Excellent, Assistant Lecturer — I’ll walk you through a clear, numbered, step-by-step plan

that covers everything you asked for: environment setup, choosing whether to use
Anaconda/Jupyter or VS Code, how to install Biopython (explain the two ways), how to fork &
clone the project, how to practice safely, and how to move from practice → first contribution. I’ll
show every command you need, tell you exactly where to run it (Anaconda Prompt, Git Bash,
VS Code terminal), and include short troubleshooting notes for common problems.

Quick summary first (one-line)

Use Conda for a dedicated dev environment, install Biopython via conda-forge for practice,
use Jupyter notebooks to learn and VS Code + Git for actual contributions; once you’re
comfortable, fork the GitHub repo, clone, pip install -e . and run tests locally before
opening PRs.

0. Preconditions (what you already have)

You said you already have:

 Python (system)
 Anaconda (good!)
 Jupyter Notebook
 VS Code
 Git Bash

Perfect — we’ll use those.

1. Create a clean conda environment

(recommended)
Use a dedicated environment so dependencies don’t clash.

1. Open Anaconda Prompt (recommended on Windows) or your terminal (Git Bash if

conda is initialized there).
2. Create and activate environment (I pick Python 3.10 as stable):

conda create -n biopython-dev python=3.10 -y

conda activate biopython-dev
If conda activate fails in Git Bash, open Anaconda Prompt or run conda init bash then
restart your shell.

3. Install essentials for practice:

# prefer conda-forge packages for bio stack stability

conda install -c conda-forge jupyterlab ipykernel pandas numpy matplotlib -y

4. Make this environment available as a Jupyter kernel:

python -m ipykernel install --user --name biopython-dev --display-name "Python

(biopython-dev)"

Now in Jupyter you can pick the Python (biopython-dev) kernel.

2. Two ways to install Biopython — which to

use when
There are two common uses and two installs:

 (A) For learning/practice only: install the released package (simple, stable).
o Use conda install -c conda-forge biopython or pip install biopython.
o Recommendation for you: use conda-forge because Anaconda + conda avoids
binary issues.
 (B) For contributing to the project: clone the GitHub repo and install the development
version (pip install -e .) so you can change code locally and run tests.

Do this flow: first install (A) and practice, then when ready to contribute, fork & clone and
follow (B).

3. Install Biopython for practice (do this now)

With your biopython-dev env activated:

# Preferred:
conda install -c conda-forge biopython -y

# Or (if you prefer pip):

# pip install biopython

Verify installation:
python -c "import Bio; print('Biopython version:', Bio.__version__)"

If you see a version number, installation succeeded.

4. Quick practice exercises (Jupyter

recommended)
Open JupyterLab (or Notebook):

jupyter lab

Create a new notebook and choose kernel Python (biopython-dev).

Copy these small cells to practice basic tasks.

A. Parse a FASTA file (example in-memory):

from [Link] import Seq

from [Link] import SeqRecord
from Bio import SeqIO
from io import StringIO

fasta_example = """>seq1
ATGCGTACGTAGCTAGCTAG
>seq2
ATGCGTACGATAG
"""
handle = StringIO(fasta_example)
for rec in [Link](handle, "fasta"):
print([Link], len([Link]), [Link][:10])

B. Compute GC content & reverse complement:

from [Link] import GC

rec = Seq("ATGCGTACGTAGCTAGCTAG")
print("GC%:", GC(rec))
print("Reverse complement:", rec.reverse_complement())

C. Translate DNA to protein:

dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
protein = [Link]()
print(protein)

These exercises let you confirm import paths and get comfortable with the API.
5. Should you use Jupyter or VS Code?
 Use Jupyter for hands-on learning, experimenting, writing and sharing notebooks (great
for tutorials).
 Use VS Code for real development: editing code files, running tests, debugging, and
opening PRs.
o Configure VS Code to use the biopython-dev interpreter (bottom-right in VS
Code → select interpreter).
o Install Python extension for VS Code.

So: learn in Jupyter, contribute via VS Code + Git.

6. Prepare GitHub: fork the Biopython repo

(do this when ready to contribute)
When you’re ready to move from practice → code contributions:

1. Go to: [Link] (open in browser).

2. Click Fork (top-right). That creates
[Link]

(Do this in your browser; no installation required.)

7. Clone your fork locally (Git Bash or VS

Code terminal)
In your biopython-dev environment, pick a working directory and run:

Using HTTPS (simpler):

cd /c/Users/YourName/projects # choose a folder

git clone [Link]
cd biopython

(Optional) Using SSH (convenient if set up):

git clone git@[Link]:<your-username>/[Link]
cd biopython

If you haven’t configured Git username/email:

git config --global [Link] "Your Name"

git config --global [Link] "[Link]@[Link]"

8. Add upstream remote (so you can sync

later)
This lets you pull official updates:

git remote add upstream [Link]

git fetch upstream

Verify remotes:

git remote -v
# origin -> your fork
# upstream -> original repo

9. Install the repository in editable/developer

mode
Inside your cloned repo (still in biopython-dev env):

# Install the current repo in "editable" mode:

pip install -e .

This makes local code editable and importable.

