5
(3) 4
(4) 3

17)
The rate constants of the above reaction at 200 K and 300K are 0.03 min–1 and 0.05 min–1
respectively. The activation energy for the reaction is (approx)
(Given : ℓn 10 = 2.3
R = 8.3 J K–1 mol–1
log5 = 0.70
log3=0.48
log2 = 0.30

(1) 1260 J
(2) 2520 J
(3) 5040 J
(4) 2020 J

18) The resistivity of a 0.8 M solution of an electrolyte is 5 × 10–3 Ωcm. Its molar conductivity is
.............. × 104 Ω–1 cm2 mol–1.

(1) 21
(2) 19
(3) 25
(4) 28

19) A sample of a metal oxide has formula M0.83O1.00. The metal M can exist in two oxidation states +2
and +3. In the sample of M0.83O1.00, the percentage of metal ions existing in +2 oxidation state is :

(1) 21%
(2) 49%
(3) 59%
(4) 28%

20) Given below are two statements, one is labelled as Assertion A and the other is labelled as
Reason R.
Assertion A : Benzene is more stable than hypothetical cyclohexatriene.
Reason R : The delocalized π electron cloud is attracted more strongly by nuclei of carbon atoms.
In the light of the above statements, choose the correct answer from the options given below:

(1) A is true but R is false.

(2) A is false but R is true.
(3) Both A and R are correct and R is the correct explanation of A.
(4) Both A and R are correct but R is NOT the correct explanation of A.

21)
In the above reaction 'X' is :
(1)

(2)

(3)

(4)

22) The complex cation which has two isomers is :

3+
(1) [Co(H2O)6]
2+
(2) [Co(NH3)5Cl]
2+
(3) [Co(NH3)5NO2]
+
(4) [Co(NH3)5Cl]

23) Compound that will give positive Lassaigne’s test for both nitrogen and halogen is

(1) [Link]
(2) CH3NH2. HCl
(3) NH4Cl
(4) [Link]

24) Reaction of propanamide with Br2 / KOH (aq) produces :

(1) Ethylnitrile
(2) Propylamine
(3) Propanenitrile
(4) Ethylamine

25) The number of correct statement/s from the following is _______.

A. Larger the activation energy, smaller is the value of the rate constant.
B. The higher is the activation energy, higher is the value of the temperature coefficient.
C. Activation energy may be greater then threshold energy.

D. A plot of ln k vs is a straight line with slope equal to

(1) 2
(2) 1
(3) 3
(4) 4

26) Which will undergo deprotonation most readily in basic medium?

(1) a only
(2) c only
(3) Both a and c
(4) b only

27) Identify the incorrect option from the following:

(1)

(2)

(3)

(4)

28) Match List I and List II

List I List II

Test Functional group / Class of Compound

A. Neutral FeCl3 test I. Alcohol

 B. Lucas test II. Phenol

C. Carbylamine Test III. Primary amine

D. Schiff's Test IV. Aldehyde

Choose the correct answer from the options given below:

(1) (A) – I, (B) – II, (C) – III, (D) – IV
(2) (A) – III, (B) – IV, (C) –I, (D) – II
(3) (A) – II, (B) – I, (C) – III, (D) – IV
(4) (A) – III, (B) – IV, (C) –II, (D) – I

29) In a reaction,

reagents ‘X’ and ‘Y’ respectively are :

(1) (CH3CO)2O/H and CH3OH/H , Δ

+ +

+ +
(2) (CH3CO)2O/H and (CH3CO)2O/H
(3) CH3OH/H , Δ and CH3OH/H , Δ
+ +

(4) CH3OH/H Δ and (CH3CO)2O/H

+ +

30)

The set of correct statements is:

(i) Manganese exhibits +7 oxidation state in its oxide.
(ii) Ruthenium and Osmium exhibit +8 oxidation state in their oxides.
(iii) Sc state shows +4 oxidation state which is oxidizing in nature.
(iv) Cr shows oxidising nature in +6 oxidation state.

(1) (ii) and (iii)

(2) (i), (ii) and (iv)
(3) (i) and (iii)
(4) (ii), (iii) and (iv)

31) 0.5 molal aqueous solution of a weak acid (HX) is 20% ionized. If Kf for water is 1.86 K kg mol–1,
the lowering in freezing point of the solution is :-

(1) –0.56 K
(2) –1.12 K
(3) 0.56 K
(4) 1.12 K

32) On heating a mixture of NaCl, K2Cr2O7 and conc. H2SO4 which of the following is formed :-
(1) CrCl3
(2) CrO2Cl2
(3) Cl2
(4) NaClO2

33) The amount of heat evolved when 0.50 mole of HCl is mixed with 0.30 mole of NaOH solution is

(1) 57.1 kJ
(2) 28.55 kJ
(3) 11.42 kJ
(4) 17.13 kJ

34) Product

(1)

(2)

(3)

(4)

35)
Number of organic products. (including stereoisomers)

(1) 2
(2) 6
(3) 5
(4) 8
36)
Compound X will be :-

(1)

(2)

(3)

(4)

37) 1 mol CoCl3.5NH3 on reaction with excess AgNO3(aq) gives

(1) 1 mol AgCl

(2) 2 mol AgCl
(3) 3 mol AgCl
(4) 0.5 mol AgCl

38) Paramagnetic complex is ion among the following

3+
(1) [Sc(H2O)6]
4–
(2) [Fe(CN)6]
3–
(3) [Co(C2O4)3]
3-
(4) [Mn(CN)6]

39) Which of the following is strong acid

(1)
(2)

(3)

(4)

40) Assertion A:- Thin layer chromatography is an adsorption chromatography.

Reason R:- A thin layer of silica gel is spread over a glass plate of suitable size in thin layer
chromatography which acts as an adsorbent

(1) Both A and R are true and R is the correct explanation of A

(2) Both A and R are true but R is not the correct explanation of A
(3) A is true but R is false
(4) A is false but R is true

41)
Product of the given reaction is

(1)
(2)

(3)

(4)

42) Cyclohexylamine when treated with nitrous acid yields (P). On treating (P) with PCC results in
(Q). When (Q) is heated with dil. NaOH we get (R) The final product (R) is :

(1)

(2)

(3)

(4)

43) Which of the following is reducing sugar?

