21-03-2026

9610WMDPYQEY25003 MD

PHYSICS

1) A physical quantity of the dimensions of length that can be formed out of c, G and is [c is
velocity of light, G is universal constant of gravitation and e is charge] :-

(1)

(2)

(3)

(4)

2) Taking into account of the significant figures, what is the value of 9.99 m – 0.0099 m ?

(1) 9.9 m
(2) 9.9801 m
(3) 9.98 m
(4) 9.980 m

3) If the velocity of a particle is v = At + Bt2, where A and B are constants, then the distance
travelled by it between 1s and 2s is :-

(1)

(2) 3A + 7B

(3)

(4)

4) The position-time (x – t) graph for positive acceleration is :

(1)
(2)

(3)

(4)

5) In the diagram shown, the normal reaction force between 2 kg and 1 kg is (Consider the surface,

to be smooth): Given g = 10 ms–2

(1) 25 N
(2) 39 N
(3) 6 N
(4) 10 N

6) A ball of mass 0.5 kg is dropped from a height of 40 m. The ball hits the ground and rises to a
height of 10 m. The impulse imparted to the ball during its collision with the ground is (Take g = 9.8
m/s2)

(1) 21 NS
(2) 7 NS
(3) 0
(4) 84 NS

7) The potential energy of a long spring when stretched by 2 cm is U. If the spring is stretched by 8
cm, potential energy stored in it will be :

(1) 4U
(2) 8U
(3) 16U
(4) 2U
8) A block of mass 10 kg is in contact against the inner wall of a hollow cylindrical drum of radius
1m. The coefficient of friction between the block and the inner wall of the cylinder is 0.1. The
minimum angular velocity needed for the cylinder to keep the block stationary when the cylinder is
vertical and rotating about its axis, will be : (g = 10 m/s2)

(1) rad/s

(2)
rad/s
(3) 10 rad/s
(4) 10π rad/s

9) A bob of heavy mass m is suspended by a light string of length l. The bob is given a horizontal
velocity v0 as shown in figure. If the string gets slack at some point P making an angle θ from the
horizontal, the ratio of the speed v of the bob at point P to its initial speed v0 is :

(1)

(2)

(3)

(4)

10) Given below are two statements : one is labelled as Assertion (A) and the other is labelled as
Reason (R),
Assertion (A) :
When a fire cracker (rocket) explodes in mid air, its fragments fly in such a way that they continue
moving in the same path, which the fire cracker would have followed, had it not exploded.
Reason (R) :
Explosion of cracker (rocket) occurs due to internal forces only and no external force acts for this
explosion.
In the light of the above statements, choose the most appropriate answer from the options given
below :

(1) Both (A) and (R) are correct and (R) is the correct explanation of (A)
(2) Both (A) and (R) are correct but (R) is not the correct explanation of (A)
(3) (A) is correct but (R) is not correct
(4) (A) is not correct but (R) is correct
11) A rope is wound around a hollow cylinder of mass 3 kg and radius 40 cm. What is the angular
acceleration of the cylinder if the rope is pulled with a force of 30 N ?

(1) 0.25 rad/s2

(2) 25 rad/s2
(3) 5 m/s2
(4) 25 m/s2

12) Find the torque about the origin when a force of acts on a particle whose position vector is
:

(1)
(2)
(3)
(4)

13) Starting from the centre of the earth having radius R, the variation of g (acceleration due to
gravity) is shown by :-

(1)

(2)

(3)

(4)

14) Assuming that the gravitational potential energy of an object at infinity is zero, the change in
potential energy (final – initial) of an object of mass m, when taken to a height h from the surface of
earth (of radius R), is given by,
(1)

(2)

(3) mgh

(4)

15) A soap bubble, having radius of 1 mm, is blown from a detergent solution having a surface
tension of 2.5 × 10–2 N/m. The pressure inside the bubble equals at a point Z0 below the free surface
of water in a container. Taking g = 10 m/s2 density of water = 103 kg/m3, the value of Z0 is :-

(1) 100 cm
(2) 10 cm
(3) 1 cm
(4) 0.5 cm

16) A capillary tube of radius r is immersed in water and water rises in it to a height h. The mass of
the water in the capillary is 5g. Another capillary tube of radius 2r is immersed in water. The mass
of water that will rise in this tube is :

(1) 20.0 g
(2) 2.5 g
(3) 5.0 g
(4) 10.0 g

17) Two rods one made of copper and other made of steel of the same length and same cross
sectional area are joined together. The thermal conductivity of copper and steel are 385 J s–1 K–1 m–1
and 50 J s–1 K–1 m–1 respectively. The free ends of copper and steel are held at 100°C and 0°C
respectively. The temperature at the junction is, nearly:

(1) 12°C
(2) 50°C
(3) 73°C
(4) 88.5°C

18) Given below are two statements: One is labelled as Assertion A and the other is labelled as
Reason R.
Assertion A : Houses made of concrete roofs overlaid with foam keep the room hotter during
summer.
Reason R : The layer of foam insulation prohibits heat transfer, as it contains air pockets.
In the light of the above statements, choose the correct answer from the options given below :

(1) A is true but R is false.

(2) A is false but R is true.
(3) Both A and R are true and R is the correct explanation of A.
(4) Both A and R are true but R is NOT the correct explanation of A.
19) The distance covered by a particle undergoing SHM in one time period is (amplitude = A) :-

(1) zero
(2) A
(3) 2A
(4) 4A

20) If x = 5 sin m represents the motion of a particle executing simple harmonic motion, the
amplitude and time period of motion respectively, are :

(1) 5 cm, 2 s
(2) 5 m, 2 s
(3) 5 cm, 1 s
(4) 5 m, 1 s

21) In a guitar, two strings A and B made of same material are slightly out of tune and produce beats
of frequency 6 Hz. When tension in B is slightly decreased, the beat frequency increases to 7 Hz. If
the frequency of A is 530 Hz, the original frequency of B will be:

(1) 537 Hz
(2) 523 Hz
(3) 524 Hz
(4) 536 Hz

22) An organ pipe filled with a gas at 27°C resonates at 400 Hz in its fundamental mode. If it is filled
with the same gas at 90°C, the resonance frequency at the same mode will be :-

(1) 420 Hz
(2) 440 Hz
(3) 484 Hz
(4) 512 Hz

23) Two point charges A and B, having charges +Q and –Q respectively, are placed at certain
distance apart and force acting between them is F. If 25% charge of A is transferred to B, then force
between the charges becomes :

(1) F

(2)

(3)

(4)

24)

A sphere encloses an electric dipole with charge ±3 × 10–6 C. What is the total electric flux across
the sphere ?

(1) –3 × 10–6 Nm2/C

(2) zero
(3) 3 × 10–6 Nm2/C
(4) 6 × 10–6 Nm2/C

25) The capacitance of a parallel plate capacitor with air as medium is 6µF. With the introduction of
a dielectric medium, the capacitance becomes 30 µF. The permittivity of the medium is : (ε0 = 8.85 ×
10–12 C2 N–1 m–2)

(1) 5.00 C2 N–1 m–2

(2) 0.44 × 10–13 C2 N–1 m–2
(3) 1.77 × 10–12 C2 N–1 m–2
(4) 0.44 × 10–10 C2 N–1 m–2

26) A parallel plate capacitor having cross-sectional area A and separation d has air in between the
plates. Now an insulating slab of same area but thickness d/2 is inserted between the plates as
shown in figure having dielectric constant K(= 4). The ratio of new capacitance to its original

capacitance will be,

(1) 2 : 1
(2) 8 : 5
(3) 6 : 5
(4) 4 : 1

27)

In the circuits shown below, the readings of the voltmeters and the ammeters will be :

(1) V2 > V1 and i1 = i2

(2) V1 = V2 and i1 > i2
(3) V1 = V2 and i1 = i2
(4) V2 > V1 and i1 > i2

28) The reading of an ideal voltmeter in the circuit shown is :

(1) 0.6 V
(2) 0 V
(3) 0.5 V
(4) 0.4 V

29) Two toroids 1 and 2 have total number of turns 200 and 100 respectively with average radii 40
cm and 20 cm respectively. If they carry same current i, then the ratio of the magnetic fields along
the two is :

(1) 1 : 1
(2) 4 : 1
(3) 2 : 1
(4) 1 : 2

30) A wire of length L metre carrying a current of I ampere is bent in the form of a circle. Its
magnetic moment is,

(1) I L2/4 A m2
(2) I π L2 /4 A m2
(3) 2 I L2/π A m2
(4) I L2/4π A m2

31) In which of the following devices, the eddy current effect is not used?

(1) induction furnace

(2) magnetic braking in train
(3) electromagnet
(4) electric heater

32) A cycle wheel of radius 0.5 m is rotated with constant angular velocity of 10 rad/s in a region of
magnetic field of 0.1 T which is perpendicular to the plane of the wheel. The EMF generated
between its centre and the rim is,
(1) 0.25 V
(2) 0.125 V
(3) 0.5 V
(4) zero

33) A series LCR circuit is connected to an ac voltage source. When L is removed from the circuit,

the phase difference between current and voltage is . If instead C is removed from the circuit, the

phase difference is again between current and voltage. The power factor of the circuit is :

(1) –1.0
(2) zero
(3) 0.5
(4) 1.0

34) A light bulb and an inductor coil are connected to an ac source through a key as shown in the
figure below. The key is closed and after sometime an iron rod is inserted into the interior of the
inductor. The glow of the light bulb

(1) decreases
(2) remains unchanged
(3) will fluctuate
(4) increases

35) Light with an average flux of 20 W/cm2 falls on a non-reflecting surface at normal incidence
having surface area 20 cm2. The energy received by the surface during time span of 1 minute is :-

(1) 48 × 103 J
(2) 10 × 103 J
(3) 12 × 103 J
(4) 24 × 103 J

36) For a plane electromagnetic wave propagating in x-direction, which one of the following
combination gives the correct possible directions for electric field (E) and magnetic field (B)
respectively ?

