Python For Biologists
Python For Biologists
This work is licensed under a Creative Commons Attribution-NonCommercialShareAlike 3.0 Unported License.
ii
iii
Preface
Welcome to Python for Biologists.
Before you read any further, make sure that this is the most recent version of
the book. Python for Biologists is being continually updated and improved to
take into account corrections, amendments and changes to Python itself, so
it's important that you are reading the most up-to-date version.
This file is revision number 189. The number of the most recent revision can
always be found at:
[Link]
If the revision number listed at the URL is higher than the one in bold, then
this is an out-of-date copy, and you need to download the latest version from
[Link]
You'll notice from the copyright page that the contents of this book are
licensed under a Creative Commons Attribution ShareAlike license. This
means that you're free to do what you like with it copy it, email it to your
friends, wallpaper your lab with it as long as you keep the attribution. You
can also modify it, as long as you license your modification under the same
terms. The only thing that the license doesn't allow is commercial use if
you'd like to use the contents of this course for commercial purposes, get in
touch with me at
martin@[Link]
Happy programming!
iv
Table of Contents
About the author ii
Preface iii
13
52
74
99
vi
6: Conditional tests
121
7: Regular expressions
141
8: Dictionaries
168
195
vii
1:
programming book, but which are very useful to biologists (for example, regular
expressions and subprocesses). Having a biology-specific textbook allows us to
include these features, along with explanations of why they are particularly useful
to us.
A related point is that a textbook written just for biologists allows us to introduce
features in a way that allows us to start writing useful programs right away. We can
do this by taking into account the sorts of problems that repeatedly crop up in
biology, and prioritising the features that are best at solving them. This book has
been designed so that you should be able to start writing small but useful programs
using only the tools in the first couple of chapters.
Why Python?
Let me start this section with the following statement: programming languages are
overrated. What I mean by that is that people who are new to programming tend to
worry far too much about what language to learn. The choice of programming
language does matter, of course, but it matters far less than people think it does. To
put it another ways, choosing the "wrong" programming language is very unlikely
to mean the difference between failure and success when learning. Other factors
(motivation, having time to devote to learning, helpful colleagues) are far more
important, yet receive less attention.
The reason that people place so much weight on the "what language should I learn?"
question is that it's a big, obvious question, and it's not difficult to find people who
will give you strong opinions on the subject. It's also the first big question that
beginners have to answer once they've decided to learn programming, so it assumes
a great deal of importance in their minds.
There are three main reasons why choice of programming language is not as
important as most people think it is. Firstly, nearly everybody who spends any
significant amount of time programming as part of their job will eventually end up
using multiple languages. Partly this is just down to the simple constraints of
various languages if you want to write a web application you'll probably do it in
Javascript, if you want to write a graphical user interface you'll probably use
something like Java, and if you want to write low-level algorithms you'll probably
use C.
Secondly, learning a first programming language gets you 90% of the way towards
learning a second, third, and fourth one. Learning to think like a programmer in the
way that you break down complex tasks into simple ones is a skill that cuts across
all languages so if you spend a few months learning Python and then discover
that you really need to write in C, your time won't have been wasted as you'll be
able to pick it up much quicker.
Thirdly, the kinds of problems that we want to solve in biology are generally
amenable to being solved in any language, even though different programming
languages are good at different things. In other words, as a beginner, your choice of
language is vanishingly unlikely to prevent you from solving the problems that you
need to solve.
Having said all that, when learning to program we do need to pick a language to
work in, so we might as well pick one that's going to make the job easier. Python is
such a language for a number of reasons:
It has a sensible set of built-in libraries for doing lots of common tasks
It is designed in such a way that there's an obvious way of doing most things
It's one of the most widely-used languages in the world, and there's a lot of
advice, documentation and tutorials available on the web
It's designed in a way that lets you start to write useful programs as soon as
possible
Its use of indentation, while annoying to people who aren't used to it, is
great for beginners as it enforces a certain amount of readability
and example output (i.e. what we see on the screen when we run the code) is
highlighted with a dotted border:
Some output goes here
Often we want to look at the code and the output it produces together. In these
situations, you'll see a red-bordered code block followed immediately by a bluebordered output block.
