DATE : 05/05/2024 Test Booklet Code

S2
UGRID

Corporate Office : Aakash Tower, 8, Pusa Road, New Delhi-110005 | Ph.: 011-47623456

Questions & Answers

Time : 3 hrs. 20 Min. for M.M. : 720

NEET (UG)-2024
Important Instructions :
1. The test is of 3 hours 20 minutes duration and the Test Booklet contains 200 multiple-choice questions (four
options with a single correct answer) from Physics, Chemistry and Biology (Botany and Zoology). 50 questions
in each subject are divided into two Sections (A and B) as per details given below:
(a) Section-A shall consist of 35 (Thirty-five) Questions in each subject (Question Nos-1 to 35, 51 to 85, 101 to
135 and 151 to 185). All Questions are compulsory.
(b) Section-B shall consist of 15 (Fifteen) questions in each subject (Question Nos- 36 to 50, 86 to 100, 136 to
150 and 186 to 200). In Section B, a candidate needs to attempt any 10 (Ten) questions out of 15 (Fifteen)
in each subject.
Candidates are advised to read all 15 questions in each subject of Section B before they start attempting the
question paper. In the event of a candidate attempting more than ten questions, the first ten questions answered
by the candidate shall be evaluated.
2. Each question carries 4 marks. For each correct response, the candidate will get 4 marks. For each incorrect
response, one mark will be deducted from the total scores. The maximum marks are 720.
3. Use Blue / Black Ball Point Pen only for writing particulars on this page / marking responses on Answer Sheet.
4. Rough work is to be done in the space provided for this purpose in the Test Booklet only.
5. On completion of the test, the candidate must hand over the Answer Sheet (ORIGINAL and OFFICE copy) to
the Invigilator before leaving the Room / Hall. The candidates are allowed to take away this Test Booklet with
them.
6. The CODE for this Booklet is S2. Make sure that the CODE printed on the Original Copy of the Answer
Sheet is the same as that on this Test Booklet. In case of discrepancy, the candidate should immediately report
the matter to the Invigilator for replacement of both the Test Booklet and the Answer sheet.
7. The candidates should ensure that the Answer Sheet is not folded. Do not make any stray marks on the Answer
Sheet. Do not write your Roll No. anywhere else except in the specified space in the Test Booklet/Answer Sheet.
8. Use of white fluid for correction is NOT permissible on the Answer Sheet.
9. Each candidate must show on-demand his/her Admission Card to the Invigilator.
10. No candidate, without special permission of the Centre Superintendent or Invigilator, would leave his/her seat.
11. Use of Electronic/Manual Calculator is prohibited.
12. The candidates are governed by all Rules and Regulations of the examination with regard to their conduct in the
Examination Room / Hall. All cases of unfair means will be dealt with as per Rules and Regulations of this
examination.
13. No part of the Test Booklet and Answer Sheet shall be detached under any circumstances.
14. The candidates will write the Correct Test Booklet Code as given in the Test Booklet / Answer Sheet in the
Attendance Sheet.

-1-
 NEET (UG)-2024 (Code-S2)

PHYSICS
SECTION-A
1. A horizontal force 10 N is applied to a block A as shown in figure. The mass of blocks A and B are 2 kg and
3 kg respectively. The blocks slide over a frictionless surface. The force exerted by block A on block B is :

(1) 10 N (2) Zero

(3) 4N (4) 6N
Answer (4)
2. 290 α e+ β− e−
82 X →Y 
→ Z 
→ P 
→Q
In the nuclear emission stated above, the mass number and atomic number of the product Q respectively, are
(1) 286, 81
(2) 280, 81
(3) 286, 80
(4) 288, 82
Answer (1)
3. Consider the following statements A and B and identify the correct answer:

A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph.
B. In a reverse biased pn junction diode, the current measured in (µA), is due to majority charge carriers.
(1) Both A and B are incorrect
(2) A is correct but B is incorrect
(3) A is incorrect but B is correct
(4) Both A and B are correct
Answer (2)
4. At any instant of time t, the displacement of any particle is given by 2t – 1 (SI unit) under the influence of force
of 5 N. The value of instantaneous power is (in SI unit):
(1) 6 (2) 10
(3) 5 (4) 7
Answer (2)
5. A wire of length ‘l’ and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series
while the next 5 parts are connected in parallel. The two combinations are again connected in series. The
resistance of this final combination is:
(1) 60 Ω (2) 26 Ω
(3) 52 Ω (4) 55 Ω
Answer (3)

-2-
NEET (UG)-2024 (Code-S2)

6. A thermodynamic system is taken through the cycle abcda. The work done by the gas along the path bc is:

(1) –60 J (2) Zero

(3) 30 J (4) –90 J
Answer (2)
7. A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at
the centre of the coil is (Take permeability of free space as 4π × 10–7 SI units):
(1) 44 T (2) 44 mT
(3) 4.4 T (4) 4.4 mT
Answer (4)
8. The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω, when connected through
an external resistance of 4 Ω as shown in the figure is:

(1) 10 V (2) 4V
(3) 6V (4) 8V
Answer (4)
9. A particle moving with uniform speed in a circular path maintains:
(1) Varying velocity and varying acceleration
(2) Constant velocity
(3) Constant acceleration
(4) Constant velocity but varying acceleration
Answer (1)
10. A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water
is 0.07 N m–1, then the excess force required to take it away from the surface is
(1) 99 N (2) 19.8 mN
(3) 198 N (4) 1.98 mN
Answer (2)
11. The quantities which have the same dimensions as those of solid angle are:
(1) angular speed and stress (2) strain and angle
(3) stress and angle (4) strain and arc
Answer (2)

-3-
 NEET (UG)-2024 (Code-S2)

12. A logic circuit provides the output Y as per the following truth table :
A B Y
0 0 1
0 1 0
1 0 1
1 1 0
The expression for the output Y is :
(1) B (2) A.B + A
(3) A.B + A (4) B
Answer (4)
13. A thin spherical shell is charged by some source. The potential difference between the two points C and P
(in V) shown in the figure is:
1
(Take = 9 × 109 SI units)
4πε0

(1) Zero
(2) 3 × 105
(3) 1 × 105
(4) 0.5 × 105
Answer (1)
14. Match List I with List II.
List I List II
(Spectral Lines of (Wavelengths (nm))
Hydrogen for
transitions from)
A. n2 = 3 to n1 = 2 I. 410.2
B. n2 = 4 to n1 = 2 II. 434.1
C. n2 = 5 to n1 = 2 III. 656.3
D. n2 = 6 to n1 = 2 IV. 486.1
Choose the correct answer from the options given below:
(1) A-I, B-II, C-III, D-IV
(2) A-II, B-I, C-IV, D-III
(3) A-III, B-IV, C-II, D-I
(4) A-IV, B-III, C-I, D-II
Answer (3)

-4-
NEET (UG)-2024 (Code-S2)
15. Match List-I with List-II.
List-I List-II
(Material) (Susceptibility (χ))
A. Diamagnetic I. χ=0
B. Ferromagnetic II. 0 > χ ≥ –1
C. Paramagnetic III. χ >> 1
D. Non-magnetic IV. 0 < χ < ε (a small positive number)
Choose the correct answer from the options given below
(1) A-IV, B-III, C-II, D-I (2) A-II, B-III, C-IV, D-I
(3) A-II, B-I, C-III, D-IV (4) A-III, B-II, C-I, D-IV
Answer (2)
16. Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves
with velocity v1 while body B is at rest before collision. The velocity of the system after collision is v2. The ratio
v1 : v2 is
(1) 1 : 4 (2) 1 : 2
(3) 2 : 1 (4) 4 : 1
Answer (3)
17. Given below are two statements:
Statement I: Atoms are electrically neutral as they contain equal number of positive and negative charges.
Statement II: Atoms of each element are stable and emit their characteristic spectrum.
In the light of the above statements, choose the most appropriate answer from the options given below.
(1) Statement I is incorrect but Statement II is correct
(2) Both Statement I and Statement II are correct
(3) Both Statement I and Statement II are incorrect
(4) Statement I is correct but Statement II is incorrect
Answer (4)
18.  π
If=x 5 sin  πt +  m represents the motion of a particle executing simple harmonic motion, the amplitude
 3
and time period of motion, respectively, are
(1) 5 m, 1 s (2) 5 cm, 2 s
(3) 5 m, 2 s (4) 5 cm, 1 s
Answer (3)
19. The output (Y) of the given logic gate is similar to the output of an/a

(1) AND gate (2) NAND gate

(3) NOR gate (4) OR gate
Answer (1)
20. In a vernier callipers, (N + 1) divisions of vernier scale coincide with N divisions of main scale. If 1 MSD
represents 0.1 mm, the vernier constant (in cm) is:
1
(1) 10(N + 1) (2)
10N
1
(3) (4) 100N
100(N + 1)
Answer (3)

-5-
 NEET (UG)-2024 (Code-S2)
21. A bob is whirled in a horizontal plane by means of a string with an initial speed of ω rpm. The tension in the
string is T. If speed becomes 2ω while keeping the same radius, the tension in the string becomes:
(1) 2T (2) T
T
(3) 4T (4)
4
Answer (3)
22. If c is the velocity of light in free space, the correct statements about photon among the following are:
A. The energy of a photon is E = hν.
B. The velocity of a photon is c.
hν
C. The momentum of a photon, p = .
c
D. In a photon-electron collision, both total energy and total momentum are conserved.
E. Photon possesses positive charge.
Choose the correct answer from the options given below:
(1) A, B, D and E only (2) A and B only
(3) A, B, C and D only (4) A, C and D only
Answer (3)
23.