(1)
(2)
(3)
(4)
37) A beam of light from a source L is incident normally on a plane mirror fixed at a certain distance
x from the source. The beam is reflected back as a spot on a scale placed just above the source L.
When the mirror is rotated through a small angle θ, the spot of the light is found to move through a
distance y on the scale. The angle θ is given by :-

(1)

(2)

(3)

(4)

38) An object is placed at a distance of 40 cm from a concave mirror of focal length 15 cm. If the
object is displaced through a distance of 20 cm towards the mirror, the displacement of the image
will be :-

(1) 30 cm away from the mirror

(2) 36 cm away from the mirror
(3) 30 cm towards the mirror
(4) 36 cm towards the mirror

39) A microscope has an objective of focal length 2 cm, eyepiece of focal length 4 cm and the tube
length of 40 cm. If the distance of distinct vision of eye is 25 cm, the magnification in the microscope
is :

(1) 100
(2) 125
(3) 150
(4) 250

40) The interference pattern is obtained with two coherent light sources of intensity ratio n. In the

interference pattern, the ratio will be :-

(1)

(2)

(3)

(4)

41) A linear aperture whose width is 0.02 cm is placed immediately in front of a lens of focal length
60 cm. The aperture is illuminated normally by a parallel beam of wavelength 5 × 10–5 cm. The
distance of the first dark band of the diffraction pattern from the centre of the screen is :-
(1) 0.20 cm
(2) 0.15 cm
(3) 0.10 cm
(4) 0.25 cm

42) An electromagnetic wave of wavelength 'λ' is incident on a photosensitive surface of negligible

work function. If 'm' mass is of photoelectron emitted from the surface has de-Broglie wavelength λd,
then :

(1)

(2)

(3)

(4)

43) If an electron in a hydrogen atom jumps from the 3rd orbit to the 2nd orbit, it emits a photon of
wavelength λ. When it jumps from the 4th orbit to the 3rd orbit, the corresponding wavelength of
the photon will be :-

(1)

(2)

(3)

(4)

44) The circuit diagram shown here corresponds to the logic gate,

(1) NOR
(2) AND
(3) OR
(4) NAND
45) The solids which have the negative temperature coefficient of resistance are :

(1) insulators and semiconductors

(2) metals
(3) insulators only
(4) semiconductors only

CHEMISTRY

1) A 0.1 molal aqueous solution of a weak acid is 30% ionized. If Kƒ for water is 1.86°C/m, the
freezing point of the solution will be :-

(1) –0.24°C
(2) –0.18°C
(3) –0.54°C
(4) –0.36°C

2) Equal volumes of two monoatomic gases, A and B, at same temperature and pressure are mixed.
The ratio of specific heats (Cp/Cv) of the mixture will be:-

(1) 3.3
(2) 1.67
(3) 0.83
(4) 1.50

3) Molar conductivities ( ) at infinite dilution of NaCl, HCl and CH3COONa are 126.4, 425.9 and
2 –1
91.0 S cm mol respectively. for CH3COOH will be :-

(1) 290.8 S cm2 mol–1

(2) 390.5 S cm2 mol–1
(3) 425.5 S cm2 mol–1
(4) 180.5 S cm2 mol–1

4) The orbital angular momentum of a p-electron is given as :-

(1)

(2)

(3)

(4)

5)
Given the reaction between 2 gases represented by A2 and B2 to give the compound AB(g).
A2(g) + B2(g) = 2AB(g).
At equilibrium, the concentration
of A2 = 3.0 × 10–3 M
of B2 = 4.2 × 10–3 M
of AB = 2.8 × 10–3 M
If the reaction takes place in a sealed vessel at 527°C, then the value of KC will be :-

(1) 0.62
(2) 4.5
(3) 2.0
(4) 1.9

6) What is the maximum numbers of electrons that can be associated with the following set of
quantum numbers ? n = 3, l = 1 and m = –1

(1) 2
(2) 10
(3) 6
(4) 4

7) A reaction having equal energies of activation for forward and reverse reactions has :-

(1) ΔH = ΔG = ΔS = 0
(2) ΔS = 0
(3) ΔG = 0
(4) ΔH = 0

8) A hydrogen gas electrode is made by dipping platinum wire in a solution of HCl of pH = 10 and by
passing hydrogen gas around the platinum wire at one atm pressure. The oxidation potential of
electrode would be ?

(1) 1.18 V
(2) 0.059 V
(3) 0.59 V
(4) 0.118 V

9) The weight of silver (at wt. = 108) displaced by a quantity of electricity which displaces 5600 mL
of O2 at STP will be :-

(1) 5.4 g
(2) 10.8 g
(3) 54.0 g
(4) 108.0 g

10) A device that converts energy of combustion of fuels like hydrogen and methane, directly into
electrical energy is known as :-
(1) Electrolytic cell
(2) Dynamo
(3) Ni-Cd cell
(4) Fuel Cell

11) A mixture of gases contains H2 and O2 gases in the ratio of 1 : 4 (w/w). What is the molar ratio of
the two gases in the mixture ?

(1) 4 : 1
(2) 16 : 1
(3) 2 : 1
(4) 1 : 4

12) The Ksp of Ag2CrO4, AgCl, AgBr and AgI are respectively, 1.1 × 10–12, 1.8 × 10–10, 5.0 × 10–13, 8.3
× 10–17. Which one of the following salts will precipitate last if AgNO3 solution is added to the
solution containing equal moles of NaCl, NaBr, NaI and Na2CrO4 ?

(1) AgCl
(2) AgBr
(3) Ag2CrO4
(4) AgI

13) What is the pH of the resulting solution when equal volumes of 0.1 M NaOH and 0.01 M HCl are
mixed?

(1) 7.0
(2) 1.04
(3) 12.65
(4) 2.0

14) Which is the strongest acid in the following?

(1) H2SO3
(2) H2SO4
(3) HClO3
(4) HClO4

15) Which of the following orders of ionic radii is correctly represented ?

(1) H– > H+ > H

(2) Na+ > F – > O2–
(3) F – > O2– > Na+
(4) Al3+ > Mg2+ > N3–

16) The pair of compounds that can exist together is:-

(1) FeCl3, SnCl2
(2) HgCl2, SnCl2
(3) FeCl2, SnCl2
(4) FeCl3, Kl

17) Be2+ is isoelectronic with which of the following ions?

(1) H+
(2) Li+
(3) Na+
(4) Mg2+

18) Which of the following molecules has the maximum dipole moment ?

(1) CO2
(2) CH4
(3) NH3
(4) NF3

19) Which one of the following species has planar triangular shape ?

(1)
(2)
(3)
(4) CO2

20) Acidity of diprotic acids in aqueous solutions increases in the order :-

(1) H2S < H2Se < H2Te

(2) H2Se < H2S < H2Te
(3) H2Te < H2S < H2Se
(4) H2Se < H2Te < H2S

21) Among the following complexes the one which shows Zero crystal field stabilization energy
(CFSE) is :-

3+
(1) [Mn(H2O)6]
3+
(2) [Fe(H2O)6]
2+
(3) [Co(H2O)6]
3+
(4) [Co(H2O)6]

22) Magnetic moment 2.83 BM is given by which of the following ions ?

(At. nos. Ti = 22, Cr = 24, Mn = 25, Ni = 28):-

(1) Ti3+
(2) Ni2+
(3) Cr3+
(4) Mn2+

23) Which of the following complexes is used to be as an anticancer agent?

(1) mer-[Co(NH3)3Cl3]
(2) cis-[PtCl2(NH3)2]
(3) cis-K2[PtCl2Br2]
(4) Na2CoCl4

24) Reason of lanthanoid contraction is :-

(1) Negligible screening effect of 'f' orbitals

(2) Increasing nuclear charge
(3) Decreasing nuclear charge
(4) Decreasing screening effect

25) Gadolinium belongs to 4f series. It's atomic number is 64. Which of the following is the correct
electronic configuration of gadolinium?

(1) [Xe] 4f75d16s2

(2) [Xe] 4f65d26s2
(3) [Xe] 4f86d2
(4) [Xe] 4f95s1

26) The formation of the oxide ion, O2– (g), from oxygen atom requires first an exothermic and then
an endothermic step as shown below : O(g) + e– → ; ΔfH! = –141 kJ mol–1

+ e– → ; ΔfH! = +780 kJ mol–1

Thus process of formation of O2– in gas phase is unfavourable even thought O2– is isoelectronic with
neon. It is due to the fact that,

(1) Oxygen is more electronegative

(2) Addition of electron in oxygen results in larger size of the ion
(3) Electron repulsion outweighs the stability gained by achieving noble gas configuration
(4) O– ion has comparatively smaller size than oxygen atom

27) On heating which of the following releases CO2 most easily ?

(1) MgCO3
(2) CaCO3
(3) K2CO3
(4) Na2CO3

28) Decreasing order of stability of O2, O2–, O2+ and O22– is :-

 + 2– –
(1) O2 > O2 > O2 > O2
– 2– +
(2) O2 > O2 > O2 > O2
+ – 2–
(3) O2 > O2 > O2 > O2
2– – +
(4) O2 > O2 > O2 > O2

29) Which of the following compounds is most basic ?

(1)

(2)

(3)

(4)

30) Which of the following is not a fat soluble vitamin ?

(1) Vitamin A
(2) Vitamin B complex
(3) Vitamin D
(4) Vitamin E

31) Which of the following compounds undergoes nucleophilic substitution reaction most easily ?

(1)

(2)
(3)

(4)

32) An organic compound 'A' on treatment with NH3 gives 'B' which on heating gives 'C'. 'C' when
treated with Br2 in the presence of KOH produces ethylamine. Compound 'A' is :-

(1) CH3CH2COOH
(2) CH3COOH
(3) CH3CH2CH2COOH

(4)

33) The order of reactivity of phenyl magnesium bromide (PhMgBr) with the following compounds:-

(1) I > II > III

(2) III > II > I
(3) II > I > III
(4) I > III > II

34) Consider the reaction :

(i) (CH3)2CH–CH2Br (CH3)2CH–CH2OC2H5 + HBr
(ii) (CH3)2CH–CH2–Br (CH3)2CH–CH2OC2H5 + Br–
The mechanisms of reaction (i) and (ii) are respectively :-

(1) and
(2) and
(3) and

(4) and

35) Which of the following compounds will give a yellow precipitate with iodine and alkali ?

(1) Acetamide
(2) 2-Hydroxypropane
(3) Acetophenone
(4) Methyl acetate

36) An organic compound (C3H9N) (A), when treated with nitrous acid, gave an alcohol and N2 gas
was evolved. (A) on warming with CHCl3 and caustic potash gave (C) which on reduction gave
isopropylmethylamine. Predict the structure of (A):

(1)

(2) CH3CH2CH2–NH2

(3)

(4) CH3CH2–NH–CH3

37) The radical, is aromatic because it has :-

(1) 6p–orbitals and 7 unpaired electrons

(2) 6p–orbitals and 6 unpaired electrons
(3) 7p–orbitals and 6 unpaired electrons
(4) 7p–orbitals and 7 unpaired electrons

38) In the reaction A is

+
(1) H /H2O
(2) HgSO4/H2SO4
(3) Cu2Cl2
(4) H3PO2 and H2O

39) The order of stability of the following tautomeric compounds is :-

(1) II > III > I
(2) I > II > III
(3) III > II > I
(4) II > I > III

40) Structure of the compound whose IUPAC name is 3–Ethyl–2–hydroxy–4–methylhex–3–en–5–ynoic

acid is :-

(1)

(2)

(3)

(4)

41) Reaction by which Benzaldehyde cannot be prepared :-

(1)
+ Zn/Hg and conc. HCl

(2)
+CrO2Cl2 in CS2 followed by H3O⊕

(3)
+ H2 in presence of Pd+BaSO4
(4)

in presence of anhydrous AlCl3

42) In collision theory of chemical reaction, ZAB represents

(1) The fraction of molecules with energies greater than Ea

(2) The collision frequency of reactants, A and B
(3) Steric factor
(4) The fraction of molecules with energies equal to Ea

43) At standard conditions, if the change in the enthalpy for the following reaction is –109 kJ mol–1
H2(g) + Br2(g) → 2HBr(g)
Given that bond energy of H2 and Br2 is 435 kJ mol–1 and 192 kJ mol–1, respectively, what is the bond
energy (in kJ mol–1) of HBr ?

