0% found this document useful (0 votes)
8 views11 pages

An Improved Dna Cryptography Using Rns

This paper presents an improved method of DNA cryptography that combines cryptography and steganography using a residue number system to enhance data security. The proposed scheme encrypts plaintext into a residue form, converts it to DNA format, and hides it within randomly generated reference DNA sequences, resulting in reduced computational time and increased security. The encoding and decoding processes are detailed, demonstrating the effectiveness of the approach in ensuring secure communication.

Uploaded by

Habib
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
8 views11 pages

An Improved Dna Cryptography Using Rns

This paper presents an improved method of DNA cryptography that combines cryptography and steganography using a residue number system to enhance data security. The proposed scheme encrypts plaintext into a residue form, converts it to DNA format, and hides it within randomly generated reference DNA sequences, resulting in reduced computational time and increased security. The encoding and decoding processes are detailed, demonstrating the effectiveness of the approach in ensuring secure communication.

Uploaded by

Habib
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd

AN IMPROVED DNA CRYTOGRAPHY USING RESIDUE NUMBER SYSTEM

Salaudeen Habib Lekan


Department of Computer Science, Federal Polytechnic Ohodo, Enugu, Nigeria.

Abnaldo11@[Link]

Abstract
In this information rich era, data protection is needed to ensure swift and secure communication
through a digital medium. Data need to be protected from unauthorized access and transmitted to
the intended receiver with confidentiality, availability, integrity, authenticity. More recent trends
are concerned with the application of DNA cryptography and data hiding by using it as a carrier
thereby making use of its bio-molecular computational properties. This paper proposed a method
that incorporate cryptography and steganography in securing the data using residue number
system and DNA base sequence. Firstly, residue number system is used in order to reduce the
computational time by encrypting plaintext into a residue form, using the moduli set {2n-1, 2n,
2n+1}, then convert the residue to a DNA format. The DNA base steganography was done to
hide the existence of the encrypted DNA with using two different reference sequence randomly
generated. The propose scheme was able to produce the cipher text in both an encrypted and
encoded DNA base form, which takes less computational time and attracts less attention of
intruders.

1 Introduction

Communicating digitally has evolved to be a in computer security, [1]. Cryptography is


fundamental aspect of interaction between an historical science that began in Egypt
two ends in this generation, with a lot of around 1900 B.C. with hieroglyphic writing,
internet based field. Keeping [2] It uses encryption to scramble the secret
communication secret is of high importance. information in such a way that only the
So, the security of data passed over a sender and the intended receiver can reveal
network is a primary consign, which it, [4] On the other hand, steganography
stretches to the confidentiality as well as began in ancient Greece around 440 B.C.
integrity of the data, making it mandatory to [3]. It is the art of hiding data into a medium
protect against intruders or unauthorized in a way that makes data unsuspicious. The
access and use. In the quest to have a hiding media used can be in the form of
secured communication between two ends, images, audios, videos and DNA which
the concept of cryptography and makes the data difficult to detect. From
steganography came into light. nature to science, the idea that genes
Cryptography and steganography are usually themselves are made of information
interrelated and share the common aims and stimulated the research in molecular
services of preserving the confidentiality, deoxyribonucleic acid (DNA). DNA
integrity, and availability of information, molecule has three main advantages that
which are some of the most significant fields make it an efficient medium for data hiding
and transmission. [5] First of all, its high dominated intensive applications such as
storage capacity; One trillion bits of binary fast Fourier transform, discrete Fourier
data can be stored in one cubic decimeter of transform, image processing, cryptography,
DNA solution. Secondly, DNA molecules digital filtering, and video coding. This is
show parallel computation, which means due to the RNS inherent features, such as
DNA based processes are capable of intense carry free operations, parallelism,
processing. DNA chains have large scale of modularity, and fault tolerance. RNS based
parallelism and its computing speed could calculation requires reverse and forward
reach up to 1 billion times per second conversions, which must be as fast as
computations. Third, DNA based computers possible not to nullify the RNS advantages.
also have very less power consumption, [9].
which is equal to one – billionth of a
traditional computer. [6] In this paper, we point out limitations in [7]
and [8] and then proposed an improved
DNA base steganography using residue
number system. Firstly, we encrypt the text
data to a residue form with respect to the
moduli set {2n-1, 2n, 2n+1}, which have a
common factor of 2. This simplify the
encryption process due to it low complexity
compared to the delayed chaotic neural
network used in [8] and also increases the
permutation and combination that enhanced
the robustness of the security when
compared to [7]. This paper is organized as
follows: section 2 states the Existing works,
section 3 explains the structure of the
proposed algorithm, section 4 shows the
performance analysis and comparisons while
section 5 is the conclusion of this work.