(1) Fructose
(2) Maltose
(3) Lactose
(4) All of above

44) D-Glucose product, product is :-

(1) D-Gluconic acid

(2) D-Glucitol
(3) D-Fructose
(4) D-Saccharic acid

45)

Select the correct order of IP :-

(1) Ne+ < Ne

(2) Be+ < Be
(3) N–3 > N
(4) Cu+ < Cu+2

BOTANY

1) Chrysophytes are ____(A)____ and float ____(B)____ in water current.

(1) A = Microscopic, B = Actively

(2) A = Macroscopic, B = Actively
(3) A = Microscopic, B = Passively
(4) A = Macroscopic, B = Passively

2) Select the incorrect statement about viroids :-

(1) Viroids are free RNA infectious agents

(2) It cause potato spindle tuber disease
(3) It is smaller than virus
(4) The RNA of the viroids have high molecular weight

3) Which of the following is not correctly matched ?

(1) Ascomycetes - Sac fungi

(2) Neurospora - Drosophila of plant kingdom
(3) Yeast - Baking industry
(4) Rhizopus - Ascomycetes

4) Multicellular female gametophyte (endosperm) in gymnosperm is developed from :-

(1) One functional megaspore

(2) Two megaspores
(3) Three megaspores
(4) Four megaspores

5) Pyrenoids contain :-

(1) Starch in the centre protein around it

(2) Protein in the centre lipid around it
(3) Protein in the centre starch around it
(4) Lipid in the centre starch around it

6) Which of the following is example of hypogynous flower?

(1) Mustard
(2) Plum
(3) Cucumber
(4) Ray florets of sunflower

7) Find the correctly matched pairs and choose the correct option:-

(A) Leptotene The chromosomes become invisible

(B) Zygotene Pairing of homologous chromosomes

Dissolution of the synaptonemal

(C) Pachytene
complex takes place

Bivalent chromosomes appear as

(D) Diplotene
tetrads

(E) Diakinesis Terminalization of chiasmata

(1) A and B
(2) A and D
(3) B and E
(4) B and C

8) Recombination occurs between:-

(1) Sister chromatid of non-homologous chromosome.

(2) Non-sister chromatid of non-homologous chromosome.
(3) Sister chromatid of homologous chromosome.
(4) Non-sister chromatid of homologous chromosomes.

9) Consider the following four statements (a-d) and select the option which includes all the correct
ones only.
(a) Most of the plants like water hyacinth is pollinated by water
(b) Not all aquatic plants use water for pollination.
(c) Vallisneria flowers are pollinated by water under the water surface.
(d) Water lily are pollinated by insects. Option:
(1) Statements (b), (c) and (d).
(2) Statements (b) and (d).
(3) Statements (a), (c) and (d).
(4) Statements (a) and (c).

10) According to fluid-mosaic model, the quasi-fluid nature of ______ enables lateral movement of
______ within the overall bilayer. This ability to move within the membrane is measured as its ______
:-
(i) Carbohydrates
(ii) Lipids
(iii) Proteins
(iv) Fluidity
(v) Selective permeability
Correct sequence is :-

(1) ii, iii, iv

(2) iii, i, iv
(3) iii, ii, v
(4) i, ii, iv

11) Assertion : Current availability of CO2 levels is limiting to the C3 plants.

Reason : 18 ATP & 12 NADPH are required for formation of one glucose molecule in Calvin cycle.

(1) Both Assertion & Reason are True & the Reason is a correct explanation of the Assertion.
(2) Both Assertion & Reason are True but Reason is not a correct explanation of the Assertion.
(3) Assertion is True but the Reason is False.
(4) Both Assertion & Reason are False.

12) Given below are two statements :

Statement-I :- ATP synthesis is linked to development of a proton gradient across a membrane.
Statement-II :- Splitting of water molecule take place in stroma.
In the light of the above statement choose the most appropriate answer from the option given below
:

(1) Both statement I and statement II are correct

(2) Both statement I and statement II are incorrect
(3) Statement I is correct but statement II is incorrect
(4) Statement I is incorrect but statement II is correct

13) Which of the following is the result of dedifferentiation ?

(1) Epidermis
(2) Cortex
(3) Cork cambium
(4) Pith

14) Find out incorrect statement with respect to Kreb's cycle.

(1) During the conversion of succinyl Co-A to succinic acid, a molecule of GTP is synthesized.
(2) There are three points in the cycle where NAD+ is reduced to NADH + H+
(3) Succinyl Co-A is oxidised to OAA allowing the cycle to continue.
The continued oxidation of acetyl Co-A via the TCA cycle requires the continued replenishment
(4)
of citric acid, the first member of the cycle.

15) Given below are two statements: one is labelled as Assertion (A) and the other is labelled as
Reason (R).
Assertion (A) : Mendel's law of Independent assortment does not hold good for the genes that are
located closely on the same chromosome.
Reason (R) : Closely located genes assort independently.
In the light of the above statements, choose the correct answer from the options given below :

(1) Both (A) and (R) are correct but (R) is not the correct explanation of (A)
(2) (A) is correct but (R) is not correct
(3) (A) is not correct but (R) is correct
(4) Both (A) and (R) are correct and (R) is the correct explanation of (A)

16)

Which of the following mRNA starnd can be synthesised from given template ?
3'TACATGGCAAATATCCATTCA5'

(1) 5'AUGUACCGUUUAUAGGUAAGU3'
(2) 5'AUGUAAAGUUUAUAGGUAAGU3'
(3) 5'AUGUACCGUUUAUAGGGAAGU3'
(4) 5'ATGTACCGTTTATAGGTAAGT3'

17) Ten [Link] cells with 15N - dsDNA are incubated in medium containing 14N nucleotide. After 60
minutes, how many [Link] cells will have DNA totally free from 15N ?

(1) 40 cells
(2) 60 cells
(3) 80 cells
(4) 20 cells

18)

The equation of Verhulst-Pearl logistic growth is From this equation, K indicates :

(1) Intrinsic rate of natural increase

(2) Biotic potential
(3) Carrying capacity
(4) Population density

19) Match List I with List II.