(1) 368
(2) 736
(3) 518
(4) 259

44) Which of the following reaction is correct ?

(1)

(2)

(3)

(4) C2H5CONH2 + Br2 + NaOH → C2H5CH2NH2 + Na2CO3 + NaBr + H2O

45) The product (P) formed from the following multistep reaction is :

(1)

(2)

(3)
(4)

BIOLOGY

1) In the taxonomic categories which hierarchial arrangement in ascending order is correct in case
of animals ?

(1) Kingdom, Class, Phylum, Family, Order, Genus, Species

(2) Kingdom, Order, Class, Phylum, Family, Genus, Species
(3) Kingdom, Order, Phylum, Class, Family, Genus, Species
(4) Kingdom, Phylum, Class, Order, Family, Genus, Species

2) Match List-I with List-II.

List-I List-II

A. Rhizopus I. Mushroom

B. Ustilago II. Smut fungus

C. Puccinia III. Bread mould

D. Agaricus IV. Rust fungus

Choose the correct answer from the options given below :-
(1) A-III, B-II, C-IV, D-I
(2) A-I, B-III, C-II, D-IV
(3) A-III, B-II, C-I, D-IV
(4) A-IV, B-III, C-II, D-I

3) Which of the following algae produce Carrageen ?

(1) Green algae

(2) Brown algae
(3) Red algae
(4) Blue-green algae

4) Match the plant with the kind of life cycle it exhibits:

List-I List-II

Dominant diploid sporophyte vascular plant, with highly reduced male or

(a) Spirogyra (i)
female gametophyte

(b) Fern (ii) Dominant haploid free-living gametophyte

Dominant diploid sporophyte alternating with reduced gametophyte called

(c) Funaria (iii)
prothallus
 Dominant haploid leafy gametophyte alternating with partially dependent
(d) Cycas (iv)
multicellular sporophyte
Choose the correct answer from the options given below:
(1) (a)–(ii), (b)–(iii), (c)–(iv), (d)–(i)
(2) (a)–(iii), (b)–(iv), (c)–(i), (d)–(ii)
(3) (a)–(ii), (b)–(iv), (c)–(i), (d)–(iii)
(4) (a)–(iv), (b)–(i), (c)–(ii), (d)–(iii)

5) The correct sequence of events in the life cycle of bryophytes is

A. Fusion of antherozoid with egg.
B. Attachment of gametophyte to substratum.
C. Reduction division to produce haploid spores.
D. Formation of sporophyte.
E. Release of antherozoids into water.
Choose the correct answer from the options given below:

(1) D, E, A, C, B
(2) B, E, A, C, D
(3) B, E, A, D, C
(4) D, E, A, B, C

6) Match the following:

List-I List-II

(a) Physalia (i) Pearl oyster

(b) Limulus (ii) Portuguese Man of War

(c) Ancylostoma (iii) Living fossil

(d) Pinctada (iv) Hookworm

Choose the correct answer from the options given below.

(a) (b) (c) (d)

(1) (ii) (iii) (i) (iv)

(2) (iv) (i) (iii) (ii)

(3) (ii) (iii) (iv) (i)

(4) (i) (iv) (iii) (ii)

(1) 1
(2) 2
(3) 3
(4) 4

7) In which of the following animals, digestive tract has additional chambers like crop and gizzard ?

(1) Bufo, Balaenoptera, Bangarus

(2) Catla, Columba, Crocodilus
(3) Pavo, Psittacula, Corvus
(4) Corvus, Columba, Chameleon

8) Select the Incorrect statements with respect to Cyclostomes :

(a) They lack scales and paired fins.
(b) They have circular mouth with Jaws.
(c) They bear 6-15 pairs of gills.
(d) They migrate to deep sea for spawning.
Choose the most appropriate answer from the options given below :

(1) (a) and (b) only

(2) (b) and (c) only
(3) (b) and (d) only
(4) (a) and (d) only

9) The following are the TRUE statements about non-chordates :-

A. Pharynx is perforated by gill slits.
B. Notochord is absent.
C. Central nervous system is dorsal.
D. Heart is dorsal if present.
E. Post anal tail is absent.

(1) A & C only

(2) A, B & D only
(3) B, D & E only
(4) B, C & D only

10) Identify the correct set of statements:-

(a) The leaflets are modified into pointed hard thorns in Citrus and Bougainvillea
(b) Axillary buds form slender and spirally coiled tendrils in cucumber and pumpkin
(c) Stem is flattened and fleshy in Opuntia and modified to perform the function of leaves
(d) Rhizophora shows vertically upward growing roots that help to get oxygen for respiration
(e) Subaerially growing stems in grasses and strawberry help in vegetative propagation
Choose the correct answer from the options given below:

(1) (a) and (d) Only

(2) (b), (c), (d) and (e) Only
(3) (a), (b), (d) and (e) Only
(4) (b) and (c) Only

11) The flowers are Zygomorphic in:-

(a) Mustard
(b) Gulmohar
(c) Cassia
(d) Datura
(e) Chilly
Choose the correct answer from the options given below:

(1) (b), (c) Only

(2) (d), (e) Only
(3) (c), (d), (e) Only
(4) (a), (b), (c) Only

12)

Match List-I with List-II.

List I List II

A. Rose I. Twisted aestivation

B. Pea II. Perigynous flower

C. Cotton III. Drupe

D. Mango IV. Marginal placentation

Choose the correct answer from the options given below :-
(1) A-II, B-IV, C-I, D-III
(2) A-I, B-II, C-III, D-IV
(3) A-IV, B-III, C-II, D-I
(4) A-II, B-III, C-IV, D-I

13)

Match List-I with List-II.

Select the correct answer from the options given below.

(1) a-(ii) b-(iv) c-(i) d-(iii)

(2) a-(iv) b-(iii) c-(ii) d-(i)
(3) a-(i) b-(ii) c-(iii) d-(iv)
(4) a-(iii) b-(ii) c-(iv) d-(i)

14) The anatomy of springwood shows some peculiar features. Identify the correct set of statements
about springwood.
(a) It is also called as the earlywood
(b) In spring season cambium produces xylem elements with narrow vessels
(c) It is lighter in colour.
(d) The springwood along with autumnwood shows alternate concentric rings forming annual rings.
(e) It has lower density
Choose the correct answer from the options given below :

(1) (a), (c), (d) and (e) only

(2) (a), (b) and (d) only
(3) (c), (d) and (e) only
(4) (a), (b), (d) and (e) only

15) Given below are two statements :

Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are false.

(2) Statement I is true but Statement II is false.
(3) Statement I is false but Statement II is true.
(4) Both Statement I and Statement II are true.

16) Tegmina in cockroach, arises from:

(1) Mesothorax
(2) Metathorax
(3) Prothorax and Mesothorax
(4) Prothorax

17) Which of the following is/are present in female Cockroach ?

A. Collateral gland
B. Mushroom gland
C. Spermatheca
D. Anal style
E. Phallic gland
Choose the most appropriate answer from the options given below :

(1) B and D only

(2) B and E only
(3) A only
(4) A and C only

18) Frogs respire in water by skin and buccal cavity and on land by skin, buccal cavity and lungs.
Choose the correct answer from the following :

(1) The statement is true for water but false for land.
(2) The statement is true for both the environment.
(3) The statement is false for water but true for land.
(4) The statement is false for both the environment.

19) Which of the following functions is carried out by cytoskeleton in a cell ?

(1) Protein synthesis

(2) Motility
(3) Transpiration
(4) Chromosome formation

20) Match List I with List II.

List I List II
A. Nucleolus I. Site of formation of glycolipid
B. Centriole II. Organization like the cartwheel
C. Leucoplasts III. Site for active ribosomal RNA synthesis
D. Golgi apparatus IV. For storing nutrients
Choose the correct answer from the options given below :
(1) A-III, B-II, C-IV, D-I
(2) A-II, B-III, C-I, D-IV
(3) A-III, B-IV, C-II, D-I
(4) A-I, B-II, C-III, D-IV

21) From the statements given below choose the correct option:
A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S.
B. Each ribosome has two sub-units.
C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S.
D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S.
E. The two sub-units of 80S ribosome are 60S and 30S and that of 70S are 50S and 30S.

(1) A, B, C are true

(2) A, B, D are true
(3) A, B, E are true
(4) B, D, E are true

22) Match List - I with List - II :

List - I List - II
(a) Adenine (i) Pigment
(b) Anthocyanin (ii) Polysaccharide
(c) Chitin (iii) Alkaloid
(d) Codeine (iv) Purine
Choose the correct answer from the options given below :

(1) (a)–(iv), (b)–(i), (c)–(ii), (d)–(iii)

(2) (a)–(iv), (b)–(iii), (c)–(ii), (d)–(i)
(3) (a)–(iii), (b)–(i), (c)–(iv), (d)–(ii)
(4) (a)–(i), (b)–(iv), (c)–(iii), (d)–(ii)

23) Primary proteins are also called as polypeptides because :

(1) They are linear chains

(2) They are polymers of protein
(3) Successive amino acids are joined by peptide bonds
(4) They can assume many conformations

24) Given below are two statements :

Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-
terminal) and the right end represented by last amino acid (N-terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two
subunits β type.)
In the light of the above statements, choose the correct answer from the options given below :

(1) Both Statement I and Statement II are false

(2) Statement I is true but Statement II is false
(3) Statement I is false but Statement II is true
(4) Both Statement I and Statement II are true

25) Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken
E. Substrate binding to active site.
Choose the correct answer from the options given below:

(1) E, A, D, C, B
(2) A, E, B, D, C
(3) B, A, C, D, E
(4) E, D, C, B, A

26) Which of the following stages of meiosis involves division of centromere ?

(1) Metaphase I
(2) Metaphase II
(3) Anaphase II
(4) Telophase II

27) With respect to metaphase, which of the following statements is incorrect ?

(1) Complete disintegration of nuclear envelope takes place

(2) Chromosomes are highly condensed
(3) Metaphase chromosomes are made up of four sister chromatids held together by centromere
(4) Chromosomes lie at the equator of the cell
28) Match List I with List II :

List-I List-II
(A) M Phase (I) Proteins are synthesized
(B) G2 Phase (II) Inactive phase
Interval between mitosis and
(C) Quiescent stage (III)
initiation of DNA replication
(D) G1 Phase (IV) Equational division
Choose the correct answer from the options given below:
(1) A-IV, B-II, C-I, D-III
(2) A-IV, B-I, C-II, D-III
(3) A-II, B-IV, C-I, D-III
(4) A-III, B-II, C-IV, D-I

29) Select the correct statements :

A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:

(1) B and D only

(2) A, C and E only
(3) B and E only
(4) A and C only

30) Which micronutrient is required for splitting of water molecule during photosynthesis ?

