11-03-2026

4504CMD303034250008 MD

PHYSICS

1) The charge on a capacitor of capacitance 10μF (in steady state) connected as shown in the figure

is

(1) 20 μC
(2) 10 μC
(3) 15 μC
(4) Zero

2) When a galvanometer is shunted with a 4Ω resistance, the deflection is reduced to one - fifth. If
the galvanometer is further shunted with a 2Ω wire, find the ratio of decrease in current to the
previous current in galvanometer (the main current remains the same).

(1) 8/13
(2) 5/13
(3) 3/4
(4) 3/13

3) Energy given by battery in one minute in following circuit is

(1) 7200 J
(2) 12000 J
(3) 9600 J
(4) 8400 J

4) n equal cell having e.m.f. E and internal resistance r, are connected in circuit of a resistance R.
Same current flows in circuit either they connected in series or parallel, if :

(1) R = nr

(2)
R=
(3) R = n2r
(4) R = r

5) The circuit shown above shows a steady state with S open. When S is closed :-

(1) No charge passes through S.

(2) A steady current of 30 A flows through S.
(3) 90µC of charge flows from B to A
(4) 120 µC of charge flows from A to B

6) Five conducting plates each having area A are arranged as shown in the figure. The outer plates
are connected by a wire. Find out equivalent capacitance between A and B is

(1)

(2)

(3)

(4)

7) A particle of charge ‘q’ and mass ‘m’ enters a uniform magnetic field region at origin ‘O’
with a velocity m/s and after some time it exits the magnetic field region with a velocity

m/s as shown. The time interval for which the particle has moved in the magnetic

field region is :-
(1)

(2)

(3)

(4)

8) The magnetic field at the center of an equilateral triangular loop of side 2L and carrying a current
i is

(1)

(2)

(3)

(4)

9) Magnetic field exists in the space between two coaxial cylinders of radius a and b respectively. An
electron of charge –e and mass m starts out from outer surface of the inner cylinder with an initial
velocity v0 in the radial direction. The maximum value of magnetic field such that electron will not

hit the surface of outer cylinder is:

(1)

(2)

(3)

(4)

10) Which one of the following options represents the magnetic field at O due to the current
flowing in the given wire segments lying on the xy plane ?
(1)

(2)

(3)

(4)

11) The magnetic field in a region is given by . A square loop of side d is placed with its
edges along the x and y axes. The loop is moved with a constant velocity . The emf induced in
the loop is :

(1)

(2)

(3)

(4)

12) The segment AB of wire carrying current I1 is placed perpendicular to a long straight wire
carrying current I2 as shown in figure. The magnitude of force experienced by the straight wire AB is
(1)

(2)

(3)

(4)

13) The magnetic susceptibility of a material of a rod is 499. Permeability in vacuum is 4π × 10–7
H/m. Absolute permeability of the material of the rod is:

(1) 4π × 10–4 H/m

(2) 2π × 10–4 H/m
(3) 3π × 10–4 H/m
(4) π × 10–4 H/m

14) The magnetic moments associated with two closely wound circular coils A and B of radius rA =
10 cm and rB = 20 cm respectively are equal if: (Where NA, IA and NB, IB are number of turn and
current of A and B respectively)

(1)
(2)
(3)
(4)

15) Two particles A and B having equal charges after being accelerated through the same potential
difference, enter a region of uniform magnetic field and describe circular paths of radii R1 and R2
respectively. The ratio of mass of A to that of B is :

2
(1) (R1/R2)
1/2
(2) (R1/R2)
3/2
(3) (R2/R1)
(4) (R1/R2)

16) A metal wire of negligible resistance slides on a horse shoe shaped metal loop of negligible
resistance and width 0.25 m. There is a 1.0 Ω resistor in the circuit as well as a 6.0 V battery and a
uniform magnetic field directed in the plane of the page of magnitude 0.5 T exists. A force of 0.25 N
to the left is required to keep it moving with constant speed to the right, the velocity of the wire is:-

(1) 20 m/s
(2) 32 m/s
(3) 48 m/s
(4) 5 m/s

17) A planar loop of wire rotates in a uniform magnetic field. Initially, at t = 0, the plane of the loop
is perpendicular to the magnetic field. If it rotates with a period of 10 s about an axis in its plane
then the magnitude of induced emf will be maximum and minimum, respectively at :

(1) 2.5 s and 7.5 s

(2) 5.0 s and 7.5s
(3) 5.0 s and 10.0 s
(4) 2.5s and 5.0 s

18) A square conducting loop is placed in the time varying magnetic field . The
centre of square coincides with axis of cylindrical region of magnetic field. The directions of induced

electric field at point a, b and c are :

(1)

(2)
(3)

(4)

19) In L-R series circuit, source voltage is 10V and voltage across R is 8V. Phase difference (ϕ)
between applied voltage and current is:

(1)

(2)

(3)

(4)

20) In the given LCR series circuit, the reading of voltmeter is 120V. The reading (in A) of the

ammeter is :

(1)
(2) 4A
(3) 2A
(4) 5A

21) Find the peak current and resonant frequency of the following circuit (as shown in figure).

[JEE(Main) 2021, Online]

(1) 0.2 A and 50 Hz
(2) 0.2 A and 100 Hz
(3) 2 A and 100 Hz
(4) 2A and 50 Hz

22) The electric field associated with an electromagnetic wave in vacuum is given by

, where E, z & t are in volt/m, meter & second respectively. The value
of propagation constant k is :

(1) 6 m–1
(2) 3 m–1
(3) 2 m–1
(4) 0.5 m–1

23) A thin rod of length f/3 lies along the axis of a concave mirror of focal length f. One end of its
magnified image touches an end of the rod. The length of the image is :-

(1) f

(2)

(3) 2f

(4)

24) A ray of light enters a glass slab at an angle of incidence θ. Then the minimum refractive index
of the glass so that the ray may not emerge at the face BC, irrespective of the angle of incidence, is :

(1)

(2)
(3)

(4)

25) Find the position of the image formed by the lens combination given in figure.
(1) 30 cm to the right of 3rd lens
(2) 20 cm to the right of 3rd lens
(3) 30 cm to the left of 3rd lens
(4) 20 cm to the right of 3rd lens

26) In a Fraunhofer diffraction at a single slit of width d with incident light of wavelength 5500 Å,
the first minima is observed, at an angle 30º. The first secondary maxima is observed at an angle θ
equals :-

(1)
sin–1

(2)
sin–1

(3)
sin–1

(4)

27) A fish rising vertically with a speed of 4 m/s to the surface of water (sees) a bird diving vertically

towards it with a velocity of 10 m/s. If refracive index water is , find the actual velocity of dive of
the bird.

(1) 2.5
(2) 1.5
(3) 4.5
(4) 3

28) The focal length of the objective and eye piece of a microscope are respectively 1cm and 2cm.
The distance between them is 12 cm. Where an object should be placed in order to view it at the
least distant of distinct vision.

(1) 4.05 cm
(2) 0.05 cm
(3) 2.05 cm
(4) 1.1 cm
29) In a Young's double slit experiment the slit separation is 0.5 mm and the screen is 0.5 m from
the slit. For a monochromatic light of wavelength 500 nm the distance of 3rd maxima from the 2nd
minima on the other side of central maxima is

(1) 2.75 mm
(2) 2.5 mm
(3) 22.5 mm
(4) 2.25 mm

30) In YDSE set up two thin transparent slabs of thickness t and 3t are introduced infront of slits (as
shown in figure). As a result, the Ist order minimum is formed at central point O, then value of λ is :

(Refractive index of slabs is µ)

(1) μt
(2) 4(μ – 1)t
(3) 3(μ – 1)t
(4) 4μt

31) The angle of polarisation for any medium is 60°. What will be critical angle for this ?