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of
induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions:
(1) BA and DC (2) AB and DC
(3) BA and CD (4) AB and CD
Answer (2)
24. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole

moment vector P of magnitude, 4 × 10–6 C m, is ± 9 × 103 V.
1
(Take = 9 × 109 SI units)
4π ∈0
2P
Reason R: V = ± , where r is the distance of any axial point, situated at 2 m from the centre of the
4π ∈0 r 2
dipole.
In the light of the above statements, choose the correct answer from the options given below:
(1) A is false but R is true.
(2) Both A and R are true and R is the correct explanation of A.
(3) Both A and R are true and R is NOT the correct explanation of A.
(4) A is true but R is false.
Answer (4)
25. 1
The mass of a planet is th that of the earth and its diameter is half that of the earth. The acceleration due
10
to gravity on that planet is:
(1) 3.92 m s–2 (2) 19.6 m s–2
(3) 9.8 m s–2 (4) 4.9 m s–2
Answer (1)

-6-
NEET (UG)-2024 (Code-S2)

26. NP 1
In an ideal transformer, the turns ratio is = . The ratio VS : VP is equal to (the symbols carry their usual
NS 2
meaning) :
(1) 1 : 4 (2) 1:2
(3) 2 : 1 (4) 1:1
Answer (3)
27. If the monochromatic source in Young’s double slit experiment is replaced by white light, then
(1) All bright fringes will be of equal width
(2) Interference pattern will disappear
(3) There will be a central dark fringe surrounded by a few coloured fringes
(4) There will be a central bright white fringe surrounded by a few coloured fringes
Answer (4)
28. The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young’s modulus,
respectively, are 8 × 108 N m–2 and 2 × 1011 N m–2, is:
(1) 8 mm (2) 4 mm
(3) 0.4 mm (4) 40 mm
Answer (2)
29. An unpolarised light beam strikes a glass surface at Brewster's angle. Then
(1) The reflected light will be completely polarised but the refracted light will be partially polarised.
(2) The reflected light will be partially polarised.
(3) The refracted light will be completely polarised.
(4) Both the reflected and refracted light will be completely polarised.
Answer (1)
30. In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as
shown. The moment of inertia of the needle is 9.8 x 10–6 kg m2. If the magnitude of magnetic moment of the
needle is x × 10–5 Am2, then the value of ‘x’ is :

(1) 1280π2 (2) 5π2

(3) 128π2 (4) 50π2
Answer (1)
31. A light ray enters through a right angled prism at point P with the angle of incidence 30° as shown in figure. It
travels through the prism parallel to its base BC and emerges along the face AC. The refractive index of the
prism is:

3 5
(1) (2)
2 4
5 3
(3) (4)
2 4
Answer (3)

-7-
 NEET (UG)-2024 (Code-S2)
32. The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is
2400 g cm2. The length of the 400 g rod is nearly:
(1) 72.0 cm (2) 8.5 cm
(3) 17.5 cm (4) 20.7 cm
Answer (2)
33. In the following circuit, the equivalent capacitance between terminal A and terminal B is :

(1) 4 µF (2) 2 µF
(3) 1 µF (4) 0.5 µF
Answer (2)
34. A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is ν in the
direction shown, which one of the following options is correct (P and Q are any highest and lowest points on
the wheel, respectively)?

(1) Point P has zero speed (2) Point P moves slower than point Q
(3) Point P moves faster than point Q (4) Both the points P and Q move with equal speed
Answer (3)
35.  1 
The graph which shows the variation of   and its kinetic energy, E is (where λ is de Broglie wavelength
 λ2 
of a free particle):

(1) (2)

(3) (4)

Answer (1)
SECTION-B
36. A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The
magnifying power of telescope for viewing a distant object is:
(1) 32 (2) 34
(3) 28 (4) 17
Answer (3)

-8-
NEET (UG)-2024 (Code-S2)
37. The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume)
at three pressures P1, P2 and P3 compared with those of Charles’s law represented as dotted lines.

Then the correct relation is:

(1) P1 > P2 > P3 (2) P3 > P2 > P1
(3) P1 > P3 > P2 (4) P2 > P1 > P3
Answer (1)
38. If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half
x
its original length, then the new time period of oscillation is times its original time period. Then the value of
2
x is:
(1) 4 (2) 3
(3) 2 (4) 2 3
Answer (3)
39. Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in
series and then in parallel to a fixed power source. The ratio of power outputs for these two cases is:
(1) 2 : 3 (2) 1 : 1
(3) 2 : 9 (4) 1 : 2
Answer (3)
40. A force defined by F = αt2 + βt acts on a particle at a given time t. The factor which is dimensionless, if α and
β are constants, is:
(1) αβ (2) βt
t α
(3) αt (4) αβt
β
Answer (3)
41. If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then
A. the charge stored in it, increases.
B. the energy stored in it, decreases.
C. its capacitance increases.
D. the ratio of charge to its potential remains the same.
E. the product of charge and voltage increases.
Choose the most appropriate answer from the options given below:
(1) A, B and C only (2) A, B and E only
(3) A, C and E only (4) B, D and E only
Answer (3)
42. An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms
make an angle 60° with each other. The magnetic moment of this new magnet is :
M
(1) (2) M
3
M
(3) (4) 2M
2
Answer (3)

-9-
 NEET (UG)-2024 (Code-S2)

43. A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to:
A. hold the sheet there if it is magnetic.
B. hold the sheet there if it is non-magnetic.
C. move the sheet away from the pole with uniform velocity if it is conducting.
D. move the sheet away from the pole with uniform velocity if it is both, non-conducting and non-polar.
Choose the correct statement(s) from the options given below:
(1) C only (2) B and D only
(3) A and C only (4) A, C and D only
Answer (3)

44. A 10 µF capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is
nearly (π = 3.14):

(1) 0.35 A (2) 0.58 A

(3) 0.93 A (4) 1.20 A
Answer (3)

45. A metallic bar of Young’s modulus, 0.5 × 1011 N m–2 and coefficient of linear thermal expansion 10–5 °C–1,
length 1 m and area of cross-section 10–3 m2 is heated from 0°C to 100°C without expansion or bending. The
compressive force developed in it is :
(1) 2 × 103 N (2) 5 × 103 N
(3) 50 × 103 N (4) 100 × 103 N
Answer (3)

46. The velocity (v) – time (t) plot of the motion of a body is shown below:

The acceleration (a) – time (t) graph that best suits this motion is :

(1) (2)

(3) (4)

Answer (4)

- 10 -
NEET (UG)-2024 (Code-S2)
47. Choose the correct circuit which can achieve the bridge balance.

