Genetics

Homologous recombination
Recombination which involves the exchange of homologous segments between any two homologous DNA molecules
(or segments of the same molecule) that share an extended homology.

Site-specific recombination
Recombination between two dsDNA molecules that have only short regions of nucleotide sequence similarity.
A different type of event called transposition, which is related to the processes of recombination, allows one DNA
sequence to be inserted into another without relying on sequence homology. It provides a means by which certain
elements move from one chromosomal location to another.

1.14.1 Homologous recombination

Homologous recombination (also termed as general recombination) is the most important version of recombination
in nature, being responsible for meiotic crossing-over in eukaryotes and the integration of acquired DNA by the
process of conjugation, transduction and transformation into bacterial genomes. It involves a reciprocal exchange
of sequences of DNA.

Holliday model for homologous recombination

An appealing scheme for homologous recombination was proposed by Robin Holliday in 1964. The Holliday model
(also known as heteroduplex model) describes recombination between two homologous double-stranded mol-
ecules, those with identical or nearly identical sequences. But, it is equally applicable to two different molecules that
share a limited region of homology, or a single molecule that recombines with itself because it contains two
separate regions that are homologous with one another.

A B
5’ 3’
3’ 5’
3’ 5’
5’ 3’
a b
Endonuclease nicking

A B

a b
Strand displacement

A B

a b
Ligation

A B
Figure 1.87
Holliday
The Holliday model for homologous
junction
recombination. Single-strand nicks
a b are introduced at the same position
Branch migration
on both parental molecules. The
A B nicked strands then exchange by
complementary base pairing, and
ligation produces a crossed-strand
intermediate called a Holliday junction.
a b

115
[Link]
 [Link]
Pages 116 to 120 are not shown in this preview.
 Genetics

1.15 DNA repair

Although the genetic variation is important for evolution, the survival of the individual demands genetic stability
also. Maintaining genetic stability requires not only an extremely accurate mechanism for replicating DNA, but also
mechanisms for repairing the many accidental lesions that occur continually in DNA. Most such spontaneous changes
in DNA are temporary because they are immediately corrected by a set of processes that are collectively called as
DNA repair. Without repair systems, a genome would not be able to maintain its essential cellular functions. Most
cells possess four different categories of DNA repair system: Direct repair, Excision repair, Mismatch repair and
Recombination repair.

1.15.1 Direct repair

Direct repair systems act directly on damaged nucleotides, converting each one back to its original structure. But
only a few types of damaged nucleotide can be repaired directly. One very common type of UV radiation mediated
damages, pyrimidine dimers, are repaired by a light-dependent direct system called photoreactivation. In E.
coli, the process involves the enzyme called DNA photolyase. When stimulated by light with a wavelength between
300 and 500 nm, the enzyme binds to pyrimidine dimers and converts them back to the original monomeric
nucleotides. Photoreactivation is a widespread but not universal type of repair.

5 5
T T UV-B
6 6

Photolyase + blue light

P P P P P P

Adjacent thymines Thymine dimer

Another example is the repair of O6-methylguanine, which forms in the presence of alkylating agents and is a
common and highly mutagenic lesion. It tends to pair with thymine rather than cytosine during replication. Direct
repair of O6-methylguanine is carried out by O6-methylguanine DNA methyltransferase (an alkyl transferase),
which catalyzes the transfer of the methyl group of O6-methylguanine to a specific Cys residue in the same protein.

6
P CH3 P Alkyl P P
transferase
S G C S S G C S
P P P P

1.15.2 Excision repair

Excision repair involves the excision of a segment of the polynucleotide containing a damaged site, followed by
resynthesis of the correct nucleotide sequence by a DNA polymerase. These pathways fall into two categories:

Base-excision repair

Base excision repair involves removal of a damaged nucleotide base, excision of a short piece of the polynucleotide
and resynthesis with a DNA polymerase. It is used to repair many minor damage like alkylation and deamination
resulting from exposure to mutagenic agents. Enzyme DNA glycosylase initiates the repair process. A DNA

121
[Link]
 [Link]
This page intentionally left blank.
 Genetics

Pyrimidine dimer

T T
5’ 3’
3’ 5’

UvrAB binds

A
B
5’ 3’
3’ 5’

C
A

C B
5’ 3’
3’ 5’
UvrBC cuts the polynucleotide either
side of the thymine dimer and removes
oligonucleotide by DNA helicase II

5’ 3’
3’ 5’

DNA polymerase and DNA ligase

T T
5’ 3’
3’ 5’

Figure 1.94 Nucleotide excision repair (A-UvrA, B-UvrB, C-UvrC).

1.15.3 Mismatch repair

The mismatch repair system can detect mismatches that occur in DNA replication. Enzyme systems involved in
mismatch repair are as follows:
1. Recognize mismatched base pairs.
2. Determine which base in the mismatch is the incorrect one.
3. Excise the incorrect base and carry out repair synthesis.
The repair must be made in the daughter polynucleotide because it is in this newly synthesized strand that the error
has occurred; the parent polynucleotide has the correct sequence. How does the repair process know which strand
is which? When mismatch errors occur during replication in E. coli, it is possible to distinguish the original strand of
DNA. Immediately after replication of methylated DNA, only the original parental strand carries the methyl groups.
During the period while the newly synthesized strand awaits the introduction of methyl groups, the two strands
can be distinguished. In E. coli, the answer is that the daughter strand is, at this stage, undermethylated and can
be distinguished from the parent polynucleotide, which has a full complement of methyl groups. E. coli DNA is
methylated because of the activities of the DNA adenine methylase ( Dam), which converts adenines to
6-methyladenines in the sequence 5’-GATC-3’, and the DNA cytosine methylase (Dcm), which converts internal
cytosines to 5-methylcytosines in 5’-CCAGG-3’ and 5’-CCTGG-3’. These methylations are not mutagenic, the modified
nucleotides having the same base-pairing properties as the unmodified versions. There is a delay between DNA
replication and methylation of the daughter strand, and it is during this window of opportunity that the repair system
scans the DNA for mismatches and makes the required corrections in the undermethylated, daughter strand.

123
[Link]
Genetics

Mismatch
C
5’ 3’
3’ 5’
CH3 A CH3
MutH and MutS

H S
5’ 3’
3’ 5’
CH3 CH3
MutH cleaves the DNA

H S
5’ 3’
3’ 5’
CH3 CH3
Helicase II and Exonuclease I

5’ 3’
3’ 5’
CH3 CH3
DNA pol and DNA ligase

5’ 3’
3’ 5’
CH3 CH3

Figure 1.95 Long patch mismatch repair in E. coli. H-MutH; S-MutS.

There are three mismatch repair systems in E. coli; on the basis of the relative lengths of the unmethylated
strand excised and repaired by components of the repair system. These are categorized as long patch, short
patch and very short patch. In E. coli the long patch system involves three Mut proteins, coded by the mut genes.
These mut proteins are MutH, MutL and MutS. Recognition of the sequence GATC and of the mismatch are
specialized functions of the MutH and MutS proteins, respectively. The role of MutL is not clear. The MutH protein
cleaves the unmethylated strand on the 5' side of the G in the GATC sequence. The combined action of DNA
helicase II and exonuclease I then removes a segment of the new strand between the cleavage site and a point
just beyond the mismatch. The resulting gap is filled in by DNA polymerase and the nick is sealed by DNA ligase.

1.15.4 Recombinational repair

Recombinational repair is a process of filling a gap in one strand of dsDNA by retrieving a homologous single
strand from another dsDNA. It is a post-replication repair method because it occurs after replication. An example
is illustrated in figure 1.96 by considering a damage, such as a pyrimidine dimer, on one strand of a double helix.
When the DNA is replicated, the dimer prevents the damaged site from acting as a template. Replication is forced
to bypass it. This results in a gap in the newly synthesized strand. Whereas the other parental strand forms a
normal complementary strand. The gap opposite the damaged site in the one double strand is filled by taking the
homologous single strand of DNA from the normal duplex. Following this single-strand exchange, the recipient
duplex has a parental (damaged) strand facing a normal strand. The donor duplex has a normal parental strand
facing a gap; that can be filled by repair synthesis in the usual way, generating a normal duplex.