(1)
(2)
(3)

(4)

32) If light of wavelength λ1 is allowed to fall on a metal, then kinetic energy of photoelectrons
emitted is E1 . If wavelength of light changes to λ2 then kinetic energy of electrons changes to E2.
Then work function of the metal is :-

(1)

(2)

(3)

(4)

33) Energy of a photon whose de-Broglie wavelength is equal to the wavelength of an electron
accelerated through potential diff. of 125 V is :-
(1) 11.5 eV
(2) 11.5 KeV
(3) 125 eV
(4) 1250 eV

34) Binding energy per nucleon versus mass no. curve for nuclei is shown. W,X,Y and Z are four

nuclei indicated on the curve. The process that would release energy

(1) Y → 2Z
(2) W → X+Z
(3) W → 2Y
(4) X → Y+Z

35) How much energy is needed to remove a neutron from the nucleus of ? mn = 1.008665 U
M(41Ca) = 40.962278 U
M(40Ca) = 39.962591 U

(1) 8.362 MeV

(2) 6.52 MeV
(3) 10 MeV
(4) 4.56 MeV

36) Electrons with de-Broglie wavelength λ fall on the target in an X-ray tube. The cut-off
wavelength of the emitted X-ray is :-

(1)

(2)

(3)

(4) λ0 = λ

37) Wavelength of photon in H-atom is 434 nm in transition from n = 5 to n = 2. Wavelength of

photon for same transition in He+ atoms is :-

(1) 108.5 nm
(2) 672 nm
(3) 174 nm
(4) 218 nm
38)

The truth table for the circuit shown in the figure is:

A B Y

1 1 1

(1) 0 1 0

1 0 0

0 0 1

A B Y

1 1 0

(2) 0 0 1

1 0 0

0 1 1

A B Y

1 1 0

(3) 0 1 0

1 0 0

0 0 0

1 1 1

0 1 1
(4)
1 0 1

0 0 1

39) An ideal diode is connected in a circuit with resistance R = 50Ω and V = 10 volt as shown in
figure, maximum and minimum value of output voltage, when no load applied is :

(1) 10 V, – 25V
(2) 10 V, – 15V
(3) 25 V, –25V
(4) 25 V, – 15V

40) In the given circuit, maximum value of series resistance for zener diode to regulate voltage on

RL, will be :-

(1) 12 kΩ
(2) 6 kΩ
(3) 4 kΩ
(4) 24 kΩ

41) Figure, shown below, shows three situations involving a charged particle and a unifomly charged
spherical shell. The charges and radii of the shells are indicated in the figure. If F1, F2 and F3 are the
magnitudes of the forces on the particle due to the presence of the shell in situations (I), (II) and (III)

respectively then :-

(1) F3 > F2 > F1

(2) F2 > F1 = F3
(3) F3 = F2 > F1
(4) F1 > F2 > F3

42) Find the dipole moment of given configuration if P = QR (where R is the radius of the circle and
P is magnitude of dipole moment) :-

(1) 3P
(2)
(3)
(4) 4P

43) Force of attraction between two point electric charges placed at a distance d in air is F. What
distance apart should these be kept in the medium, of dielectric constant 6 so that net force
between them becomes F/3 ?

(1) 2d
(2) d/2

(3)

(4)

44) Two charges q1 and q2 are kept on x-axis and electric field at different points on x-axis is plotted
against x. Choose correct statement about nature and magnitude of q1 and q2.

(1) q1 +ve, q2 –ve; |q1| > |q2|

(2) q1 +ve, q2 –ve; |q1| < |q2|
(3) q1 –ve, q2 +ve; |q1| > |q2|
(4) q1 –ve, q2 +ve; |q1| < |q2|

45) Consider a spherical symmetric distribution of charge. The centre of symmetry is at O. Electric
flux linked with a spherical Gaussian surface of radius 'r' and centered at O is given by ϕ = ϕ0r4.
Volume charge density at a distance 'r' from O is given by :-

(1)

(2)

(3)

(4)

CHEMISTRY

1) Which of the following is incorrect?

(1) Carbolic Acid and carbinol can be distinguished by neutral (FeCl3) test
(2) Both carbolic Acid and Picric acid have – COOH group
(3) Benzaldehyde and formaldehyde can be distinguished by Fehling Solution Test
(4) Ethanol and propanol can be distinguished by Iodoform test

2) Among the following is incorrect

(1) Glucose, fructose, maltose give positive tollens reagent test

(2) Number of chiral carbons present in glucose is 5
(3) Glucose and galactose are C-4 epimers.
During denaturation of proteins secondary and tertiary structures are destroyed but primary
(4)
structure remain intact.

3) Given below the following statements:

Statement 1 : pH of Aq. Solution of NaCl after electrolysis is 7.0
Statement 2 : Equilibrium constant Keq for for the Zn|Zn+2(0.1M)||Zn+2(0.01M) | Zn is unity

(1) Both statement-I and statement-II are incorrect

(2) Both statement-I and statement-II are correct
(3) Statement-I is correct and statement-II is incorrect
(4) Statement-I is incorrect and statement-II is correct

4) Given below the following statements:

Statement 1: Permanganate titrations in presence of HCl are unsatisfactory, since HCl is oxidized
to chlorine.
Statement 2: Lanthanides resemble one another more closely than do the members of ordinary
transition elements in any series, due to one stable +3 common oxidation state, but large changes in
size and nuclear charge along the series.
In the light of above statements select the correct option :-

(1) Both statement-I and statement-II are incorrect

(2) Both statement-I and statement-II are correct
(3) Statement-I is correct and statement-II is incorrect
(4) Statement-I is incorrect and statement-II is correct

5) In which of the following aqueous solution van't Hoff factor attains its limiting value

(1) 0.1 m NaCl

(2) 0.01 m NaCl
(3) 0.001 m NaCl
(4) In all of these

6) Which of the following is not correct the property given against is

(1) C6H5F > C6H5Cl > C6H5Br > C6H5I (aromatic nucleophilic substitution)
(2) RCOX < RCOOCOR < RCOOR < RCONH2 (Nucleophilic acyl substitution)
(3) HCHO > PhCHO > CH3COCH3 > PhCOCH3(Nucleophilic addition Reactivity)
(4) tert-butylbenzene < isopropylbenzene < toluene (Electrophilic aromatic substitution)
7) Among the following compound. Which show high reactivity towards SN1 reaction.

I.

II.

III.
IV. CH3Cl

V.

VI.

(1) I, II, IV and VI

(2) III, IV and VI
(3) II, IV, V and VI
(4) II, V and VI

8) Given :

(i) MnO4– + 8H+ + 5e– Mn2+ + 4H2O Eº = x1V

(ii) MnO2 + 4H+ + 2e– Mn2+ + 2H2O Eº = x2V

Find Eº for the following reactions :

MnO4– + 4H+ + 3e– MnO2 + 2H2O

(1) x2 – x1
(2) x1 – x2

(3)

(4)

9) For d1, d2 and d3 octahedral complexes, the value of CFSE (crystal field stabilization energy) in
weak field ligands and strong field ligands is:

(1) Different for all three cases

(2) Same for all three cases
(3) Same for d1 and d2 , but different for d3
(4) Same for d3 only

10) Among the following amine which can be synthesized by Gabriel Phthalimide reaction

(1) p-nitroanline
(2) Diethylamine
(3) t-Butylamine
(4) m-nitroaniline

11) Compounds A and B on cross aldol condensation in presence of dilute alkali at 293 K gives
following product of reaction

A and B identified as

(1)

(2)

(3)

(4)

12) Statement 1 : Solubility of chloroform and acetone mixture increases on increasing

temperature and mixture boils at particular composition at the temperature more than boiling point
of both of components.
Statement 2 : Observed molecular mass of benzoic Acid in benzene is more than theoretical
molecular mass.
In the light of above statements select the correct option

(1) Both statement-I and statement-II are incorrect

(2) Both statement-I and statement-II are correct
(3) Statement-I is correct and statement-II is incorrect
(4) Statement-I is incorrect and statement-II is correct

13) For a first order reaction, rate constant is given by

log k = 14 – , then what will be the value

of temperature if the rate constant is 100 sec–1 ?

(1) 100 K
(2) 327 K
(3) 1000 K
(4) 720 K

14) Which oxide of Mn is acidic in nature ?