(1)

(2)

(3)

(4)

Answer (2)
48. The property which is not of an electromagnetic wave travelling in free space is that:
(1) They originate from charges moving with uniform speed
(2) They are transverse in nature
(3) The energy density in electric field is equal to energy density in magnetic field
1
(4) They travel with a speed equal to
µ0 ε0
Answer (1)
49. The minimum energy required to launch a satellite of mass m from the surface of earth of mass M and radius
R in a circular orbit at an altitude of 2R from the surface of the earth is:
GmM 5GmM
(1) (2)
3R 6R
2GmM GmM
(3) (4)
3R 2R
Answer (2)
50. A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the
circuit, then in the gap between the plates:
(1) Displacement current of magnitude greater than I flows but can be in any direction
(2) There is no current
(3) Displacement current of magnitude equal to I flows in the same direction as I
(4) Displacement current of magnitude equal to I flows in a direction opposite to that of I
Answer (3)

- 11 -
 NEET (UG)-2024 (Code-S2)

CHEMISTRY

SECTION-A
51. Match List I with List II.
List I List II
(Conversion) (Number of Faraday required)
A. 1 mol of H2O to O2 I. 3F

B. 1 mol of MnO4 to Mn2+ II. 2F

C. 1.5 mol of Ca from molten CaCl2 III. 1F

D. 1 mol of FeO to Fe2O3 IV. 5F
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-II, D-I (2) A-II, B-IV, C-I, D-III
(3) A-III, B-IV, C-I, D-II (4) A-II, B-III, C-I, D-IV
Answer (2)

52. The highest number of helium atoms is in

(1) 2.271098 L of helium at STP (2) 4 mol of helium
(3) 4 u of helium (4) 4 g of helium
Answer (2)

53. 1
Which plot of ln k vs is consistent with Arrhenius equation?
T

(1) (2)

(3) (4)

Answer (1)

54. For the reaction 2A  B + C, KC = 4 × 10–3. At a given time, the composition of reaction mixture is:
[A] = [B] = [C] = 2 × 10–3 M.
Then, which of the following is correct?
(1) Reaction has gone to completion in forward direction.
(2) Reaction is at equilibrium.
(3) Reaction has a tendency to go in forward direction.
(4) Reaction has a tendency to go in backward direction.
Answer (4)

- 12 -
NEET (UG)-2024 (Code-S2)

55. Match List I with List II.

List I (Complex) List II (Type of isomerism)
A. [Co(NH3)5(NO2)]Cl2 I. Solvate isomerism
B. [Co(NH3)5(SO4)]Br II. Linkage isomerism
C. [Co(NH3)6][Cr(CN)6] III. Ionization isomerism
D. [Co(H2O)6]Cl3 IV. Coordination isomerism
Choose the correct answer from the options given below:
(1) A-II, B-IV, C-III, D-I (2) A-II, B-III, C-IV, D-I
(3) A-I, B-III, C-IV, D-II (4) A-I, B-IV, C-III, D-II
Answer (2)
56. A compound with a molecular formula of C6H14 has two tertiary carbons. Its IUPAC name is :
(1) 2,2-dimethylbutane (2) n-hexane
(3) 2-methylpentane (4) 2,3-dimethylbutane
Answer (4)
57. Match List I with List II
List I List II
(Quantum Number) (Information provided)
A. ml I. Shape of orbital
B. ms II. Size of orbital
C. l III. Orientation of orbital
D. n IV. Orientation of spin of
electron
Choose the correct answer from the options given below :
(1) A-II, B-I, C-IV, D-III (2) A-I, B-III, C-II, D-IV
(3) A-III, B-IV, C-I, D-II (4) A-III, B-IV, C-II, D-I
Answer (3)
58. ‘Spin only’ magnetic moment is same for which of the following ions?
A. Ti3+ B. Cr2+
C. Mn2+ D. Fe2+
E. Sc3+
Choose the most appropriate answer from the options given below.
(1) A and D only (2) B and D only
(3) A and E only (4) B and C only
Answer (2)
59. Which one of the following alcohols reacts instantaneously with Lucas reagent?

(1) (2) CH3 – CH2 – CH2 – CH2OH

(3) (4)

Answer (1)

- 13 -
 NEET (UG)-2024 (Code-S2)

60. Arrange the following elements in increasing order of electronegativity:

N, O, F, C, Si
Choose the correct answer from the options given below:
(1) F < O < N < C < Si (2) Si < C < N < O < F
(3) Si < C < O < N < F (4) O < F < N < C < Si
Answer (2)
61. In which of the following processes entropy increases?
A. A liquid evaporates to vapour.
B. Temperature of a crystalline solid lowered from 130 K to 0 K.
C. 2NaHCO3(s)  Na2CO3(s) + CO2(g) + H2O(g)
D. Cl2(g)  2Cl(g)
Choose the correct answer from the options given below:
(1) C and D (2) A and C
(3) A, B and D (4) A, C and D
Answer (S4)
62. The most stable carbocation among the following is :

(1) (2)

(3) (4)

Answer (1)
63. The energy of an electron in the ground state (n = 1) for He+ ion is –x J, then that for an electron in n = 2
state for Be3+ ion in J is
4
(1)  x (2) –x
9
x
(3)  (4) –4x
9
Answer (2)
64. Given below are two statements:
Statement I : The boiling point of three isomeric pentanes follows the order
n-pentane > isopentane > neopentane
Statement II : When branching increases, the molecule attains a shape of sphere. This results in smaller
surface area for contact, due to which the intermolecular forces between the spherical molecules are weak,
thereby lowering the boiling point.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is incorrect but Statement II is correct
(2) Both Statement I and Statement II are correct
(3) Both Statement I and Statement II are incorrect
(4) Statement I is correct but Statement II is incorrect
Answer (2)

- 14 -
NEET (UG)-2024 (Code-S2)

65. Match List I with List II.

List I List II
(Compound) (Shape/geometry)
A. NH3 I. Trigonal Pyramidal
B. BrF5 II. Square Planar
C. XeF4 III. Octahedral
D. SF6 IV. Square Pyramidal
Choose the correct answer from the options given below:
(1) A-II, B-III, C-IV, D-I (2) A-I, B-IV, C-II, D-III
(3) A-II, B-IV, C-III, D-I (4) A-III, B-IV, C-I, D-II
Answer (2)
66. Given below are two statements:
Statement I: The boiling point of hydrides of Group 16 elements follow the order
H2O > H2Te > H2Se > H2S.
Statement II: On the basis of molecular mass, H2O is expected to have lower boiling point than the other
members of the group but due to the presence of extensive H-bonding in H 2O, it has higher boiling point.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true (2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false (4) Statement I is true but Statement II is false
Answer (2)
67. Arrange the following elements in increasing order of first ionization enthalpy:
Li, Be, B, C, N
Choose the correct answer from the options given below:
(1) Li < Be < N < B < C (2) Li < Be < B < C < N
(3) Li < B < Be < C < N (4) Li < Be < C < B < N
Answer (3)
68. Identify the correct reagents that would bring about the following transformation.

(1) (i) H2O/H+

(ii) PCC
(2) (i) H2O/H+
(ii) CrO3
(3) (i) BH3

(ii) H2 O 2 / OH

(iii) PCC
(4) (i) BH3

(ii) H2 O 2 / OH

(iii) alk.KMnO4

(iv) H3O

Answer (3)

- 15 -
 NEET (UG)-2024 (Code-S2)

69. Activation energy of any chemical reaction can be calculated if one knows the value of

(1) rate constant at two different temperatures

(2) rate constant at standard temperature

(3) probability of collision

(4) orientation of reactant molecules during collision

Answer (1)

70. On heating, some solid substances change from solid to vapour state without passing through liquid state.
The technique used for the purification of such solid substances based on the above principle is known as

(1) Chromatography (2) Crystallization

(3) Sublimation (4) Distillation

Answer (3)

71. Among Group 16 elements, which one does NOT show –2 oxidation state?

(1) Po (2) O

(3) Se (4) Te

Answer (1)

72. Match List I with List II.

List-I List-II

(Process) (Conditions)

A. Isothermal process I. No heat exchange

B. Isochoric process II. Carried out at constant temperature

C. Isobaric process III. Carried out at constant volume

D. Adiabatic process IV. Carried out at constant pressure

Choose the correct answer from the options given below:

(1) A-II, B-III, C-IV, D-I (2) A-IV, B-III, C-II, D-I

(3) A-IV, B-II, C-III, D-I (4) A-I, B-II, C-III, D-IV

Answer (1)

73. Which reaction is NOT a redox reaction?

(1) BaCl2 + Na2SO4  BaSO4 + 2NaCl (2) Zn + CuSO4  ZnSO4 + Cu

(3) 2KClO3 + I2  2KIO3 + Cl2 (4) H2 + Cl2  2HCl

Answer (1)

74. The Henry’s law constant (KH) values of three gases (A, B, C) in water are 145, 2 × 10–5 and 35 kbar,
respectively. The solubility of these gases in water follow the order:

(1) A>B>C (2) B>A>C

(3) B>C>A (4) A>C>B

Answer (3)

- 16 -
NEET (UG)-2024 (Code-S2)

75. Match List I with List II.

List I List II
(Reaction) (Reagents/Condition)

A. I.

B. II. CrO3

C. III. KMnO4/KOH, 

D. IV. (i) O3

(ii) Zn-H2O
Choose the correct answer from the options given below:
(1) A-I, B-IV, C-II, D-III (2) A-IV, B-I, C-III, D-II
(3) A-III, B-I, C-II, D-IV (4) A-IV, B-I, C-II, D-III
Answer (S4)