124
[Link]
 [Link]
This page intentionally left blank.
Genetics

A more serious problem occurs if one of the parent strand being replicated contains a single-strand nick. If a
break or nick in the phosphodiester backbone of DNA strand is not repaired before a replication fork passes, the
replication process leads to double strand break in one of the daughter double helix and the replication fork is
lost. This is called replication fork collapse. The break can be repaired by a form of homologous recombination
between the broken end and the second, undamaged DNA helix. End of the broken DNA is processed by RecBCD
to create a 3’ single stranded overhang. RecA mediates the invasion of 3’ overhang into donor homologous
duplex. The donor DNA duplex acts as a template for DNA synthesis, resulting in the formation of Holliday
junction. Cleavage of the resulting Holliday junction restores the replication fork.

Nick
5’
3’ 3’
5’ 5’
3’

Replication fork encounters

a nick resulting in fork collapse

5’ 3’
3’ 5’
5’ 3’
3’ 5’

Strand invasion

3’ 5’
5’
5’ 3’
3’ 5’

Branch migration and

cleavage of Holliday junction
Figure 1.98

3’ 5’
Recombinational repair of a collapsed
5’ replication fork. Replication fork collapse
5’ 3’ when the advancing fork encounters a
3’ 5’ nick on the template strand. The broken
arm is processed by RecBCD to create
Replication fork restart 3’ ssDNA overhang. The 3’ overhang
invades the donor DNA and forms a
D-loop. Invasion is followed by formation
5’
3’ 5’
of Holliday junction. Resolution of the
5’ 3’ Holliday junction restores the
3’ 5’ replication fork.

1.15.5 Repair of double strand DNA break

Ionizing radiation, oxidizing agents and replication errors may cause double-strand break in DNA. If these lesions
were left unrepaired, they would lead to the breakdown of chromosomes into smaller fragments.
Two distinct mechanisms have evolved to repair these damages – Non-homologous and homologous end joining. The
choice of cells to use either non-homologous or homologous end joining is largely dependent on the phases of the
cell cycle. Non-homologous end joining is present throughout the cell cycle but is particularly common in the G0 and
G1 phases whereas homologous end joining predominates in the S and G2 phases.

126
[Link]
 [Link]
This page intentionally left blank.
Genetics

as a co-protease and stimulates protease activity. It also promotes base-pairing between a single-strand of DNA
and its complement in a dsDNA. The LexA repressor regulates the transcription of all of the SOS genes. LexA
represses SOS response genes by binding to a 20 bp stretch of DNA called an SOS box.
When the genome is subjected to heavy damage through exposure to UV light or a DNA-damaging reagent, DNA
repair becomes significantly less accurate and a high mutation rate is observed. Higher levels of DNA damage
effectively bring normal DNA replication to a halt in E. coli because normal DNA replication with DNA polymerase III
cannot proceed past many types of DNA lesions. In this situation, DNA polymerase V (or UmuD’2C) performs the
DNA replication. Protein RecA triggers the activation of DNA polymerase V. The UmuD (umu for UV mutagenesis)
protein is cleaved to UmuD’ when RecA is activated; the cleavage event activates UmuD.

RecA UmuC
2 UmuD 2 UmuD' UmuD'C
2

DNA polymerase V (a Y-family DNA polymerase) lacks 3’→5’ exonuclease proofreading activity. Hence it is also
known as error-prone DNA polymerase. Because proper base pairing is often impossible at the site of a lesion,
this translesion DNA synthesis (TLS) is an error-prone replication.

Problem

For each DNA repair process in column I, list all characteristics from column II that correctly describe that process.

Column I Column II
a. Nucleotide excision repair 1. RecA protein participates.
b. Photo reactivation 2. Damaged nucleotides are removed by breaking phosphodiester bonds.
c. Base excision repair 3. A free radical mechanism is involved.
d. SOS repair 4. The repair enzyme functions only once.
e. Alkyl transferase repair 5. The key enzyme contains a bound folate cofactor.
f. Mismatch repair 6. No bases or nucleotides are removed from the DNA.
7. Deficiency of this enzyme in humans increases the risk of skin cancer.
8. This system is responsible for error prone replication.
9. This process begins up to 1 kbp away from the site to be repaired.
10. DNA ligase catalyzes the final reaction.
Solution
a. 2, 7, 10
b. 3, 5, 6
c. 2, 10
d. 1, 8, 10
e. 4, 6
f. 9, 10

1.16 Transcription
Transcription is a process of formation of transcript (RNA). It takes place by the usual process of complementary
base pairing, catalyzed and scrutinized by the enzyme RNA polymerase. It occurs unidirectionally in which RNA
chain (transcript) is synthesized from the 5’ to 3’ direction.

128
[Link]
 Genetics

1.16.1 Transcription unit

Transcription is a selective process. Each transcribed segment of DNA is called a transcription unit. In eukaryotes,
a transcription unit typically carries the information of just one gene and it is termed as monocistronic transcription
unit. In prokaryotes, a set of adjacent genes is often transcribed as a unit termed polycistronic transcription unit.
The immediate product of transcription is called the primary transcript. The eukaryotic transcription unit may be
simple or complex. The primary transcript produced from a simple transcription unit is processed to yield a single
type of mRNA, encoding a single protein. In the case of complex transcription units, which are quite common in
multicellular organisms, the primary RNA transcript can be processed in more than one way, leading to formation
of more than one type of mRNAs, encoding more than one type of polypeptides. Transcription starts from the first
base pair that is called the start point. From this point, RNA polymerase moves along the template, synthesizing
RNA, until it reaches a terminator sequence. Sequences prior to the startpoint are described as upstream of it;
those after the startpoint (within the transcribed sequence) are downstream of it.

During transcription, only one strand of the transcription unit is transcribed. Therefore, the transcript is identical in
sequence with one strand of the DNA, which is called the coding strand and complementary to the other strand,
called template strand. The coding strand is also known as the sense (+) strand while the template strand is the
antisense (–) strand. In principle, any region of the DNA double helix could be copied into two different RNA
molecules - one from each of the two DNA strands. In reality, only one DNA strand is used as a template in each
region.

5' A AT C G AT C T G C TA ATTTA G C TA G A C 3' Coding or sense strand

dsDNA
3' TTA G C TA G A C G ATTA A AT C G AT C T G 5' Template or antisense strand

RNA 5' AAUCGAUCUGCUAAUUUAGCUAGAC 3'

1.16.2 Prokaryotic transcription

RNA polymerase

DNA dependent RNA synthesis is catalyzed by the enzyme DNA dependent RNA polymerase (simply called RNA
polymerase). It was discovered by Samuel B. Weiss and Jerard Hurwitz in 1960. In prokaryotes, single type of RNA
polymerase appears to be responsible for the synthesis of all different types of RNA such as mRNA, rRNA and tRNA.
Eubacterial RNA pol is a multisubunit enzyme made up of five different polypeptides – α, β, β’, ω, σ. The holoenzyme
(α2ββ’ω σ) can be separated into two components, the core enzyme (α2ββ’ω) and the sigma factor (the σ polypeptide).
The complete enzyme or holoenzyme in E. coli has a molecular mass of ~465 kDa. The α subunit is required for
assembly of the core enzyme and plays a role in promoter recognition. The α subunit also plays a role in the
interaction of RNA polymerase with some regulatory factors. The β and β’ subunits together make up the catalytic
center. β subunit involves in chain elongation. The σ subunit is concerned specifically with promoter recognition. The
ω subunit facilitates assembly of RNA polymerase and stabilizes assembled RNA polymerase. The catalytic activity
of RNA pol is provided by core complex composed of β and β’ subunits, ω subunit and two copies of α subunit.