(1) MnO
(2) Mn2O7
(3) Mn2O3
(4) MnO2

15) A certain substance 'A' tetramerizes in water to the extent of 80% A solution of 2.5 g of A' in 100
g of water lowers the freezing point by 0.3°C the molar mass of 'A' is (Kf for water = 1.86°C Kg mol-1)

(1) 120
(2) 61
(3) 62
(4) 60

16) In Hoffmann bromamide degradation reaction, the number of moles of KOH required and the
number of moles of K2CO3 formed respectively, for one mole of ethanamide is:

(1) 4 moles and 1 moles

(2) 2 moles and 1 mole
(3) 2 moles of each
(4) 4 moles and 2 moles

17) Among the following, the correct order of acidic strength is:

(1) HCOOH > CH3COOH > PhCOOH

(2) PhCOOH > CH2=CH–COOH > CH3COOH
(3) NO2CH2COOH > CHCl2COOH > NCCH2COOH
(4) C6H5COOH > CH3COOH > C6H5CH2COOH

18)

For a first order reaction

3A(g) → 2B(g) + 3C(g) + D(g)
if initial pressure of A is P0 and after time 't' the pressure of gaseous mix is Pt the Rate Constant is :

(1)

(2)

(3)

(4) None of these

19) In crystal field splitting, the number of metal d-orbitals directly facing the ligands in
octahedral and tetrahedral complexes respectively is

(1) 3 and 2
(2) 2 and 3
(3) 4 and 1
(4) 1 and 4

20) The number of gaseous product(s) are formed on the basis of following :

(1) 1
(2) 2
(3) 3
(4) 4

21) In co-ordination compound, dichloridobis(Ethane-1, 2-diamine)cobalt(III) Chloride

(1) Cis-trans isomerism not possible

(2) Cis-isomer is optically inactive, while trans-isomer is optically active
(3) Total 3 stereoisomers are formed, in which cis isomer is optically active
(4) Primary valency and secondary valency are 6 and 3 respectively

22) Electrolytic reduction of 1.23 gm nitro benzene (MM = 123) into Aniline with 50% current
efficiency charge required is
(1) 0.03 F
(2) 0.06 F
(3) 0.12 F
(4) 0.60 F

23) For the cell Zn(s) | Zn2+(aq) || Mx+ (aq) | M(s), different half cells and their standard electrode
potentials are given below :

If , which cathode will give a maximum value of per electron transferred ?

(1) Fe3+ / Fe2+

(2) Ag+ / Ag
(3) Au3+ / Au
(4) Fe2+ / Fe

24) Statement 1 : In a solution containing non-volatile solute if mole fraction of solvent increases
vapour pressure increases.
Statement 2 : In a binary liquid mixture of ‘A’ into ‘B’. If vapour pressure of ‘A’ is more than ‘B’
than ‘A’ will be rich in vapour phase than ‘B’
In the light of above statements select the correct option :-

(1) Both statement-I and statement-II are incorrect

(2) Both statement-I and statement-II are correct
(3) Statement-I is correct and statement-II is incorrect
(4) Statement-I is incorrect and statement-II is correct

25) In faintly alkaline solution, KMnO4 oxidise thiosulphate ion (S2O3)–2 almost quantitatively to

-2
(1) SO4
–2
(2) S + SO4
–2
(3) S4O6
(4) S

26) Among the following reactions which give acetaldehyde as only product?

I. CH3CH = CH2

II.

III. CH3 – CH3OH

IV. CH3–CH2OH

(1) I, II and IV
(2) II and IV
(3) I, III and IV
(4) IV only

27) The pressure of hydrogen gas is increased from 1 atm to 100 atm. Keeping the H+ (1M) constant,
the voltage of the hydrogen half-cell at 25ºC will be :-

(1) 0.059 V
(2) 0.59 V
(3) 0.0259 V
(4) – 0.0591 V

28) Number of unpaired electrons present in [Mn(CN)6]3– is

(1) Zero
(2) 2
(3) 4
(4) 3

29) Among the following which is incorrect ?

+3
(1) Degenerate orbitals of [Cr(H2O)6] are dxy and dyz
–4 –2
(2) [Fe(CN)6] [Ni(CN)4] and Ni(CO)4 are Diamagnetic
(3) Zeise’s salt, is a π-bonded complex
+
(4) Geometric Isomers that can exists for square planar complexes [Pt(Py)(NH3)(CN)(NH2OH)] is 3

30) The reactions involving cleavage of O-H bond in alcohols is/are

(I) Reaction with active metals to yield corresponding alkoxides and H2.
(II) Reaction with thionyl-chloride SOCl2.
(III) Dehydration of alcohols.
(IV) Reaction with HX(X = Cl/Br/I)
(V) Reaction of alcohols with PCl3 to give H3PO3 as by product.
(VI) Reaction of alcohols with carboxylic acid.

(1) II, III and IV

(2) I, V and VI
(3) I and VI
(4) II, III, V and VI

31) Consider the following four electrodes,

P = Cu2+ (0.0001 M) / Cu(s)
Q = Cu2+ (0.1 M) / Cu(s)
R = Cu2+ (0.01 M) / Cu(s)
S = Cu2+ (0.001 M) / Cu(s)
If the standard reduction potential of Cu2+ / Cu is 0.34 V, the reduction potential in volt of the above
electrodes follow the order :-

(1) Q > R > S > P

(2) P > S > R > Q
(3) R > S > Q > P
(4) P > Q > R > S

32) The complex compound [Co(NH3)3NO2ClCN] is named as :-

(1) TriammineChlorocyanonitro cobalt (III)

(2) Nitrochlorocyanotriammine cobalt (III)
(3) Cyanonitriochlorotriammine cobalt (III)
(4) Triamminenitrochlorocyano cobalt (III)

33) On moving from Ce+3 to Lu+3 the cation having maximum no. of unpaired electrons is :-

(1) Ce+3
(2) Lu3+
(3) Eu+3
(4) Gd+3

34) A decimolar solution of potassium ferrocyanide is 50% dissociated at 300K. The osmotic pressure
of the solution. (R=25/3 JK-1 mol-1)

(1) 7.5 × 105 Pa

(2) 7.5 × 102 Pa
(3) 7.5 × 104 Pa
(4) 7.5 × 103 Pa

35) Which statement is correct regarding Fischer esterification?

(1) It is independent of steric effects

(2) Tertiary alcohols react faster than primary alcohols
(3) Reaction is reversible
(4) Alcohol acts as electrophile

36)

The final product R of the reaction :

(1)

(2)

(3)

(4)

37)

Anisole Product :-

(1)
+ CH3I

(2)
+ CH3OH

(3)
+ CH3I

(4)
+ CH3CH2I

38) Molar conductance of 0.1 M acetic acid is 7 ohm–1 cm2 mol–1. If the molar conductance. of acetic
acid at infinite dilution is 380.8 ohm–1 cm2 mol–1, the value of dissociation constant will be :

(1) 226 × 10–5 mol dm–3

(2) 1.66 × 10–3 mol dm–1
(3) 1.66 × 10–2 mol dm–3
(4) 3.442 × 10–5 mol dm–3

39) Four successive members of the first row transition elements are listed below with atomic

numbers. Which one of them is expected to have the highest value?

(1) Cr (Z = 24)
(2) Mn (Z = 25)
(3) Fe (Z = 26)
(4) Co (Z = 27)

40) Aqueous solution of Na2SO4 containing a small amount of HPh is electrolysed using Pt-
electrodes. The color of the solution after some time will.

(1) Remain colorless

(2) Change from pink to colorless
(3) Change from colorless to pink
(4) Remain pink

41) t-Butyl alcohol on reaction with PhMgBr gives same major product as

(1) Reaction of benzene diazonium chloride with ethanol

(2) Clemmensen reduction of acetophenone
(3) n-hexane on heating in presence of Cr2O3/Al2O3 at high temp
(4) Both (1) & (3)

42) Most suitable reagent to convert 2-hydroxy-cyclohexane-carbaldehyde into 2-methyl-

cyclohexanol?