 List I List II
(Interacting (Name of
species) Interaction)

A Leopard and a Lion

A. I. Competition
in a forest/grassland

A Cuckoo laying egg

B. II. Brood parasitism
in a Crow's nest

Fungi and root of a

C. higher plant III. Mutualism
in Mycorrhizae

A cattle egret and a

D. IV. Commensalism
Cattle in a field

Choose the correct answer from the options given below :

(1) A-I, B-II, C-IV, D-III
(2) A-III, B-IV, C-I, D-II
(3) A-II, B-III, C-I, D-IV
(4) A-I, B-II, C-III, D-IV

20) If '8' Drosophila in a laboratory population of '80' died during a week, the death rate in the
population is _________ individuals per Drosophila per week.

(1) 10
(2) 1.0
(3) zero
(4) 0.1

21) Alexander Von Humbolt described for the first time:

(1) Laws of limiting factor

(2) Species area relationships
(3) Population Growth equation
(4) Ecological Biodiversity

22) Winged pollen grains are present in

(1) Mustard
(2) Cycas
(3) Mango
(4) Pinus

23) Assertion (A): Human genome project was called mega project.
Reason (R): Human genome project was coordinated by the US Department of energy and the
National Institute of Health.

(1) Both A & R are correct. R is the explanation to A

(2) Both A & R are correct, but R doesn’t explains A
(3) A is true, R is false
(4) Both the statements are incorrect

24) Both epipetalous condition and axile placentation are together present in which family.

(1) Brassicaceae
(2) Solanaceae
(3) Fabaceae
(4) Liliaceae

25) Which of the following is heterosporous and has unbranched stem ?

(1)

(2)

(3)
(4)

26) Cell wall is not a common feature of :-

(1) Diatoms
(2) Gonyaulax
(3) Euglena
(4) Albugo

27) If N = 100, b = 0.5 and d = 0.3, find dN/dt ?

(1) 20
(2) 30
(3) 50
(4) 40

28) Viruses grown in the presence of radioactive phosphorus contained radioactive ..."A"... while
viruses grown on radioactive sulfur contained radioactive ..."B"...
Choose the correct word for "A" and "B"

"A" "B"

(1) DNA Protein

(2) Protein DNA

(3) Carbohydrate Protein

(4) RNA Carbohydrate

(1) 1
(2) 2
(3) 3
(4) 4

29) What will be ploidy of the cells of nucellus, megaspore mother cell, functional megaspore and
embryosac respectively

(1) n, 2n, 3n, 4n

(2) n, 3n, 4n, 2n
(3) 2n, 2n, n, n
(4) 3n, 4n, 2n, n

30) Match the column-I with column-II and give the correct answer from the given options :
 Column-I Column-II

(i) Perigynous flower (a) Liliaceae ; monocot family

(ii) Trimerous flower (b) Calotropis, Mustard, Chilli

(iii) Valvate aestivation (c) Plum, Peach, Rose

Marginal
(iv) (d) Pea, Bean, Gram
placentation
(1) i-a, ii-b, iii-c, iv-d
(2) i-c, ii-a, iii-b, iv-d
(3) i-a, ii-c, iii-b, iv-d
(4) i-c, ii-a, iii-d, iv-b

31)

Match column-I, column-II and column-III and select the correct option.

Column-I Column-II Column-III

(i) Consist
(I) Golgibodies of RNA
and protein
(A)

(II) Cilia / (ii) Power

Flagella house of the cell
(B)

(iii) Site of
(III) Mitochondria formation
of glycolipid & glycoprotein
(C)

(iv) Hair like

outgrowth
(IV) Ribosome
of the cell
membrane

(D)
(1) A-III-(i), B-IV-(ii), C-II-(iii), D-I-(iv)
(2) A-IV-(i), B-III-(ii), C-II-(iii), D-I-(iv)
(3) A-III-(ii), B-IV-(i), C-II-(iii), D-I-(iv)
(4) A-III-(ii), B-IV-(i), C-II-(iv), D-I-(iii)

32) L.S. of a Maize grain is given below. Identify labelled structures [A] & [B] :-
(1) [A] Embryo , [B] Scutellum
(2) [A] Scutellum , [B] Embryo
(3) [A] Endosperm, [B] Scutellum
(4) [A] Scutellum , [B] Endosperm

33) In an angiosperm, how many microspore mother cells are required to produce 80 male gamete ?

(1) 10
(2) 20
(3) 25
(4) 50

34) Match the following columns.

Column-I Column-II
A. F Miescher i. DNA double helix
B. Griffith ii. Nuclein
Hershey and Streptococcus
C. iii.
Chase pneumoniae
D. Watson and Crick iv. Bacteriophage
(1) A - ii, B - iv, C - iii, D - i
(2) A - i, B - iv, C - iii, D - ii
(3) A - ii, B - iii, C - iv, D - i
(4) A - i, B - iii, C - iv, D - ii

35) Examine the diagram below and select the right option given all the correct match w.r.t. A, B, C.

A B C
14 14 15 15
N N14 15
N N N N
(1)
Light DNA Heavy DNA Hybrid DNA
N15 N14 N14 N14 N15 N15
(2)
Hybrid DNA Light DNA Heavy DNA
 N15 N15 N15 N14 N14 N14
(3)
Heavy DNA Hybrid DNA Light DNA

N15 N15 N14 N14 N15 N14

(4)
Heavy DNA Light DNA Hybrid DNA
(1) 1
(2) 2
(3) 3
(4) 4

36)

Identify A, B & C in given diagram :-

A B C

Histone Histone
(1) DNA
H1 octamer

Histone
(2) DNA Histone H1
octamer

Histone
(3) Histone H1 DNA
octamer

Histone
(4) DNA Histone H1
octamer
(1) 1
(2) 2
(3) 3
(4) 4

37) Observe the sex determination in the following:-

I. Human males = XY
II. Female bird = ZW
III. Male Drosophila = XY
IV. Male grasshopper = XO
V. Male birds = ZZ
Which of the following combination is correct ?