(1) Molybdenum
(2) Magnesium
(3) Copper
(4) Manganese

31) Which one of the following products diffuses out of chloroplast during photosynthesis?

(1) ADP
(2) NADPH
(3) O2
(4) ATP

32) Match List I with List II.

List I List II

A. Chlorophyll a I. Yellow-green
 B. Chlorophyll b II. Yellow

C. Xanthophylls III. Blue-green

D. Carotenoids IV. Yellow to Yellow-orange

Choose the option with all correct matches.
(1) A-III, B-IV, C-II, D-I
(2) A-III, B-I, C-II, D-IV
(3) A-I, B-II, C-IV, D-III
(4) A-I, B-IV, C-III, D-II

33) The number of time(s) decarboxylation of isocitrate occurs during single TCA cycle is :

(1) One
(2) Two
(3) Three
(4) Four

34) Match List I with List II :

Choose the correct answer from the options given below :

(1) A-II, B-IV, C-I, D-III

(2) A-III, B-I, C-II, D-IV
(3) A-II, B-IV, C-III, D-I
(4) A-III, B-IV, C-II, D-I

35) Which of the following growth regulators is an adenine derivative ?

(1) Auxin
(2) Cytokinin
(3) Ethylene
(4) Abscisic acid

36) The phenomenon by which the undividing parenchyma cells start to divide mitotically during
plant tissue culture is called as :

(1) Differentiation
(2) Dedifferentiation
(3) Redifferentiation
(4) Secondary growth
37) Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as
auxin

(1) promotes apical dominance.

(2) promotes abscission of mature leaves only.
(3) does not affect mature monocotyledons plants.
(4) can help in cell division in grasses, to produce growth.

38) Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?

(1) High pO2 and High pCO2

+
(2) High pO2 and Lesser H concentration
+
(3) Low pCO2 and High H concentration
(4) Low pCO2 and High temperature

39) Match List I with List II.

List I List II

A. P wave I. Heart muscles are electrically silent.

B. QRS complex II. Depolarisation of ventricles.

C. T wave III. Depolarisation of atria.

D. T-P gap IV. Repolarisation of ventricles.

Choose the correct answer from the options given below :-
(1) A-I, B-III, C-IV, D-II
(2) A-III, B-II, C-IV, D-I
(3) A-II, B-III, C-I, D-IV
(4) A-IV, B-II, C-I, D-III

40) Given below are two statements : one is labelled as

Assertion (A) and the other is labelled as Reason (R)
Assertion (A) : Ascending limb of loop of Henle is impermeable to water and allows transport of
electrolytes actively or passively.
Reason (R) : Dilution of filtrate takes place due to efflux of electrolytes in the medullary fluid.
In the light of the above statements, choose the correct answer from the options given below :

(1) (A) is true but (R) is false

(2) (A) is false but (R) is true
(3) Both (A) and (R) are true and (R) is the correct explanation of (A)
(4) Both (A) and (R) are true and (R) is not the correct explanation of (A)

41) Match List-I with List-II.

List I List II

A Fibrous joints I Adjacent vertebrae, limited movement

 Cartilaginous
B II Humerus and Pectoral girdle, rotational
joints

C Hinge joints III Skull, don’t allow any movement

Ball and socket

D IV Knee, help in locomotion
joints
Choose the correct answer from the options given below :-
(1) A-IV, B-II, C-III, D-I
(2) A-I, B-III, C-II, D-IV
(3) A-II, B-III, C-I, D-IV
(4) A-III, B-I, C-IV, D-II

42) Given below are two statements :-

Statement-I : The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement-II : The brain stem consists of the medulla oblongata, pons and cerebrum. In the light of
the above statements, choose the most appropriate answer from the options given below:

(1) Both Statement I and Statement II are correct.

(2) Both Statement I and Statement II are incorrect.
(3) Statement I is correct but Statement II is incorrect.
(4) Statement I is incorrect but Statement II is correct.

43) Match List-I with List-II.

List-I List-II
Excess secretion of cortisol, moon face
A. Exophthalmic goitre I.
& hyperglycemia.
Hypo-secretion of thyroid hormone and
B. Acromegaly II.
stunted growth.
Hyper secretion of thyroid hormone &
C. Cushing’s syndrome III.
protruding eye balls.
Excessive secretion of growth
D. Cretinism IV.
hormone.
Choose the correct answer from the options given below :-
(1) A-I, B-III, C-II, D-IV
(2) A-IV, B-II, C-I, D-III
(3) A-III, B-IV, C-II, D-I
(4) A-III, B-IV, C-I, D-II

44) Identify the wrong statements :-

(A) Erythropoietin is produced by juxtaglomerular cells of the kidney
(B) Leydig cells produce Androgens
(C) Atrial Natriuretic factor, a peptide hormone is secreted by the seminiferous tubules of the testes.
(D) Cholecystokinin is produced by gastro-intestinal tract
(E) Gastrin acts on intestinal wall and helps in the production of pepsinogen
Choose the most appropriate answer from the options given below :-
(1) D and E only
(2) A and B only
(3) C and E only
(4) A and C only

45) The residual persistent part which forms the perisperm in the seeds of beet is :

(1) Calyx
(2) Endosperm
(3) Nucellus
(4) Integument

46) Identify the correct description about the given figure :

(1) Wind pollinated plant inflorescence showing flowers with well exposed stamens.
(2) Water pollinated flowers showing stamens with mucilaginous covering.
(3) Cleistogamous flowers showing autogamy
(4) Compact inflorescence showing complete autogamy.

47) How many meiotic and mitotic divisions need to occur for the development of a mature female
gametophyte from the megaspore mother cell in an angiosperm plant ?

(1) 2 Meiosis and 3 Mitosis

(2) 1 Meiosis and 2 Mitosis
(3) 1 Meiosis and 3 Mitosis
(4) No Meiosis and 3 Mitosis

48) How many secondary spermatocytes are required to form 400 million spermatozoa ?

(1) 50 million
(2) 100 million
(3) 200 million
(4) 400 million

49) Given below are two statements : one is labelled as Assertion (A) and the other is labelled as
Reason (R).
Assertion (A) : During pregnancy the level of thyroxine is increased in the maternal blood.
Reason (R) : Pregnancy is characterised by metabolic changes in the mother.
In the light of the above statements, choose the most appropriate answer from the options given
below :

(1) Both (A) and (R) are correct and (R) is the correct explanation of (A)
(2) Both (A) and (R) are correct but (R) is not the correct explanation of (A)
(3) (A) is correct but (R) is not correct
(4) (A) is not correct but (R) is correct

50) Arrange the sequence of different hormones for their role during gametogenesis.
(A) Gonadotropin LH stimulates synthesis and secretion of Androgen
(B) Gonadotropin releasing hormone from hypothalamus
(C) Androgen stimulates spermatogenesis
(D) Gonadotropin FSH helps in the process of spermiogenesis
(E) Gonadotropins from anterior pituitary gland.
Choose the correct answer from the options given below :

(1) (E), (A), (D), (B), (C)

(2) (C), (A), (D), (E), (B)
(3) (B), (E), (A), (C), (D)
(4) (D), (B), (A), (C), (E)

51) Which of the following is not a natural/traditional contraceptive method ?

(1) Coitus interruptus

(2) Periodic abstinence
(3) Lactational amenorrhea
(4) Vaults

52) Match List-I with List-II :

List-I List-II
A. Non-medicated IUD I. Multiload 375
B. Copper releasing IUD II. Progestogens
C. Hormone releasing IUD III. Lippes loop
D. Implants IV. LNG-20
Choose the correct answer from the options given below:
(1) A-III, B-I, C-II, D-IV
(2) A-I, B-III, C-IV, D-II
(3) A-IV, B-I, C-II, D-III
(4) A-III, B-I, C-IV, D-II

53) Assuming that fur colour of an animal is dark, range of colour shade and white. A cross is made
between a male (AABBCC) with dark fur colour and a female (aabbcc) with white fur colour. What
would be the fur colour of F1 generation?

(1) Range of colour shade

(2) All dark colour
(3) All white colour
(4) All intermediate colour

54) A low frequency recombination indicates that the genes are :

(1) Located close to each other

(2) Not linked
(3) Present on different chromosome
(4) Located far apart from each other

55) Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also
expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:

(1) C and D only

(2) B and E only
(3) A and E only
(4) A and B only

56) Which one of the following can be explained on the basis of Mendel’s Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in F2 generation.
C. Factors occur in pairs in normal diploid plants.
D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below :

(1) A, B and C only

(2) A, C, D and E only
(3) B, C and D only
(4) A, B, C, D and E

57) Match List-I with List-II :

List-IType of Inheritance List-IIExample

A. Incomplete dominance I. Blood groups in human
B. Co-dominance II. Flower colour in Antirrihinum
C. Pleiotropy III. Skin colour in human
D. Polygenic inheritance IV. Phenylketonuria
Choose the correct answer from the options given below :-
(1) A-III, B-IV, C-II, D-I
(2) A-II, B-I, C-IV, D-III
(3) A-II, B-III, C-I, D-IV
(4) A-IV, B-I, C-III, D-II

58) Identify the correct statement.

(1) In capping, methyl guanosine triphosphate is added to the 3' end of hnRNA.
(2) RNA polymerase binds with Rho factor to terminate the process of transcription in bacteria.
(3) The coding strand in a transcription unit is copied to an mRNA.
(4) Split gene arrangement is characteristic of prokaryotes.

59) DNA fingerprinting involves identifying differences in some specific regions in DNA sequence,
called as :

(1) Satellite DNA

(2) Repetitive DNA
(3) Single nucleotides
(4) Polymorphic DNA

60) Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and
Termination in the process of transcription in prokaryotes?

(1) DNA dependent DNA polymerase

(2) DNA dependent RNA polymerase
(3) DNA Ligase
(4) DNase

61) Expressed Sequence Tags (ESTs) refers to

(1) All genes that are expressed as proteins.

(2) All genes whether expressed or unexpressed.
(3) Certain important expressed genes.
(4) All genes that are expressed as RNA.

62) How many different proteins does the ribosome consist of?

(1) 60
(2) 40
(3) 20
(4) 80

63) Which one of the following is the sequence on corresponding coding strand, if the sequence on
mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
(1) 3' UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5'
(2) 5' ATCGATCGATCGATCGATCGATCGATCG 3'
(3) 3' ATCGATCGATCGATCGATCGATCGATCG 5'
(4) 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'

64) Given below are two statements regarding RNA polymerase in prokaryotes.
Statement-I: In prokaryotes, RNA polymerase is capable of catalysing the process of elongation
during transcription. Statement-II: RNA polymerase associate transiently with 'Rho' factor to
initiate transcription.
In the light of the above statements, choose the correct answer from the options given below :-

(1) Statement I is true but Statement II is false

(2) Statement I is false but Statement II is true
(3) Both Statement I and Statement II are true
(4) Both Statement I and Statement II are false

65) Which of the following are the post-transcriptional events in an eukaryotic cell ?
A. Transport of pre-mRNA to cytoplasm prior to splicing.
B. Removal of introns and joining of exons.
C. Addition of methyl group 5’ end of hnRNA.
D. Addition of adenine residues at 3’ end of hnRNA.
E. Base pairing of two complementary RNAs.
Choose the correct answer from the options given below :

(1) A, B, C only
(2) B, C, D only
(3) B, C, E only
(4) C, D, E only

66) Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.