(1) Zn-Hg/[Link]
(2) NH2-NH2/KOH in glycol
(3) LiAlH4
(4) Red P and HI

43) Correct increasing order of anhydride formation in the presence of P2O5:

CH3COOH, CF3COOH, (CH3)3CCOOH, HCOOH

(1) (CH3)3CCOOH < CH3COOH < HCOOH < CF3COOH

(2) CF3COOH < HCOOH < CH3COOH < (CH3)3CCOOH
(3) HCOOH < CH3COOH < (CH3)3CCOOH < CF3COOH
(4) (CH3)3CCOOH < HCOOH < CH3COOH < CF3COOH

44) The correct order of the stoichiometries of AgCl formed when AgNO3 in excess is treated with
the complexes : CoCl3.6NH3, CoCl3.5NH3, CoCl3.4NH3 respectively is:

(1) 3AgCl, 1AgCl, 2AgCl

(2) 3AgCl, 2AgCl, 1AgCl
(3) 2AgCl, 3AgCl, 2AgCl
(4) 1AgCl, 3AgCl, 2AgCl

45) Statement 1: Alkaline oxidative fusion of pyrolusite (MnO2) gives a compound, which is
paramagnetic and green and in acidic-medium this give MnO4–
Statement 2: Manganese (VI) becomes unstable relative to manganese (VII) and manganese (IV) in
acidic solution.
In the light of above statements select the correct option :-

(1) Both statement-I and statement-II are incorrect

(2) Both statement-I and statement-II are correct
(3) Statement-I is correct and statement-II is incorrect
(4) Statement-I is incorrect and statement-II is correct

BIOLOGY

1) Microoganisms such as Lactobacillus are used for the commercial production of

(1) Acetic acid

(2) Butyric acid
(3) Lactic acid
(4) Citric acid

2)

Biological control methods adopted in agriculture pest control are based on the ability of the
predator to

(1) Completely eradicate the pest population in that ecosystem

(2) Overexploit the prey population
(3) Regulate the prey population
(4) First increase and then decrease the prey population

3) Identify the incorrect match w.r.t. sacred groves

(1) Chanda and Bastar areas - Gujarat

(2) Aravalli Hills - Rajasthan
(3) Western Ghat regions - Karnataka
(4) Khasi and Jaintia Hills - Meghalaya

4) When a species becomes extinct, the plant and animal species associated with it, in a obligatory
an way, also become extinct. This exemplifies

(1) Over-exploitation
(2) Co-extinction
(3) Alien species invasion
(4) Fragmentation

5) Observe the population growth curves given below.

Choose the correct equations for 'A & B' respectively.

(1)

(2)

(3)

(4)

6) In an ecosystem, 200 kJ of sunlight energy falls on the organism that occupies the first trophic
level of a food chain. What amount of this energy will be utilised by the organism for its different
biological activities which occupies the third trophic level in the this food chain?

(1) 2J
(2) 1.8J
(3) 20J
(4) 18J

7) Read the statements given below and identify the correct option.
Statement-I : A fruit which develops from any floral part except ovary is said to be a false fruit.
Statement-II : Some species of Asteraceae family have evolved the mechanism of apomixis.

(1) Both the statement-I and statement-II are true

(2) Both the statement-I and statement-II are false
(3) Statement-I is false but statement-II is true
(4) Statement-I is true but statement-II is false

8) Read the following Assertion (A) and Reason (R) statements and choose the correct option from
the following.
Assertion(A) : A typical angiosperm embryo sac at maturity, is 8-nucleate and 7-celled.
Reason (R) : Egg apparatus consists of two synergids, one egg cell and three antipodals.

(1) Both (A) and (R) are true but (R) is not the correct explanation of (A)
(2) Both (A) and (R) are true and (R) is the correct explanation of (A)
(3) (A) is true but (R) is false
(4) (A) is false but (R) is true

9) Myotonic dystrophy and cystic fibrosis both are

(1) Autosomal disorders

(2) Recessive gene disorders
(3) X-linked recessive disorders
(4) X-linked dominant disorders

10)

Choose the correct option w.r.t. sickle-cell anaemia.

(1) It is the example of frame-shift mutation

(2) it is transmitted from a healthy homozygous father and a carrier mother to the male child.
(3) homozygous individuals for HbS show the diseased phenotype
It is caused by the substitution of Valine by Glutamic acid at the sixth position of the beta
(4)
globin chain of haemoglobin.

11) Four genes a, b, c and d are present on a chromosome. Percentage of recombination between a
and b = 20%, a and d = 5%, b and c = 10% and b and d = 15%. Which of the following can be the
sequence of genes on the chromosome?

(1) adcb
(2) cdab
(3) acbd
(4) dcab

12) The rate of decomposition of detritus is faster in the ecosystem due to the following factors,
except

(1) Presence of aerobic soil microbes

(2) Detritus rich in lignin and chitin
(3) Warm and moist environment
(4) Detritus rich in sugar

13) Read the given assertion (A) and reason (R) and choose the correct option.
Assertion (A) : During Griffith's experiment, the R-strain bacteria is somehow been transformed by
heat-killed S-strain bacteria.
Reason (R) : There might be absorption of some transforming principle by rough type bacteria from
heat-killed smooth bacteria during Griffith's experiment, that had enabled R-strain to synthesise
smooth polysaccharide coat.

(1) Both (A) and (R) are true and (R) is the correct explanation of (A)
(2) Both (A) and (R) are true but (R) is not the correct explanation of (A)
(3) (A) is true but (R) is false
(4) Both (A) and (R) are false

14) During the process of transcription, both the strands of DNA are not copied as
a. They would form two RNA molecules that are complementary to each other.
b. It may lead to prevention of translation of RNA into protein.
c. Same type of proteins will be produced in higher quantity.
d. They lack structural and promoter genes.
The correct ones are

(1) b and c only

(2) c and d only
(3) a, c and d only
(4) a and b only

15) State true (T) or false (F) for the given statements and choose the correct option
A. One of the applications of human genome project is to correct a number of hereditary diseases
produced due to single gene defects.
B. The human genome contains 3164.7 billion nucleotide bases

A B

(1) T T

(2) F F

(3) T F

(4) F T

(1) (1)
(2) (2)
(3) (3)
(4) (4)

16) A breeder wants to perform artificial hybridisation experiments. To ensure that only desired
pollens fall on the stigma, he should make sure that
a. Emasulation of staminate flower is done
b. Bagging of the emasculated flower is done.
c. Bagging of the female flower in bud stage is done
d. Bisexual flowers, showing protogyny are not selected for the cross.
The correct ones are

(1) b, c and d only

(2) b and c only
(3) a,b and d only
(4) a and c only

17) Read the statements given below and choose the correct answer.
Statement I : Linked genes always assort independently of one another.
Statement II : The frequency of recombination between gene pairs on the same chromosome can
be used to determine their map distance on the chromosome.

(1) Statement I is true but statement II is false

(2) Statement II is true but statement I is false
(3) Both the statements I and II are true
(4) Both the statements I and II are false

18) Match column I with column II.

Column I Column II

occurs due to the presence of defective

a. Sickle-cell anaemia (i)
blood clotting factor in affected individual

Affected individual lacks liver enzyme

b. α-Thalassemia (ii)
phenylalanine hydroxylase

Defect is caused by transversion mutation

c. Phenylketonuria (iii) of the gene controlling β-chain of
haemoglobin

Controlled by two closely linked genes

d. Haemophilia (iv)
HBA1 and HBA2 on chromosome 16
Choose the correct option.
(1) a(iv), b(ii), c(i), d(iii)
(2) a(iii), b(iv), c(ii), d(i)
(3) a(iii), b(i), c(ii), d(iv)
(4) a(i), b(iii), c(iv), d(ii)

19) Read the following statements(A-D)

A. The size of the population tells us a lot about its status in the habitat.
B. The density of a population in a given habitat during a given period, fluctuates due to changes
only in natality and emigration.
C. Oysters and pelagic fishes produced a large number of small sized offspring.
D. The intrinsic rate of natural increase (r) is a measure of the inherent potential of population to
grow.
The correct statements are

(1) Only A, B and D

(2) Only A, C and D
(3) Only C and D
(4) Only A and B

20)

Read the given statements (A-E).

A. Earthworm breaks down detritus into smaller particles known as anabolism.
B. The humus is further degraded by some microbes and release only organic nutrients called
mineralization.
C. Water soluble inorganic nutrients goes deep down into the soil and get precipitated by a process
called leaching.
D. Detritus food chain begins with living organism.
E. Rate of decomposition is not controlled by climatic factors.
How many of the above statements are incorrect?