Table 1.22 RNA polymerase subunits and their functions

Subunits Gene Function
α rpoA assembly of the core enzyme and promoter recognition
β rpoB catalytic center
β’ rpoC catalytic center
ω rpoZ assembly of RNA polymerase
σ rpoD promoter recognition and transcription initiation

129
[Link]
 [Link]
Pages 130 to 144 are not shown in this preview.
 Genetics

1.17 RNA processing

In eukaryotes, transcription and translation take place in different cellular compartments: transcription takes place
in the nucleus, whereas translation takes place in the cytoplasm. In prokaryotes, transcription of mRNA and
translation occur simultaneously. Thus, mRNA molecules undergo little or no modification after synthesis by RNA
polymerase in prokaryotes. In contrast, pre-tRNA and pre-rRNA undergo processing like cleavage, addition of
nucleotides and chemical modification after synthesis. Although both prokaryotes and eukaryotes modify pre-tRNA
and pre-rRNA, eukaryotes very extensively process pre mRNA destined to become mRNA. The primary transcript
of an RNA polymerase is referred to as pre-RNA. Processing of eukaryotic pre-mRNA involves 5’ capping, 3’
cleavage/polyadenylation, splicing and RNA editing before being transported to the cytoplasm, where they are
translated by ribosomes.

1.17.1 Processing of eukaryotic pre-mRNA

5’-capping

Eukaryotic mRNA has a peculiar enzymatically appended cap structure consisting of 7-methylguanosine residue
joined via a 5’-5’ triphosphate bridge. During transcription, 7-methylguanosine is added to the 5’ end of nascent
mRNA. The initial steps in RNA capping are catalyzed by a dimeric capping enzyme, which associates with the
phosphorylated carboxyl-terminal tail domain (CTD) of RNA polymerase II.

g ba
5’ pppNpN 3’

Phosphohydrolase 1
Pi
abg ba
Gppp + ppNpN 3’

Guanylyl transferase 2
PPi

GpppNpN 3’

Guanine 7-methyl +CH3 from

3 S-Ado-Met
transferase

7
m GpppNpN 3’

Figure 1.117 The reactions that cap the 5’ end of each RNA molecule synthesized by RNA polymerase II.
The final cap contains a novel 5’-to-5’ linkage between the positively charged 7-methyl G residue and the 5’
end of the RNA transcript. The letter N represents any one of the four ribonucleotides, although the nucleotide
that starts an RNA chain is usually a purine.

One subunit of the capping enzyme removes the γ-phosphate from the 5’ end of the nascent RNA emerging from
the surface of an RNA polymerase II. The other subunit transfers the GMP moiety from GTP to the 5’-diphosphate
of the nascent transcript, creating the guanosine 5’-5’-triphosphate structure. In the final steps, separate enzymes
transfer methyl groups from S-adenosylmethionine to the N7 position of the guanine at the 5’ end of the nascent
RNA. If mRNA has a methyl group on N7 position of guanine at the 5’ end, then it is called cap 0. This is the first
methylation step and occurs in all eukaryotes. In some higher eukaryotes, methyl group addition also occurs at
second base. But this happens only when the position is occupied by adenine; the reaction involves addition at the
N6 position.

145
[Link]
 [Link]
Pages 146 to 178 are not shown in this preview.
 Genetics

1.22 RNA interference

RNA interference (abbreviated RNAi) is an evolutionarily conserved mechanism of gene regulation that is induced
by small silencing RNA in a sequence-specific manner. In 1998, Fire and Mello first established this in C. elegans.
Historically, RNA interference was known by other names, including post transcriptional gene silencing (PTGS),
transgene silencing and quelling. RNAi has been observed in all eukaryotes, from yeast to mammals. RNA interference
has an important role in post-transcriptional gene regulation, transposon regulation and defending cells against
viruses. Two types of small silencing RNA molecules – small interfering RNA (siRNA) and microRNA (miRNA) – are
central to RNA interference.

siRNAs mediated RNAi

In the siRNAs mediated RNAi pathway, the dsRNAs are processed into siRNAs duplexes comprised of two ~21
nucleotides long strands with two nucleotides overhangs at the 3’ ends by an enzyme called Dicer. Dicer is a
~200 kDa multidomain, an RNase III family enzyme that functions in processing dsRNA to siRNA. The Dicer includes
an ATPase/RNA helicase domain, catalytic RNase III domains, and dsRNA binding domain. Dicer and a dsRNA
binding protein (together form the RISC loading complex) then load the RNA duplex into RISC. The siRNA is thought
to provide target specificity to RISC through base pairing of the guide strand with the target mRNA. Only one of the
two strands, which is known as the guide strand, directs the gene silencing. The other anti-guide strand or passenger
strand is degraded during RISC activation. The active components of an RNA-induced silencing complex (RISC) are
endonucleases called argonaute proteins, which cleave the target mRNA strand complementary to their bound siRNA.

Long dsRNA

Dicer

Guide strand
siRNA duplex
Passenger strand

RISC
loading complex

pre-RISC

RISC Guide strand

Target cleavage

Figure 1.153 dsRNA precursors are processed by Dicer to generate siRNA duplexes containing guide and
passenger strands. RISC-loading complex loads the duplex into RISC. The passenger strand is later destroyed
and the guide strand directs RISC to the target RNA.

miRNAs mediated RNAi

miRNAs (microRNAs) are small, non-coding RNA molecules encoded in the genomes of plants, animals and their
viruses. These highly conserved, 20–25 mer RNAs appear to regulate gene expression post-transcriptionally by

179
[Link]
 [Link]
Pages 180 to 181 are not shown in this preview.
Genetics

1.23 Genetic code

General features of genetic code

• The genetic code is a triplet code called a codon.

How many nucleotides in DNA are needed to specify each amino acid in a protein? We know that the information
in DNA must reside in the sequence of the four nucleotides that constitute the DNA: A, T, G and C. A doublet
code involving two adjacent nucleotides would not be adequate, as four kinds of nucleotides taken two at a time
can generate only 42 = 16 different combinations. But with three nucleotides per word, the number of different
words that can be produced with an alphabet of just four letters is 43=64. This number is more than sufficient to
code for 20 different amino acids. Such mathematical arguments led biologists to suspect the existence of a
triplet code. Later Francis Crick, Sydney Brenner, and their colleagues provided genetic evidence for the triplet
nature of the code by studying the mutagenic effects of the chemical proflavin on bacteriophage T4.
• Certain codons contain start and stop signals to initiate and terminate translation. The initiation codon is usually
AUG, which specifies methionine. In few mRNA, GUG or UUG also acts as initiation codon. Out of 64 codons,
three do not code for any amino acids and called a stop or termination codons (UAA, UAG, and UGA).
• The code is unambiguous, meaning that each triplet specifies only a single amino acid.
• No internal punctuation (commas) is used in the code. Thus, the code is said to be commaless. Once the
translation of mRNA begins, the codons are read one after the other with no breaks between them.
• The code is degenerate, meaning that a given amino acid can be specified by more than one triplet codon.
This is the case for 18 of the 22 amino acids. The different codons for a given amino acid are said to be
synonymous. For example, UUU and UUC are synonyms for phenylalanine, whereas serine is encoded by the
synonyms UCU, UCC, UCA, UCG, AGU and AGC.

Table 1.32 Amino acids and their synonymous codons

Amino acids Number of synonymous codon
Leu, Ser, Arg 6
Gly, Pro, Ala, Val, Thr 4
Ile 3
Phe, Tyr, Cys, His, Gln, Glu, Asn, Asp Lys 2
Met, Trp 1

• The code is nonoverlapping. After translation commences, any single ribonucleotide at a specific location
within the mRNA is part of only one triplet.
• It is usual to describe the genetic code as a universal code, meaning that the same code is used throughout
all life forms. This is not strictly true. There is a few example of context dependent codons also. For example,
selenocysteine is coded by UGA and pyrrolysine by UAG. These codons, therefore, have a dual meaning
because they are mainly used as stop codons. Similarly, some differences in the genetic code have been found,
especially in the mitochondria, chloroplast, some protozoans and others as mentioned in table 1.33. In this
context the code is nearly universal. With only minor exceptions, a single coding dictionary is used by almost all
viruses, prokaryotes, archaea and eukaryotes.