Sometimes it's necessary to refer in the text to individual lines of code or output, in
which case I've used line numberings on the left:
1 first line
2 second line
3 third line
Other blocks of text (usually file contents or typed command lines) don't have any
kind of border and look like this:
contents of a file
Like this.
Getting in touch
One of the most convincing arguments for presenting a course like this one in the
form of an ebook is that it can be continually updated and tweaked based on reader
feedback. So, if you find anything that is hard to understand, or you think may
contain an error, please get in touch just drop me an email at
martin@[Link] and I promise to get back to you.
Installing Python
The process of installing Python depends on the type of computer you're running
on. If you're running a mainstream Linux distribution like Ubuntu, Python is
probably already installed. To find out, open a terminal and type
python
Then you are ready to go. If your Linux installation doesn't already have Python
installed, try installing it with your package manager (the command will probably
be either sudo apt-get install python or sudo yum install python).
If this doesn't work, then download the package from the Python download page 1.
The official Python website has installation instructions for Mac2 and Windows3
computers as well; these are likely to be the most up-to-date instructions, so follow
them closely.
1
2
3
4
[Link]
[Link]
[Link]
When we refer to "a Python program" in this book, we are usually talking about the text file that holds the
code.
10
To run a Python program, it's generally easiest to be in the same folder as it. By
convention, Python programs are given the extension .py, so to run a program
called [Link], we just type:
/usr/local/bin/python [Link]
There are a couple of tricks that can be useful when experimenting with programs1.
Firstly, you can run Python in an interactive (or "shell") mode by running it without
the name of a program file. This allows you to type individual statements and see
the result straight away.
Secondly, you can run Python with the -i option, which will cause it to run your
program and then enter interactive mode. This can be handy if you want to
examine the state of variables after your code has run.
1
2
Don't worry if these two options make no sense to you right now they will do so later on in the book, once
you've learned what statements and variables actually are.
You might encounter writing online that makes the 2 to 3 changeover seem like a big deal, and it is but
only for existing, large projects. When writing code from scratch, as you'll be doing when learning, you're
unlikely to run into any problems.
11
If you're going to use Python 2, there is just one thing that you have to do in order
to make some of the code examples work: include this line at the start of all your
programs:
from __future__ import division
We won't go into the explanation behind this line, except to say that it's necessary
in order to correct a small quirk with the way that Python 2 handles division of
numbers.
Depending on what version you use, you might see slight differences between the
output in this book and the output you get when you run the code on your
computer. I've tried to note these differences in the text where possible.
Text editors
Since a Python program is just a text file, you can create and edit it with any text
editor of your choice. Note that by a text editor I don't mean a word processor do
not try to edit Python programs with Microsoft Word, LibreOffice Writer, or similar
tools, as they tend to insert special formatting marks that Python cannot read.
When choosing a text editor, there is one feature that is essential1 to have, and one
which is nice to have. The essential feature is something that's usually called tab
emulation. The effect of this feature at first seems quite odd; when enabled, it
replaces any tab characters that you type with an equivalent number of space
characters (usually set to four). The reason why this is useful is discussed at length
in chapter 4, but here's a brief explanation: Python is very fussy about your use of
tabs and spaces, and unless you are very disciplined when typing, it's easy to end up
with a mixture of tabs and spaces in your programs. This causes very infuriating
problems, because they look the same to you, but not to Python! Tab emulation
1
OK, so it's not strictly essential, but you will find life much easer if you have it.
12
fixes the problem by making it effectively impossible for you to type a tab
character.
The feature that is nice to have is syntax highlighting. This will apply different
colours to different parts of your Python code, and can help you spot errors more
easily.
Recommended text editors are Notepad++ for Windows1, TextWrangler for Mac
OSX2, and gedit for Linux3, all of which are freely available.