(1) Two
(2) Five
(3) Three
(4) Four

21) Which among the following is not a direct cause of biodiversity loss?
A. Introduction of invasive species
B. Over exploitation
C. Mutualism
D. Habitat loss
Choose the correct option :

(1) A, B and D
(2) A, B and C
(3) C only
(4) D only

22) Match the taxanomic group of animal in Column-I with their percentage of threat of extinction in
Column-II and choose the correct option from the codes given below :

(1) A-i, B-ii, C-iii, D-iv

(2) A-ii, B-i, C-iv, D-iii
(3) A-i, B-iv, C-ii, D-iii
(4) A-iv, B-iii, C-ii, D-i

23) Given below are two statements:

Statement I : According to Gause's Competitive Exclusion Principle, two species occupying the
same niche can coexist indefinitely in a stable environment.
Statement II : If two species compete for exactly the same resources, one can be excluded due to
competitive disadvantage.
Choose the correct answer from the options given below :

(1) Both Statement I and Statement II are true

(2) Both Statement I and Statement II are false
(3) Statement I is true but Statement II is false
(4) Statement I is false but Statement II is true

24) Which one is the correct product of DNA dependent RNA polymerase to the given template.
3'TACATGGCAAATATCCATTCA5'

(1) 5'TACATGGCAAATATCCATTCA3'
(2) 3'TACAACCGTTTATAGGTAAGT5'
(3) 5'AUGUACCGUUUAUAGGUAAGU3'
(4) 5'ATGTACCGTTTUCAGGTAAGU3'

25)

Identify the set of incorrect statements :-

A. The flowers of Vallisneria are colourless and produce fragrance.
B. The Flower of waterlily are pollinated by water.
C. In most of water pollinated species, the pollen grain not covered by mucilaginous layer.
D. Pollen grain of some hydrophyte are long and ribbon like.
E. In most of hydrophyte, the pollen grains are carried actively inside water.
Choose the appropriate option from the given below :-

(1) C,D and E only

(2) A,B,C and D only
(3) A,C,D,E only
(4) A,B,C and E only

26) Which statements do not support the Mendel's law of dominance?

(A) Factors occur in pairs.
(B) In F1 both alleles express themselves.
(C) In F1 none of the alleles is completely dominant.
(D) Segregation of one pair of character is independent of other pair of character.
(E) Characters are controlled by discrete units called factor.
Choose the appropriate from the options given below

(1) A, B, C, D, E
(2) A and E only
(3) A, B and C only
(4) B, C and D only

27) Which is related to latitude gradient in species diversity:-

(A) Columbia has nearly 1400 species of bird while New York at 41°N has105 species of bird.
(B) New York at 71°N has 105 species of bird while Greenland at 41°N has 56 species of bird.
(C) Amazon rain forest have more mammal species than amphibian species.
(D) Tropics harbour more species than temperate.
(E) India has more species of bird than Greenland.
Choose the correct statements from the options given below.

(1) A, B, C & E
(2) B, C & D
(3) C, D & E only
(4) Only A, D & E

28) In the equation of Verhulst pearl logistic growth is given below :-

From this equation 'K' indicates

(1) Biotic potential

(2) Carrying capacity
(3) Environmental resistance
(4) Intrinsic rate of natural increase

29) In India ecologically unique and Biodiversity-rich regions are legally protected as biosphere
reserve, national park, and sanctuaries. Which type of conservationis it.

(1) In Vitro conservation

(2) Cultural conservation
(3) Heritage conservation
(4) In-situ conservation

30) The variation shown by the medicinal plant Rauwolfia vomitoria growing in different Himalayan
ranges might be in terms of potency and concentration of the active chemical that the plant
produces. This exhibits and example of

(1) Ecological diversity

(2) Species diversity
(3) Genetic diversity
(4) Community diversity

31) Which of the following characteristics of Drosophila and garden pea favours them as
experimental material in genetics experiment?
(a) Having short life-cycle.
(b) Presence of easily observable characters
(c) Produce large number of progenies in a single mating

(1) All (a), (b) and (c)

(2) (a) and (b) only
(3) (b) and (c) only
(4) All except (b)

32) Endemic species

(1) Face no risk of extinction

(2) Are found everywhere and are also called cosmopolitan species
(3) Are found only in a particular geographical area and not anywhere else
(4) Can only be conserved by ex-situ mode of conservation.

33) Read the following assertion (A) and reason (R) and choose the correct option.
Assertion (A): An individual having AB blood group shows the expression of both A and B antigens
on the surface of RBC.
Reason (R): AB blood groups in humans show co-dominance.

(1) Both (A) and (R) are true and (R) is the correct explanation of (A)
(2) Both (A) and (R) are true but (R) is not the correct explanation of (A)
(3) (A) is true but (R) is false
(4) Both (A) and (R) are false

34) Which among the following disorders is caused due to substitution of a purine by a pyrimidine?

(1) Haemophilia
(2) Sickle cell anaemia
(3) Phenylketonuria
(4) Thalassemia

35) Which anticodon will be found in the initiator

t-RNA?

(1) 5'UAC3'
(2) 5'CAU3'
(3) 5'AUG3'
(4) 3'GUA3'

36) If a dsDNA contains 20% of A, what will be the percentage composition of G?

(1) 20%
(2) 40%
(3) 30%
(4) 60%

37) A molecule that can act as a genetic material

(1) Should be unstable chemically and structurally

(2) Should be able to generate its replica
(3) Should provide the scope for fast mutation
(4) Should not be able to express itself in the form of Mendelian characters

38) Read the following statements and select the correct option.
Statement-A: The technology of biogas production was developed in India mainly due to the efforts
of IARI and KVIC.
Statement-B: The greater the BOD of waste water, less is its polluting potential.

(1) Only statement A is correct

(2) Only statement B is correct
(3) Both statements A and B are correct
(4) Both statements A and B are incorrect

39) Bamacles growing on the back of whale is the example of

(1) Mutualism
(2) Competition
(3) Commensalism
(4) Amensalism

40)

How many types of gametes will be produced by the individual with genotype PpQQRrSs?

(1) Four
(2) Sixteen
(3) Eight
(4) Three

41) Which of the following is not a process of post transcriptional modification of primary transcript?

(1) Capping
(2) Aminoacylation of t-RNA
(3) Splicing
(4) Tailing

42) Which approach focused on identifying all the genes that are expressed as RNA?

(1) Sequence annotation

(2) BAC
(3) EST
(4) VNTR

43) Read the following statements and select the correct option.
Assertion (A): Maize is a wind-pollinated plant.
Reason (R): Light and non-sticky pollen grains surrounded by mucilaginous covering, large feathery
stigma and single ovule in each ovary are found in wind-pollinated flowers.

(1) Both (A) and (R) are true and (R) is the correct explanation of (A)
(2) Both (A) and (R) are true but (R) is not the correct explanation of (A)
(3) (A) is true but (R) is false
(4) Both (A) and (R) are false
44) The organism which is used commercially for the production of cyclosporin A, is

(1) Monascus purpureus

(2) Trichoderma polysporum
(3) Aspergillus niger
(4) Candida lipolytica

45) Read the following statements and select the correct option regarding age-pyramid.
(i) An age pyramid is a graphic representation of proportion of various age groups of a population.
(ii) The shape of the pyramid reflects the growth status of the population.
(iii) In bell shaped age-pyramid, population is said to be stable.
(iv) Urn-shaped age-pyramid shows positive growth.

(1) (i), (ii) and (iv) are correct

(2) Only (iii) is incorrect
(3) All are correct except (ii)
(4) All are correct except (iv)

46) Which of the following hormones stimulates the production of sex hormones in both males and
females?

(1) LH
(2) PRL
(3) FSH
(4) GHRH

47) Identify the human developmental stage shown below and the related right place of its
occurrence in a normal woman, and select the right option for the two together.
(1) 1
(2) 2
(3) 3
(4) 4

48) All of the following are functions of Sertoli cells, except

(1) Regulate spermatogenesis by releasing inhibin to check FSH over-activity

(2) To absorb the parts being shed by developing spermatozoa
(3) Synthesise and secrete androgens
(4) Provide nutrition to germ cells

49) Read the given statements and select the correct option.
Statement (A): Immediately before implantation, the inner cell mass differentiates into outer
ectoderm and inner endoderm.
Statement (B): The mammary glands are one of the female secondary sexual characteristics

(1) Both statements (A) and (B) are correct

(2) Both statements (A) and (B) are incorrect
(3) Only statement (A) is correct
(4) Only statement (B) is correct

50) A paleontologist has recovered a bit of tissue from the 500 years old preserved skin of an extinct
dinosaur. To compare a specific region of the DNA from a sample with DNA from living reptile,
which of the following would be most useful for increasing the amount of dinosaur's DNA available
for testing?

(1) Gel electrophoresis

(2) Electroporation
(3) PCR
(4) Tissue culture

51)

The restriction site for an enzyme called Pst I is represented by following sequence:
5’ – CTGCAG – 3’
3’ – GACGTC – 5’
Staggered ends are made by cutting between the A and G on each strand. What type of bonds are
being cleaved

(1) Phosphodiester bonds

(2) Glycosidic bonds
(3) Peptide bonds
(4) Hydrogen bonds

52) Read the given statements and select the correct option.
Statement (A): Presence of hCG in urine is tested in pregnancy test early in pregnancy after missed
period.
Statement (B): During the second trimester, the hCG production drops and the corpus luteum
reduces in size

(1) Both statements (A) and (B) are correct

(2) Both statements (A) and (B) are incorrect
(3) Only statement (A) is correct
(4) Only statement (B) is correct

53) If each vas deferens in a male is surgically sealed off, the following changes in sexual response
and ejaculate composition are observed, except

(1) Absence of sperms in the ejaculate

(2) No change in the sexual response
(3) Minimal change in ejaculate volume
(4) No production of androgens that affect sexual response

54) Which of the given statements does not hold true for contraception?