2 Existing works
Fig. 1. DNA Structure
OA Al-Harbi, [Link]. [11], investigates the
The DNA is the Deoxyribo nucleic acid
most recent data hiding techniques based on
which contains six smaller molecules in it. A
DNA steganography, including the highly
sugar molecule called deoxyribose, a
improved DNA-based steganography
phosphate molecule, and four different
technique, the data hiding using double
nitrogenous bases (Adenine, Thymine,
DNA sequences method, and the enhanced
Cytosine and Guanine). The two long
DNA-based steganography technique. The
strands twisted around like a ladder to form
strengths and weaknesses of these
a double helix model which is made up of
techniques are discussed. Additionally, the
sugar and phosphate group. [10].
security of these techniques is analyzed
.
based on several security parameters that
Residue Number Systems (RNS) is an
measure the quality of DNA steganography
unweighted number system, which is usually
with respect to many factors, including, but
employed in addition and multiplication
not limited to, cracking probability, DES, and Blowfish), the experimental
blindness, modification rate and expansion results show that this method leaves behind
rate, and layers of security. The goal of the the traditional algorithms based on
comparison between the investigated ciphertext size, encryption time, and
techniques is to highlight the advantages and throughput. Hence this new method is much
disadvantages of the existing data hiding more efficient and performs better.
algorithms and to motivate future research in
this field. Moreover, the paper evaluates the
discussed techniques based on some Tiwari, [Link]. [14], recommended a scheme
parameters, including capacity, payload, and in which the DNA mapping technique was
bit per nucleotide (bpn). The result shows offered for ECC. In this method the DNA
that the enhanced DNA-based code is random, and non‐ repetitive
steganography technique hides 2 bpn, subsections are allotted to alphabets. Then
whereas the highly improved method can these alphabets are used for encoding and
hide on average 1.46 bpn, which is higher decoding at the two ends. This scheme was
than data hiding using double DNA effectively employed and used in real‐ time
sequences method can hide. The paper also internet of things devices.
presents suggestions for how each technique
can be optimized to to achieve a higher
security level for hiding data within DNA P. Malathi, [Link]. [7], modifies the insertion
sequences. algorithm to decrease the cracking
probability of the fake DNA sequence. The
El-Latif, [Link]. [12], suggested a method algorithm uses two different keys. The first
which has two rounds of encryption. This key (K1)(K1) is a number in the range of 0
scheme is the same as the existing technique to 255, which is used to XOR the last
named the Data Encryption Standard (DES) character in the message (M); the result will
algorithm. In this method, two keys are used be XORed with the character preceding the
for encoding the plaintext. These two keys last one in the M, and so on. Accordingly,
are made up of the elliptic curve the first key is used to encrypt the message.
cryptography (ECC), and Gaussian kernel The second key (K2)(K2) is randomly
function (GKF) and another key is created generated and is used to divide the DNA
on random based injective mapping on the sequence into same-length segments. The
second characters repeated in the first key. resulting cipher characters are inserted as
At last, the encryption message arbitrarily binary bits one by one at the beginning of
hides in the second DNA sequence based on each segment. Then, the binary sequence is
the numbers from GKF. converted into DNA bases. The second key
is preferred to be a small number so that the
DNA sequence has a minimum length while
Sohal, [Link]. [13], introduced a new method hiding the secret message.
with the cryptographic technique. In this
technique, client-side data is encrypted
before storing it in the cloud. This is a S.S. Roy, [Link]. [8] proposed a new method
symmetric-key cryptography scheme which using delayed chaotic neural network with a
uses DNA cryptography. Apart from posterior DNA cryptography. The binary
presenting the thorough design of this sequence needed to perform XOR operation
approach, and comparing it with the present with message blocks is generated from
symmetric-key algorithms (DNA, AES, chaotic neural network. The permutation of
the plaintext and the number of epoch is also chaotic neural network as well as the
based on the chaotic neural network. It is position bits for using permutation
difficult for any cryptanalyst to determine operation. The scheme is slower for use in
the actual parameters of the encryption practical applications. In case of online
method and decrypt the DNA cipher media file transmission, the scheme would
sequence. Without knowing all the not provide efficient solution.
parameters i.e. input, delay function of the