(1) Numbat, Spotted cuscus, Flying phalanger

(2) Mole, Flying squirrel, Tasmanian tiger cat
(3) Lemur, Anteater, Wolf
(4) Tasmanian wolf, Bobcat, Marsupial mole

67) Match List I with List II.

List-I List-II
A. Mesozoic Era I. Lower invertebrates
B. Proterozoic Era II. Fish & Amphibia
C. Cenozoic Era III. Birds & Reptiles
D. Paleozoic Era IV. Mammals
Choose the correct answer from the options given below :-
(1) A-II, B-I, C-III, D-IV
(2) A-III, B-I, C-II, D-IV
(3) A-I, B-II, C-IV, D-III
(4) A-III, B-I, C-IV, D-II

68) Given below are two statements :

Statement I : Autoimmune disorder is a condition where body defense mechanism recognizes its
own cells as foreign bodies.
Statement II : Rheumatoid arthritis is a condition where body does not attack self cells.
In the light of the above statements, choose the most appropriate answer from the options given
below :

(1) Both Statement I and Statement II are incorrect

(2) Statement I is correct but Statement II is incorrect
(3) Statement I is incorrect but Statement II is correct
(4) Both Statement I and Statement II are correct

69) Match List-I with List-II.

List-I List-II
A. Malignant tumors I. Destroy tumors
B. MALT II. AIDS
C. NACO III. Metastasis
D. a-Interferons IV. Lymphoid tissue
Choose the correct answer from the options given below :-
(1) A-III, B-IV, C-II, D-I
(2) A-IV, B-III, C-II, D-I
(3) A-III, B-IV, C-I, D-II
(4) A-III, B-I, C-IV, D-II

70) After maturation, in primary lymphoid organs, the lymphocytes migrate for interaction with
antigens to secondary lymphoid organ(s) / tissue(s) like:
A. thymus
B. bone marrow
C. spleen
D. lymph nodes
E. Peyer's patches
Choose the correct answer from the options given below:

(1) B, C, D only
(2) A, B, C only
(3) E, A, B only
(4) C, D, E only

71) Which of the following microbes is NOT involved in the preparation of household products?
A. Aspergillus niger
B. Lactobacillus
C. Trichoderma polysporum
D. Saccharomyces cerevisiae
E. Propionibacterium sharmanii
Choose the correct answer from the options given below:

(1) A and B only

(2) A and C only
(3) C and D only
(4) C and E only

72) DNA strands on a gel stained with ethidium bromide when viewed under UV radiation, appear as
:

(1) Yellow bands

(2) Bright orange bands
(3) Dark red bands
(4) Bright blue bands

73) A specific recognition sequence identified by endonucleases to make cuts at specific positions
within the DNA is :

(1) Degenerate primer sequence

(2) Okazaki sequences
(3) Palindromic Nucleotide sequences
(4) Poly(A) tail sequences

74) Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a
correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:

(1) C, A, B, D
(2) C, B, D, A
(3) B, D, A, C
(4) B, C, D, A

75) Which of the following statements is incorrect?

(1) A bio-reactor provides optimal growth conditions for achieving the desired product.
(2) Most commonly used bio-reactors are of stirring type.
(3) Bio-reactors are used to produce small scale bacterial cultures.
(4) Bio- reactors have an agitator system, an oxygen delivery system and foam control system.
76)
In the above represented plasmid an alien piece of DNA is inserted at EcoRI site. Which of the
following strategies will be chosen to recombinant colonies?

(1) Using ampicillin & tetracyclin containing medium plate.

(2) Blue color colonies will be selected.
(3) White color colonies will be selected.
(4) Blue color colonies grown on ampicillin plates can be selected.

77) With regard to insulin choose correct options.

(a) C-peptide is not present in mature insulin.
(b) The insulin produced by rDNA technology has C-peptide.
(c) The pro-insulin has C-peptide.
(d) A-peptide and B-peptide of insulin are interconnected by disulphide bridges.
Choose the correct answer from the options given below.

(1) (b) and (d) only

(2) (b) and (c) only
(3) (a), (c) and (d) only
(4) (a) and (d) only

78) Transposons can be used during which one of the following ?

(1) Gene silencing

(2) Autoradiography
(3) Gene sequencing
(4) Polymerase Chain Reaction

79) The Bt-toxin in genetically engineered Bt-cotton kills the pest by :-

(1) Creating pores in the midgut.

(2) Damaging the respiratory system.
(3) Degenerating the nervous system.
(4) Altering the pH of body fluids.

80) Following are the steps involved in action of toxin in Bt. Cotton.
(A) The inactive toxin converted into active form due to alkaline pH of gut of insect.
(B) Bacillus thuringiensis produce crystals with toxic insecticidal proteins.
(C) The alkaline pH solubilises the crystals.
(D) The activated toxin binds to the surface of midgut cells, creates pores and causes death of the
insect.
(E) The toxin proteins exist as inactive protoxins in bacteria.

(1) E → C → B → A → D
(2) B → C → A → E → D
(3) A → E → B → D → C
(4) B → E → C → A → D

81) Amensalism can be represented as :

(1) Species A (–); Species B (0)

(2) Species A (+); Species B (+)
(3) Species A (–); Species B (–)
(4) Species A (+); Species B (0)

82) If a pond has 40 lotus plants last year and through reproduction 8 new plants are added, taking
the current population to 48, what will be the birth rate?

(1) 0.6 offspring per lotus per year

(2) 0.5 offspring per lotus per year
(3) 0.2 offspring per lotus per year
(4) 0.1 offspring per lotus per year

83) Match List I with List II :

List I List II
(Interaction) (Species A and B)

A. Mutualism I. +(A), O(B)

B. Commensalism II. –(A), O(B)

C. Amensalism III. +(A), –(B)

D. Parasitism IV. +(A), +(B)

Choose the correct answer from the options given below:
(1) A–IV, B–I, C–II, D–III
(2) A–IV, B–III, C–I, D–II
(3) A–III, B–I, C–IV, D–II
(4) A–IV, B–II, C–I, D–III

84) What do 'a' and 'b' represent in the following population growth curve ?
 'a' represents exponential growth when
(1)
responses are not limiting the growth; and 'b' represents Iogistic growth when responses
'a' represents logistic growth when responses are not limiting the growth; 'b' represents
(2)
exponential growth when responses are limiting the growth.
'a' represents carrying capacity and 'b'shows logistic growth when responses are limiting the
(3)
growth.
'a' represents exponential growth when
(4)
responses are not limiting the growth and 'b' shows carrying capacity.

85) Which of the following statements is not correct?

(1) Pyramid of biomass in sea is generally inverted.

(2) Pyramid of biomass in sea is generally upright.
(3) Pyramid of energy is always upright.
(4) Pyramid of numbers in a grassland ecosystem is upright.

86) Identify the correct statements :

A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called
leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the option given below:

(1) B, C, D only
(2) C, D, E only
(3) D, E, A only
(4) A, B, C only

87) Given below are two statements :

Statement-I: The primary source of energy in an ecosystem is solar energy.
Statement-II: The rate of production of organic matter during photosynthesis in an ecosystem is
called net primary productivity (NPP).
In the light of the above statements, choose the most appropriate answer from the options given
below :
(1) Both statement I and statement II are correct.
(2) Both statement I and statement II are incorrect.
(3) Statement I is correct but statement II is incorrect.
(4) Statement I is incorrect but statement II is correct.

88) Habitat loss and fragmentation, over exploitation, alien species invasion and co-extinction are
causes for :

(1) Competition
(2) Biodiversity loss
(3) Natality
(4) Population explosion

89) The World Summit on sustainable development held in 2002 in Johannesburg, South Africa
pledged for :

(1) A significant reduction in the current rate of biodiversity loss.

(2) Declaration of more biodiversity hotspots.
(3) Increase in agricultural production
Collection and preservation of seeds of different genetic strains of commercially important
(4)
plants.

90) Match List-I with List-II :

List-I List-II
(a) Sacred groves (i) Alien species
(b) Zoological park (ii) Release of large quantity of oxygen
(c) Nile perch (iii) Ex-situ conservation
(d) Amazon forest (iv) Khasi Hills in Meghalaya
Choose the correct answer from the options given below :
(1) (a)–(iv), (b)–(iii), (c)–(i), (d)–(ii)
(2) (a)–(ii), (b)–(iv), (c)–(i), (d)–(iii)
(3) (a)–(iv), (b)–(i), (c)–(ii), (d)–(iii)
(4) (a)–(iv), (b)–(iii), (c)–(ii), (d)–(i)
 ANSWER KEYS

PHYSICS

Q. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
A. 4 3 3 1 1 1 3 3 4 4 2 4 4 2 3 4 4 2 4 2
Q. 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
A. 3 2 2 2 4 2 3 4 1 4 4 2 4 1 4 2 4 2 2 4
Q. 41 42 43 44 45
A. 2 3 1 1 1

CHEMISTRY

Q. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
A. 1 2 2 3 1 1 4 3 4 4 1 3 3 4 2 3 2 3 2 1
Q. 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85
A. 2 2 2 1 1 3 1 3 3 2 2 1 1 4 2 3 2 4 3 3
Q. 86 87 88 89 90
A. 1 2 1 2 4

BIOLOGY

Q. 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
A. 4 1 3 1 3 3 3 3 3 2 1 1 1 1 1 1 4 3 2 1
Q. 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
A. 1 1 3 3 1 3 3 2 1 4 3 2 2 3 2 2 3 2 2 3
Q. 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150
A. 4 3 4 3 3 1 3 3 1 3 4 4 4 1 2 2 2 2 2 2
Q. 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170
A. 4 4 2 1 2 1 4 2 1 4 2 2 3 4 3 3 3 1 1 4
Q. 171 172 173 174 175 176 177 178 179 180
A. 1 3 1 1 2 4 3 2 1 1
 SOLUTIONS

PHYSICS

1) [L] = [c]a [G]b

[L] = [LT–1]a [M–1L3T–2]b

[L] = La+3b+3c M–b+c T–a–2b–2c
a + 3b + 3c =1
–b + c = 0
a + 2b + 2c = 0
On solving,

a = – 2, b = , c =

∴L= .

2) In subtraction the number of decimal places in the result should be equal to the number of
decimal places of that term in the operation which contain lesser number of decimal places.