(1) Tubectomy is a terminal method to prevent conception in females

The use of barrier contraceptives prevent the passage of primary oocyte through the uterine
(2)
tubes
Oral contraceptive pills have to be taken daily for a period of 21 days starting preferably within
(3)
the first five days of menstrual cycle
(4) Progestogen only pills thicken cervical mucus and block implantation of blastocyst in the uterus

55) All of the following will lead to increase in the rate of growth of a population, except

(1) An increase in female fecundity

(2) An increase in IMR
(3) A decline in MMR
(4) An increase in number of people in reproducible age

56) A female went to a doctor as she was facing problems in conceiving the child. After check-up, the
doctor suggested her to opt for ART as she was unable to produce ova but she had capability to
provide suitable environment for fertilisation. Which of the following technique would be likely
suggested by doctor?

(1) IUI
(2) ZIFT
(3) GIFT
(4) IUT

57) All of the following methods are used for gene transfer without a vector, except

(1) Biolistics
(2) Disarmed retrovirus mediated
(3) Polyethylene glycol method
(4) Microinjection

58) Assume the frequency of ‘A’ allele is 0.7 and that of ‘a’ allele is 0.3 in a large population. What
would be the frequency of heterozygotes in a random mating population at equilibrium?

(1) 0.16
(2) 0.24
(3) 0.42
(4) 0.30

59) Darwin’s finches represent one of the best examples of all of the following, except

(1) Adaptive radiation

(2) Convergent evolution
(3) Allopatric speciation
(4) Genetic drift

60) Given below are some characters. Select the option that includes the characters for Stegosaurus
a. Herbivores
b. Quadruped with longest tail
c. Carnivores
d. 3-horned face Plate backed and spikes at the end of the tail

(1) (a) and (e)

(2) (a), (b) and (d)
(3) (b), (c) and (e)
(4) (b), (c), (d)

61) Among the human ancestors, the brain size was less than 1000 cc in
(1) Homo neanderthalensis
(2) Homo sapiens sapiens
(3) Homo sapiens fossilis
(4) Homo habilis

62) Consider the following situation:

Chicken eggs of intermediate weight have the highest hatching success.
The process of selection underway above is

(1) Disruptive
(2) Stabilizing
(3) Directional
(4) Artificial selection

63) Match column I with column II and select the correct option

(1) 1
(2) 2
(3) 3
(4) 4

64) Consider the given structure and select the correct option
(1) The type of drug which is obtained from this plant is a very effective sedative
(2) The drug obtained from this plant is never abused by sports persons in any form
The drug obtained are generally taken by inhalation and oral ingestion and are known for their
(3)
effects on cardiovascular system of body
(4) Cocaine is obtained from this plant

65) The predominant early antibody, that is important for primary immune response is
___(A)___ which has ___(B)___ paratopes.
Select the correct option that fills the blanks (A) and (B)

(1) 1
(2) 2
(3) 3
(4) 4

66) A widely used diagnostic test for AIDS is

(1) Based on the principle of antigen-antibody interaction

(2) Not the technique that serve the purpose of early diagnosis
(3) Used to detect mutations in genes
(4) Followed by detection using autoradiography

67) Choose the correct set from the given options which includes side effects of the use of anabolic
steroids in males

(1) Increased aggressiveness, excessive hair growth on the face, deepening of voice
(2) Premature baldness, enlargement of prostate gland, liver dysfunction
(3) Increase in size of testicles, deepening of voice, acne
(4) Kidney dysfunction, increased sperm production, deepening of voice

68) Concerns have been raised about the safety of genetically modified crops and other organisms
centered on following claims, except
(1) Genetic manipulation is an unnatural interference with nature
(2) Genetically modified food may be unsafe for consumption
(3) Genetically altered crop plants may be hazardous for environment
(4) Genetically altered crop plants have increased efficiency of mineral usage

69) A research student ligated gene of interest in the coding sequence of β-galactosidase of the
cloning vector pUC8. Then, the recombinants that are formed will be

(1) Ampicillin sensitive

(2) Tetracycline resistant
(3) Ampicillin resistant
(4) Blue coloured

70) If genes of interest A and B are simultaneously ligated at the restriction site of Pvu I and Pvu II
in pBR322 cloning vector of [Link], then what will happen to the recombinant host cell?

(1) Replication of the plasmid inside the host cell will be affected
(2) It is resistant to ampicillin and will grow on X- gal containing medium
(3) Blue coloured tetracycline resistant colonies will grow on X-gal medium
(4) White coloured tetracycline resistant recombinants will grow on X-gal medium

71) Select the correct match.

(1) 1
(2) 2
(3) 3
(4) 4

72) Which one of the following options gives one correct example each of convergent evolution and
divergent evolution?
(1) 1
(2) 2
(3) 3
(4) 4

73) Which of the following scientists gave the theory of inheritance of acquired characters?

(1) Ernst Haeckel

(2) Early Greek Thinkers
(3) Lamarck
(4) Malthus

74) could be the reason that can disturb the genetic equilibrium in a population. Select
the option that correctly fills the blank.

(1) Selective mating

(2) Random mating
(3) Absence of natural selection
(4) Lack of migration

75) Consider the following statements and select the correct option.
Statement (A): Sickle cell anaemia has not been eliminated from the african population because it
provides immunity against malaria.
Statement (B): Hugo de Vries gave his mutation theory on organic evolution while working on
Drosophila melanogaster.
Statement (C): Electron-spin resonance method is the relatively most accurate method for dating of
fossils.
(1) All the statements are correct
(2) Statement (A) is correct, statements (B) and (C) are incorrect
(3) Statements (B) and (C) are correct, statement (A) is incorrect
(4) Statements (A) and (C) are correct, statement (B) is in correct

76) A 32 year old woman whose menstrual cycle is of 34 days is trying to conceive. On roughly which
day of her cycle she should have sexual intercourse for maximum chances of fertilisation?

(1) 14th day

(2) 27th day
(3) 20th day
(4) 40th day

77) Assertion (A): In order to link the alien DNA, the vector needs to have very few, preferably
single recognition sites for the commonly used restriction enzymes.
Reason (R): Presence of more than one recognition sites within the vector will generate several
fragments, which will make the gene cloning easier
In the light of above two statements, select the correct option

(1) Both (A) and (R) are true, but (R) is not the explanation of (A)
(2) Both (A) and (R) are true and (R) is the correct explanation of (A)
(3) (A) is true, (R) is false
(4) (R) is true, (A) is false

78) Identify the correct statement

(1) PCR is employed to check the progression of a restriction enzyme digestion

Genetic engineering has been successfully used for producing transgenic models for studying
(2)
new treatments for certain diseases except cancer
(3) DNA or RNA segment tagged with a radioactive molecule is called vector
(4) Denaturation is the first step of PCR

79) Read the given statements and select the correct option.
Statement (X): If we were to clone insulin gene directly from the nuclear DNA, bacteria would not
be able to express the insulin protein.
Statement (Y): Bacteria cannot carry out the RNA splicing reactions

(1) Both statements (X) and (Y) are correct

(2) Both statements (X) and (Y) are incorrect
(3) Only statement (X) is correct
(4) Only statement (Y) is correct

80) Select the correct match w.r.t. contraceptive and its mode of action
(1) 1
(2) 2
(3) 3
(4) 4

81) Consider the given statements and select the option that correctly states each of them as
true (T) or false (F).
a. For viability of mammalian sperms, sperms must be concentrated in a thick suspension before
ejaculation.
b. The earliest stages of spermatogenesis occur closest to the lumen of the seminiferous tubules.
c. A normal human inherits 23 sex chromosomes from his father.
d. Sperms contribute to the cleavage of zygote by providing centriole

(1) 1
(2) 2
(3) 3
(4) 4

82) How many structures in the list given below are haploid :-
Oogonia, polar body, spermatids, primary spermatocyte, ovum, PGCs, Secondary oocyte,
Spermatozoa.

