Module 2 study guide and practice problems

Topic list for quiz #2

1. The transforming principle

2. Hershey-Chase experiment
3. Structure of DNA
4. Characteristics of genetic material
5. Structure of prokaryotic chromosomes
6. Structure of eukaryotic chromosomes and genomes
7. Haploid v. Diploid cells
8. Mitochondrial and chloroplast DNA
9. The endosymbiont theory
10. Heteroplasmy v. homoplasmy
11. Maternal inheritance of organelles
12. Stages of the cell cycle
13. Semi-conservative model of DNA replication (other models)
14. The Meselson-Stahl experiment
15. Theta replication in prokaryotes
16. Linear replication in eukaryotes
17. Architecture of DNA synthesis: leading v. lagging strand replication
18. Steps of DNA replication
19. Enzymes required for replication (leading v. lagging strand)
20. Proof-reading
21. Replication of telomeres
22. RNA structure and composition, differences with DNA
23. Types of RNA
24. Transcription unit
25. Template v. non-template. Sense v. anti-sense.
26. Promoter consensus sequences. -10 TATA box, -35.
27. Sigma factor
28. RNA polymerase
29. Hairpin
30. Differences between pro and eukaryotic transcription
31. RNA polymerase II promoters in eukaryotes
32. Basal or general transcription apparatus v. cell type specific factors
33. Co-linearity
34. Introns v. exons
35. RNA processing events
36. Splicing components and consensus sequences
37. Alternative splicing
38. Levels of protein structure
39. Non-overlapping v. overlapping code, experiments
40. The genetic code, experiments
 41. Degeneracy of the genetic code
42. tRNA and tRNA-synthases
43. Wobble
44. The ribosome and the sites of the ribosome
45. Shine-Delgarno sequence
46. Phases of translation
47. Initiation, elongation, and release factor
48. Differences between pro and eukaryotic translation
49. Mutations
50. PCR and RT-PCR
51. DNA sequencing
52. Cloning of DNA molecules, plasmids
53. Gel electrophoresis
54. Nextgen sequencing

DNA, chromosome structure, and organelle DNA, and DNA replication

1. What are the characteristics of genetic material?

2. Describe the experiments that led to the “transforming principle”.

3. How did Avery and his colleagues demonstrate that the transforming principle is DNA?

4. How did the Hershey-Chase experiment support Avery’s findings?

5. Draw and label a generalized structure of a DNA nucleotide. Consider what is connected to
each of the carbon atoms of the ribose sugar. How would you change this drawing for RNA?

6. How does a purine differ from a pyrimidine? What purines and pyrimidines are found in DNA
and RNA?

7. Draw a short segment of a single polynucleotide strand, including at least three nucleotides.
Indicate the polarity of the strand by labeling the 5end and the 3end. How are the nucleotides
joined together?

8. Which bases are capable of forming hydrogen bonds with each other? How many bonds are
formed between nucleotide pairs?

9. What is the significance of the major and minor grooves of DNA?

10. What are some of the important implications of the DNA structure?

11. You collect DNA from serval different cell types: salmon sperm DNA, mouse neuron DNA,
human zygote DNA, and human oocyte DNA. You then determine the amount of G, C, T, and A
nucleotides in each of these samples. What do you predict you will find?

12. Label the important structures of this chromosome.

13. Be able to distinguish between metacentric, acrocentric, and telocentric chromosomes

14. Explain why many traits encoded by mtDNA and cpDNA exhibit considerable variation in
their expression, even among members of the same family. How is inheritance of mitochondria
and chloroplasts different than nuclear inheritance?
15. What is the endosymbiotic theory? How does it help to explain some of the characteristics
of mitochondria and chloroplasts?

16. What is the difference between the conservative, semi-conservative, and dispersive
replication models?

17. How did Meselson and Stahl demonstrate that replication in E. coli takes place in a
semiconservative manner? Be able to diagram the results for a the 3 replication models
(conservative, semi-conservative, dispersive)

18. Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin
of replication, (b) polarity (5and 3ends) of all template strands and newly synthesized strands,
(c) leading and lagging strands, (d) Okazaki fragments, and (e) location of primers.

19. Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify
(a) origin of replication, (b) polarity (5and 3ends) of all template strands and newly
synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) location of
primers.
20. On your diagrams for 18,19, indicate where each protein works and the protein’s activity.

21. In what ways is eukaryotic replication similar to bacterial replication, and in what ways is it
different?

22. What is the end-of-chromosome problem for replication in eukaryotes? Why, in the
absence of telomerase, do the ends of chromosomes get progressively shorter each time the
DNA is replicated?

23. Suppose a future scientist explores a distant planet and discovers a novel form of double-
stranded nucleic acid. When this nucleic acid is exposed to DNA polymerases from E. coli,
replication takes place continuously on both strands. What conclusion can you make about the
structure of this novel nucleic acid?

24. What would be the effect on DNA replication of mutations that destroyed each of the
following activities in DNA polymerase I?

a. 35exonuclease activity
b. 53exonuclease activity
c. 53polymerase activity
25. How would DNA replication be affected in a bacterial cell that is lacking DNA gyrase?

26. What would be the effect of removing each of the following from a DNA replication reaction
(explain with regards to theta replication in prokaryotes and consider the leading v. lagging
strand):

a. DNA polymerase I
b. Ligase
c. Helicase
d. Primase

27. You have found a new strain of bacteria that has a DNA polymerase that can synthesize
DNA in the 3’ to 5’ direction in addition to the 5’ to 3’ polymerase. Predict the consequences of
this enzyme on DNA replication.