(1) All are correct

(2) I, II, III & IV only
(3) IV & V only
(4) I, II & V only

38) The given pedigree chart shows the inheritance pattern of which of the following genetic

conditions?

(1) Myotonic dystrophy

(2) Colour-blindness
(3) Sickle-cell anaemia
(4) Thalassemia

39) The best example for pleiotropy is :-

(1) Skin colour

(2) Phenylketoneuria
(3) Colour Blindness
(4) ABO Blood group

40) How many of following represent in-situ (I) and ex-situ (E) conservation strategies ?
Sarcred groves, Wildlife sanctuary, Biosphere reserve, Seed bank, Gene bank, National park,
Botanical garden, Zoological park.

(1) I = 4, E = 4
(2) I = 5, E = 3
(3) I = 3, E = 5
(4) I = 2, E = 6

41) Which is not true about sporopollenin ?

(1) It is a fatty substance.

(2) It is secreted by tapetum.
(3) It forms exine of pollen grains.
(4) It is digested by strong acids and biocatalysts.

42) Which of the following is absent in gymnosperms?

(1) Trachieds
(2) Sieve cells
(3) Vessels
(4) All of these

43) The Cu1 and Cu2 are present in which of the following complex?
(1) Complex- IV
(2) Complex- II
(3) Complex- I
(4) Complex- III

44) Amensalism is an association between two species where:

(1) One species is harmed and the other is benefited

(2) One species is harmed and the other is unaffected
(3) One species is benefited and the other is unaffected
(4) Both the species are harmed

45) Amorphophallus flower provide floral rewards to the pollinator in the form of :-

(1) Beautiful colour

(2) Providing safe place to lay eggs
(3) Nectar
(4) Providing safe place for asexual reproduction

ZOOLOGY

1) A vertebrate which doesn’t possess jaws :

(1) Balanoglossus
(2) Petromyzon
(3) Salamandra
(4) Scoliodon

2) Statement-I :- In platyhelminthes the mesoderm is present as scattered, pouches, between

ectoderm and endoderm.
Statement-II :- In earthworms, the body is externally and internally divided into segments with a
serial repetition of atleast some organs.

(1) Statement I is correct but II is incorrect.

(2) Statement II is correct but I is incorrect.
(3) Both statements are correct.
(4) Both statements are incorrect.

3) Cephalochordate's excretory organ is

(1) Protonephridia
(2) Nephridia
(3) Malpighian tubule
(4) Green gland

4) Which of the following statements incorrect about porifera ?

(1) Sponges have a water transport or water canal system.
(2) Fertilisation is internal and development is direct.
(3) Member of this phylum are commonly known as sponges.
(4) They are generally marine and mostly asymmetrical animals.

5) Column I contains the characteristics features and column II contains the function/location. Select
the correct match from the options given below:-

Column-I Column-II
(Characteristic feature) (Function/Location)

A. Water canal system (I) Sponges

B. Comb plates (II) Helpful in swimming

C. Nephridia (III) Present in mollusca

Characteristics of
D. Jointed appendages (IV)
roundworm

E. Muscular foot (V) Arthropoda

(VI) Helpful in reproduction

(VII) Platyhelminthes

Helpful in
(VIII) osmoregulation and
excretion

Eight ciliated external

(IX) rows present in a body
of ctenophora.
(1) A-I; B-IX; C-VIII; D-V; E-III
(2) A-III; B-I; C-VI; D-II; E-V
(3) A-II; B-V; C-I; D-IV; E-IX
(4) A-III; B-VI; C-IV; D-V; E-I

6) Which is incorrectly matched ?

(1) Chameleon - Reptilia - Shed scales

(2) Ornithorynchus - Mammalia - Exclusively viviparous
(3) Neophron - Aves - Pneumatic long bones
(4) Rana - Amphibia - Tympanum is present

7) Given below is a figure of the mouth parts of cockroach labelled A, B and C :-

 Identify correct one :-

(1) A is mandible
(2) B is hypopharynx, acting as tongue
(3) C is upper lip known as labrum
(4) A is lower lip known as labium

8) Head of the cockroach is formed by fusion of :-

(1) Six segments

(2) Four segments
(3) Two segments
(4) Eight segments

9) Match column–I with column–II :-

Column–I Column–II

Heart not
(A) Cardiac arrest (i) pumping blood
effectively

Heart muscle
(B) Heart failure (ii) is suddenly
damaged

(C) Heart attack (iii) Acute chest pain

(D) Angina (iv) Heart stops beating

(1) (A)–i, (B)–ii, (C)–iii, (D)–iv
(2) (A)–iv, (B)–ii, (C)–i, (D)–iii
(3) (A)–iv, (B)–i, (C)–ii, (D)–iii
(4) (A)–ii, (B)–iii, (C)–i, (D)–iv

10) Which statement is correct regarding the cardiac cycle?

(1) The first heart sound (Lub) is associated with the closure of the AV valves.
(2) During ventricular systole, atrioventricular valves open and semilunar valves close.
(3) From the atria nearly 70% of the blood flows into the ventricles during atrial systole.
(4) The first heart sound is of shorter duration and caused by the closure of the semilunar valves.
11) Which of the following factor increase the cardiac output ?

(1) Acetylcholine
(2) Vagus nerve
(3) Adrenaline
(4) Parasympathetic system

12) In total WBCs, neutrophils are :-

(1) 2-3%
(2) 6-8%
(3) 60-65%
(4) 20-25%

13) Which of the given option is correct about the blood groups and donor compatibility ?

(1)

(2)

(3)

(4)

14) Assertion : Pneumotaxic centre can moderate the functions of the respiratory rhythm centre.
Reason : Role of oxygen in the regulation of respiratory rhythm is quite insignificant.

(1) Both Assertion & Reason are True & the Reason is a correct explanation of the Assertion.
(2) Both Assertion & Reason are True & the Reason is not a correct explanation of the Assertion.
(3) Assertion is True but the Reason is False.
(4) Both Assertion & Reason are False.