76. In which of the following equilibria, Kp and Kc are NOT equal?

(1) 2BrCl(g)  Br2(g)  Cl2(g) (2) PCl5(g)  PCl3(g)  Cl2(g)

(3) H2(g)  I2(g)  2HI(g) (4) CO(g)  H2 O(g)  CO 2(g)  H2(g)

Answer (2)

77. Intramolecular hydrogen bonding is present in

(1) HF (2)

(3) (4)

Answer (2)

78. Given below are two statements :

Statement I: Both [Co(NH3)6]3+ and [CoF6]3– complexes are octahedral but differ in their magnetic behaviour.
Statement II: [Co(NH3)6]3+ is diamagnetic whereas [CoF6]3– is paramagnetic.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true (2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false (4) Statement I is true but Statement II is false
Answer (2)

- 17 -
 NEET (UG)-2024 (Code-S2)

79. The compound that will undergo SN1 reaction with the fastest rate is

(1) (2)

(3) (4)

Answer (1)
80. Given below are two statements:
Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II : Aniline cannot be prepared through Gabriel synthesis.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is incorrect but Statement II is true (2) Both statement I and Statement II are true
(3) Both Statement I and Statement II are false (4) Statement I is correct but Statement II is false
Answer (2)
81. 1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide
left unreacted is equal to
(1) 200 mg (2) 750 mg
(3) 250 mg (4) Zero mg
Answer (3)
82. The E° value for the Mn3+/Mn2+ couple is more positive than that of Cr3+/Cr2+ or Fe3+/Fe2+ due to change of
(1) d3 to d5 configuration (2) d5 to d4 configuration
(3) d5 to d2 configuration (4) d4 to d5 configuration
Answer (S4)
83. The reagents with which glucose does not react to give the corresponding tests/products are
A. Tollen’s reagent
B. Schiff’s reagent
C. HCN
D. NH2OH
E. NaHSO3
Choose the correct options from the given below:
(1) E and D (2) B and C
(3) A and D (4) B and E
Answer (4)
84. Match List I with List II.
List I List II
(Molecule) (Number and types of
bond/s between two
carbon atoms)
A. ethane I. one -bond and two -bonds
B. ethene II. two -bonds
C. carbon molecule, C2 III. one -bond
D. ethyne IV. one -bond and one -bond

- 18 -
NEET (UG)-2024 (Code-S2)
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II (2) A-I, B-IV, C-II, D-III
(3) A-IV, B-III, C-II, D-I (4) A-III, B-IV, C-II, D-I
Answer (4)
85. Fehling’s solution ‘A’ is
(1) aqueous sodium citrate
(2) aqueous copper sulphate
(3) alkaline copper sulphate
(4) alkaline solution of sodium potassium tartrate (Rochelle’s salt)
Answer (2)

SECTION-B
86. Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group
number from 0 to VI.
A. Al3+ B. Cu2+
C. Ba2+ D. Co2+
E. Mg2+
Choose the correct answer from the options given below.
(1) E, A, B, C, D (2) B, A, D, C, E
(3) B, C, A, D, E (4) E, C, D, B, A
Answer (2)

87. Major products A and B formed in the following reaction sequence, are

(1) (2)

(3) (4)

Answer (2)

88. The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of
activation.
Given R = 8.314 J K–1 mol–1, log4 = 0.6021
(1) 3804 kJ/mol (2) 38.04 kJ/mol
(3) 380.4 kJ/mol (4) 3.80 kJ/mol
Answer (2)

- 19 -
 NEET (UG)-2024 (Code-S2)

89. Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper
sulphate solution for 100 seconds is (Given : Molar mass of Cu : 63 g mol –1, 1 F = 96487 C)
(1) 0.0315 g (2) 3.15 g
(3) 0.315 g (4) 31.5 g
Answer (3)

90. Identify the major product C formed in the following reaction sequence:
NaCN
CH3  CH2  CH2  I  A

OH NaOH

Partial hydrolysis
 B 
Br
 C
2 (major )

(1) –bromobutanoic acid (2) propylamine

(3) butylamine (4) butanamide
Answer (2)

91. The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure
of 20 atmosphere to 10 atmosphere is
(Given R = 2.0 cal K–1 mol–1)
(1) 100 calories (2) 0 calorie
(3) –413.14 calories (4) 413.14 calories
Answer (3)

92. Consider the following reaction in a sealed vessel at equilibrium with concentrations of
N2 = 3.0 × 10–3 M, O2 = 4.2 × 10–3 M and NO = 2.8 × 10–3 M.

2NO(g)  N2(g) + O2(g)

If 0.1 mol L–1 of NO(g) is taken in a closed vessel, what will be degree of dissociation () of NO(g) at
equilibrium?
(1) 0.717 (2) 0.00889
(3) 0.0889 (4) 0.8889
Answer (1)

93. Given below are two statements :

Statement I : [Co(NH3)6]3+ is a homoleptic complex whereas [Co(NH 3)4Cl2]+ is a heteroleptic complex.
Statement II : Complex [Co(NH3)6]3+ has only one kind of ligands but [Co(NH3)4Cl2]+ has more than one
kind of ligands.
In the light of the above statements, choose the correct answer from the options given below.
(1) Statement I is false but Statement II is true (2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false (4) Statement I is true but Statement II is false
Answer (2)

94. The pair of lanthanoid ions which are diamagnetic is

(1) Pm3+ and Sm3+ (2) Ce4+ and Yb2+
(3) Ce3+ and Eu2+ (4) Gd3+ and Eu3+
Answer (2)

- 20 -
NEET (UG)-2024 (Code-S2)

95. During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is
added to prevent hydrolysis of Fe2+ ion?
(1) dilute sulphuric acid (2) dilute hydrochloric acid
(3) concentrated sulphuric acid (4) dilute nitric acid
Answer (1)

96. The products A and B obtained in the following reactions, respectively, are
3ROH + PCl3  3RCl + A
ROH + PCl5  RCl + HCl + B
(1) H3PO3 and POCl3 (2) POCl3 and H3PO3
(3) POCl3 and H3PO4 (4) H3PO4 and POCl3
Answer (1)

97. For the given reaction:

‘P’ is

(1) (2)

(3) (4)

Answer (3)

98. A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of
X is :
(Given atomic masses of A = 64; B = 40; C = 32 u)
(1) ABC4 (2) A2BC2
(3) ABC3 (4) AB2C2
Answer (3)

99. The plot of osmotic pressure () vs concentration (mol L–1) for a solution gives a straight line with slope
25.73 L bar mol–1. The temperature at which the osmotic pressure measurement is done is
(Use R = 0.083 L bar mol–1 K–1)
(1) 12.05°C (2) 37°C
(3) 310°C (4) 25.73°C
Answer (2)

100. Identify the correct answer.

(1) Three canonical forms can be drawn for CO32 ion

(2) Three resonance structures can be drawn for ozone

(3) BF3 has non-zero dipole moment
(4) Dipole moment of NF 3 is greater than that of NH3
Answer (1)

- 21 -
 NEET (UG)-2024 (Code-S2)
w

BOTANY
SECTION-A
101. Given below are two statements:
Statement I : Parenchyma is living but collenchyma is dead tissue.
Statement II : Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of
angiosperms.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false
(4) Statement I is true but Statement II is false
Answer (1)
102. Identify the part of the seed from the given figure which is destined to form root when the seed germinates.