3 Proposed Work

Improving the existing system towards providing a better means through which secure
communication can be ensured from one end to the other, a new scheme was proposed. The
concept of residue number system was adopted to encrypt the corresponding ASCII value of the
secret message, through computation of forward conversion with respect to the moduli set {2n-1,
2n, 2n+1}. The residue encrypted message is then converted to binary and then converted to
DNA bases using the DNA bases table where each bases are assigned two unique binary digit
value. The base A is assigned the binary value 00, the base C is assigned binary value 01, the
base G is assigned the binary value 10, the base T is assigned the binary value 11. The DNA
bases encrypted message is then hidden in-between to two different 30 bases long reference
DNA that is randomly generated out of the 163 million DNA available online and concatenate it
together to form a fake DNA that will be the cipher text send to the receiver. The insertion
method is adopted here for the encoding of the cipher DNA inside the reference DNA.
The decoding of the fake DNA is done by extracting the cipher DNA out of the two
reference DNA that must have been shared between the sender and the receiver. The cipher DNA
bases is binary converted using the DNA base table and later converted to residue. The residue
encrypted message is converted back to ASCII value through computation of reverse conversion
using Chinese Remainder Theorem (CRT). The ASCII values are concatenated and converted to
it Alphanumeric form to get the original secret message.

3.1 Algorithm for encoding

Step 1: Convert the plain-text to it equivalent ASCII value.


Step 2: Convert the ASCII value to residue with respect to the moduli set {2n-1, 2n, 2n+1},
where value of n = 2.
Step 3: Convert the residue to a 4 bits binary and later to DNA base using DNA base table to
form DNA ‘A’.
Step 4: Generate two 30 bases long reference DNA sequence ‘B’ and ‘C’ randomly.
Step 5: Insert the encrypted DNA ‘A’ in-between reference DNA sequence ‘B’ and ‘C’ and
concatenate them to form fake DNA S.

3.1.1 Example of encoding technique for message ‘We’


Step 1: Convert the plain text to it equivalent ASCII values
W 87
e 101
Step 2: Convert the ASCII value to residue with respect to the moduli set {2n-1, 2n, 2n+1},
where value of n = 2.
ASCII Residue
87 2 3 3
101 1 5 3

Step 3: Convert the residue to a 4 bit’s binary and later to DNA base using DNA base table to
form DNA ‘A’.
Residue 4 bits binary DNA base
2 3 3 0010 0011 0011 AG AT AT

1 5 3 0001 0101 0011 AC CC AT

Step 4: Generate two reference 30 bases long DNA sequence ‘B’ and ‘C’ randomly.
Consider the sequence ‘GAATAAGGCTTGACCTAGTAAATTCGGGCG’ and
‘GTACGGACAACATACAAGGATTAAGATAGA’ as the two reference sequence
‘B’ and ‘C’ respectively.

Step 5: Insert the encrypted DNA ‘A’ in-between reference DNA sequence ‘B’ and ‘C’ and
concatenate them to form fake DNA S.

Concatenate ‘B’, ‘A’ and ‘C’

B GAATAAGGCTTGACCTAGTAAATTCGGGCG
A AGATATACCCAT
C GTACGGACAACATACAAGGATTAAGATAGA

Fake DNA sequence

S GAATAAGGCTTGACCTAGTAAATTCGGGCGAGATATACCCATGTACGGAC
AACATACAAGGATTAAGATAGA

3.2 Algorithm for decoding

Step 1: Extract the DNA ‘A’ from fake DNA ‘S’ by counting 30 from the left and 30 from the
right and extract the middle DNA sequence
Step 2: Convert the DNA ‘A’ to 4-bit binary using the DNA base table and later to residue.
Step 3: Convert the residue to ASCII using Chinese Remainder Theorem.
Step 4: Convert the ASCII value to it corresponding Alphanumeric value and concatenate to
form the plain text.

3.2.1 Example of decoding technique for message ‘We’


Step 1: Extract the DNA ‘A’ from fake DNA ‘S’ by counting 30 from the left and 30 from the

right and extract the middle DNA sequence

GAATAAGGCTTGACCTAGTAAATTCGGGCG’AGATATACCCAT’GTACGGCAAC

ATACAAGGATTAAGATAGA

Step 2: Convert the DNA ‘A’ to 4 bits binary using the DNA base table and later to residue.