15) Read the following Statement carefully-

(i) At tissue level, CO2 diffuse into blood and forms and H+
(ii) Every 100 ml of deoxygenated blood delivers approximactely 4 ml of CO2 to tissues.
(iii) Carbonic anhydrase mainly present in plasma and minute quantities of the same is present in
RBC too.
(iv) CO2 trapped in blood as bicarbonate at the tissue level and transported to alveoli is released out
as CO2
Choose the correct statement/s with respect to CO2 transport

(1) i, iii & iv

(2) ii & iii only
(3) i & ii only
(4) i & iv only

16) In cortex area of kidney all structure are found except :–

(1) Bowman capsule

(2) D.C.T.
(3) Major part of collecting duct
(4) Malphighian body

17) Which of the following will increase in blood if we remove liver from the body

(1) Ammonia
(2) Water
(3) Urea
(4) Uric acid

18) Many bony fishes, aquatic amphibian, aquatic insects, mammals, many terrestial amphibians,
marine fishes, reptiles, birds, land snails, insects.
How many of the above organisms are ureotelic in nature ?

(1) Two
(2) Five
(3) Four
(4) Three

19) The flow of electric current on the inner

surface will be :-

(1) From left to right

(2) From right to left
(3) There will be no current flow
(4) Direction is not certain

20) Statement-1 : Coordination is the process through which 2 or more organs interact and
complement the function of one another.
Statement-2 : In our body the neural system and the endocrine system jointly co-ordinate and
integrate all the activities of the organs so that they function in a synchronised fashion.

(1) only statement 1 is correct

(2) only statement 2 is correct
(3) both statement 1 and 2 are correct
(4) both statement 1 and 2 are incorrect

21) The gray matter differs from white matter in the :-

(1) Absence of axons

(2) Absence of myelin sheath
(3) Presence of myelin sheath
(4) Absence of nurilemma

22)

Calcium homeostasis is maintained by a group of hormones. Which hormone increases Calcium in

bones?

(1) T3
(2) Calcitonin
(3) Thyroxine
(4) PTH

23) The steroid hormone responsible for balance of water and electrolytes in our body is :-

(1) Insulin
(2) Melatonin
(3) Testosterone
(4) Aldosterone

24) Which of the following pair is not antagonistic:-

(1) Insulin and glucagon

(2) FSH and LH
(3) Calcitonin and PTH
(4) MSH and melatonin

25) Assertion : Decreased level of estrogen is a common cause of osteoporosis.

Reason : Osteoporosis is age related disorder characterised by decreased bone mass and increased
chances of fractures.

(1) Both assertion & reason are true & the reason is a correct explanation of the assertion.
(2) Both assertion & reason are true but reason is not a correct explanation of the assertion.
(3) Assertion is true but the reason is false.
(4) Both assertion & reason are false.

26) Identify the correct match from column I, II and III.

Column-I Column-II Column-III

 (I) ADH (a) Para-Thyroid (i) Tetany

Hypo- Diabetes
(II) PTH (b) (ii)
thalamus mellitus

Anterior Diabetes
(III) Insulin (c) (iii)
pituitary insipidus

Growth
(IV) (d) Parncreas (iv) Dwarfism
hormone
(1) I-b-ii, II-a-i, III-d-iii, IV-c-iv
(2) I-c-iii, II-a-i, III-d-ii, IV-b-iv
(3) I-c-ii, II-a-i, III-d-iii, IV-b-iv
(4) I-b-iii, II-a-i, III-d-ii, IV-c-iv

27) Acromian process is found in :-

(1) Pectoral girdle

(2) Pelvic girdle
(3) Femur
(4) Humerus

28) Give below the list of the organs.

Buccal cavity, Renal pelvis, ureter, Urinary Bladder and Pharynx.
How many organ consist of Non-Keratinized stratified squamous epithelium.

(1) Two
(2) Three
(3) Five
(4) Four

29) The ____X___ emerging from the glomerulus forms a fine capillary network around the renal
tubule called the ___Y___ identify X and Y :

X Y

(1) Afferent arteriole Peritubular Capillaries

(2) Afferent arteriole Efferent arteriole

(3) Efferent arteriole Afferent arteriole

(4) Efferent Arteriole Peritubular Capillaries

(1) 1
(2) 2
(3) 3
(4) 4

30) Silencing of mRNA has been used in producing transgenic plants resistant to :
(1) Bacterial Blights
(2) Bollworms
(3) Nematodes
(4) White rusts

31) Which one of the following statement is incorrect regarding gametogenesis?

Spermatogenesis starts at the age of puberty due to significant increase in the secretion of
(1)
gonadotropin releasing hormone.
FSH acts on the sertoli cells and stimulate secretion of some factor which help in the process of
(2)
spermiogenesis
(3) After spermiogenesis, sperm heads become embedded in the sertoli cells.
A primary spermatocyte completes the first meiotic division leading to formation of two
(4)
unequal, haploid cells called secondary spermatocyte.

32) Assertion :- B-lymphocytes produce an army of proteins in response to pathogens into our blood
to fight with them.
Reason :- Each antibody monomer has two light chain and two heavy chains.

(1) Both (A) and (R) are true and (R) is the correct explanation of (A).
(2) Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
(3) (A) is true but (R) is false.
(4) (A) is false but (R) is true.

33) Out of the given options choose the character present only in the coelenterates :-

(1) Hermaphroditism
(2) Flame cells
(3) Polymorphism
(4) Nematocysts

34) Which of the following option is incorrect for roundworms ?

(1) Dioecious
(2) Alimentary canal-complete
(3) Fertilization-internal
(4) Acoelomate

35) Which one of the following pairs of animals are similar to each other for the feature stated
against them:

(1) Pteropus and Ornithorhynchus-viviparity

(2) Garden lizard and crocodile - three chambered heart
(3) Ascaris and Ancylostoma - Metameric segmentation
(4) Sea horse and flying fish - Poikiothermal

36) Select the correct statement -

(1) Cervical vertebrae in adult human is 7.
(2) Elbow joint is an example of ball & socket joint
(3) A decreased level of progesterone causes osteoporosis in old people.
(4) Ciliary movement is found in spermatozoa.

37) Which of the following statements is correct about the origin and evolution of men ?

(1) Homo erectus probably did not eat meat.

The Neanderthal man with a brain size of 900 C.C lived in near east and central Asia between
(2)
1,00000-40,000 years back.
(3) 15 mya, Australopithecines probably lived in East African grasslands.
(4) Homo erectus had a brain size about 900 C.C.