(1) D (2) A
(3) B (4) C
Answer (4)
103. Which one of the following is not a criterion for classification of fungi?
(1) Fruiting body (2) Morphology of mycelium
(3) Mode of nutrition (4) Mode of spore formation
Answer (3)

104. Tropical regions show greatest level of species richness because

A. Tropical latitudes have remained relatively undisturbed for millions of years, hence more time was
available for species diversification.
B. Tropical environments are more seasonal.
C. More solar energy is available in tropics.
D. Constant environments promote niche specialization.
E. Tropical environments are constant and predictable.
Choose the correct answer from the options given below.
(1) A, B and D only (2) A, C, D and E only
(3) A and B only (4) A, B and E only
Answer (2)

- 22 -
NEET (UG)-2024 (Code-S2)
105. Which of the following is an example of actinomorphic flower?
(1) Sesbania
(2) Datura
(3) Cassia
(4) Pisum
Answer (2)

106. Spindle fibers attach to kinetochores of chromosomes during

(1) Telophase
(2) Prophase
(3) Metaphase
(4) Anaphase
Answer (3)

107. The type of conservation in which the threatened species are taken out from their natural habitat and placed
in special setting where they can be protected and given special care is called
(1) Sustainable development
(2) in-situ conservation
(3) Biodiversity conservation
(4) Semi-conservative method
Answer (3)

108. Formation of interfascicular cambium from fully developed parenchyma cells is an example for
(1) Maturation
(2) Differentiation
(3) Redifferentiation
(4) Dedifferentiation
Answer (4)

109. Identify the set of correct statements:

A. The flowers of Vallisneria are colourful and produce nectar.
B. The flowers of water lily are not pollinated by water.
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon like.
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below.
(1) B, C, D and E only
(2) C, D and E only
(3) A, B, C and D only
(4) A, C, D and E only
Answer (1)

- 23 -
 NEET (UG)-2024 (Code-S2)
110. A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to
upstream and down stream end;
(1) Promotor, Structural gene, Terminator
(2) Repressor, Operator gene, Structural gene
(3) Structural gene, Transposons, Operator gene
(4) Inducer, Repressor, Structural gene
Answer (1)
111. Given below are two statements:
Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.
Statement II : The beginning of diplotene stage is recognized by dissolution of synaptonemal complex.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false
(4) Statement I is true but Statement II is false
Answer (2)
112. The capacity to generate a whole plant from any cell of the plant is called:
(1) Somatic hybridization (2) Totipotency
(3) Micropropagation (4) Differentiation
Answer (2)
113. In the given figure, which component has thin outer walls and highly thickened inner walls?

(1) B (2) C
(3) D (4) A
Answer (2)
114. Match List I with List II

List-I List-II

A. Rhizopus I. Mushroom

B. Ustilago II. Smut fungus

C. Puccinia III. Bread mould

D. Agaricus IV. Rust fungus

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-II, D-I (2) A-III, B-II, C-IV, D-I
(3) A-I, B-III, C-II, D-IV (4) A-III, B-II, C-I, D-IV
Answer (2)

- 24 -
NEET (UG)-2024 (Code-S2)
115. Match List I with List II

List-I List-II

A. Nucleolus I. Site of formation of glycolipid

B. Centriole II. Organization like the

cartwheel

C. Leucoplasts III. Site for active

ribosomal RNA synthesis

D. Golgi apparatus IV. For storing nutrients

Choose the correct answer from the options given below:

(1) A-I, B-II, C-III, D-IV
(2) A-III, B-II, C-IV, D-I
(3) A-II, B-III, C-I, D-IV
(4) A-III, B-IV, C-II, D-I
Answer (2)

116. List of endangered species was released by

(1) IUCN (2) GEAC
(3) WWF (4) FOAM
Answer (1)

117. The lactose present in the growth medium of bacteria is transported to the cell by the action of
(1) Polymerase
(2) Beta-galactosidase
(3) Acetylase
(4) Permease
Answer (4)

118. The cofactor of the enzyme carboxypeptidase is:

(1) Haem (2) Zinc
(3) Niacin (4) Flavin
Answer (2)

119. Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
(1) Carbohydrates
(2) Amino acids
(3) Phospholipids
(4) Glycerides
Answer (3)

- 25 -
 NEET (UG)-2024 (Code-S2)
120. Match List I with List II
List I List II
A. Clostridium butylicum I. Ethanol
B. Saccharomyces cerevisiae II. Streptokinase
C. Trichoderma polysporum III. Butyric acid
D. Streptococcus sp. IV. Cyclosporin-A
Choose the correct answer from the options given below:
(1) A-IV, B-I, C-III, D-II
(2) A-III, B-I, C-II, D-IV
(3) A-II, B-IV, C-III, D-I
(4) A-III, B-I, C-IV, D-II
Answer (4)

121. Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary
from the given figures (a) and (b)

(1) (a) Perigynous; (b) Perigynous

(2) (a) Epigynous; (b) Hypogynous
(3) (a) Hypogynous; (b) Epigynous
(4) (a) Perigynous; (b) Epigynous
Answer (1)

122. Bulliform cells are responsible for

(1) Providing large spaces for storage of sugars.
(2) Inward curling of leaves in monocots.
(3) Protecting the plant from salt stress.
(4) Increased photosynthesis in monocots.
Answer (2)

123. In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype
of the black seed plant, with which of the following genotype will you cross it?

(1) BB/Bb (2) BB

(3) bb (4) Bb

Answer (3)

- 26 -
NEET (UG)-2024 (Code-S2)
124. Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
(1) can help in cell division in grasses, to produce growth.
(2) promotes apical dominance.
(3) promotes abscission of mature leaves only.
(4) does not affect mature monocotyledonous plants.
Answer (4)

125. Which one of the following can be explained on the basis of Mendel's Law of Dominance?
A. Out of one pair of factors one is dominant and the other is recessive.
B. Alleles do not show any expression and both the characters appear as such in F2 generation.

C. Factors occur in pairs in normal diploid plants.

D. The discrete unit controlling a particular character is called factor.
E. The expression of only one of the parental characters is found in a monohybrid cross.
Choose the correct answer from the options given below:
(1) A, B, C, D and E
(2) A, B and C only
(3) A, C, D and E only
(4) B, C and D only
Answer (3)

126. Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:

(1) Enzyme activation
(2) Cofactor inhibition
(3) Feedback inhibition
(4) Competitive inhibition
Answer (4)

127. What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
B. It may get integrated into the genome of the recipient.
C. It may multiply and be inherited along with the host DNA.
D. The alien piece of DNA is not an integral part of chromosome.
E. It shows ability to replicate.
Choose the correct answer from the options given below:
(1) A and E only
(2) A and B only
(3) D and E only
(4) B and C only
Answer (4)

- 27 -
 NEET (UG)-2024 (Code-S2)
128. A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of
phenotype/s is/are expected in the progeny?
(1) Red, Pink as well as white flowered plants
(2) Only red flowered plants
(3) Red flowered as well as pink flowered plants
(4) Only pink flowered plants
Answer (3)

129. These are regarded as major causes of biodiversity loss:

A. Over exploitation
B. Co-extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration
Choose the correct option:
(1) A, B and D only (2) A, C and D only
(3) A, B, C and D only (4) A, B and E only
Answer (1)
130. Which of the following are required for the dark reaction of photosynthesis?
A. Light
B. Chlorophyll
C. CO2

D. ATP
E. NADPH
Choose the correct answer from the options given below:
(1) D and E only (2) A, B and C only
(3) B, C and D only (4) C, D and E only
Answer (4)

131. Match List I with List II

List I List II
A. Two or more alternative forms of a gene I. Back cross
B. Cross of F1 progeny with homozygous II. Ploidy
recessive parent
C. Cross of F1 progeny with any of the parents III. Allele
D. Number of chromosome sets in plant IV. Test cross
Choose the correct answer from the options given below:
(1) A-IV, B-III, C-II, D-I (2) A-I, B-II, C-III, D-IV
(3) A-II, B-I, C-III, D-IV (4) A-III, B-IV, C-I, D-II
Answer (4)

- 28 -
NEET (UG)-2024 (Code-S2)
132. Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
(1) 10 bp (2) 8 bp
(3) 6 bp (4) 4 bp
Answer (3)

133. dN K − N 
The equation of Verhulst-Pearl logistic growth is = rN  .
dt  K 
From this equation, K indicates:
(1) Population density (2) Intrinsic rate of natural increase
(3) Biotic potential (4) Carrying capacity
Answer (4)
134. How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle?
(1) 3 molecules of ATP and 2 molecules of NADPH
(2) 2 molecules of ATP and 3 molecules of NADPH
(3) 2 molecules of ATP and 2 molecules of NADPH
(4) 3 molecules of ATP and 3 molecules of NADPH
Answer (1)

135. Given below are two statements:

Statement I : Bt toxins are insect group specific and coded by a gene cry IAc.
Statement II : Bt toxin exists as inactive protoxin in B. thuringiensis. However, after ingestion by the insect
the inactive protoxin gets converted into active form due to acidic pH of the insect gut.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false
(4) Statement I is true but Statement II is false
Answer (4)

SECTION-B
136. Match List-I with List-II
List-I List-II
A. GLUT-4 I. Hormone
B. Insulin II. Enzyme
C. Trypsin III. Intercellular ground substance
D. Collagen IV. Enables glucose transport into cells
Choose the correct answer from the options given below.
(1) A-III, B-IV, C-I, D-II
(2) A-IV, B-I, C-II, D-III
(3) A-I, B-II, C-III, D-IV
(4) A-II, B-III, C-IV, D-I
Answer (2)

- 29 -
 NEET (UG)-2024 (Code-S2)
137. Match List I with List II

List I List II
(Types of Stamens) (Example)