DNA base 4 bits binary Residue


AG AT AT 0010 0011 0011 2 3 3

AC CC AT 0001 0101 0011 1 5 3

Step 3: Convert the residue to ASCII using Chinese Remainder Theorem.

The CRT is given by

and and is the multiplicative inverse of Mi with respect to mi.

Using the moduli m1 = 5, m2 = 6, m3 = 7, the dynamic range is;

M = ∏ mi = 5 x 6 x 7 = 210
i=1

M 210 M 210 M 210


M1 = m1 = 5 = 42, M2 = m2 = 6 = 35, M3 = m3 = 7 = 30

M1-1 = 3, M2-1 = 5, M3-1 = 4,

For the first row of the cipher-text with residue {2, 3, 3} the reverse conversion is;

|x|210 = |(2 x 42 x 3) + (3 x 35 x 5) + (3 x 30 x 4)|210

= |252 + 525 + 360|210


= |1137|210 = 87

For the next row of the cipher-text with residue {1, 5, 3} the reverse conversion is;

|x|210 = |(1 x 42 x 3) + (5 x 35 x 5) + (3 x 30 x 4)|210

= |126 + 875 + 360|210

= |1361|210 = 101

Step 4: Convert the ASCII value to it corresponding Alphanumeric value and concatenate to
form the plain text.

ASCII Alphanumeric

87 W

101 e

Hence the message “We” is retrieved.

3.2.2 Cracking Probability

It is the total probability to predict the confidential information hidden inside the reference DNA
sequence. The attacker needs the following information to crack the secret message hidden in the
reference DNA.

The message is encrypted using residue number system with respect to a specific moduli set,
specific arrangement of the moduli set and a specific value of n. This measure is the first
information for the intruders to break the hidden information in the DNA sequence, and thus the
probability of guessing the moduli set is
1
(1)
(120 ⁿ −1)
and the probability of guessing the arrangement of the moduli set is
1
(2)
6
and the probability of guessing the specific value of n used is
1
(3 ⁿ −1)
(3)
The size of the reference DNA available is about 163 million. This is another information the
intruder will need to crack the secret message. Thus the probability to predict reference DNA
sequence twice is
1
(4)
( 1.63 x 108 ) ˆ 2
The binary coding of A, C, G, T gives different combinations of two, thus the probability to
guess binary coding is
1
(5)
24
Thirdly, the size of the message and prefix DNA is the another information available to the
intruder to crack the hidden message and the probability of finding message and reference DNA
sequence is
1
(6)
(n −1) ˆ 2
The message and DNA are segmented and this provides another information to the intruder and
thus the probability of guessing the segmentation of the DNA is
1
(7)
2ˢ −1
and the probability of guessing segmentation of message is
1
(8)
2ᵐ −1
Hence the total probability to find the message hidden in the DNA sequence using the proposed
scheme is
1 1 1 1 1 1 1 1
X X X X X X X (9)
(120 ᵇ −1) 6 (3 ᵈ −1) ( 1.63 x 10 ) ˆ 2 24 (n −1)ˆ 2 2 ˢ −1 2 ᵐ − 1
8

Here,
● d is the number of bits in the moduli set.
● n is the number of bits in the Fake DNA sequence.
● m is the number of bits in the secret message.
● s is the number of bits in the reference DNA sequence.

4 Performance Analysis and Comparisons

The proposed scheme takes 0.098s to encrypt the word ‘We’ and 0.037s to decrypt it compare to
the scheme proposed by S.S. Roy, [Link]. [8] that takes 0.40s to encrypt and 0.39s to decrypt the
word ‘We, as seen in figure 4.1 and figure 4.2 below. The proposed scheme have a lower
1
cracking probability of
( 1.63 x 10 ) ˆ 2(24)(n −1)ˆ 2(2 ˢ − 1)(2 ᵐ −1)(120 ⁿ −1)(3 ⁿ −1)(6)
8

compare to P. Malathi, [Link]. [7] that has a cracking probability of


1 1 1 1 1 1
X X X X X , as shown in table 4.1.
( 1.63 x 10 ) 24 (n −1) 2 ˢ −1 (2ᵐ −1) 2⁸ ᵐ
8
Figure 4.1: Proposed scheme