3)

4)

(if coefficients of t2 is positive (a > 0) upward opening parabola)

5)

FBD of 1kg

N – 18 – 5 = 1(2)
N = 25 N

6) = –28 m/s
= 14 m/s

= 0.5 [14– (–28)]

= 0.5 × 42 = 21 NS

7)
for x = 2

…(1)

…(2)
Eq. (2)/eq. (1)

8) Explain Question : A 10 kg block is pressed against a vertical rotating cylinder's inner

wall. We must find the minimum angular velocity so friction can hold the block up.
Concept : This question is based on friction provides weight support; normal reaction comes
from rotation.
Solution :
fL = μN = μmrω2
fs = mg
As fs ≤ fL
⇒ mg ≤ μmrω2

⇒
⇒ ωmin = 10 rad/s
Final answer : 3

9)

C.O.M.E. ......(i)

At pt P Tp + mg sin θ (as Tp = 0)

mg sin θ =
⇒ mg sin θ ......(ii)
From (i) & (ii)

....(iii)

10) Assertion (A):

 "When a firecracker (rocket) explodes in mid-air, its fragments fly in such a way that they
continue moving in the same path, which the firecracker would have followed, had it not
exploded."

A. This statement is incorrect. When a firecracker explodes, the fragments move in different
directions based on the force of the explosion. The fragments do not follow the same path as
the original firecracker unless the explosion is symmetric and the rocket's motion is exactly
along its original path. Generally, due to the explosion, fragments move along different
trajectories.

Reason (R):
"Explosion of cracker (rocket) occurs due to internal forces only and no external force acts for this
explosion."

A. This statement is correct. The explosion occurs due to internal forces, as the gases inside the
rocket push outward, but there is no external force involved in the explosion itself (if we
assume no air resistance).

Conclusion:

A. Assertion (A) is not correct.

B. Reason (R) is correct.

Thus, the correct answer is:

Option 4: (A) is not correct but (R) is correct.

11) τ = Iα
RF = mR2α

12)

13) for 0 < r ≤ Re ⇒ g∝r

for r ³ Re ⇒

14) ΔU = –GMm

= –GMm
=

15) Explain Question:

A soap bubble with a given radius is blown in a detergent solution. The pressure inside the
bubble is measured at a certain depth below the water's free surface. We need to calculate this
depth.

Concept :
Pressure inside a Soap Bubble and Depth.

Solution :
The pressure at depth Z0 is given by the hydrostatic equation P = P0 + ρgZ0. The pressure

inside the bubble, due to surface tension, is P = . Equating both expressions for
pressure:

0
ρgZ =
Substituting the given values:

0
Z =

Final Answer : Option (3)

16)

17)

⇒ 77(100 – θ) = 10 θ

⇒ 7700 – 77θ = 10 θ

⇒ 87 θ = 7700 ⇒ θ = = 88.5°C

18) Houses made of concrete roofs overlaid with foam keep the room colder during summer.

19) Distance in one oscillation = 4A

20) x = 5 sin
comparing with x = A sin (ωt + ϕ)
we get A = 5 m and ω = π

⇒T=

21) Guitar string i.e. string is fixed from both ends Frequency ∝

If tension in B slightly decrease then frequency of B decrease.

If B is 536 Hz, as the frequency decreases, beats with A also decreases.
If B is 524 Hz, as the frequency decreases, beats with A increases.
∴ Original frequency of B will be 524 Hz.

22)

23)

25% charge from A is transferred to B

New force (F') = .

24)

25)
Cm = ∈rCo ⇒ ∈r = =5
∈ = ∈0∈r = 8.85 × 10–12 × 5 = 0.44 × 10–10

26)

27)
10Ω is in series with ideal voltmeter.
Therefore it will not affect the circuit (Circuit-2)

i1 = = 1A i2 = = 1A
V1 = 10V V2 = 10V.

28)

(V1 – V2) = = = 0.4 V

29) B =

30)

M = I (πr2) Where,
 ⇒ M = I (π)

31) Explanation: According to the properties of eddy currents and the instrument given in the
option we need to identify the instrument which not used the properties of eddy current.
Ans. The device in which the eddy current effect is not used is an electric heater.
Concept: Eddy Currents are induced currents in a conductor when there is a change in
magnetic flux through the conductor. These currents can cause energy loss in the form of heat.
In an electric heater, the primary purpose is to convert electrical energy into heat energy. This
is achieved through resistive heating, where the electrical resistance of the heating element
causes it to heat up when current passes through it. Eddy currents are not a significant factor
in this process.
In induction furnaces, magnetic breaking, and electromagnets, eddy currents are intentionally
induced to achieve specific effects, such as heating metals, slowing down moving objects, or
generating magnetic fields.

32) Explanation: For a rotating conducting conductor in magnetic field EMF will be
generated.
Here's how we can calculate the induced emf:
Given:

A. Radius of wheel, r = 0.5m

B. Angular velocity, ω = 10 rad/s
C. Magnetic field, B = O.1T

Concept: When the wheel rotates in a magnetic field, the radial lines connecting the center to the
rim act as conductors cutting through the magnetic field lines. This induces as emf across each
radial line.
Calculation: For the rotated conductor here, the spokes in the wheel the emf generated across the
center of wheel and rim of the wheel is give by the ....

emf =

=
emf = 0.5 × 0.5 × 0.5 = 0.125 volt.
All the redial lines (spokes) are connected in parallel:
In a parallel connection, the potential difference across each component is the same.

33)

here XC = XL
⇒ϕ=0
⇒ power factor cos ϕ = cos 0 = 1

34) Impedance, z =
XL , Z , I ↓

35) ⇒ =
3
= 24 × 10 J

36) is parallel to (as )

Option (1)
Option (2) (parallel to )
Option (3)
Option (4)

37)

2θ = ; θ=

38) (i)
(ii)

= –60 cm
Displacement of image = v2 – v1 = –36 cm = 36 cm away from the mirror

39)

f0 = 2cm fe = 4 cm
L = 40 cm D = 25 cm
In the condition of normal adjustment.

= 125

40) Let

Dividing numerator and denominator by I2

required ratio

41) f = D = 60 cm
For first minima,

= 0.15 cm

42) Question is Asking About:

Here we have to find the de-Broglie wavelength of photo electron emitted when wore of is
given and work function and negligible.

Concept:
Einstein equation of PEE

Formula:
 [given ϕ is negligible]

so,

and

43) Explanation :- Here we have to find the wavelength of photon if electron jump from 3rd to
2nd orbit emits to photon of wavelength . Then if electron jump from up to 3rd orbit
Concept :- Energy emitted when electron jumps from Higher Energy state to lower energy
state

Formula
Calculation When electron Transit from 3 → 2 wavelength .

When transit from 4 → 3rd wavelength .

44) NOR gate

45) In semiconductors and insulators, the number of charge carries per unit volume increases
with an increase in temperature, so ∝ is negative for these.

CHEMISTRY

46)

Let the weak acid be HX.

i = 1 – α + nα = 1 + (2 – 1) × 0.3 = 1.3
ΔTƒ = i × Kƒ × m
= 1.3 × 1.86 × 0.1 = 0.24°C
ΔTƒ = 0 – (f.p.)solution
∴ (f.p.)solution = – 0.24°C
47) For monoatomic gases

48) (CH3COOH) =
= 91.0 + 425.9 – 126.4
= 390.5 S cm2mol–1

49) Orbital angular momentum of a p-electron is given by =

50)

KC = 0.62

51) n = 3, = 1 and m = –1 represent a 3p-orbital so maximum 2 electrons can be accomodate

in it.

52)

ΔH = (Ea)f – (Ea)b
Given : (Ea)f = (Ea)b
∴ ΔH = 0

53) H2(g) —→ H+ + e–

EO.P. = E°O.P. – log

EO.P. = 0 – log (pH = 10, [H+] = 10–10 M)

EO.P. = 0.59 V

54)
According to faraday's 2nd law

​
∴ wAg = 108g

55) A device that converts energy of combustion of fuels, directly into electrical energy is
known as fuel cell.

56)

57)

= maxm
so answer is Ag2CrO4

58)

N1V1 – N2V2 = N.V.

0.1 × 1 – 0.01 × 1 = N × 2

[OH– ] = NR = = 0.045 N
pOH = – log (0.045) = 1.35
∴ pH = 14 – pOH = 14 – 1.35 = 12.65

59)

Option : (4)
HClO4

60)

Option : (2)
Na+ > F – > O2–

61) Both are reducing agent

62) Be+2 & Li+ both have 2 electron.

63)

64) has sp2 hybridisation i.e. has planar shape.

65) On moving down the group bond length increases so liberation tendency of H will be more.

66) Due to d5 configuration and H2O is a weak ligand.

67) Ni+2 has two unpaired electron. (3d8 configuration)

68) Cis-platin is used as an anticancer agent.

69) Due to poor shielding of f-orbitals, nucleus will exert a strong attraction, Causes
lanthanoid contraction.

70)

71)

Option : (3)
Electron repulsion outweighs the stability gained by achieving noble gas configuration

72)

Thermal stability order

Therefore MgCO3 releases CO2 most easily

73)

Given species : O2, O2–1, O2+1, O22–

Total number of electrons
* Stability order

74) lone pair on N is not involved in resonance so availability of e– on

N(donor atom) is relatively more

75) Vitamin B complex

76)
Intermediate formed during the reaction is carbanion, so presence of electron withdrawing
group increases stability of intermediate resulting in increased reactivity of compound.

77)

78) Mechanism involved in reaction of PhMgBr with carbonyl compound is nucleophilic

addition reaction
Reactivity of carbonyl compounds for the reaction depends on d+ on carbonyl carbon and
steric hindrance on carbonyl carbon.
Reactivity ∝ d+ on carbonyl carbon
79) Reaction does not involve rearrangement

80)

Option : (2)
2-Hydroxypropane

81)

82) Benzyl free radical is aromatic as per Huckel's rule it has 6p electreons
present in p-orbital of carbon atoms involved in formation of benzene ring (Aromatic nature).

6π electrons and 6 p orbitals

83)

84) Stability order is

 85)
3-Ethyl-2-hydroxy-4-methylhex-3-en-5-ynonic acid

86) In presence of Zn – Hg and conc. HCl reduction is useful specially for aldehyde and ketone
but carboxylic group remains uneffected

87) ZAB = Collision frequency

88)

ΔH = Σ(B.E)Reactants – Σ(B.E)Products
–109 = [B.E(H–H) + B.E(Br–Br)] – [2 × B.E(H– Br)]
–109 = 435 + 192 – 2 × B.E(H–Br)

B.E(H–Br) =
=368 KJ/mol

89)

90)

BIOLOGY
 91)

The correct answer is:

4. Kingdom, Phylum, Class, Order, Family, Genus, Species

Explanation: In the taxonomic hierarchy, the correct ascending order for animals is:
Kingdom > Phylum > Class > Order> Family > Genus > Species.

95)

The correct sequence of events is B, E, A, D, C.