A. Monoadelphous I. Citrus

B. Diadelphous II. Pea

C. Polyadelphous III. Lily

D. Epiphyllous IV. China-rose

Choose the correct answer from the options given below:

(1) A-III, B-I, C-IV, D-II
(2) A-IV, B-II, C-I, D-III
(3) A-IV, B-I, C-II, D-III
(4) A-I, B-II, C-IV, D-III
Answer (2)

138. Match List I with List II

List I List II

A. Citric acid cycle I. Cytoplasm

B. Glycolysis II. Mitochondrial matrix

C. Electron transport system III. Intermembrane space of mitochondria

D. Proton gradient IV. Inner mitochondrial membrane

Choose the correct answer from the options given below:

(1) A-IV, B-III, C-II, D-I (2) A-I, B-II, C-III, D-IV
(3) A-II, B-I, C-IV, D-III (4) A-III, B-IV, C-I, D-II
Answer (3)

139. Match List I with List II

List I List II
A. Robert May I. Species-Area relationship
B. Alexander von Humboldt II. Long term ecosystem experiment using out door
plots
C. Paul Ehrlich III. Global species diversity at about 7 million
D. David Tilman IV. Rivet popper hypothesis
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-II, D-I
(2) A-II, B-III, C-I, D-IV
(3) A-III, B-I, C-IV, D-II
(4) A-I, B-III, C-II, D-IV
Answer (3)

- 30 -
NEET (UG)-2024 (Code-S2)
140. Given below are two statements:
Statement I: In C3 plants, some O2 binds to RuBisCO, hence CO2 fixation is decreased.
Statement II: In C4 plants, mesophyll cells show very little photorespiration while bundle sheath cells do not
show photorespiration.
In the light of the above statements, choose the correct answer from the options given below:
(1) Statement I is false but Statement II is true
(2) Both Statement I and Statement II are true
(3) Both Statement I and Statement II are false
(4) Statement I is true but Statement II is false
Answer (4)

141. Match List I with List II

List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson & Stahl IV. Lac operon
Choose the correct answer from the options given below:
(1) A-IV, B-I, C-II, D-III
(2) A-III, B-II, C-I, D-IV
(3) A-III, B-IV, C-I, D-II
(4) A-II, B-III, C-IV, D-I
Answer (3)

142. In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m–2) yr–1, what would
be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?

(1)
100 x
(kcal m–2 ) yr –1
3x

(2)
x
(kcal m–2 ) yr –1
10

(3) x ( kcal m –2 ) yr –1

(4) 10 x ( kcal m–2 ) yr –1

Answer (4)

143. Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
(1) Isocitrate → -ketoglutaric acid
(2) Malic acid → Oxaloacetic acid
(3) Succinic acid → Malic acid
(4) Succinyl-CoA → Succinic acid
Answer (4)

- 31 -
 NEET (UG)-2024 (Code-S2)
144. The DNA present in chloroplast is:
(1) Circular, single stranded
(2) Linear, double stranded
(3) Circular, double stranded
(4) Linear, single stranded
Answer (3)

145. Read the following statements and choose the set of correct statements:
In the members of Phaeophyceae,
A. Asexual reproduction occurs usually by biflagellate zoospores.
B. Sexual reproduction is by oogamous method only.
C. Stored food is in the form of carbohydrates which is either mannitol or laminarin.
D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll.
E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin.
Choose the correct answer from the options given below:
(1) A, B, C and E only
(2) A, B, C and D only
(3) B, C, D and E only
(4) A, C, D and E only
Answer (4)

146. Which of the following statement is correct regarding the process of replication in [Link]?
(1) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ direction
(2) The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3’ → 5’
(3) The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5’ → 3’
(4) The DNA dependent DNA polymerase catalyses polymerization in 5’ → 3’ as well as 3’ → 5’ direction
Answer (1)

147. Match List I with List II

List I List II
A. Rose I. Twisted aestivation
B. Pea II. Perigynous flower
C. Cotton III. Drupe
D. Mango IV. Marginal placentation
Choose the correct answer from the options given below :
(1) A-II, B-III, C-IV, D-I
(2) A-II, B-IV, C-I, D-III
(3) A-I, B-II, C-III, D-IV
(4) A-IV, B-III, C-II, D-I
Answer (2)

- 32 -
NEET (UG)-2024 (Code-S2)
148. Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem,

thus, increasing the yield?

(1) Abscisic acid

(2) Auxin

(3) Gibberellin

(4) Cytokinin

Answer (3)

149. Which of the following are fused in somatic hybridization involving two varieties of plants?

(1) Pollens

(2) Callus

(3) Somatic embryos

(4) Protoplasts

Answer (4)

150. Identify the correct description about the given figure:

(1) Compact inflorescence showing complete autogamy

(2) Wind pollinated plant inflorescence showing flowers with well exposed stamens.

(3) Water pollinated flowers showing stamens with mucilaginous covering.

(4) Cleistogamous flowers showing autogamy.

Answer (2)

- 33 -
 NEET (UG)-2024 (Code-S2)

ZOOLOGY
SECTION-A
151. Match List I with List II :
List I List II

A.  –I antitrypsin I. Cotton bollworm

B. Cry IAb II. ADA deficiency

C. Cry IAc III. Emphysema

D Enzyme replacement therapy IV Corn borer

Choose the correct answer form the options given below:

(1) A-II, B-IV, C-I, D-III
(2) A-II, B-I, C-IV, D-III

(3) A-III, B-I, C-II, D-IV

(4) A-III, B-IV, C-I, D-II

Answer (4)
152. Which of the following is not a component of Fallopian tube?
(1) Ampulla
(2) Uterine fundus

(3) Isthmus

(4) Infundibulum
Answer (2)
153. The “Ti plasmid” of Agrobacterium tumefaciens stands for
(1) Temperature independent plasmid
(2) Tumour inhibiting plasmid

(3) Tumor independent plasmid

(4) Tumor inducing plasmid

Answer (4)
154. Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
(1) Constant gene pool
(2) Genetic recombination

(3) Genetic drift

(4) Gene migration

Answer (1)

- 34 -
NEET (UG)-2024 (Code-S2)
155. Following are the stages of pathway for conduction of an action potential through the heart

A. AV bundle B. Purkinje fibres

C. AV node D. Bundle branches

E. SA node

Choose the correct sequence of pathway from the options given below

(1) E-A-D-B-C

(2) E-C-A-D-B

(3) A-E-C-B-D

(4) B-D-E-C-A

Answer (2)

156. Given below are two statements :

Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and permeable
to electrolytes.

Statement II : The proximal convoluted tubule is lined by simple columnar brush border epithelium and
increases the surface area for reabsorption.

In the light of the above statements, choose the correct answer from the option given below :

(1) Statement I is false but Statement II is true

(2) Both Statement I and Statement II are true

(3) Both Statement I and Statement II are false

(4) Statement I is true but Statement II is false

Answer (3)

157. Match List I with List II :

List I List II

A. Down’s syndrome I. 11th chromosome

B. -Thalassemia II. ‘X’ chromosome

C. -Thalassemia III. 21st chromosome

D. Klinefelter’s syndrome IV. 16th chromosome

Choose the correct answer from the options given below :

(1) A-IV, B-I, C-II, D-III

(2) A-I, B-II, C-III, D-IV

(3) A-II, B-III, C-IV, D-I

(4) A-III, B-IV, C-I, D-II

Answer (4)

- 35 -
 NEET (UG)-2024 (Code-S2)
158.
Given below are some stages of human evolution.
Arrange them in correct sequence. (Past to Recent)
A. Homo habilis
B. Homo sapiens
C. Homo neanderthalensis
D. Homo erectus
Choose the correct sequence of human evolution from the options given below:
(1) A-D-C-B
(2) D-A-C-B

(3) B-A-D-C

(4) C-B-D-A
Answer (1)
159.
The flippers of the Penguins and Dolphins are the example of the
(1) Divergent evolution
(2) Adaptive radiation

(3) Natural selection

(4) Convergent evolution

Answer (4)
160.
Match List I with List II :

List I List II
(Sub Phases of Prophase I) (Specific Characters)

A. Diakinesis I. Synaptonemal complex formation

B. Pachytene II. Completion of terminalisation of chiasmata

C. Zygotene III. Chromosomes look like thin threads

D. Leptotene IV. Appearance of recombination nodules

Choose the correct answer from the options given below

(1) A-IV, B-III, C-II, D-I
(2) A-IV, B-II, C-III, D-I

(3) A-I, B-II, C-IV, D-III

(4) A-II, B-IV, C-I, D-III

Answer (4)

- 36 -
NEET (UG)-2024 (Code-S2)
161. Match List I with List II :

List I List II

A. Typhoid I. Fungus

B. Leishmaniasis II. Nematode

C. Ringworm III. Protozoa

D. Filariasis IV. Bacteria

Choose the correct answer from the options given below:

(1) A-II, B-IV, C-III, D-I
(2) A-I, B-III, C-II, D-IV

(3) A-IV, B-III, C-I, D-II

(4) A-III, B-I, C-IV, D-II

Answer (3)
162. Match List I with List II :

List I List II

A. Pons I. Provides additional space for Neurons, regulates posture

and balance.