Table 1.33 Some differences between the universal code and mitochondrial genetic codes.
Codon Universal code Unusual code Occurrence
UGA Stop Trp Mycoplasma, Spiroplasma, mitochondria of many species
CUG Leu Thr Mitochondria in yeasts
UAA, UAG Stop Gln Acetabularia, Tetrahymena, Paramecium, etc.
UGA Stop Cys Euplotes

182
[Link]
 [Link]
Pages 183 to 203 are not shown in this preview.
Genetics

Activation of ubiquitin: Ubiquitin is activated by an E1; ubiquitin-activating enzyme. E1 becomes covalently linked to
free ubiquitin through the free C-terminal residue of ubiquitin, in an energy-dependent manner.
Transfer of ubiquitin from E1 to E2: The activated ubiquitin is subsequently transferred to a cysteine residue
present on an E2; ubiquitin-conjugating enzyme.
Ligation of ubiquitin to target protein: Finally, E3; ubiquitin ligases (~500 in humans) transfer the activated ubiquitin
from E2 to a Lys amino acid residue of its target protein, forming an isopeptide bond. A ubiquitinated protein is
proteolytically degraded to short peptides in an ATP-dependent process mediated by proteasome.

E1 —SH
E2 —SH
AMP
Target
ATP

protein
O O
Target
O C—Ubiquitin S—C—Ubiquitin S—C—Ubiquitin protein
Ubiquitin
E1 —SH E3
OH E1 E2
+
E2—SH

Figure 1.174 The reactions involved in the attachment of ubiquitin to a protein. In the first part of the process,
ubiquitin's terminal carboxyl group is joined, via a thioester linkage, to E1 in a reaction driven by ATP hydrolysis.
The activated ubiquitin is subsequently transferred to a sulfhydryl group of E2 and then in a reaction catalyzed
by E3, to the amino group of a lysine residue on a target protein.

1.25 Mutation
Genome is not a static entity. It is subject to different types of heritable changes. A sudden and heritable change
in the sequence of an organism’s genome that gives rise to alternate forms of any gene is called mutation. It can
simply be put as an abrupt change in the genotype of an organism that is not the result of recombination. The
process by which mutations is produced is called mutagenesis. An organism exhibiting a novel phenotype as a
result of the presence of a mutation is referred to as a mutant. In a broad sense, the term mutations include all
types of heritable genetic change of an organism not explainable by recombination of preexisting genetic variability.
Such genetic changes include ploidy, chromosomal aberrations and changes in individual genes. Generally, the
change in individual gene is known as gene mutation.

General characteristics of mutation

• Mutations are generally recessive, but dominant mutations also occur.
• Mutations are generally harmful to the organisms.
• Mutations are random, occur at any time and in any cell of an organism.
• Mutations are recurrent i.e. the same mutation may occur again and again.

Role of mutation
• Ultimate source of all genetic variation and it provides the raw material for evolution.
• Mutation results into the formation of alleles. Without mutation, all genes would exist in only one form.
• Organisms would able to evolve and adapt to environmental change.

Molecular basis of gene mutation

Mutations arise in two ways : Some mutations are spontaneous that occur without treatment of the organism with
an exogenous mutagen. Mutagen is an agent that leads to an increase in the frequency of occurrence of mutations.
Spontaneous mutations account for the ‘background rate’ of mutation and are presumably the ultimate source of
natural genetic variation that is seen in populations. Spontaneous mutations can occur because of replication
errors, spontaneous lesions and transposition of transposable elements during the normal growth of the cell. Other
mutations called induced mutations arise because a mutagen has reacted with the parent DNA, causing a structural
change that affects the base-pairing capability of the altered nucleotide.

204
[Link]
 [Link]
Pages 205 to 219 are not shown in this preview.
Genetics

Concept of cistron and genetic complementation

The word cistron was coined in 1956 by Seymour Benzer. He used the term to identify a segment of a genome that
is responsible for a single genetic ‘function’, as determined by the cis-trans complementation test. The underlying
idea of the test is that two mutations might produce similar phenotypic effects in several different ways. First, the
two mutations might alter the same gene and, consequently, affect the same enzymatically catalysed step in a
biochemical pathway. Alternatively, the two mutations might affect genes that encode enzymes for different steps
in a single biochemical pathway. A third possibility is that two mutations might block steps in two different biochemical
pathways that converge.
It is important to realize that a gene is not a point on a chromosome, but a segment of a chromosome. Mutations
within a single gene may occupy different sites (that is, different DNA bases) within the gene. Any two mutations
within a single gene are said to be ‘alleles’ in the sense that they affect the same genetic function. Mutations at
exactly the same site are called homoalleles; mutations at different sites within a gene are heteroalleles.

Problem

Seven arginine requiring mutants of E. coli were independently isolated. All pairwise matings were done to
determine the number of complementation groups involved. If a (+) in the following table indicates growth and a
(–) no growth on minimal medium, how many complementation groups are involved?

1 2 3 4 5 6 7
– + + + + – – 1
– + + – + + 2
– – + + + 3
– + + + 4
– + + 5
– – 6
– 7

Solution

A group of mutants which do not complement each other belongs to single complementation group. Thus, we
conclude that there are three complementation groups present: 1, 6 and 7 are mutually non-complementing, as
are 2 and 5 and 3 and 4.

1.26 Developmental genetics

A multicellular animal or plant arises from a single cell – a fertilized egg. During development, the cell divides
repeatedly to produce many different cells. The genetically identical cells come to differ from one another by
expressing distinct sets of genes during development. The differential gene expression controls cell proliferation,
cell specialization, cell interactions and cell movement. The strategies used to instruct genetically-identical cells to
express distinct sets of genes and thereby differentiate into diverse cell types are mRNA localization, cell-to-cell
contact and signaling through the diffusion of a secreted signaling molecule. In this section, we will encounter these
strategies during embryonic development in some model organisms.

1.26.1 Genetic control of embryonic development in Drosophila

Embryonic development in Drosophila is an orderly sequence of change and is controlled by the differential expression
of genes. Drosophila displays a holometabolous method of development, meaning that they have three distinct
stages of their post-embryonic life cycle, each with radically different body plans: larva, pupa and finally, adult (imago).

220
[Link]
 Genetics

Imago consists of a head followed by three thoracic segments (T1 to T3) and eight or nine abdominal segments
(A1 to A9). Segment T1 carries a pair of legs, T2 carries a pair of legs plus a pair of wings and T3 carries a pair of
legs plus a pair of halteres.

In Drosophila, after fertilization, the diploid nuclei undergo a series of nuclear divisions and forms a syncytium— a
group of nuclei without cell membranes. Most of nuclei then migrate from the middle of the egg toward the surface,
where they form a monolayer called the syncytial blastoderm. Later, plasma membrane encloses each nucleus and
thereby converting the syncytial blastoderm into a cellular blastoderm. A small subset of nuclei present in the
extreme posterior end of the egg are segregated into cells; these pole cells are the primordial germ cells that will
give rise to eggs or sperm.

Fertilized egg

Nine rounds of nuclear

divisions produce
multinucleated syncytium

Nuclei migrate to periphery

(syncytial blastoderm)

Nuclei become enclosed

in membranes, forming a
single layer of cells over
embryo surface
Pole cells (Cellular blastoderm)
(precursors to germ cells)

Figure 1.185 Early stages of embryonic development in Drosophila.

Three important classes of pattern-regulating genes specify the basic features and functions during embryonic
development: Maternal effect genes, Segmentation genes and Homeotic genes.