Figure 4.2: Delayed Chaotic Neural Network, S.S. Roy, [Link]. (2017)
Table 4.1: Cracking probability of existing and proposed algorithm

Highly Improved DNA 1 1 1 1 1 1


X X X X X
Based Steganography ( 1.63 x 10 )
8 24 (n −1) 2 ˢ −1 (2ᵐ −1) 2⁸ ᵐ

Delayed Chaotic Neural 1 1 1 1 1 1 1


X X X X X X
Network And DNA 24 (n −1) 2 ˢ − 1 (2 ᵐ − 1) 2⁸ ᵐ (16) (n −1)⁴
Cryptography
Proposed method 1
( 1.63 x 10 ) ˆ 2(24)(n −1)ˆ 2(2 ˢ − 1)(2 ᵐ −1)(120 ⁿ −1)(3 ⁿ −1)(6)
8

5 Conclusion

This paper proposed an improved method for hiding secret information within DNA sequence to
increase the security and confidentiality of the data. Residue number system is merged with the
DNA sequence, which added more permutations and combinations that provides more security,
flexibility with less complexity. The encrypted message is converted to a DNA sequence and
later hidden within a reference DNA sequence, which is known only by the sender and the
receiver. This reference sequence can be selected from any web-site associated with DNA
sequences. Since there are many web-sites and roughly 163 million publicly available DNA
sequences, it is virtually impossible to guess this sequence. The improved method outperformed
existing methods either in term of speed or security due to the parallel computation ability of
both residue number system and DNA and it extremely low cracking probability.

Reference

1. Krishnan RB, Thandra PK, Sai Baba M (2017) An overview of text steganography. In:
2017 4th international conference on signal processing, communication and networking
(ICSCN). IEEE
2. Sokół B, Yarmolik VN (2005) Cryptography and steganography: teaching experience.
Enhanced methods in computer security, biometric and artificial intelligence systems.
Springer, Boston,
3. Vinodhini RE, Malathi P, Gireesh Kumar T (2017) A survey on DNA and image
steganography. 2017 4th International Conference on Advanced Computing and
Communication Systems (ICACCS). IEEE
4. Selvaraj D (2017) Development of a secure communication system based on
steganography for mobile devices. p 3
5. Samiha M., Ahmed S., Khaled N. (2017). Utilizing DNA Strands for Secured Data-
Hiding with High Capacity. International Journal of Interactive Mobile Technology, Vol.
11, No 2.
6. Ahsan O., Muhammad I.F. (2015). DNA Cryptography Algorithms and applications.
HiTech University.
7. Malathi P., [Link]. (2017). Highly Improved DNA Based Steganography. 7th International
Conference on Advances in Computing & Communications, ICACC, Procedia Computer
Science 115, 651–659.
8. Roy S.S., [Link]. (2017). A Novel Encryption Model for Text Messages using Delayed
Chaotic Neural Network and DNA Cryptography. 20th International Conference of
Computer and Information Technology (ICCIT).
9. K.A. Gbolagade and S.D. Cotofana (2008). A residue to binary converter for the
{2n+2;2n+1;2n} moduli set. Proceedings of 42nd Asilomar Conference on Signals,
Systems, and Computers, pp. 1785-1789.
10. Khalifa A. LSBase: A key encapsulation scheme to improve hybrid crypto-systems using
DNA steganography. In 8th IEEE International Conference on Computer Engineering &
Systems (ICCES) 2013; 105-110.
11. O.A. Al-Harbi, W.E. Alahmadi, A.O. Aljahdali (2020). Security analysis of DNA based
steganography techniques. Springer Nature journal, SN Applied Sciences 2:172.
12. E.I. Abd El-Latif, M.I. Moussa (2019). Information hiding using artificial DNA
sequences based on Gaussian kernel function. Journal of Information and Optimization
Sciences ISSN: 0252-2667. 2169-0103.
13. Sohal, Sharma (2018). BDNA-A DNA inspired symmetric key cryptographic technique
to secure cloud computing. Journal of King Saud University - Computer and Information
Sciences.
14. H.D. Tiwari, J.H. Kim (2018). Novel Method for DNA‐ Based Elliptic Curve
Cryptography for IoT Devices. ETRI Journal, Volume 40, Number 3.

You might also like