B. Hypothalamus II. Controls respiration and gastric secretions.

C. Medulla III. Connects different regions of the brain.

D. Cerebellum IV. Neuro secretory cells

Choose the correct answer from the options given below :

(1) A-II, B-I, C-III, D-IV
(2) A-II, B-III, C-I, D-IV

(3) A-III, B-IV, C-II, D-I

(4) A-I, B-III, C-II, D-IV

Answer (3)
163. Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
(1) 5’ATGTACCGTTTATAGGTAAGT3’
(2) 5’AUGUACCGUUUAUAGGUAAGU3’

(3) 5’AUGUAAAGUUUAUAGGUAAGU3’

(4) 5’AUGUACCGUUUAUAGGGAAGU3’
Answer (2)

- 37 -
 NEET (UG)-2024 (Code-S2)
164. Match List I with List II :
List I List II
A. Pterophyllum I. Hag fish
B. Myxine II. Saw fish
C. Pristis III. Angel fish
D. Exocoetus IV. Flying fish
Choose the correct answer from the options given below :
(1) A-III, B-II, C-I, D-IV
(2) A-II, B-I, C-IIII, D-IV

(3) A-III, B-I, C-II, D-IV

(4) A-IV, B-I, C-II, D-III

Answer (3)
165. Consider the following statements :
A. Annelids are true coelomates
B. Poriferans are pseudocoelomates
C. Aschelminthes are acoelomates
D. Platyhelminthes are pseudocoelomates
Choose the correct answer from the options given below :
(1) D only
(2) B only

(3) A only

(4) C only
Answer (3)
166. Match List I with List II :
List I List II
A. Common cold I. Plasmodium
B. Haemozoin II. Typhoid
C. Widal test III. Rhinoviruses
D. Allergy IV. Dust mites
Choose the correct answer from the options given below :
(1) A-IV, B-II, C-III, D-I
(2) A-II, B-IV, C-III, D-I

(3) A-I, B-III, C-II, D-IV

(4) A-III, B-I, C-II, D-IV

Answer (4)

- 38 -
NEET (UG)-2024 (Code-S2)
167. Which of the following statements is incorrect?
(1) Bio-reactors have an agitator system, an oxygen delivery system and foam control system
(2) A bio-reactor provides optimal growth conditions for achieving the desired product
(3) Most commonly used bio-reactors are of stirring type

(4) Bio-reactors are used to produce small scale bacterial cultures

Answer (4)
168. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male.
Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in
male human being.
In the light of the above statements, choose the correct answer from the options given below :
(1) A is false but R is true
(2) Both A and R are true and R is the correct explanation of A
(3) Both A and R are true but R is NOT the correct explanation of A

(4) A is true but R is false

Answer (1)
169. Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :
(1) E-C-A-D-B
(2) C-E-D-A-B
(3) E-B-D-A-C

(4) B-D-E-A-C
Answer (1)
170. Given below are two statements:

Statement I: The presence or absence of hymen is not a reliable indicator of virginity.

Statement II: The hymen is torn during the first coitus only.

In the light of the above statements, choose the correct answer from the options given below :

(1) Statement I is false but Statement II is true

(2) Both Statement I and Statement II are true

(3) Both Statement I and Statement II are false

(4) Statement I is true but Statement II is false

Answer (4)

- 39 -
 NEET (UG)-2024 (Code-S2)
171. Which of the following is not a natural/traditional contraceptive method?
(1) Vaults
(2) Coitus interruptus

(3) Periodic abstinence

(4) Lactational amenorrhea

Answer (1)
172. Match List I with List II :
List I List II
A. Fibrous joints I. Adjacent vertebrae, limited movement
B. Cartilaginous joints II. Humerus and Pectoral girdle, rotational movement
C. Hinge joints III. Skull, don’t allow any movement
D. Ball and socket joints IV. Knee, help in locomotion
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II
(2) A-IV, B-II, C-III, D-I

(3) A-I, B-III, C-II, D-IV

(4) A-II, B-III, C-I, D-IV

Answer (1)
173. The following diagram showing restriction sites in E. coli cloning vector pBR322. Find the role of ‘X’ and ‘Y’
genes :

(1) Gene ’X’ is responsible for recognitions sites and ‘Y’ is responsible for antibiotic resistance.
(2) The gene ‘X’ is responsible for resistance to antibiotics and ‘Y’ for protein involved in the replication of
Plasmid.

(3) The gene ‘X’ is responsible for controlling the copy number of the linked DNA and ‘Y’ for protein involved
in the replication of Plasmid.
(4) The gene ‘X’ is for protein involved in replication of Plasmid and ‘Y’ for resistance to antibiotics.
Answer (3)

- 40 -
NEET (UG)-2024 (Code-S2)
174. Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
(1) Low pCO2 and High temperature
(2) High pO2 and High pCO2
(3) High pO2 and Lesser H+ concentration
(4) Low pCO2 and High H+ concentration
Answer (3)
175. In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on
(1) 11th segment
(2) 5th segment
(3) 10th segment
(4) 8th and 9th segment
Answer (3)
176. Match List I with List II
List I List II

A. Non-medicated IUD I. Multiload 375

B. Copper releasing IUD II. Progestogens

C. Hormone releasing IUD III. Lippes loop

D. Implants IV. LNG-20

Choose the correct answer from the option given below:

(1) A-III, B-I, C-IV, D-II
(2) A-III, B-I, C-II, D-IV
(3) A-I, B-III, C-IV, D-II
(4) A-IV, B-I, C-II, D-III
Answer (1)
177. Match List I with List II :
List I List II
A. Expiratory capacity I. Expiratory reserve volume + Tidal volume +
Inspiratory reserve volume
B. Functional residual II. Tidal volume + Expiratory reserve volume
capacity
C. Vital capacity III. Tidal volume + Inspiratory reserve volume
D. Inspiratory capacity IV. Expiratory reserve volume + Residual volume
Choose the correct answer from the options given below :
(1) A-I, B-III, C-II, D-IV
(2) A-II, B-IV, C-I, D-III
(3) A-III, B-II, C-IV, D-I
(4) A-II, B-I, C-IV, D-III
Answer (2)

- 41 -
 NEET (UG)-2024 (Code-S2)
178. Match List I with List II :

List I List II

A. Pleurobrachia I. Mollusca

B. Radula II. Ctenophora

C. Stomochord III. Osteichthyes

D. Air bladder IV. Hemichordata

Choose the correct answer from the options given below :

(1) A-IV, B-III, C-II, D-I
(2) A-IV, B-II, C-III, D-I

(3) A-II, B-I, C-IV, D-III

(4) A-II, B-IV, C-I, D-III

Answer (3)
179. Which of the following are Autoimmune disorders?
A. Myasthenia gravis B. Rheumatoid arthritis
C. Gout D. Muscular dystrophy
E. Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
(1) C, D & E only
(2) A, B & D only

(3) A, B & E only

(4) B, C & E only

Answer (3)
180. Match List I with List II :
List I List II
A. Cocaine I. Effective sedative in surgery
B. Heroin II. Cannabis sativa
C. Morphine III. Erythroxylum
D. Marijuana IV. Papaver somniferum
Choose the correct answer from the options given below:
(1) A-III, B-IV, C-I, D-II
(2) A-IV, B-III, C-I, D-II

(3) A-I, B-III, C-II, D-IV

(4) A-II, B-I, C-III, D-IV

Answer (1)

- 42 -
NEET (UG)-2024 (Code-S2)
181. Match List I with List II :
List I List II
A. Axoneme I. Centriole
B. Cartwheel pattern II. Cilia and flagella
C. Crista III. Chromosome
D. Satellite IV. Mitochondria
Choose the correct answer from the options given below :
(1) A-II, B-I, C-IV, D-III (2) A-IV, B-III, C-II, D-I
(3) A-IV, B-II, C-III, D-I (4) A-II, B-IV, C-I, D-III
Answer (1)
182. Given below are two statements: One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Breast-feeding during initial period of infant growth is recommended by doctors for bringing a
healthy baby.
Reason R : Colostrum contains several antibodies absolutely essential to develop resistance for the new
born baby.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) A is not correct but R is correct
(2) Both A and R are correct and R is the correct explanation of A
(3) Both A and R are correct but R is NOT the correct explanation of A
(4) A is correct but R is not correct
Answer (2)
183. Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in
human body:

Name of muscle/location
(1) (a) Involuntary – Nose tip
(b) Skeletal – Bone
(c) Cardiac – Heart
(2) (a) Smooth - Toes
(b) Skeletal – Legs
(c) Cardiac – Heart
(3) (a) Skeletal - Triceps
(b) Smooth – Stomach
(c) Cardiac – Heart
(4) (a) Skeletal - Biceps
(b) Involuntary – Intestine
(c) Smooth – Heart
Answer (3)

- 43 -
 NEET (UG)-2024 (Code-S2)
184. Match List I with List II :
List-I List-II
A. Lipase I. Peptide bond
B. Nuclease II. Ester bond
C. Protease III. Glycosidic bond
D. Amylase IV. Phosphodiester bond
Choose the correct answer from the options given below :
(1) A-IV, B-I, C-III, D-II (2) A-IV, B-II, C-III, D-I

(3) A-III, B-II, C-I, D-IV (4) A-II, B-IV, C-I, D-III

Answer (4)
185. Which of the following is not a steroid hormone?
(1) Glucagon
(2) Cortisol

(3) Testosterone

(4) Progesterone
Answer (1)
SECTION-B
186. Regarding catalytic cycle of an enzyme action, select the correct sequential steps :
A. Substrate enzyme complex formation.
B. Free enzyme ready to bind with another substrate.
C. Release of products.
D. Chemical bonds of the substrate broken.
E. Substrate binding to active site.
Choose the correct answer from the options given below :
(1) E, D, C, B, A (2) E, A, D, C, B

(3) A, E, B, D, C (4) B, A, C, D, E

Answer (2)
187. Given below are two statements :
Statement I : Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are
produced.
Statement II : Both bone marrow and thymus provide micro environments for the development and
maturation of T-lymphocytes.
In the light of above statements, choose the most appropriate answer from the options given below :
(1) Statement I is incorrect but Statement II is correct.
(2) Both Statement I and Statement II are correct.

(3) Both Statement I and Statement II are incorrect.

(4) Statement I is correct but Statement II is incorrect.

Answer (2)

- 44 -
NEET (UG)-2024 (Code-S2)
188. Match List I with List II :

List I List II

A. Exophthalmic goiter I. Excess secretion of cortisol, moon face & hypergylcemia.

B. Acromegaly II. Hypo-secretion of thyroid hormone and stunted growth.

C. Cushing’s syndrome III. Hyper secretion of thyroid hormone & protruding eye balls.

D. Cretinism IV. Excessive secretion of growth hormone.

Choose the correct answer from the options given below :

(1) A-III, B-IV, C-I, D-II
(2) A-I, B-III, C-II, D-IV

(3) A-IV, B-II, C-I, D-III

(4) A-III, B-IV, C-II, D-I

Answer (1)
189. Match List I with List II:

List I List II

A. RNA polymerase III I. snRNPs

B. Termination of transcription II. Promotor

C. Splicing of Exons III. Rho factor

D. TATA box IV. SnRNAs, tRNA

Choose the correct answer from the options given below :

(1) A-IV, B-III, C-I, D-II
(2) A-II, B-IV, C-I, D-III

(3) A-III, B-II, C-IV, D-I

(4) A-III, B-IV, C-I, D-II

Answer (1)
190. Given below are two statements:
Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum.
Statement II: The brain stem consists of the medulla oblongata, pons and cerebrum.
In the light of the above statements, choose the most appropriate answer from the options given below:
(1) Statement I is incorrect but Statement II is correct.
(2) Both Statement I and Statement II are correct.

(3) Both Statement I and Statement II are incorrect.

(4) Statement I is correct but Statement II is incorrect.

Answer (4)

- 45 -
 NEET (UG)-2024 (Code-S2)
191. Match List I with List II:
List I List II
A. Unicellular glandular epithelium I. Salivary glands
B. Compound epithelium II. Pancreas
C. Multicellular glandular epithelium III. Goblet cells of alimentary canal
D. Endocrine glandular epithelium IV. Moist surface of buccal cavity
Choose the correct answer from the options given below:
(1) A-II, B-I, C-IV, D-III (2) A-II, B-I, C-III, D-IV
(3) A-IV, B-III, C-I, D-II (4) A-III, B-IV, C-I, D-II
Answer (4)
192. Match List I with List II:
List I List II
A. Mesozoic Era I. Lower invertebrates
B. Proterozoic Era II. Fish & Amphibia
C. Cenozoic Era III. Birds & Reptiles
D. Paleozoic Era IV. Mammals
Choose the correct answer from the options given below :
(1) A-III, B-I, C-IV, D-II (2) A-II, B-I, C-III, D-IV
(3) A-III, B-I, C-II, D-IV (4) A-I, B-II, C-IV, D-III
Answer (1)
193. Given below are two statements:
Statement I: Mitochondria and chloroplasts both double membranes bound organelles.
Statement II: Inner membrane of mitochondria is relatively less permeable, as compared chloroplast.
In the light of the above statements, choose the mis appropriate answer from the options given below:
(1) Statement I is incorrect but Statement Il is correct.
(2) Both Statement I and Statement II are correct.
(3) Both Statement I and Statement II are incorrect.
(4) Statement I is correct but Statement Il is incorrect.
Answer (4)
194. Match List I with List II related to digestive system of cockroach.
List I List II
A. The structures used for storing of food I. Gizzard
B. Ring of 6-8 blind tubules at junction of foregut and midgut. II. Gastric Caeca
C. Ring of 100-150 yellow coloured thin filaments at junction III. Malpighian tubules
of midgut and hindgut.
D. The structures used for grinding the food. IV. Crop
Choose the correct answer from the options given below:
(1) A-III, B-II, C-IV, D-I (2) A-IV, B-II, C-III, D-I
(3) A-I, B-II, C-III, D-IV (4) A-IV, B-III, C-II, D-I
Answer (2)

- 46 -
NEET (UG)-2024 (Code-S2)
195. Given below are two statements:
Statement I: Gause's competitive exclusion principle states that two closely related species competing for
different resources cannot exist indefinitely.
Statement II: According to Gause's principle, during competition, the inferior will be eliminated. This may be
true if resources are limiting.
In the light of the above statements, choose the correct answer from the options given below :
(1) Statement I is false but Statement II is true.
(2) Both Statement I and Statement II are true.

(3) Both Statement I and Statement II are false.

(4) Statement I is true but Statement II is false.

Answer (1)
196. The following are the statements about non-chordates:
A. Pharynx is perforated by gill slits. B. Notochord is absent.
C. Central nervous system is dorsal. D. Heart is dorsal if present.
E. Post anal tail is absent.
Choose the most appropriate answer from the options given below:
(1) B, C & D only (2) A & C only

(3) A, B & D only (4) B, D & E only

Answer (4)
197. As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their
respective genotype can be
A. IBi/IAi/ii B. IBIB/IAIA/ii
C. IAIB/iIA/IBi D. IAi/IBi/IAi
E. iIB/iIA/IAIB
Choose the most appropriate answer from the options given below :
(1) D & E only (2) A only

(3) B only (4) C & B only

Answer (2)
198. Choose the correct statement given below regarding juxta medullary nephron.
(1) Juxta medullary nephrons outnumber the cortical nephrons.
(2) Juxta medullary nephrons are located in the columns of Bertini.

(3) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla.

(4) Loop of Henle of juxta medullary nephron runs deep into medulla.
Answer (4)

- 47 -
 NEET (UG)-2024 (Code-S2)
199. Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.

(1) ICSH, Leydig cells, Sertoli cells, spermatogenesis.

(2) FSH, Leydig cells, Sertoli cells, spermiogenesis.

(3) ICSH, Interstitial cells, Leydig cells, spermiogenesis.

(4) FSH, Sertoli cells, Leydig cells, spermatogenesis.

Answer (2)
200. Match List I with List II :
List I List II
A. P wave I. Heart muscles are electrically
silent.
B. QRS complex II. Depolarisation of ventricles.
C. T wave III. Depolarisation of atria.
D. T-P gap IV. Repolarisation of ventricles.
Choose the correct answer from the options given below :
(1) A-IV, B-II, C-I, D-III
(2) A-I, B-III, C-IV, D-II

(3) A-III, B-II, C-IV, D-I

(4) A-II, B-III, C-I, D-IV

Answer (3)

❑ ❑ ❑

- 48 -