Maternal effect genes

Maternal effect genes are expressed during oogenesis by the mother (expressed prior to fertilization) and develop
the anterior-posterior and dorsal-ventral polarity of the egg. The anterior end of the egg becomes the head; the
posterior end becomes the tail. The dorsal side is on top; the ventral side is underneath. The products of maternal
effect genes, called maternal mRNAs, are produced by nurse cells and follicle cells and deposited in the egg cell
(oocyte). At the start of development, gradients of maternal mRNA and their products are established in the oocyte
along the anterior-posterior and dorsal-ventral axes.
About 30 maternal effect genes involved in pattern formation have been identified. In particular, products of four
maternal effect genes are critical to the formation of the anterior-posterior axis. The product of two maternal effect
genes, bicoid and hunchback, regulates the formation of anterior structures, while another pair of maternal effect
genes, nanos and caudal, specifies proteins that regulate the formation of the posterior parts of the embryo.

221
[Link]
 [Link]
Pages 222 to 234 are not shown in this preview.
 Chapter 02
Recombinant DNA technology

Recombinant DNA technology (also known as genetic engineering) is the set of techniques that enable the DNA
from different sources to be identified, isolated and recombined so that new characteristics can be introduced into
an organism. The invention of recombinant DNA technology—the way in which genetic material from one organism
is artificially introduced into the genome of another organism and then replicated and expressed by that other
organism—was largely the work of Paul Berg, Herbert W. Boyer, and Stanley N. Cohen, although many other
scientists made important contributions to the new technology as well. Paul Berg developed the first recombinant
DNA molecules that combined DNA from SV40 virus and lambda phage. Later in 1973, Herbert Boyer and Stanley
Cohen develop recombinant DNA technology, showing that genetically engineered DNA molecules may be cloned in
foreign cells.
One important aspect in recombinant DNA technology is DNA cloning. It is a set of techniques that are used to
assemble recombinant DNA molecules and to direct their replication within host organisms. The use of the word
cloning refers to the fact that the method involves the replication of a single DNA molecule starting from a single
living cell to generate a large population of cells containing identical DNA molecules.

2.1 DNA cloning

DNA cloning is the production of a large number of identical DNA molecules from a single ancestral DNA molecule.
The essential characteristic of DNA cloning is that the desired DNA fragments must be selectively amplified resulting
in a large increase in copy number of selected DNA sequences. In practice, this involves multiple rounds of DNA
replication catalyzed by a DNA polymerase acting on one or more types of template DNA molecule. Essentially two
different DNA cloning approaches are used: Cell-based and cell-free DNA cloning.

Cell-based DNA cloning

This was the first form of DNA cloning to be developed, and is an in vivo cloning method. The first step in this
approach involves attaching foreign DNA fragments in vitro to DNA sequences which are capable of independent
replication. The recombinant DNA fragments are then transferred into suitable host cells where they can be propagated
selectively.

The essence of cell-based DNA cloning involves following steps:

Construction of recombinant DNA molecules

Recombinants are hybrid DNA molecules consisting of autonomously replicating DNA segment plus inserted elements.
Such hybrid molecules are also called chimera. Recombinant DNA molecules are constructed by in vitro covalent
attachment (ligation) of the desired DNA fragments (target DNA) to a replicon (any sequence capable of independent
DNA replication). This step is facilitated by cutting the target DNA and replicon molecules with specific restriction
endonucleases before joining the different DNA fragments using the enzyme DNA ligase.

235

[Link]
Recombinant DNA technology

Transformation
The recombinant DNA molecules are transferred into host cells (often bacterial or yeast cells) in which the chosen
replicon can undergo DNA replication independently of the host cell chromosome(s).

Selective propagation of cell clones

Selective propagation of cell clones involves two stages. Initially the transformed cells are plated out by spreading
on an agar surface in order to encourage the growth of well-separated cell colonies. These are cell clones (populations
of identical cells all descended from a single cell). Subsequently, individual colonies can be picked from the plate
and the cells can be further expanded in liquid culture.

Isolation of recombinant DNA clones

Isolation of recombinant DNA clones by harvesting expanded cell cultures and selectively isolating the recombinant
DNA.

Cloning
vector
Target DNA

Recombinant Non-recombinant
Introduction of cloning
vector into host

Transformed cell Transformed cell Non-transformed

Bacterial chromosome
Selection of transformed cells

Selection of transformed cell with recombinant

Amplification

Figure 2.1 An overview of DNA cloning in bacteria using a plasmid vector.

236

[Link]
 Recombinant DNA technology

Cell-free DNA cloning

The polymerase chain reaction (PCR) is a newer form of DNA cloning which is enzyme mediated and is conducted
entirely in vitro. PCR (developed in 1983 by Kary Mullis) is a revolutionary technique used for selective amplification
of specific target sequence of nucleic acid by using short primers. It is a rapid, inexpensive and simple method of
copying specific DNA sequence.

2.2 Enzymes for DNA manipulation

The enzymes used in the recombinant DNA technology fall into four broad categories:

2.2.1 Template-dependent DNA polymerase

DNA polymerase enzymes that synthesize new polynucleotides complementary to an existing DNA or RNA template
are included in this category. Different types of DNA polymerase are used in gene manipulation.

DNA polymerase I (Kornberg enzyme) has both the 3’-5’ and 5’-3’ exonuclease activities and 5’-3’ polymerase
activity.

Reverse transcriptase, also known as RNA-directed DNA polymerase, synthesizes DNA from RNA.
Reverse transcriptase was discovered by Howard Temin at the University of Wisconsin, and independently by David
Baltimore at about the same time. The two shared the 1975 Nobel Prize in Physiology or Medicine.

Taq DNA polymerase is a DNA polymerase derived from a thermostable bacterium, Thermus aquaticus. It operates
at 72°C and is reasonably stable above 90°C and used in PCR. It has a 5’ to 3’ polymerase activity and a 5’ to 3’
exonuclease activity, but it lacks a 3’ to 5’ exonuclease (proofreading) activity.

2.2.2 Nucleases
Nucleases are enzymes that degrade nucleic acids by breaking the phosphodiester bonds that link one nucleotide
to the next. Ribonucleases (RNases) attack RNA and deoxyribonucleases (DNases) attack DNA. Some nucleases
will only attack single stranded nucleic acids, others will only attack double-stranded nucleic acids and a few will
attack either kind. Nuclease are of two different kinds – exonucleases and endonucleases. Exonucleases remove
nucleotides one at a time from the end of a nucleic acid whereas endonucleases are able to break internal
phosphodiester bonds within a nucleic acid. Any particular exonuclease attacks either the 3’-end or the 5’-end but
not both.

Mung bean nuclease

The mung bean nuclease is an endonuclease specific for ssDNA and RNA. It is purified from mung bean sprouts. It
digests single-stranded nucleic acids, but will leave intact any region which is double stranded. It requires Zn2+ for
catalytic activity.

S1 nuclease
The S1 nuclease is an endonuclease purified from Aspergillus oryzae. This enzyme degrades RNA or single stranded
DNA, but does not degrade dsDNA or RNA-DNA hybrids in native conformation. Thus, its activity is similar to mung
bean nuclease, however, the enzyme will also cleave a strand opposite a nick on the complementary strand.

RNase A
RNase A is an endonuclease, which digests ssRNA at the 3’ end of pyrimidine residues.

RNase H
It is an endonuclease which digests the RNA strand of an RNA-DNA heteroduplex. The enzyme does not digest ss or
dsDNA.

237

[Link]
 [Link]
Pages 238 to 245 are not shown in this preview.
Recombinant DNA technology

thermodynamically less stable than DNA because of the 2’ hydroxyl group on the ribose ring that promotes hydrophilic
attack on the 5’-3’ phosphodiester bond to form a 2’-3’ cyclic phosphate. Therefore, even if all RNases are eliminated
or inhibited during RNA purification, RNA spontaneously degrades while in solution. To circumvent this biological
decay of RNA, purified samples are stored at –20°C as ethanol precipitates.
The purification of mRNA involves two basic steps: 1. Biochemical separation of total cellular RNA from DNA and
protein using a strong protein denaturant to inhibit cellular RNases, and 2. Isolation of poly A tail mRNA using an
oligo dT affinity matrix. A common method used to isolate mRNA from tissue culture cells is outlined in the following
figure 2.4. Guanidinium thiocyanate is a protein denaturant that lyses the cells and inhibits cellular RNases.