On the web and elsewhere you may see references to Python IDEs. IDE stands for
Integrated Development Environment, and they typically combine a text editor
with a collection of other useful programming tools. While they can speed up
development for experienced programmers, they're not a good idea for beginners as
they complicate things, so I don't recommend you use them.
1
2
3
4
[Link]
[Link]
[Link]
[Link]
13
2:
14
the word we use to refer to a bit of text in a computer program (it just means a
string of characters). From this point on we'll use the word string when we're talking
about computer code, and we'll reserve the word sequence for when we're discussing
biological sequences like DNA and protein.
Let's take a look at the various bits of this line of code, and give some of them
names:
The whole line is called a statement.
print is the name of a function. The function tells Python, in vague terms, what we
want to do in this case, we want to print some text. The function name is always2
followed by parentheses3.
The bits of text inside the parentheses are called the arguments to the function. In
this case, we just have one argument (later on we'll see examples of functions that
take more than one argument, in which case the arguments are separated by
commas).
2
3
When we talk about printing text inside a computer program, we are not talking about producing a
document on a printer. The word "print" is used for any occasion when our program outputs some text in
this case, the output is displayed in your terminal.
This is not strictly true, but it's easier to just follow this rule than worry about the exceptions.
There are several different types of brackets in Python, so for clarity we will always refer to parentheses
when we mean these: (), square brackets when we mean these: [] and curly brackets when we mean these: {}
15
The arguments tell Python what we want to do more specifically in this case, the
argument tells Python exactly what it is we want to print: a friendly greeting.
Assuming you've followed the instructions in chapter 1 and set up your Python
environment, type the line of code above into your favourite text editor, save it, and
run it. You should see a single line of output like this:
Hello world
You'll notice that the output above doesn't contain quotes they are part of the
code, not part of the string itself. If we do want to include quotes in the output, the
easiest thing to do2 is use the other type of quotes for surrounding the string:
1
2
From this point on, I won't tell you to create a new file, enter the text, and run the program for each
example I will simply show you the output but I encourage you to try the examples yourself.
The alternative is to place a backslash character (\) before the quote this is called escaping the quote and
16
Be careful when writing and reading code that involves quotes you have to make
sure that the quotes at the beginning and end of the string match up.
You're going to see a lot of comments in the source code examples in this book, and
also in the solutions to the exercises. Comments are a very useful way to document
your code, for a number of reasons:
You can put the explanation of what a particular bit of code does right next
to the code itself. This makes it much easier to find the documentation for a
line of code that is in the middle of a large program, without having to
search through a separate document.
17
Because the comments are part of the source code, they can never get mixed
up or separated. In other words, if you are looking at the source code for a
particular program, then you automatically have the documentation as well.
In contrast, if you keep the documentation in a separate file, it can easily
become separated from the code.
Having the comments right next to the code acts as a reminder to update the
documentation whenever you change the code. The only thing worse than
undocumented code is code with old documentation that is no longer
accurate!
Don't make the mistake, by the way, of thinking that comments are only useful if
you are planning on showing your code to somebody else. When you start writing
your own code, you will be amazed at how quickly you forget the purpose of a
particular section or statement. If you are working on a solution to one of the
exercises in this book on Friday afternoon, then come back to it on Monday
morning, it will probably take you quite a while to pick up where you left off.
Comments can help with this problem by giving you hints about the purpose of
code, meaning that you spend less time trying to understand your old code, thus
speeding up your progress. A side benefit is that writing a comment for a bit of code
reinforces your understanding at the time you are doing it. A good habit to get into
is writing a quick one-line comment above any line of code that does something
interesting:
# print a friendly greeting
print("Hello world")
You'll see this technique used a lot in the code examples in this book, and I
encourage you to use it for your own code as well.