(1) Six
(2) Three
(3) Five
(4) Four

83) Assertion : Symptoms of allergic reaction include sneezing, watery eyes, running nose and
difficulty in breathing.
Reason : During allergy mast cell release chemicals like histamine.

(1) Both Assertion and Reason are true but Reason is NOT the correct explanation of Assertion.
(2) Assertion is true but Reason is false.
(3) Assertion is false but Reason is true.
(4) Both Assertion and Reason are true and Reason is the correct explanation of Assertion.

84) Read the following statements and choose the correct option : (T-true, F-false)
(A) Treatment of AIDS with anti-retroviral drugs is completely effective.
(B) Individuals who have multiple sexual partners are at high risk of getting HIV infection.
(C) In radiotherapy, tumor cells are irradiated lethally, taking proper care of the normal tissues
surrounding the tumor mass.
(D) Cancer detection is based on biopsy and histopathological studies of the tissue and blood and
bone marrow tests for decreased cell counts in the case of leukemias.

(1) A-T, B-T, C-F, D-F

(2) A-F, B-T, C-T, D-F
(3) A-T, B-F, C-T, D-T
(4) A-F, B-T, C-F, D-T

85) Viral DNA after being converted from viral RNA by enzyme X, incorporates into host genome to
undergo replication. What is 'X'?

(1) DNA polymerase

(2) Restriction endonuclease
(3) RNA polymerase
(4) Reverse transcriptase

86) Select correct statement with respect to disease and immunization:-

(1) In conditions like SCID both humoral and cellular immunity affected
(2) Injection of snake antivenom is active immunization
(3) Certain protozoans have been used to produce hepatitis-B vaccine
(4) Injection of dead/inactivated pathogens causes passive immunity

87) Identify the disease according to given points :

(a) Parasite of large intestine
(b) Constipation, abdominal pain and cramps
(c) Stools with excess blood and mucous
(d) House flies are mechanical carriers

(1) Ascariasis
(2) Amoebiasis
(3) Cholera
(4) Ringworm

88) Which of the following is incorrect matching:

Drug Source Function

Stimulates
Adrenal
(1) Nicotine Tobacco gland to
release
adrenaline

Inflorescence
(2) Ganja Hallucination
of cannabis

Latex of
Sedative and
(3) Papaver
pain killler
somniferum

Interferes
with the
(4) Cocaine Erythroxylum
transport of
dopamine
(1) 1
(2) 2
(3) 3
(4) 4

89) Given figure is of immune responce shown by an organism Identify the correct match.

(1) A = Primary immune response based on memory of immune system

(2) A = Secondary immune response based on memory of immune system
(3) B = Secondary immune response based on Memory of Immune system
(4) B = Primary Immune response
90) How many bacterial & viral disease respectively in the list given below are transmitted through
droplet infection :
Tuberculosis, Typhoid, Pertusis, SARS, Dengue, Filariasis, Cholera, Polio, Influenza, Rabies,
Hepatitis, common cold

(1) 4, 2
(2) 3, 2
(3) 2, 3
(4) 2, 4
 ANSWER KEYS

PHYSICS

Q. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
A. 1 1 4 4 3 1 3 1 2 3 3 2 2 3 1 2 4 1 1 2
Q. 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40
A. 1 3 2 2 1 3 3 4 4 2 4 3 2 3 1 1 1 3 1 3
Q. 41 42 43 44 45
A. 3 4 4 3 1

CHEMISTRY

Q. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65
A. 2 2 4 3 3 2 4 3 1 1 2 4 3 2 3 1 2 1 2 2
Q. 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85
A. 3 3 2 2 1 2 4 2 4 3 1 1 4 1 3 2 3 4 4 1
Q. 86 87 88 89 90
A. 4 2 1 2 2

BIOLOGY

Q. 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110
A. 3 3 1 2 1 3 3 3 1 3 1 2 1 4 3 2 2 2 2 4
Q. 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130
A. 3 3 4 3 4 4 4 2 4 3 1 3 1 2 2 3 2 1 3 3
Q. 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150
A. 2 3 3 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
Q. 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170
A. 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1
Q. 171 172 173 174 175 176 177 178 179 180
A. 1 3 4 2 4 1 2 3 3 3
 SOLUTIONS

PHYSICS

1) Question Explanation :
We have to find the charge on a given capacitor in steady state in the circuit shown.

Concept:
This question is based on steady state of capacitor.

Solution:
In steady state, capacitor act as open circuits, meaning no current flows through them.

Since capacitor is open so

Q = CV

Final Answer: The correct option is (1).

2)

initial galvalnometer current = ig

after shunting

Rg = Galvanometer resistance
4 + Rg = 20
Rg = 16Ω
2Ω further shunted
Req =
Now

reduction is current =

3)

Apply KCL at Point D

...(1)
Apply KCL at point y

...(2)

Energy given by battery in one minute

4) Current when cells are connected in series

is =
in parallel ip =
According to equation is = ip

r (n – 1) ⇒ R = r

5) Charge initially

Charge finally

for this charge arrangement to happen, 90C charge has to flow upwards.

6) C = ε0A/d

7) Since the particle exists the magnetic field region with a velocity

The angular displacement of the particle in the magnetic field region is

Angular velocity,

8)

Magnetic field due to one side

⇒ due to all three sides :

9)
R = radius of circle followed by electron

two circles S & S1 touch internally

if d = b – R
=b–R

10) BBC = 0; BDE = 0; BFG = 0

11)

Enet = E1 – E2

12)

⇒
13) Question Explanation: We need to find the absolute permeability of given material.

Concept: Magnetic property.

Solution:
µ = µ0 (1 + xm)
= 4π ×10–7 × 500
= 2π ×10–4 H/m

Final Answer: 2π × 10–4 H/m

14) M = NIA
MA = MB
∴ NA IA AA = NB IB AB
NA I A
NAIA = 4NBIB

15) =qvB

⇒r= = =

16)

For constant velocity current through the wire is 2 A. Therefore effective potential for the
circuit must be 2 V ⇒ BLV = 4 V ⇒ V = 32m/s

17)
Flux ϕ = = BA cos θ = BA cos ωt

|Induced emf| = |e| = = |BAω sin ωt|

|e| will be maximum at ωt =

⇒ t = 2.5 sec
|e| will be minimum at ωt = π

⇒ t = 5 sec

18) Since flux increasing field line will be such that it will decrease the 'B'.

19) or

20) RMS values of supply voltage v = 200 Volts

(200)2 = (VL – VC)2 + VR2
(200)2 = (120)2 + VR2
VR = 160 Volts

Current

21)

as given
xL = ωL = 100 × 100 × 10–3 = 10Ω

= 30 × 5= 150Ω

& For resonant frequency

⇒
 &

=
as

22) speed =

⇒k=2

23)

If end A of rod acts an object for mirror then it's image will be A' and if

so by using

∴ Length of image =

24)

25) For the first convex lens :

u = –30 cm
f1 = +10 cm

v1 = 15 cm
For the second lens (concave lens).
The image formed by the first lens serves as virtual object for the concave lens.
∴ For the second lens u2 = +10 cm
 f2 = –10

v2 = ∞.
The image is formed at infinity.
For the 3rd lens (convex lens)
The image at ∞ formed by 2nd lens acts as object,
∴ u3 = ∞, f3 = +30

or v3 = +30 cm.
Thus the final image is formed at 30 cm to the right of the 3rd lens.

26)

Option (3) is correct

27) Apparent ehgith of an object in rarer medium, when seen from insdie a denser medium is
more than the actual height.

If actual height AB of bird from the surface is y, then apparent height from the surface of
water (AB') is
AB' = μ · AB = μy
∴ Apparent distance of the bird as seen by fish.
z = x + μy

or

or

or

28) f0 = 1 cm, fe = 2 cm, L = 12 cm

ve = 25 cm, u0 = ?

29) d = 0.5 mm
D = 0.5 m
Separation = 3β + 1.5β = 4.5β
 = 4.5 • = 2.22 mm

30)

Displacement of fringe = =

– {(μ – 1)3t – (μ – 1)t} = 0

= 2t (μ – 1) =

∴ λ = 4t(μ – 1)

31) By using µ = tanθP ⇒ µ = tan60° =

also ⇒

0 0
32) E = W + Kmax ⇒ = W + E1

and =
hc = W0λ1 + E1λ1 and hc = W0λ2 + E2λ2
W0λ1 + E1λ1 = W0λ2 + E2λ2

⇒ W0 =

33) λphoton = λe–

or Ephoton = 11.5 × 103 eV

= 11.5 KeV

34) Energy per nucleon of final product is more then the parent nuclei.