Aqueous
phase

Guanidinium + Phenol
thiocyanate + CHCl3
Centrifuge
Removal of
Cell culture aqueous phase

Isopropanol
Separation of mRNA
Aqueous
Centrifuge RNA pellet with oligo dT affinity
phase
matrix

Figure 2.4 Isolation and purification of mRNA from tissue culture cells using guanidinium thiocyanate and
oligo dT cellulose. This purification method is based on the finding that RNA preferentially partitions to the
aqueous phase in a solution containing guanidinium thiocyanate at pH 4 in the presence of phenol and
chloroform. Under these conditions, proteins partition to the organic phase and most of the large DNA
fragments trapped in the interphase. Poly A+ mRNA is purified from total cellular RNA using polyadenylated
and therefore, oligo dT affinity ligand.

2.4 Vectors
The term vector refers to the DNA molecules that act as transporting vehicle which carries foreign DNA from the
test tube to the host cell for the purpose of cloning and expression. Cloning vectors are used to clone foreign DNA
whereas expression vectors are engineered so that any foreign DNA can be transcribed in RNA and translated into
protein. A viral DNA or plasmid is generally used as a vector. The important features of a cloning vector are as follows:

1. Ability to replicate in host cells.

All cloning vectors have origin of replication for autonomous replication within the host cell. The origin of
replication is a specific sequence in DNA from where replication starts. When foreign DNA is linked to vector
containing origin of replication then along with vector replication, foreign (desirable) DNA also starts replicating
within the host cell.

2. Unique restriction enzyme sites for insertional cloning.

All cloning vectors have features that allow a foreign DNA to be conveniently inserted into the vector. This may
be a multiple cloning site (also called polylinker site) which contains many unique restriction sites. The restriction
sites in the polylinker site are first cleaved by restriction enzymes, and a target gene is then ligated into the
vectors using DNA ligase.

3. Genetic marker to select for host cells containing the vector.

Genetic marker is a gene that allow the selection of transformed from nontransformed cell and recombinant
containing transformed cell from non-recombinant containing transformed cell. Marker genes belong to two

246

[Link]
 [Link]
This page intentionally left blank.
Recombinant DNA technology

It is small (only 4361 base pairs) and maintained in the host in relatively high copy number, 20–30 copies per cell.
It has genes conferring ampicillin resistance and tetracycline resistance on its host and has single cleavage sites for
PstI, EcoRI, HindIII, BamI, SalI and ClaI. pBR322 is genetically engineered from DNA derived from three different
naturally occurring plasmids (R1, R6-5 and pMB1). Antibiotic resistance genes ampR and tetR are derived from
plasmid R1 and R6-5, respectively. The origin of replication is derived from pMB1. The valuable features of pBR322
have been enhanced by the construction of a series of plasmids termed pUC (produced at the University of
California). The plasmid vector pUC19 (2,686 bp long) contains a polylinker with unique cloning sites for multiple
restriction nucleases and an ampicillin resistance gene to permit identification of transformed cells. In addition, a
selection of recombinants is achieved by insertional inactivation of a component of the β-galactosidase gene, a
complementary portion of this gene being provided by using a specially modified E. coli host cell.

Bacterial Artificial Chromosome (BAC)

BAC cloning vectors were developed by Mel Simon and his colleagues. BAC vectors are maintained in E. coli as
large single copy plasmids and contain an insert of 50–300 kb. BAC vectors contain the F-plasmid origin of replication,
F-plasmid genes control plasmid replication, plasmid copy number and the bacterial chloramphenicol acetyltransferase
gene for plasmid selection.

2. Cloning vectors based on viral DNA

Viral vectors are those in which the gene or genes of interest are incorporated into the genome of a virus. Because
viruses infect cells with high efficiency, the cloned gene can be introduced into cells at a significantly higher
frequency than by simple transformation. Some viral vectors are specialized for producing high levels of proteins
encoded by the cloned genes and other viral vectors, such as the bacterial M13-based vectors, are designed to
facilitate sequencing and the generation of mutations in cloned genes.

Cloning vector based on λ phage

Lambda phage, a temperate phage, infects bacteria E. coli and replicates by a lytic or lysogenic pathway. Its
genome consists of single linear dsDNA of ~48 kb. However, at either end of the molecule is a short 12 nucleotides
stretch, in which the DNA is single-stranded described as cohesive ends or sticky ends. The lambda cohesive ends
are called the cos ends and they play two distinct roles during the lambda infection cycle. First, they allow the
linear DNA molecule that is injected into the cell to be circularized. The second role of the cos sites is rather
different and comes into play during the lytic cycle. During lytic cycle, a large number of new lambda DNA molecules
are produced by the rolling circle mechanism of replication. The result is a catenate consisting of a series of linear
λ genomes joined together at the cos sites. The role of the cos sites is now to act as recognition sequences for an
endonuclease that cleaves the catenate at the cos sites, producing individual lambda genomes.
In the lytic pathway, viral functions are fully expressed: viral DNA and proteins are quickly produced and packaged
into virus particles, leading to the lysis of the host cell and release of virus particles, or virions. In the lysogenic
pathway, the phage DNA becomes integrated into the host-cell genome and can be replicated together with host-
cell DNA for many generations, remaining inactive. Certain environmental changes can trigger the expression of
this dormant viral DNA, which leads to the formation of progeny virus and lysis of the host.
There is one problem in using λ phage DNA as cloning vector. This is size limitation. Normal λ phage genome size is
about 49 kb, whereas the capacity of capsid to incorporate maximum genome size is about 53 kb. Thus a λ phage
DNA molecule that can be increased in size by the addition of only 3 kb of new DNA. However, this problem has
overcome by deletion of non-essential DNA of about 15 kb. This means that as much as 18 kb of new DNA can now
be added. The non-essential region, in fact, contains the genes involved in lysogenic pathway. A deleted λ genome
is, therefore, non-lysogenic and can follow only the lytic cycle.

Two basic types of lambda vectors have been developed:

Insertion λ vectors
Insertion vectors are the simplest form of lambda cloning vectors. In the development of this vector, a large
segment of the nonessential region of λ phage genome has been deleted and the two fragments ligated together. It

248

[Link]
 [Link]
Pages 249 to 257 are not shown in this preview.
Recombinant DNA technology

2.6 Recombinant screening

A selective medium enables transformants to be distinguished from non-transformants. The next problem is to
determine which of the transformed colonies comprise cells that contain recombinant DNA molecules, and which
contain self-ligated vector molecules. With most cloning vectors insertion of a DNA fragment into the plasmid destroys
the integrity of one of the genes present on the molecule. Recombinants can, therefore, be identified because the
characteristic coded by the inactivated gene is no longer displayed by the host cells (called insertional inactivation).
Most commonly recombinant selection is carried out by insertional inactivation of antibiotic resistance gene. In
this case the insertion of new DNA fragments (insert) occurs at the site within the gene that confers resistance
towards a particular antibiotic.

Ampicillin Ampicillin
BamHI
resistance resistance
R R
(amp ) (amp )
pBR322 pBR322 New DNA inserted
in BamHI site
Origin of
Tetracycline
replication R
resistance (tet )

R R R S
Normal vector (amp tet ) Recombinant (amp tet )

Insertional inactivation does not always involve antibiotic resistance genes. For example in pUC8, gene LacZ’,
which codes for part of enzyme β-galactosidase is used for insertional inactivation. Recombinant pUC8 involves
insertional inactivation of the lac Z’ gene, can be identified because of their inability to synthesize β-galactosidase.
β-galactosidase, coded by lacZ gene, causes the breakdown of lactose to glucose plus galactose. lacZ’, a modified
lacZ gene, codes for the α peptide portion of β-galactosidase.