(B) Haploid spores germinate to form a free-living gametophyte which requires attachment of
the gametophyte to a substratum.
(E) Male sex organs produce biflagellate antherozoids and entail the release of antherozoids
into water.
(A) They come in contact with the archegonium, leading to the fusion of antherozoid with the
egg to produce a zygote.
(D) The zygote develops into a multicellular body, resulting in the formation of a sporophyte.
(C).Certain cells of the sporophyte undergo reduction division to produce haploid spores.

99)

TRUE statements about non-chordates B, D & E only.

100) EXPLANATION (a) The leaflets are modified into pointed hard thorns in Citrus
and Bougainvillea: This is correct. In both Citrus and Bougainvillea, the leaflets or leaves
are modified into thorns for protection.
(b) Axillary buds form slender and spirally coiled tendrils in cucumber and pumpkin
This is correct. In cucumber and pumpkin, the axillary buds modify into tendrils that are
slender and spirally coiled, helping the plant to climb.
(c) Stem is flattened and fleshy in Opuntia and modified to perform the function of
leaves: This is correct. In Opuntia (a type of cactus), the stem is flattened and fleshy,
performing the functions of leaves, such as photosynthesis and water storage.
(d) Rhizophora shows vertically upward growing roots that help to get oxygen for
respiration: This is correct. In Rhizophora (a mangrove species), specialized aerial roots
grow upward obtain oxygen for respiration in the waterlogged environment.
(e) Subaerially growing stems in grasses and strawberry help in vegetative
propagation: This is correct. Both grasses and strawberries have subaerial stems (like
runners) that grow along the soil surface and help in vegetative propagation.
Correct answer: 2 (b), (c), (d), and (e) Only.

101) EXPLANATION Zygomorphic flowers are those that are symmetrical along only one
plane, meaning they can be divided into two identical halves only by one specific vertical
plane.
Gulmohar (Delonix regia): Gulmohar flowers are zygomorphic, as they are asymmetrical and
can be divided into two equal halves only along one plane.
Cassia: Cassia flowers are zygomorphic, characterized by bilateral symmetry.
Correct answer: (b), (c) Only.
 103)

104) Let's analyze each statement about springwood (earlywood) in the context of its
anatomical features:
(a) It is also called the earlywood.

A. This is correct. Springwood is commonly known as earlywood because it is produced at the

beginning of the growing season (spring) when the conditions are favorable for growth.

(b) In the spring season, cambium produces xylem elements with narrow vessels.

A. This is incorrect. In the spring, cambium produces wide vessels that allow for faster water
conduction. In contrast, in autumn, the cambium produces smaller, narrower vessels.

(c) It is lighter in colour.

A. This is correct. Springwood has a lighter color due to the larger vessel elements and less
dense structure.

(d) The springwood along with autumnwood shows alternate concentric rings forming
annual rings.

A. This is correct. An annual ring is typically formed by the alternating layers of springwood
(earlywood) and autumnwood (latewood), each season contributing to the growth of one ring.

(e) It has lower density.

A. This is correct. Springwood has a lower density because it is less compact due to the presence
of larger vessels and more open structure.

Correct answer:
Option 1: (a), (c), (d) and (e) only is the right choice.

106) Explanation:
In cockroaches, the tegmina are the forewings. They are hardened and leathery, and they
cover and protect the delicate hindwings when the cockroach is at rest. These forewings arise
from the mesothorax, the second segment of the thorax.
answer - 1

108)

Frogs respire in water by skin only.

109)

Explain Question : The question asks which cellular function is performed by the
cytoskeleton.

Concept : The Cell - Structure and Function: Cytoskeleton and its functions

Solution :
The cytoskeleton is a network of protein filaments that maintains cell shape and plays an
important role in cell movement, including amoeboid movement, cilia and flagella movement.

Final answer : Option (2)

112)

Explanation:

A. Adenine (a) → (iv) Purine

A. Adenine is a purine nitrogenous base found in DNA and RNA.

B. Anthocyanin (b) → (i) Pigment

A. Anthocyanins are flavonoid pigments responsible for red, blue, and purple colors in
plants.

C. Chitin (c) → (ii) Polysaccharide

A. Chitin is a structural polysaccharide found in fungal cell walls and the exoskeleton
of arthropods.

D. Codeine (d) → (iii) Alkaloid

A. Codeine is a plant-derived alkaloid used as a pain reliever.

Correct Answer: 1. (a)–(iv), (b)–(i), (c)–(ii), (d)–(iii)

113) Question Explanation: primary protein are also called polypeptide because

Concept: configuration of protein

Solution: Primary structure of proteins refers to the linear sequence of amino acids held
together by peptide bonds.

A. Peptide bonds are covalent bonds formed between the carboxyl (-COOH) group of one
amino acid and the amino (-NH₂) group of another, releasing water (dehydration
synthesis).

B. Since the primary structure consists of a chain of amino acids linked by peptide bonds, it
is also called a polypeptide.
Final answer: 3

114) Explanation:

A. Statement I is false: In a polypeptide or protein, the first amino acid (at the left end) is
the N-terminal (amino terminus), and the last amino acid (at the right end) is the C-
terminal (carboxyl terminus). The statement incorrectly reverses this order.

B. Statement II is true: Adult human hemoglobin (HbA) is a tetrameric protein composed of

four polypeptide chains:

A. 2 α (alpha) chains

B. 2 β (beta) chains
This structure is correct, making Statement II true.

Correct Answer: 3 (Statement I is false but Statement II is true)

120)

Explain Question: The question is asking which micronutrient is essential for the splitting of
the water molecule during photosynthesis.

Concept: Photolysis of Water

Solution:
The splitting of water (photolysis) takes place in Photosystem II during the light reaction of
photosynthesis. This process is carried out by the oxygen-evolving complex, which requires
manganese (Mn) as a key micronutrient. Manganese plays a vital role in releasing oxygen,
protons, and electrons from water.

Final answer: Option 4

121)

O2 diffuses out of the chloroplast during photosynthesis. The light reaction (photolysis of
water) splits water molecules to release oxygen as a byproduct, which diffuses out of the
chloroplasts and eventually out of the leaves. ATP and NADPH are produced during the light
reaction but are consumed within the chloroplast stroma to drive the dark reactions (Calvin
cycle).

123) Explain Question : The question is asking: “How many decarboxylation steps happen
starting from isocitrate onward in one full turn of the TCA cycle?”

Concept : Krebs cycle

Solution :

Decarboxylation of isocitrate is followed by two successive steps leading to the formation of

alpha-ketoglutaric acid and then succinyl-CoA.

- Isocitrate is converted to alpha-ketoglutarate, which is the reaction where the first CO2
molecule is released.

- A second decarboxylation occurs when alpha-ketoglutarate is converted to succinyl-CoA.

Therefore, the decarboxylation of isocitrate specifically happens one time per cycle.

Final answer: Option (2) . Two

126) Question Explanation: Parenchyma cells resuming division.

Concept: Dedifferentiation in tissue culture
Solution: Dedifferentiation is the process where mature, specialized cells, like parenchyma,
lose their specialization and regain the ability to divide. In plant tissue culture, this
phenomenon is induced to form an undifferentiated mass of cells called a callus, which can
then be used to regenerate a whole plant.
Final Answer: Dedifferentiation

127)

Auxin does not affect mature monocotyledons plants, synthetic auxins like 2,4-D are described
as widely used herbicides to kill dicotyledonous weeds in lawns, while leaving mature
monocotyledonous grass plants unharmed.

129)

A-III, B-II, C-IV, D-I

131)

A-III, B-I, C-IV, D-II

137)

1 Meiosis and 3 Mitosis divisions needed to occur for the development of a mature female
gametophyte from the megaspore mother cell in an angiosperm plant.

138)

In spermatogenesis, each secondary spermatocyte undergoes meiosis II to produce two

spermatids, which later develop into spermatozoa. Therefore, for every secondary
spermatocyte, two spermatozoa are formed.
To produce 400 million spermatozoa, we divide the total number of sperm by 2 (since each
 secondary spermatocyte forms two spermatozoa):
400 million spermatozoa 2=200 million secondary spermatocytes\frac{400\,\text{million
spermatozoa} {2} = 200 \,\text {million secondary spermatocytes} 2400 million spermatozoa
= 200 million secondary spermatocytes
Thus, 200 million secondary spermatocytes are required to form 400 million spermatozoa.

140)

Solution/Explanation:
1. (B) Gonadotropin releasing hormone (GnRH) from hypothalamus: The process of
gametogenesis begins with the release of GnRH from the hypothalamus. This hormone
stimulates the release of gonadotropins from the anterior pituitary gland.
2. (E) Gonadotropins from anterior pituitary gland: GnRH triggers the anterior pituitary
to release two key gonadotropins: Luteinizing Hormone (LH) and Follicle Stimulating
Hormone (FSH). These hormones are critical for the regulation of the gonads.
3. (A) Gonadotropin LH stimulates synthesis and secretion of Androgen: LH acts on the
Leydig cells in the testes, stimulating them to produce androgens (primarily testosterone),
which play a critical role in the development of sperm.
4. (C) Androgen stimulates spermatogenesis: The androgens (mainly testosterone)
stimulate spermatogenesis in the seminiferous tubules of the testes, leading to the production
of sperm cells.
5. (D) Gonadotropin FSH helps in the process of spermiogenesis: FSH acts on the
Sertoli cells in the testes, supporting the process of spermiogenesis, where spermatids are
transformed into mature sperm.

Conclusion:
The correct sequence of events is: (B), (E), (A), (C), (D), which corresponds to Option 3.
The correct answer is Option 3: (B), (E), (A), (C), (D)

141)

Coitus interruptus, Periodic abstinence and Lactational amenorrhea are natural/traditional

contraceptive method.

142)

A-III, B-I, C-IV, D-II

143)

The correct answer is:

4. All intermediate colour
Explanation:
In this case, the male has the genotype AABBCC (dark fur) and the female has the genotype
aabbcc (white fur). Since the male and female are true-breeding for the traits, the F1
generation will inherit one allele from each parent for each gene.

A. The male contributes AB C alleles, and the female contributes ab c alleles.

So, the F1 generation will have the genotype Aa Bb Cc for all offspring, which means they will all
have an intermediate fur color (a blend of dark and white). This suggests incomplete dominance or a
blending of traits, leading to an intermediate fur color.
Thus, the fur color of the F1 generation will be an intermediate color.

144)

The correct answer is:

1. Located close to each other
Explanation:
A low-frequency recombination indicates that the genes are closely linked on the same
chromosome. When genes are close together, the chance of a crossover event (which leads to
recombination) between them is low, so the genes tend to be inherited together. Conversely,
genes that are far apart or on different chromosomes have a higher chance of recombination.

145)

The correct answer is: 2. B and E only

Explanation:

A. A. This disorder was first described by Langdon Down (1866) is incorrect. Klinefelter's
Syndrome was first described by Harry Klinefelter in 1942, not Langdon Down, who is
associated with Down syndrome.

B. B. Such an individual has overall masculine development. However, the feminine

development is also expressed is correct. In Klinefelter's syndrome, individuals typically
have male genitalia and secondary male characteristics but may develop some female
characteristics, such as breast enlargement (gynecomastia), due to the extra X
chromosome.