Transcription and RNA processing

1. Draw an RNA nucleotide and a DNA nucleotide, highlighting the differences. How is the
structure of RNA similar to that of DNA? How is it different?
2. What parts of DNA make up a transcription unit? Draw a typical bacterial transcription unit
and identify its parts.

3. A DNA molecule has the following sequence:

5’ ……..ATTATA……….. TGTCAA …….. 3’

3’……...TAATAT…….…..ACAGTT ……...5’

Which strand of DNA will be used as the template? Which direction will transcription proceed?

4. Give the names of the RNA polymerases found in eukaryotic cells and the types of RNA that
they transcribe.

5. What are the three basic stages of transcription? Describe what happens at each stage.

6. How are transcription and replication similar and how are they different?
7. How is transcription different in bacteria and eukaryotes? How is it similar?

8. The following diagram represents DNA that is part of the RNA-coding sequence of a
transcription unit. The bottom strand is the template strand. Give the sequence found on the
RNA molecule transcribed from this DNA and label the 5′ and 3′ ends of the RNA.

3’…TGTGACCACCTTGGATCGGTA…5’ 5’…
ACACTGGTGGAACCTAGCCAT…3’

9. The following diagram represents a transcription unit on a DNA molecule.

a. Assume that this DNA molecule is from a bacterial cell. Draw in the approximate location of
the promoter and terminator for this transcription unit.

b. Assume that this DNA molecule is from a eukaryotic cell. Draw in the approximate location of
an RNA polymerase II promoter.
10. Describe the steps involved in transcription initiation in prokaryotes.

11. Write and RNA sequence that would give rise to a “hairpin” structure. Why is this structure
important during the process of transcription?

12. What is the concept of co-linearity? In what way is this concept fulfilled in bacterial and
eukaryotic cells?

13. What makes up the spliceosome? What is the function of the spliceosome?

14. Explain the process of pre-mRNA splicing in eukaryotes. How are intron/ exon boundaries
recognized?

15. Summarize the different types of processing events that affect eukaryotic pre-mRNAs.
16. A geneticist discovers that two different proteins are encoded by the same gene. One
protein has 56 amino acids and the other 82 amino acids. Provide a possible explanation for
how the same gene could encode both of these proteins.

The genetic code and translation

1. What is meant by primary, secondary, and tertiary structure of proteins?

2. How are amino acids joined when a protein is synthesized? Draw a peptide bond.

3. Understand the logic behind the experiments that showed the genetic code is a non-
overlapping triplet code.

4. What is meant by the degeneracy of the genetic code? What contributes to this degeneracy?

5. What are isoaccepting tRNAs?

6. What is meant by Wobble?

7. For the following sequence of DNA,

a. indicate the template and non-template strands.

b. Write the sequence of the mRNA that will be transcribed and label directions.
c. Write the sequence of the tRNA anti-codons that will bind to the mRNA and label
directions.
d. Write the amino acid sequence of the peptide that will be produced.

5’--TACTTAGCGGGATGCCTAATGCTTTGGACTGAACCGTTAA--3’
3’--ATGAATCGCCCTACGGATTACGAAACCTGACTTGGCAATT--5’

8. Define the following terms as they apply to the genetic code:

a. Reading frame
b. Overlapping code
c. Nonoverlapping code
d. Initiation codon
e. Termination codon
f. Sense codon
g. Nonsense codon
h. Universal code

9. How are tRNAs linked to their corresponding amino acids?

10. How does the process of initiation differ in bacterial and eukaryotic cells?

11. Describe one cycle of translational elongation. Include the events that happen at each site
in the ribosome.

12. What events bring about the termination of translation?

13. Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells,
giving similarities and differences in the process of translation in these two types of cells.

14. Define the different types of mutations:

Missense, nonsense, silent, frameshift

Recombinant DNA technology

1. What are some applications of recombinant DNA technology?

2. Which of the following are needed in a PCR reaction? Pick all that are correct. If you do not
pick an answer, explain why.
a) DNA template
b) helicase
c) topoisomerase
d) DNA polymerase
e) primase
f) dNTPs
g) NTPs
h) oligo nucleotide primers
i) DNA ligase

3. Why is it necessary to use a special DNA polymerase (Taq polymerase) in PCR?

4. Describe what is happening in each stage of a PCR cycle.

5. Describe the steps involved in RT-PCR. Why is RT-PCR useful?

6. What are the important features of bacterial plasmids? Which of these features must be
present in the plasmid in order for it to be useful to researchers? What are some features that
are not characteristic of every plasmid?
7. Describe the steps involved in isolating a gene and cloning it into a bacterial plasmid.

8. You wish to clone the following eukaryotic gene (gDNA illustrated), which has the indicated
start and stop codons (bold) and restriction sites (bold, red), into a bacterial plasmid and
produce its protein. The plasmid you are using has an MCS containing the following unique
sites: EcoRI, SalI, and BamHI. Describe a strategy step by step to accomplish this. Consider the
problems associate with trying to produce a eukaryotic protein in bacteria.

//=Intron

9. When generating recombinant DNA molecules, scientists frequently ligate pieces of DNA into
bacterial plasmids, which are then transformed into bacteria. What is a quick way for scientists
to determine if their insert DNA has been successfully ligated into the plasmid? What would be
a more laborious way of accomplishing this?

10. How would you add a restriction site to the ends of an RT-PCR or PCR fragment?

Describe the movement of different size DNA fragments through an agarose gel.
11. Understand the steps involved in Sanger dideoxy sequencing.

12. What are the steps in Nextgen sequencing? How is a whole genome assembled from many
short sequence reads?