Developer/test tools: install pytest and flake8 (if not already):

pip install pytest flake8

Note: Some projects have additional dev requirements. If you find a [Link],
[Link], or a [Link] extras like [[Link]-
dependencies], follow the repo’s [Link] instructions to install them. If in doubt,
pip install pytest flake8 is a minimal start.
10. Run the test suite (basic)
Run the tests to confirm everything is OK:

pytest -q

If the full test suite is large and slow, run a single test or directory:

pytest Tests/test_Seq.py -q # example; replace with an actual test file

if found

If you get many failures, don’t panic — sometimes Windows-specific or missing optional
packages cause tests to fail. For your first contributions, you can start with docs/typo fixes or
small modules that don’t require heavy testing.

11. Workflow for a small change → PR (full,

detailed)
When you find an issue (docs or small bug) and want to contribute:

1. Create a branch:

git checkout -b fix/my-first-typo

2. Make your edits in VS Code (open folder in VS Code: code .).

3. Run local tests for the affected area. If you changed docs, just run pytest or make docs
if documentation build is required (check repo README/CONTRIBUTING).
4. Stage & commit with clear message:

git add path/to/file

git commit -m "Docs: fix typo in tutorial section on SeqIO"

5. Push branch to your fork:

git push origin fix/my-first-typo

6. Open a Pull Request:

o Go to your fork on GitHub → you’ll see a banner to create a PR, or go to Pull
requests → New pull request → choose your branch → create PR.
o Write a clear PR description: What you changed, why, how you tested,
reference the issue number (e.g., Fixes #5059).
 7. Respond to review from maintainers: they may ask for style tweaks, test additions, or
rewording. Make edits locally, git commit, and git push again — the PR updates
automatically.

12. Keeping your fork up-to-date (sync

upstream)
Before starting a new branch, ensure your local main is current:

git checkout main

git fetch upstream
git merge upstream/main
# OR (if you prefer rebase)
# git rebase upstream/main
git push origin main

Then create your feature branch from updated main.

13. Where to find easy issues (practical)

 Go to: [Link]
 Filter by labels: good first issue, documentation, help wanted, easy.
 Read issue comments carefully to ensure it’s unassigned and not already taken.

If no clear “good first issue” exists at the moment, start with small documentation improvements
or small unit tests — maintainers welcome these.

14. Example first contribution candidates

(practical ideas)
 Fix spelling/grammar in docstrings or tutorial pages.
 Add or update example notebooks for SeqIO or Seq utilities.
 Add a simple unit test that reproduces a small bug described in an issue.
 Improve README examples or replace old code snippets with modern Python idioms.
15. Helpful VS Code setup for development
 Open the cloned biopython folder in VS Code.
 Select the biopython-dev Python interpreter (bottom-right).
 Install recommended extensions: Python, Pytest (or Python test support), GitLens
(optional).
 Configure testing: VS Code → Testing → Configure Python tests → PyTest. This lets
you run tests from the UI.

16. Example: create a small documentation

PR (end-to-end)
1. Find a doc page with a typo or outdated code sample.
2. Edit the .rst or .md file in Doc/ (or repo docs).
3. Build docs locally if you want: if repo uses Sphinx, you might do pip install -r
docs/[Link] then make -C Doc html (skip if this is too heavy for first PR).
4. Commit & push branch → open PR with a clear description: what changed, where, and
why.

17. Troubleshooting common issues

 ImportError: No module named Bio → you are not in the biopython-dev
environment OR didn’t pip install -e . in your cloned repo. Fix: activate conda env
and run pip install -e . in the cloned repository.
 pytest not found → pip install pytest in your env.
 Permission errors on Windows during install → use Anaconda Prompt and ensure no
admin privileges are required for your environment.
 Tests failing because of optional binaries (BLAST, external tools) → many tests require
optional dependencies; skip those tests and focus on docs/tests that don’t require external
tools.

18. Suggested practice → contribution

timeline (fast path)
  Week 1: Create env, install Biopython (conda), do the Jupyter exercises above, become
comfortable with API.
 Week 2: Read [Link] in the cloned repo, fork & clone repo, run pip
install -e ., run a subset of tests.
 Week 3: Pick one small doc/typo issue, submit first PR.
 Week 4–8: Solve 2–3 more issues (docs/tests/small code), grow confidence, attempt a
small feature (e.g., a helper function or notebook example).

19. Etiquette and tips for fast acceptance

 Keep PRs small and focused.
 Write a clear PR description and show how you tested changes.
 Respect project coding style — run flake8 (or follow CONTRIBUTING) if requested.
 Be patient and responsive to review comments.
 Start in docs if unsure — maintainers love docs improvements.

20. Final checklist (do this now)

1. Open Anaconda Prompt.
2. Run:

conda create -n biopython-dev python=3.10 -y

conda activate biopython-dev
conda install -c conda-forge jupyterlab ipykernel pandas numpy matplotlib -y
conda install -c conda-forge biopython -y
python -m ipykernel install --user --name biopython-dev --display-name "Python
(biopython-dev)"
python -c "import Bio; print('Biopython version:', Bio.__version__)"

3. Open JupyterLab and run the example cells in Section 4.

4. When ready to contribute: fork the repo on GitHub, clone, pip install -e ., run
pytest -q, create branch, make a small PR.