38) Read the following statements (A-D) :-

(A) Plasma is a straw coloured, viscous fluid constituting nearly 45 percent of the blood.
(B) 90-92 percent of plasma is water.
(C) Proteins contribute 6-8 percent of plasma.
(D) Globulins primarly are involved in coagulation of blood.
How many of the above statements are correct ?

(1) One
(2) Two
(3) Four
(4) Three

39) Which of the following hormones is synthesized by hypothalamus ?

(1) Prolactin, Oxytocin

(2) Oxytocin, ADH
(3) FSH, GnRH
(4) LH, FSH

40) What is true for molecular diagnosis ?

(1) It is traditional process.

(2) It involves drawing of serum for the test
(3) It can be used in the initial stages of the of diseases.
(4) All of the above

41) Given below are two statements

Statement-I : At puberty only 60,000 – 80,000 primary follicles are left in each ovary.
Statement-II : The secondary follicle is characterised by a fluid filled cavity called antrum.
In the light of above two statements, choose the most appropriate answer from the options given
below.

(1) Both statement-I and statement-II are correct

(2) Both statement-I and statement-II are incorrect
(3) Statement-I is correct but statement-II is incorrect
(4) Statement-I is incorrect but statement-II is correct

42) __A__ enters the human body as ___C___ through the bite of infected female ____B____ mosquito.

A B C

1 Streptococcus Trophozoite Sporozoite

2 Plasmodium Sporozoite Anopheles

3 Wuchereria Aedes Gametocyte

4 Plasmodium Anopheles Sporozoite

(1) 1
(2) 2
(3) 3
(4) 4

43) Which of the following statements are correct or incorrect regarding class Amphibia :
(i) Body is divisible into head and trunk. Tail is present in some amphibians
(ii) Show respiration by gills, lungs and through, skin
(iii) Has scales in all its members
(iv) Can lead dual life
(v) Has eyelids

(1) All are correct

(2) (i) and (iv) are correct
(3) Only (iii) is incorrect
(4) Only (ii) is incorrect

44) Match List-I with List-II.

List-I List-II

(a) Ernst Heckel (i) Worked in Malay Archipelago

(b) Louis Pasteur (ii) Supported embryological evidences

(c) Charles Darwin (iii) dismissed spontaneous generation

(d) Alfred Wallace (iv) Theory of Natural selection

(a) (b) (c) (d)

(1) (ii) (iii) (iv) (i)

(2) (ii) (iv) (iii) (i)

(3) (iv) (iii) (ii) (i)

(4) (iii) (i) (iv) (ii)

(1) 1
(2) 2
(3) 3
(4) 4

45) Select the correct statement regarding human heart.

Heart is an endodermally derived organ situated in the thoracic cavity, in between the two
(1)
lungs.
(2) It is protected by a single walled membranous bag pericardium, enclosing the pericardial fluid.
Our heart has four chambers, two relatively large upper chambers called atria and two smaller
(3)
lower chambers called ventricles.
(4) A thin, muscular wall called the inter-atrial septum separates the right and the left atria.
 ANSWER KEYS

PHYSICS

Q. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
A. 2 3 4 3 3 4 3 4 2 1 2 1 4 1 3 4 3 3 3 3
Q. 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
A. 3 4 2 2 2 2 1 1 4 4 1 2 3 4 2 3 3 3 4 3
Q. 41 42 43 44 45
A. 1 1 4 3 1

CHEMISTRY

Q. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
A. 4 2 2 1 4 3 3 4 2 3 3 3 1 3 3 1 2 3 3 3
Q. 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85
A. 1 3 2 4 3 1 2 3 1 2 4 2 4 3 2 3 2 4 2 1
Q. 86 87 88 89 90
A. 1 2 4 4 4

BOTANY

Q. 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
A. 3 4 4 1 3 1 3 4 2 1 2 3 3 4 2 1 2 3 4 4
Q. 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
A. 2 4 2 2 4 3 1 1 3 2 4 3 1 3 3 2 1 1 2 1
Q. 131 132 133 134 135
A. 4 3 1 2 2

ZOOLOGY

Q. 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155
A. 2 2 1 2 1 2 2 1 3 1 3 3 2 2 4 3 1 4 2 3
Q. 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175
A. 2 2 4 2 2 4 1 1 4 3 4 2 4 4 4 1 4 2 2 3
Q. 176 177 178 179 180
A. 3 4 3 1 4
 SOLUTIONS

PHYSICS

1)
Area A ∝ ℓ2

2)
⇒ Integrate

3)

h = 40m

4) Loss =

5) Body will move on arc

Body will move on semicircle
Body will move on circle

6)
 FC = mrω2
T sin θ = m(L sin θ)ω2
T = mLω2
Tmax =

Given m = 0.5 kg , L = 0.5 m, Tmax =324 N.

ω2=

ω= = 36 rad/s

7)

x=

Time =

8) Keff = K1 + K2

9)

Let the frequency of standard fork = x

Number of beats per second = nA – nB = 6

10) LC of screw gauge = 0.5 mm/50 = 0.01 mm

Diameter = MSR +CSR – ZE = 3.0 mm + (24) (0.01 mm) – 0
= 3.24 mm = 0.324 cm
Length : MSR + VSR – ZE = 6 cm + (7) (0.01) cm – 0
= 6.07 cm

Volume =

= 0.5002
≌ 0.500 cm3

11) From principle of moments

40(48–x) + 30(48–20) = 60(50–48) + 50 (80–48)

1920 – 40x + 840 = 120 + 1600
40x = 1040
⇒ x = 26 cm

12) V1 = 331 + 12 = 343, V2 = 331 + 30 = 361

⇒ 26

13)

R ∝ sin 2θ T ∝ sin θ
H ∝ sin2 θ

14) k[100 – T1] = 2k[T1 – T2] = k[T2 – 20]

100 – T1 = 2(T1 – T2) = T2 – 20

15) PV–1 = constant

In the process, PVx = constant

Here, x = –1

16)
As x is same, so T1 = T2

17) Tension = Force

Surface tension =

18) ω2 = ω0 + 2 α θ
2
α=–

0=
∴N=5

19)

⇒ 100x2 = (1 – x)2
⇒ 10x = 1 – x

20)

Isothermal conditions → Total internal energy of the system remains constant.