C. C. The affected individual is short statured is incorrect. Individuals with Klinefelter's

syndrome are generally tall rather than short.

D. D. Physical, psychomotor, and mental development is retarded is incorrect. While

Klinefelter syndrome can be associated with mild developmental delays and learning
difficulties, it does not always result in significant retardation in physical, psychomotor,
or mental development.

E. E. Such individuals are sterile is correct. Individuals with Klinefelter's syndrome are
typically sterile due to the chromosomal abnormality affecting their sperm production.

Thus, the correct statements are B and E, so the answer is Option 2.

148)

This question is about understanding transcription and related molecular biology processes.
Explanation of the Correct Answer (Option 2) In bacteria, transcription termination can
occur in Rho-dependent
In Rho-dependent termination, the Rho factor is a helicase protein that binds to a specific
RNA 3159877 sequence . Once bound, it travels along the RNA, catches up with RNA
polymerase, and helps terminate transcription by disrupting the RNA-DNA hybrid in the
transcription bubble.
Thus, RNA polymerase works with Rho factor for transcription termination in
bacteria, making option 2 the correct statement.

149)

DNA fingerprinting identifies differences in specific regions of the DNA, primarily focusing on
repetitive sequences, which vary greatly among individuals and are inherited. These regions
are highly conserved and form the basis for unique DNA profiles.
Correct Answer: 2 - Repetitive DNA
Concept Repetitive DNA includes minisatellites (VNTRs) and microsatellites (STRs),
which are highly variable between individuals. These sequences are analyzed in DNA
fingerprinting because their repetitive nature makes them suitable for identifying genetic
differences. This variability is used in forensics, paternity testing, and genetic studies.

151) Expressed Sequence Tags (ESTs) are short sequences of cDNA ( complementary DNA)
that represent a portion of the mRNA transcribed from a gene. These sequences are derived
from expressed genes, meaning those genes that are actively transcribed into RNA. ESTs are
useful for identifying gene expression and characterizing genes in a given organism.

152) The ribosome consists of a combination of rRNA and proteins. The total number of
proteins in the ribosome of eukaryotes is approximately 80.

153)

The mRNA sequence is synthesized from the coding strand (also called the sense strand) of
DNA. The coding strand has the same sequence as the mRNA, except that thymine (T) in DNA
is replaced by uracil (U) in RNA.
To find the corresponding coding strand from the given mRNA sequence, we need to:
1. Replace uracil (U) in the mRNA with thymine (T), since uracil in RNA corresponds to
thymine in DNA.
2. Write the complementary sequence (because the mRNA is complementary to the template
strand of DNA).
Given the mRNA sequence:
5' AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'
We can convert it into the corresponding DNA sequence:
• Replace U with T:
5' ATCGATCGATCGATCGATCGATCGATCG 3'
Thus, the correct DNA coding strand sequence is:
5' ATCGATCGATCGATCGATCGATCGATCG 3'

156) Adaptive radiation is the process by which a single ancestral species diversifies into a
wide variety of forms to adapt to different ecological niches.
Among the given options, the correct group/set of Australian marsupials exhibiting
adaptive radiation is:
1. Numbat, Spotted cuscus, Flying phalanger.
These species belong to different ecological niches, exhibiting the diversification typical of
adaptive radiation in Australia.
Correct Answer:
1. Numbat, Spotted cuscus, Flying phalanger

158)

The correct answer is:2. Statement I is correct but Statement II is incorrect.

Statement I accurately describes autoimmune disorders, while Statement II is incorrect
because rheumatoid arthritis is indeed a condition where the body attacks its own cells.

159)

A-III, B-IV, C-II, D-I

161) Aspergillus niger and Trichoderma polysporum are NOT involved in the preparation of
household products. These are microbes involved in industrial products (citric acid and
Cyclosporin A, respectively). The others—Lactobacillus (curd), Saccharomyces cerevisiae
(bread), and Propionibacterium sharmanii (Swiss cheese)—are used for household products.

162) Ethidium bromide is a fluorescent dye used to stain DNA in agarose gel electrophoresis.
When DNA is stained with ethidium bromide and viewed under UV light, the dye intercalates
between the base pairs of the DNA and fluoresces, emitting a bright orange light. This makes
the DNA bands visible as bright orange bands under UV radiation.

163) Palindromic nucleotide sequences are specific DNA sequences that are recognized by
restriction endonucleases (or restriction enzymes). These enzymes make cuts at specific
positions within the DNA based on these sequences. The term "palindromic" refers to
sequences that read the same in both directions when read 5' to 3' on one strand and 3' to 5'
on the complementary strand. For example, the restriction enzyme EcoRI recognizes and cuts
the palindromic sequence GAATTC.
RNAi is a mechanism by which double-stranded RNA (dsRNA) induces the degradation of
complementary mRNA, thereby silencing specific genes.
Reason (R): "Nematode specific gene introduced in the host produces both sense and
antisense complementary RNA which initiate RNA interference in the host cell" is also correct.
This is a description of how RNA interference works. When a nematode-specific gene is
introduced into the host, it can be transcribed into both sense and antisense RNA strands.
These RNA strands then form double-stranded RNA ( dsRNA), which triggers RNA
interference, leading to the silencing of the nematode-specific gene and preventing its
function.
Since the reason directly explains why the assertion is true, (R) is the correct explanation of
(A). Thus, both statements are correct, and (R) correctly explains (A).

164) 1. B. Cutting of DNA at specific location by restriction enzyme:

 The first step is using restriction enzymes to cut the DNA at precise locations. This ensures
that you have manageable, specific DNA fragments to work with.
2. C. Isolation of desired DNA fragment:
After cutting the DNA, the desired gene or fragment is isolated. This is the step where you
pick the target gene from the fragmented DNA.
3. D. Amplification of gene of interest using PCR:
Once you've isolated the gene of interest, you can use PCR (Polymerase Chain Reaction) to
amplify it. This step ensures that you have enough copies of the gene for further work.
4. A. Insertion of recombinant DNA into the host cell:
Finally, after amplifying the gene, the recombinant DNA (which consists of the desired gene
inserted into a vector) is introduced into a host cell (like a bacterium) for replication and/or
expression.

165)

Bio-reactors are used to produce large scale bacterial [Link]-reactors are used to
produce large scale bacterial cultures.

168) Transposons, also known as jumping genes, are segments of DNA that can move from one
location to another within a genome. They are often used in gene silencing and other genetic
manipulation techniques. Transposons can be used to insert or disrupt genes in specific
locations, which is useful in studying gene function and regulating gene expression.

171)

The correct answer is:

1. Species A (-); Species B (0)
In amensalism, one species is harmed (-) while the other is neither helped nor harmed (0). An
example is when a large tree's canopy shades the ground, preventing smaller plants from
growing, while the tree itself is unaffected.

172) Given:

A. Initial population of lotus plants (last year) = 40

B. New plants added through reproduction = 8
C. Current population = 48

Calculation:

A. Birth rate is calculated as the number of new individuals born per individual in the population
per unit time.
B. In this case, the unit time is one year.
C. Birth rate = (Number of new plants) / (Initial population)
D. Birth rate = 8 / 40 = 0.2

Therefore, the birth rate is 0.2 offspring per lotus per year.
So, the correct answer is Option C.

173)
 Question Explanation :
Question asking about Match List I with List II:

Solution :

A. Mutualism (A–IV): Both species benefit → (+A, +B)

B. Commensalism (B–I): One benefits, the other is unaffected → (+A, 0B)
C. Amensalism (C–II): One is harmed, the other is unaffected → (–A, 0B)
D. Parasitism (D–III): One benefits, the other is harmed → (+A, –B)

Final Answer :
Option (1)

175)

The incorrect statement is 2. Pyramid of biomass in sea is generally upright.

Explanation: In marine ecosystems, particularly the open ocean, the pyramid of biomass is often
inverted. This means that the biomass of primary producers (phytoplankton) is smaller than the
biomass of primary consumers (zooplankton). This is because phytoplankton have a short lifespan
and reproduce rapidly, but their individual size is very small. Zooplankton on the other hand, can be
larger and have a greater total biomass despite feeding on the smaller phytoplankton.

176)

The correct answer is 4. A, B, C only.

Explanation:

A. A. Detrivores perform fragmentation: This is true. Detrivores (such as earthworms) break

down larger organic matter into smaller fragments.
B. B. The humus is further degraded by some microbes during mineralization: This is
true. Microbes degrade humus into simpler inorganic substances during the process of
mineralization.
C. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a
process called leaching: This is true. Leaching is the process where water-soluble nutrients
are carried away from the surface layers of soil, often into deeper layers.
D. D. The detritus food chain begins with living organisms: This is false. The detritus food
chain begins with dead organic matter (detritus), not living organisms.
E. E. Earthworms break down detritus into smaller particles by a process called
catabolism: This is false. Earthworms fragment the detritus, but catabolism refers to the
breakdown of complex molecules into simpler ones, which is done by microbes, not directly by
earthworms.

177)

Statement I: The primary source of energy in an ecosystem is indeed solar energy.

Statement II: The rate of production of organic matter during photosynthesis in an ecosystem
is actually called Gross Primary Productivity (GPP), not net primary productivity (NPP).
NPP is calculated by subtracting respiration losses (R) from GPP (NPP = GPP - R). Therefore,
Statement II is conceptually incorrect.
 178)

Habitat loss and fragmentation, over-exploitation, alien species invasion, and co-extinction are
all causes of biodiversity loss. These factors disrupt ecosystems and lead to a decrease in the
variety of life forms.
Correct answer: 2. Biodiversity loss.

179)

The World Summit on Sustainable Development held in 2002 in Johannesburg, South Africa,
pledged for a significant reduction in the current rate of biodiversity loss by 2010. This goal
was part of the global commitment to halt the ongoing loss of biodiversity and promote
sustainable development.
Correct answer: 1. A significant reduction in the current rate of biodiversity loss by 2010.

180)

Let's go through each option:

List-1:
(a) Sacred groves: These are traditional areas protected by local communities. One well-
known example is the Khasi Hills in Meghalaya.
(b) Zoological park: A zoological park is a facility where animals are kept for conservation
and research purposes, representing Ex-situ conservation.
(c) Nile perch: The Nile perch is an alien species that was introduced to Lake Victoria and
caused significant ecological disruption.
(d) Amazon forest: The Amazon rainforest is known for its vast biodiversity and is often
referred to as the "lungs of the Earth" due to its role in release of a large quantity of oxygen.
Now, let's match them correctly:

A. (a) Sacred groves → Khasi Hills in Meghalaya (iv)

B. (b) Zoological park → Ex-situ conservation (iii)
C. (c) Nile perch → Alien species (i)
D. (d) Amazon forest → Release of large quantity of oxygen (ii)

The correct answer is:

Option 1: (a) (iv), (b)(ii), (c)-(i), (d)-(ii).