2.7 Introduction of DNA into the host cells

2.7.1 In bacterial cells
The process of transferring exogenous DNA into bacterial cells is called transformation. There are basically two
general methods for transforming bacteria.
The first is a chemical transformation method utilizing CaCl2 and heat shock to promote DNA entry into cells. The
chemical method uses bacteria that are incubated with DNA on ice cold salt solution containing CaCl2 followed by a
brief heat shock at 42°C. Exactly how this treatment works is not understood. Possibly CaCl2 causes the DNA to
precipitate onto the surface of the cells, or perhaps the salt is responsible for some kind of change in the cell wall
that improves DNA binding.
A second method is called electroporation. It uses a short pulse of electric charge to facilitate DNA uptake.
Electroporation induces formation of microscopic pores within a biological membrane. These pores, called electropores,
allow molecules, ions and water to pass from one side of the membrane to the other.

2.7.2 In plant cells

Gene transfer to plant cells is achieved using three different methods:
First, the natural ability of certain bacteria of the genus Agrobacterium to naturally transfer DNA to the genomes of
infected plant cells. These bacteria are also known as natural genetic engineers of plants since these bacteria have
ability to transfer T-DNA of their plasmid into plant genome upon infection of cells at the wound site. Ti and Ri
plasmids can be used as gene vectors for delivering useful foreign genes into target plant cells and tissues.
The foreign gene is cloned in the T-DNA region of Ti plasmid by replacing unwanted sequences.

258

[Link]
 [Link]
This page intentionally left blank.
Recombinant DNA technology

In transfected cells, transgene present in two different states. In a large proportion of transfected cells, the transgenes
do not integrate into the genome and are maintained in the nucleus in an extrachromosomal state. If it does not
contain an origin of replication, it persists for just a short time before it is degraded. This is known as transient
transfection. In second types of transfection called stable transfection, foreign DNA must be maintained permanently
in the cell. If the exogenous DNA is non-replicative, stable transfection must occur by integration of the DNA into
the genome. Alternatively, the foreign DNA may be carried in an episomal vector, whose moderate replication rate
does not cause cell death. The stable transfection is required for the long-term production of foreign proteins, for
gene silencing by antisense RNA synthesis and for the generation of transgenic animals. It is also highly desirable
in many gene therapy applications.
Transfection strategies : Two basic DNA transfection strategies have been developed to deliver DNA to cells. These
termed as stealth and attack strategies of DNA transfection. The stealth strategy is based on the use of positively
charged carrier molecules that are mixed with the experimental DNA in vitro and then applied directly to the cell
culture media. These carrier-DNA complexes attach to cell membranes and stimulate the uptake of the stealth DNA
molecules. The three most commonly used stealth transfection methods are calcium phosphate precipitation, DEAE
dextran-mediated gene transfer and liposome-mediated gene transfer. Each of these techniques is sensitive to cell
type differences owing to the requirement for selective interactions between the carrier molecule and the cell
membrane. The attack strategy uses physical methods to force DNA into cells. Two attack DNA transfection methods
have been developed: biolistics and microinjection.
Chemical transfection techniques : In chemical transfection techniques, cells take up DNA complexed with another
molecule by endocytosis. The chemical transfection is carried out by precipitating DNA in the presence of the cells.
This can be achieved by washing cultured cells in a phosphate buffer, adding the DNA, and then adding calcium
chloride to the mixture. Under these circumstances, it is thought that the precipitate settles on the surface of cells
and is then internalized through endocytosis.
An alternate chemical transfection method utilizes diethylaminoethyl dextran (DEAE-dextran), a soluble polycationic
carbohydrate that promotes interactions between DNA and the cell and thus their internalization.
Liposomes and Lipofection : Liposomes are unilaminar phospholipid vesicles into which DNA can be packaged. When
mixed with cells in culture, the vesicles fuse with the cell membrane and deliver DNA directly into the cytoplasm.
The efficiency of liposome-mediated gene transfer can be enhanced by incorporating viral proteins that facilitate
the active fusion between viral envelopes and cell membranes. Such fusogenic particles, have been termed virosomes.
Lipofection involves cationic/neutral lipid mixtures, which spontaneously associate with negatively charged DNA
to form complexes. Unlike liposome-mediated transfection, where the DNA is encapsulated within a lipid vesicle,
lipofection involved in the formation of a DNA lipid complex (lipoplex) which is taken up efficiently by endocytosis.
Cell or protoplast fusion : Certain chemicals, such as polyethylene glycol (PEG), act as fusogens, agents that cause
cell membranes to fuse together. This can be exploited to transfect animal cells by mixing them with other cells
containing large amounts of plasmid DNA. Schaffner first successfully used bacterial protoplasts to transfect
mammalian cells in culture by treating bacterial cells with chloramphenicol to amplify the plasmid contents and
lysozyme to remove the cell wall. The protoplasts were then induced to fuse with mammalian cells.
Microinjection : The direct microinjection of DNA into the cytoplasm or nuclei of cultured cells is sometimes used as
a transfection method. Although highly efficient on an individual cell basis, the procedure is time consuming, and
only a small number of cells can be treated. One major advantage of this technique is that direct nuclear delivery
avoids exposing the foreign DNA to any cytoplasmic organelles; so it is delivered intact. Microinjected DNA, therefore,
suffers a less mutation than DNA delivered by most chemical transfection methods. The most significant use of
microinjection is the introduction of DNA into the oocytes and eggs of animals, either for transient expression
analysis (e.g. in Xenopus) or to generate transgenic animals.
Particle bombardment : Particle bombardment (also known as microballistic or microprojectile transfection) is a
relatively recent transfection technique. The procedure involves coating micrometer-sized gold or tungsten particles
with DNA and then accelerating the particles into cells using blast of high pressure He gas or an electrical discharge.

260

[Link]
 Recombinant DNA technology

Receptor-mediated transfection : Receptor-mediated transfection involves the delivery of DNA to particular cells by
conjugation to a specific ligand. The ligand interacts with receptors on the cell surface, allowing both and the
attached DNA to be internalized. One problem associated with this technique is that the ligand-DNA complexes are
internalized via endocytotic vesicles that generally fuse with lysosomes, resulting in degradation of the DNA and
consequent failure of gene expression. Some of the DNA escapes this fate and finds its way to the nucleus to be
expressed, but the mechanism by which this occurs is not understood. Receptor-mediated transfection is highly
efficient in cell culture, resulting in the transfection of up to 90% of cells carrying the appropriate receptor. Less
success has been observed for in vivo gene transfer, partly because the ligand-DNA complexes are degraded in
serum, and partly because the size of the particles appears to be a critical parameter for the transfection of
different cell types.

Table 2.4 Examples of the major categories of transfection method

Category Examples
Chemical Calcium phosphate, DEAE-dextran, lipofection
Poration Electroporation
Fusion Liposome/virosome delivery, protoplast fusion
Physical Particle bombardment, microinjection
Receptor mediated Conjugation to various ligands

Transduction : It describes virus-mediated gene transfer. Certain animal viruses naturally infect human and
mammalian cells. They include both DNA viruses (e.g. SV40, adenovirus) and RNA viruses (e.g. HIV and other
retroviruses). Modified forms of these viruses can be used as vectors to transfer exogenous genes into suitable
target cells at high efficiency. Development of viral vectors for DNA transfer to animal cells utilizes several
advantageous characteristics of animal viruses:
1. They have evolved efficient mechanisms to adsorb to the surface and gain entry into cells without damaging
them.
2. They deliver their nucleic acid intact because it is initially packaged in a proteinaceous capsid.
3. Viral genomes contain strong regulatory elements that can be exploited to drive high-level foreign gene expression.
4. Many animal viruses have a broad host range and can thus replicate in diverse cell types.
5. Many viruses can stably transform cells by integration or latent episomal replication.

2.8 Polymerase chain reaction

PCR is a rapid and versatile in vitro method for amplifying defined target DNA sequences present within the source
of DNA. This technique was formulated in 1985 by Kerry Mullis. Usually, the method is designed to permit selective
amplification of a specific target DNA sequence(s) within a heterogeneous collection of DNA sequences (e.g. total
genomic DNA or a complex cDNA population). To permit such selective amplification, some prior DNA sequence
information from the target sequences is required. This information is used to design two oligonucleotide primers
(amplimers) which are specific for the target sequence and which are often about 15–25 nucleotides long. After the
primers are added to denatured template DNA, they bind specifically to complementary DNA sequences at the
target site. In the presence of a suitably heat-stable DNA polymerase and DNA precursors (the four deoxynucleoside
triphosphates, dATP, dCTP, dGTP and dTTP), primer initiates the synthesis of new DNA strands which are
complementary to the individual DNA strands of the target DNA segment, and which will overlap each other.