∴ U1 + U2 = Ufinal
⇒ SA1 + SA2 = SA
⇒ A = A1 + A 2
⇒ 4πR2 = 4π (12)2 + 4π(5)2
⇒ R2 = 144 + 25
⇒ R2 = 169
⇒

21) P1 = P +

0
P2 = P +
r1 < r2
∴ p1 > p2
Air would flow from higher pressure to lower pressure.
∴ Air flows from smaller bubble to bigger bubble.

22) (ΔQ)v = μCVΔT

= 30 R
23) Heat energy supplied ⇒ ΔQ = 1500 J
External work done ΔW = 525 T
By 1st law of thermodynamics
ΔQ = ΔU + ΔW
∴ ΔU = ΔQ – ΔW = 1500 – 525
ΔU = 975 J

24) Fractional change in time =

= 0.001

25)

VA – VB = –10V

26)

27)
R = 6 ohm

28)
x = 0.25Ω

29) P = i2R
In series Ι = same

30) Theoritical

31) Image formed by the slab is at the centre of

carvature of mirror S = 2 (shift)
32) Distance between 1st dark and central.

Fringe = =
= 1.2 mm

33) =

= λ2 = 2λ1

34) Henc P–N junction diode acts as half wave rectifier during the half cycle

35) ∵ (KE)max = hν – ϕ

36) Li = 0, Lf = m u sinθ ×

Lf = 2 × 10 × ×
Lf = 50
Δ L = Lf – Li = 50

T=

τavg.= N-m

37) (50 – x) × 1 = x × 0.25

x = 40 cm
minimum length on the table = 100 – 40 = 60 cm

38)
39)

40) ,

41) To prevent sparking, the capacitor must hold all energy contained by inductor

42)
E = 10 × 10–3

43) mT = = – 4.5
u = – 20 cm

then, = –4.5 ⇒ V = –90 cm

Now + =

44)
Distance between 3rd bright and 5th dark.

=
= 0.75 mm
 45) For pth overtone

n = (2P + 1)
No of nodes = No of antinodes = P + 1

CHEMISTRY

46)

ΔE = (E2 – E1)H × Z2

= 10.2 × 9 = 91.8 eV

47) Ionisation energy of Li+2 ion = 13.6 × 9 = 122.4eV e– of H-atom will have kinetic energy
after removal from ground state = (122.4 – 13.6) = 108.8eV

or
= 1.17 Å

48) N2(g) + 3H2(g) ⇌ 2NH3(g)

ni 1 3 0
neq 1 – x 3(1 – x) 2x
∵ at equilibrium
moles of H2 = 3 × mole of N2

Kp = =

49)

∴ pOH = – log (6 × 10–3) = 2.22 ⇒ pH = 11.78

50)
Pure water is always neutral, meaning [H+] = [OH–]
pKw = – log(1×10–12) = 12. This confirms statement 1

[H+] =
pH = – log(10–6) = 6. This confirms statement 2
Since the solution is neutral, it cannot be acidic, making statement 4 incorrect.

51)
∴ v.f. of As2S3 = 4 + 24 = 28

52)

2 C6H6 (l) + 15 O2 (g) → 12 CO2 (g) + 6H2 O (l)

Δng = 12 – 15 = – 3

ΔH – ΔE = = – 7.43 kJ

53)

C2 ⇒ Diamagnetic
&

54)

PCl5, IF7, SF4, ClF3

Unequal bond length.

55)

For halogen family

Cl2 > Br2 > F2 > I2 (B.E./B.D.E.)

56) NCERT Page No. 84

57)

NaOH (Basic) + BeO (Acidic) → Salt

⇒ BeO - amphoteric in nature

58) NCERT-XI, Part-II, Page # 359

 59) NCERT Pg. # 332

60)

Element Colour in flame test

K Violet
Ca Brick red
Sr Crimson red
Ba Apple green

61)

......(1)]

Net Reaction→ Pd2+ (aq.) + 4Cl–

2–
(aq.) ⇌ PdCl (aq.)
4

0.83 – 0.65
0.18 .....(2)
Also n = 2 .....(3)
Using equation (1), (2) & (3)
logK = 6

62)

Ea = 2519.88 J ⇒ Ea = 2520 J

63)

25 × 104 Ω–1 cm2 mol–1

64)

= 59%
65) Assertion – A : Benzene is more stable than cyclohexatriene (True)
Reason – R : Delocalised π – e cloud lies B.M.O so more attracted by nuclei of carbon atom.
(True & Correct Explanation)

66)

67)

([Co(NH3)5NO2]2+
Two linkage isomers possible
NO2 → Ambidentate ligand

68) CH3NH2 . HCl NaCN and NaCl

NaCN gives +ve test for nitrogen and
NaCl gives +ve test for halogen

69)

70) A : k =
As Ea increases k decreases

B : Temperature coefficient =

D : ln k = ln A

71) Most easily deprotonation

72) In alcoholic KOH, elimination reaction takes place.

73)
 List I List II

Test Functional group / Class of Compound

A. Neutral FeCl3 test I. Phenol

B. Lucas test II. Alcohol

C. Carbylamine Test III. Primary amine

D. Schiff's Test IV. Aldehyde

74)

75)

(i), (ii) and (iv) correct.

Manganese exhibits +7 oxidation state in its oxide.
(Mn2O7)
Ru & Os from RuO4 & OsO4 oxide in +8 oxidation state
Cr in +6 oxidation act is oxidizing.
Sc does not show +4 oxidation state.

76) ΔTf = i Kf m
= 1.2 × 1.86 × 0.5
= 1.116
= 1.12 K

77) Chromyl chloride test

78) Explain Question:

We need to calculate heat evolved in neutralization of HCI with NaOH.
Concept :
Heat of neutralization of strong acid with strong base \approx 57.1 kJ per mole of water
formed.
Solution:
Reaction: HCI + NaOH → NaCI + H2O
Moles given: HCI = 0.50 mol, NaOH = 0.30 mol.
Limiting reagent = NaIOH (0.30 mol).
So, moles of water formed = 0.30 mol.
Heat evolved = 0.30 × 57.1 kJ = 17.13 kJ.