35)
Δm = mi–mf = (39.96259 + 1.008665)– 40.962278
= 0.008974
E = 0.00897 × 931
= 8.36 MeV

36) de Broglie wavelenth is

λ= .....(1)
The out-off wavelength is

λ =
0

From Eq. (1) eV = Hence

0
λ =

37) &

⇒ = 108.5 nm

38)
⇒

39) Positive half cycle

Voutput = 10V
For negative half cycle
potential difference across output = –25V

41) F1 is zero as charge lies inside the shell (Electric field inside the shell due to its own
charge is zero.)
F2 = F3 as charge over the surface of the shell behaves like point charge at the centre.

42)
 43)

44) Equilibrium shall be near smaller magnitude charge.

45) Consider a spherical symmetric surface

ϕ = f0r4
Q = ∈0ϕ0r4 [From Gauss' Theorem]

ρ=

CHEMISTRY

46) Option (2) is correct

47) Option (2) is correct

48)

Option (4) is correct

49) Option (3) is correct

50) Option (3) is correct

51) Option (2) is correct

52)

Option (4) is correct

53)

Option (3) is correct

54)

Option (1) is correct

55) Option (1) is correct

 56)

Option (2) is correct

57)

Option (d) is correct.

58) Question Explanation: Find the value of temperature if the rate constant is 100 sec–1.

Concept : This question is based on Arrhenius equation.

Solution: log K = 14 –
K = 100 sec–1 put in above equation

log 100 = 14 –
T = 1000 K

Final Answer: Option (3)

59) Question Explanation : Identify which manganese oxide behaves as an acidic oxide.

Concept : Higher oxidation states of metals form acidic oxides due to strong covalency.

Solution : The acidic nature of metal oxides increases with oxidation state. Manganese in
Mn₂O₇ has the highest oxidation state of +7, leading to strong covalent bonding with oxygen.
Such highly oxidized oxides react with water to form acids. Therefore, Mn₂O₇ behaves as an
acidic oxide, unlike lower oxidation state oxides.

Final Answer: OPTION (2)

60) Option (3) is correct

61)

Option (1) is correct

62)

Option (2) is correct

63) 3 A(g) → 2B(g) + 3C(g) + D(g)

P0

0
P –x x

0 0
Pt ⇒ P – x + +x+ =P +x
x = (Pt – P0)

64) Option (2) is correct

66) Option (3) is correct

67)

Option (3) is correct

68) Question Explanation: Find cathode for which E°cell is maximum

Concept: Standard cell potential.

Solution:
For Au3+

For Ag+

(maximum)

For Fe3+

For Fe2+

Final answer: Ag+ / Ag

69)

Option 2 is correct

70) Option (1) is correct

71) Option (2) is correct

72) H+ + e– —→ H2(g) (1 atm)

At 1 atm pressure

Ered = E°red –
Ered = E°red = 0
At 100 atm pressure

– 0.0591
= 0 – 0.0591 ⇒ – 0.0591

73)

Number of d-electrons present in [Mn(CN)6]3– is 4.

CN– is a strong field ligand hence pairing in t2g orbitals with occur. It is inner orbital complex

Number of unpaired electrons = 2

74) Option (4) is correct

75) Option (3) is correct

76)

Cu+2 + 2e– —→ Cu

Ered = E°red –
on increasing [Cu+2] ↑ Erd ↑
therefore order of S.R.P. Q>R>S>P

77)

Triammine Chlorocyanonitro cobalt (III)

78)
Question Explanation :

We need the lanthanide ion with the maximum number of unpaired 4f electrons among Ce3+ to
Lu3+.

Concept :

Unpaired electrons depend on 4f subshell configuration (Ce3+ → Lu3+).

Solution :

Ce3+ = [Xe]4f1 → 1 unpaired

Eu3+ = [Xe]4f6 → 6 unpaired

Gd3+ = [Xe]4f7 → 7 unpaired (half-filled, most stable)

Lu3+ = [Xe]4f14 → 0 unpaired

Hence, Gd3+ has the maximum number of unpaired electrons.

Final Answer : Option (4)

79) Option ( 1) is correct

80)

Option (3) is correct

81)

82)

83)

Option (4) is correct

84)

Thus, is highest for Co.

 85)

Option (1) is correct

86)

Option (4) is correct

87)

Option (2) is correct

88)

Option (1) is correct

89) [Co(NH3)6]Cl3 [Co(NH3)6]3+ + 3Cl-

[Co(NH3)5Cl]Cl2 [Co(NH3)5Cl]2+ + 2Cl-
[Co(NH3)4Cl2]Cl [Co(NH3)4Cl2]+ + Cl-

90)

Option 2 is correct

BIOLOGY

91)

Option (3) is correct

92)

Option (3) is correct

93)

Option (1) is correct

94)

Option (2) is correct

95)
Option (1) is correct

96)

Option (3) is correct

97)

Option (3) is correct

98)

Option (3) is correct

99)

Option (1) is correct

100)

Option (3) is correct

101)

Option (1) is correct

102)

Option (2) is correct

103)

Option (1) is correct

104)

Option (4) is correct

105)

Option (3) is correct

106)

Option (2) is correct

107)

Option (2) is correct

108)

Option (2) is correct

109)

Option (2) is correct

110)

Option (4) is correct

111)

Option (3) is correct

112)

Option (3) is correct

113)

Option (4) is correct

114)

Option (3) is correct

115)

Option (4) is correct

116)

Option (4) is correct

117)

Option (4) is correct

118)
Option (2) is correct

119)

Option (4) is correct

120)

Option (3) is correct

121)

Option (1) is correct

122)

Option (3) is correct

123)

Option (1) is correct

124)

Option (2) is correct

125)

Option (2) is correct

126)

Option (3) is correct

127)

Option (2) is correct

128)

Option (1) is correct

129)

Option (3) is correct

130)

Option (3) is correct

131)

Option (2) is correct

132)

Option (3) is correct

133)

Option (3) is correct

134)

Option (2) is correct

135)

Option (4) is correct

136)

NCERT XIIth Pg#31

137)

NCERT XIIth Pg#52

138)

NCERT XIIth Pg#31

139)

NCERT XIIth Pg#53

140)

NCERT XIIth Pg#172

141)
NCERT XIIth Pg#167

142)

NCERT XIIth Pg#53

143)

NCERT XIIth Pg#45

144)

NCERT XIIth Pg#45

145)

NCERT XIIth Pg#43

146)

NCERT XIIth Pg#48

147)

NCERT XIIth Pg#171

148)

NCERT XIIth Pg#120

149)

NCERT XIIth Pg#117

150)

NCERT XIIth Pg#114

151)

NCERT XIIth Pg#124

152)

NCERT XIIth Pg#120

153)

NCERT XIIth Pg#122

154)

NCERT XIIth Pg#142

155)

NCERT XIIth Pg#135

156)

NCERT XIIth Pg#140

157)

NCERT XIIth Pg#146

158)

NCERT XIIth Pg#178

159)

NCERT XIIth Pg#170

160)

NCERT XIIth Pg#169

161)

NCERT XIIth Pg#170

162)

NCERT XIIth Pg#115

163)

NCERT XIIth Pg#116

164)
NCERT XIIth Pg#120

165)

NCERT XIIth Pg#116

166)

NCERT XIIth Pg#33

167)

NCERT XIIth Pg#168

168)

NCERT XIIth Pg#172

169)

NCERT XIIth Pg#170

170)

NCERT XIIth Pg#45

171)

NCERT XIIth Pg#31

172)

NCERT XIIth Pg#31

173) NCERT Pg. # 137

174) NCERT Pg # 155, 156, 157, 158

175)

NCERT XIIth Pg#139

176)
NCERT XIIth Pg#136

177)

NCERT XIIth Pg#132

178) NCERT (XII) E Pg. # 150

179)

Explain Question: Identify the correct match between labeled responses (A and B) and types
of immune response in the given graph.

Concept: ACQUIRED IMMUNITY

Solution:
The first exposure to antigen (A) shows a slow and low antibody response — this is the primary
immune response.
The second exposure to the same antigen (B) shows a rapid and higher antibody production
due to memory cells — this is the secondary immune response (based on immunological
memory).

Final Answer: Option 3

180)

NCERT XIIth Pg#131