Primer design

To permit selective amplification, some prior DNA sequence information from the target DNA is required. The information
is used to design two primers (amplimers), which are specific for sequences flanking the target DNA sequence.

261

[Link]
 [Link]
Pages 262 to 271 are not shown in this preview.
Recombinant DNA technology

Problems due to the prokaryotic host, E. coli

Processing of proteins
Prokaryotes do not carry out the same kind of post-translational modifications such as glycosylation and
phosphorylation as eukaryotes do. This affects a protein’s activity or stability, or at least its response to antibodies.

Folding
In prokaryotic expression systems, most protein products of cloned eukaryotic genes become insoluble aggregates
called inclusion bodies due to incorrect folding and are very difficult to recover as functional proteins. Target
proteins expressed in E. coli may be mis-folded for a variety of reasons, including the exposure of hydrophobic
residues that are normally in the core of the protein, the lack of its normal interaction partners and inappropriate or
missing post-translational modifications.

Eukaryotic expression systems

Problems associated with obtaining active recombinant proteins from genes cloned in prokaryotic host can be
mitigated by using eukaryotic expression system. Eukaryotic systems for the expression of protein include: yeast,
mammalian cells and baculovirus cells (insect). Advantages of eukaryotic protein expression systems include very
high levels of expression. The proteins are easy to purify using special tags which are included into the vectors
including His, Myc and other tags. The disadvantages of the systems include the fact that eukaryotic cells do grow
slower than prokaryotic cells.

2.10.3 Fusion protein

Proteins may be expressed by expression vectors as native polypeptide or fusion proteins; the latter often to
facilitate protein purification or analysis. Fusion proteins (also called hybrid protein, chimeric protein) are the
products of two or more coding sequences from different genes that have been cloned together and that, after
translation, form a single polypeptide sequence. Fusion protein protects the cloned gene product from attack by
host cell proteases. In a number of cases, cloned gene proteins have been found to be resistant to degradation
when they are part of a fusion protein, whereas, when expressed as separate intact proteins, they are susceptible
to degradation by proteolytic enzymes (proteolysis).
Fusion proteins are constructed at the DNA level by ligating together a portion of the coding regions of two or more
genes. In its simplest form, a fusion vector system entails the insertion of a target gene or gene segment into the
coding region of a cloned host gene. Knowledge of the nucleotide sequences of the various coding segments that
are joined at the DNA level is necessary to ensure that ligation produces the correct reading frame.

2.11 DNA sequencing

The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases,
adenine, guanine, cytosine and thymine, in a DNA oligonucleotide.

The methodologies for DNA sequencing:

The chain termination method (by Sanger), in which the sequence of a ssDNA molecule is determined by enzymatic
synthesis of complementary polynucleotide chains, these chains terminating at specific nucleotide positions.
The chemical degradation method (by Maxam and Gilbert), in which the sequence of a dsDNA molecule is determined
by treatment with chemicals that cut the molecule at specific nucleotide positions.
The pyrosequencing method, in which the addition of a deoxynucleotide to the end of the growing strand is detectable
because it is accompanied by the release of a flash of light.

Chain termination method

Chain termination method relies on the use of dideoxyribonucleoside triphosphates, derivatives of the normal
deoxyribonucleoside triphosphates that lack the 3’ hydroxyl group.

272

[Link]
 [Link]
Pages 273 to 275 are not shown in this preview.
Recombinant DNA technology

2.12 Genome mapping

A map of the locations of identifiable landmarks on chromosomes is known as genome map. There are two kinds of
maps - genetic and physical map. The genetic map gives the relative position of genetic markers (gene loci)
according to the frequency of recombination, expressed in term of centimorgans (cM). Genetic maps illustrate the
order of genetic markers on a chromosome and the relative distances between those markers. Genetic mapping
uses classical genetic techniques to determine distances between markers. Physical maps, by contrast, always
give the physical, DNA-base-pair distances from one genetic marker to another.
There is a difference between a genome map and a genome sequence. A genome sequence spells out the order of
every DNA base in the genome, while a map simply identifies a series of landmarks in the genome. A genome map
is less detailed than a genome sequence.

2.12.1 Genetic marker

A gene or DNA sequence having a known location on a chromosome and associated with a particular trait or gene
is used as a genetic marker. Genes were the first markers to be used to prepare the first genetic maps of fruit fly.
There are three major types of genetic markers:
1. Morphological (also classical or visible) markers which are based on phenotypic traits or characters;
2. Biochemical markers, which are based on gene products; and
3. DNA (or molecular) markers, which reveal sites of variation in DNA.

Morphological markers are usually visually characterized phenotypic characters such as flower colour, seed shape,
growth habits or pigmentation. Biochemical markers are differences in gene products that are detected by
electrophoresis and specific staining. The major disadvantages of morphological and biochemical markers are that
they may be limited in number and are influenced by environmental factors or the developmental stages. A
molecular or DNA marker is defined as a particular segment of DNA that is representative of the differences at the
genome level. Molecular markers should not be considered as normal genes, as they usually do not have any
biological effect, and instead can be thought of as constant landmarks in the genome. They are identifiable DNA
sequences, found at specific locations of the genome, and transmitted by the standard laws of inheritance from one
generation to the next. An ideal molecular marker should have the following criteria:
1. be polymorphic and evenly distributed throughout the genome,
2. provide adequate resolution of genetic differences,
3. have linkage to distinct phenotypes.

2.12.2 Types of DNA markers

Various types of DNA markers have been described in the literature. They can be broadly divided into two classes
based on the method of their detection: Hybridization-based (such as RFLP) and PCR based (such as RAPD, AFLP,
SSLP). PCR-based techniques can further be subdivided into two subcategories: arbitrarily primed PCR-based
techniques or sequence nonspecific techniques (such as RAPD, AFLP) and sequence targeted PCR-based tech-
niques (such as SSLP, SNP).
DNA markers may be described as codominant or dominant. This description is based on whether markers can
discriminate between homozygotes and heterozygotes. Codominant markers indicate differences in size whereas
dominant markers are either present or absent.

276

[Link]
 Recombinant DNA technology

P1 P2 F1 P1 P2 F1

AA aa Aa BB bb Bb
(a) (b)
Figure 2.22 Comparison between (a) codominant and (b) dominant markers. Codominant markers can
clearly discriminate between homozygotes and heterozygotes whereas dominant markers do not. Genotypes
at two marker loci (A and B) are indicated below the gel diagrams.

RFLPs

RFLP (Restriction Fragment Length Polymorphisms) is the most widely used hybridization-based molecular marker.
RFLP markers were first used in 1975 to identify DNA sequence polymorphisms for genetic mapping. RFLPs arise
because mutations can create or destroy the sites recognized by specific restriction enzymes, leading to variations
between individuals in the length of restriction fragments produced from identical regions of the genome. Although
two individuals of the same species have almost identical genomes, they will always differ at a few nucleotides due
to point mutation and insertion/deletion. Some of the differences in DNA sequences at the restriction sites can
result in the gain, loss or relocation of a restriction site.

Sample 1 Sample 2

Wild-type Mutant
restriction site restriction site

DNA GA A T T C DNA GC A T T C
C T T AAG C GT A A G

Treatment with Treatment with

restriction enzyme (EcoRI) restriction enzyme (EcoRI)

G AAT TC GC A T T C
CT T A A G C GT A A G

Two fragments One fragment

(Cutting at restriction site) (No cutting at restriction site)

Gel electrophoresis

Sample 1 Sample 2

Figure 2.23 Restriction-fragment length polymorphisms.

277

[Link]
 [Link]
Pages 278 to 282 are not shown in this preview.