Final answer: option (4)

79)

Conceptual

80)

Conceptual

81)

Explain Question : Ask to identity compound x that reacts with acetophenone in water to
form a nitrophenyl hydrazone derivatives.
Concept : This question is based on hydrazone formation, nucleophilic addition.
Solution :
Acetophenone (ketone) reacts with hydrazine derivatives to form hydrazones.
So 'x' must be 2, 4-Di-nitrophenylhydrazine. (2,4-DNP)

Final answer : Option (3)

82) NCERT Reference: XII, Part-I, Page No. 245

83) NCERT Reference: XII, Part-I, Page No. 256

84) Due to ortho effect

85) Both A and R are true and R is the correct explanation of A

86)

Explaining the Question :-

Find out the product of the given reaction
Concept :- Reduction with NaBH4
Solution :-
NaBH4 reduce Aldehyde, ketone and acid halide into Alcohal.

NaBH4 can't reduce ester.

Final Answer :- Option (1)
 87)

88) Explain Question:

Identify which of the listed sugar are reusing nature.

Concept:
Reducing sugars possess s free anomeric carbon capable of opening to from opening to from
an an aldehyde or ketone group, allowing them to reduce mild oxidizing agents.

Solution: Fructose: Reducing – although a ketose, it tautomerizes to form an aldehyde under

basic conditions.
Maltose: Reducing – one glucose unit has a free anomeric carbon.
Lactose: Reducing – glucose unit has a free anomeric carbon. All three have at least one free
carbon capable of ring opening and reduction.

Final answer: Option (4)

89) Asking About :- Product of reaction.

Concept :- HNO3 is strong oxidising agent and oxidise –CHO and 1° alcohol to carboxylic acid.
Sol. Explanation :-

90)

Fact, conceptual.

BOTANY

91)

NCERT (XI) Pg. No. # 20

92) NCERT XI (E)/(H) Page No. # 27

93)
NCERT Page No. 17.

94)

NCERT (XI) Page No. # 33

95) NCERT-XI, Page 32, Para 3.1.1.

96) NCERT Pg. # 73, para-1

97)

NCERT Based.

98)

NCERT-XI, Pg. # 126

99) NCERT (XII) Pg. # 29

100) NCERT Pg. # 132

101) NCERT Pg. # 223

102) NCERT, Pg # 140,141

103) NCERT Pg#172

104)

NCERT Pg # 159

106)

Explanation : Given template strand:

3'– TAC ATG GCA AAT ATC CAT TCA –5'
Now convert each base to RNA (5' → 3'):
So mRNA =
5' AUG UAC CGU UUA UAG GUA AGU 3'

107)

NCERT Based
108) NCERT-XII, Pg. # 195

109) NCERT XII Pg # 236 & 237 (E)

NCERT XII Pg # 257, 258 (H)

110)

NCERT Based

111)

NCERT Based

113)

Both A & R are correct, but R doesn’t explains A

114) NCERT XI Page No. # 80

115) NCERT XI Page No. # 34 & 39

116) NCERT XI Page No. # 20, 21 and 23

117) NCERT, Pg # 230

118) NCERT, Pg # 101

119)

NCERT-XIIth, Page 26 (E), 27 (H)

120) NCERT XI Page No. # 73, 75, 79, 81

121) NCERT XI Page No. # 133, 135, 136, 137

122) NCERT (XII) Pg. # 37(E) 39(H)

123)

20 microspore mother cells.

Each division yields 4 male gametes from each mother cell.
So, 20 microspore mother cells are required to produce 80 male gametes in angiosperms.

124)

A - ii, B - iii, C - iv, D - i

125)

NCERT Based

126)

NCERT Based

127)

NCERT Based.

128)

NCERT Based

129)

NCERT Based

130)

NCERT Based

131) Module-4 Pg. # 131

132) Ncert Page 87.

133)

NCERT Based

134)

NCERT Based

135) NCERT (XII) Pg. # 30

ZOOLOGY

136)

NCERT Pg. # 47

137) NCERT, Pg. # 39

138)

NCERT (XI) Pg # 206

139) NCERT Pg. # 49

140) NCERT Pg. # 52,53,54

141) NCERT XI, Page # 59

142)

Module

143)

Allen Module

144)

NCERT Pg. # 288

145)

NCERT Pg. # 199

146)

NCERT Pg. # 202

147)

NCERT Pg. # 194

148)
NCERT Pg. # 195

149)

NCERT Pg. # 190

150)

NCERT Pg. # 190

151)

NCERT Pg. # 208

152)

NCERT Pg. # 205

153) NCERT-XI, Pg # 205

154)

NCERT Pg. # 233

155) NCERT-XI, Pg. No. # 315

156)

NCERT Pg. # 236

157)

NCERT Pg. # 243

158) NCERT (XI) Pg. # 335 para(22.2.7)

159)

NCERT Pg. # 241

160) NCERT Pg # 312

161)
NCERT Pg. # 241, 243

162)

NCERT Pg. # 226

163) NCERT XI Pg. # 102

Buccal cavity and Pharynx have non-keratinized stratified squamous epithelium.

164)

NCERT Page No. # 293

166) NCERT Pg. No. # 47-48

167) NCERT Pg. No. # 151

168) NCERT Pg. No. # 50

169)

NCERT Based

170) NCERT Pg. No. # 52,57,58,59

171) NCERT Pg. No. # 303,311,312

172) NCERT Page No. # E-140,141, H-153, 154

173) NCERT Page No. # E-278/279, H-279

B and C are correct
(A) Plasma is nearly 55 percent of blood
(B) Fibrinogen primarly are involved in coagulation of blood.

174) NCERT Page No. # 333

175) NCERT Page No. # 212

176) NCERT Pg. No. # 48

177) NCERT Pg. No. # 147,149

178) NCERT Pg. No. # 57

179) NCERT Page No. # E-127, 129, H-139, 141

180) NCERT Page No. E-283, H-284