18
Forgetting quotes
Here's one possible error we can make when printing a line of output we can
forget to include the quotes:
print(Hello world)
This is easily done, so let's take a look at the output we'll get if we try to run the
above code1:
1 $ python [Link]
2 File "[Link]", line 1
3
print(Hello world)
4
^
5 SyntaxError: invalid syntax
The output that you see might be very slightly different from this, depending on a bunch of factors like
your operating system and the exact version of Python you are using.
19
Referring to the line numbers on the left we can see that the name of the Python
file is [Link] (line 1) and that the error occurs on the first line of the file (line
2). Python's best guess at the location of the error is just before the close
parentheses (line 3). Depending on the type of error, this can be wrong by quite a
bit, so don't rely on it too much!
The type of error is a SyntaxError (line 5), which mean that Python can't
understand the code it breaks the rules in some way (in this case, the rule that
strings must be surrounded by quotation marks). We'll see different types of errors
later in this book.
Spelling mistakes
What happens if we miss-spell the name of the function?:
prin("Hello world")
We get a different type of error a NameError and the error message is a bit
more helpful:
1 $ python [Link]
2 Traceback (most recent call last):
3 File "[Link]", line 1, in <module>
4
prin("Hello world")
5 NameError: name 'prin' is not defined
20
This time, Python doesn't try to show us where on the line the error occurred, it
just shows us the whole line (line 4). The error message tells us which word Python
doesn't understand (line 5), so in this case, it's quite easy to fix.
We might try putting a new line in the middle of our string like this:
print("Hello
World")
but that won't work and we'll get the following error message:
1 $ python [Link]
2 File "[Link]", line 1
3
print("Hello
4
^
5 SyntaxError: EOL while scanning string literal
Python finds the error when it gets to the end of the first line of code (line 2 in the
output). The error message (line 5) is a bit more cryptic than the others. EOL stands
for End Of Line, and string literal means a string in quotes. So to put this error
message in plain English: "I started reading a string in quotes, and I got to the end of
the line before I came to the closing quotation mark"
If splitting the line up doesn't work, then how do we get the output we want.....?
21
Notice that there's no need for a space before or after the new line.
There are a few other useful special characters as well, all of which consist of a
backslash followed by a letter. The only ones which you are likely to need for the
exercises in this book are the tab character (\t) and the carriage return character
(\r). The tab character can sometimes be useful when writing a program that will
produce a lot of output. The carriage return character works a bit like a new line in
that it puts the cursor back to the start of the line, but doesn't actually start a new
line, so you can use it to overwrite output this is sometimes useful for longrunning programs.
22
The variable my_dna now points to the string "ATGCGTA". We call this assigning a
variable, and once we've done it, we can use the variable name instead of the string
itself for example, we can use it in a print statement1:
# store a short DNA sequence in the variable my_dna
my_dna = "ATGCGTA"
# now print the DNA sequence
print(my_dna)
Notice that when we use the variable in a print statement, we don't need any
quotation marks the quotes are part of the string, so they are already "built in" to
the variable my_dna.
We can change the value of a variable as many times as we like once we've created
it:
my_dna = "ATGCGTA"
print(my_dna)
# change the value of my_dna
my_dna = "TGGTCCA"
Here's a very important point that trips many beginners up: variable names are
arbitrary that means that we can pick whatever we like to be the name of a
variable. So our code above would work in exactly the same way if we picked a
different variable name:
# store a short DNA sequence in the variable banana
banana = "ATGCGTA"
# now print the DNA sequence
print(banana)
If it's not clear why this is useful, don't worry it will become much more apparent when we look at some
longer examples.
23
What makes a good variable name? Generally, it's a good idea to use a variable
name that gives us a clue as to what the variable refers to. In this example, my_dna
is a good variable name, because it tells us that the content of the variable is a DNA
sequence. Conversely, banana is a bad variable name, because it doesn't really tell
us anything about the value that's stored. As you read through the code examples
in this book, you'll get a better idea of what constitutes good and bad variable
names.
This idea that names for things are arbitrary, and can be anything we like is a
theme that will occur many times in this book, so it's important to keep it in mind.
Occasionally you will see a variable name that looks like it has some sort of
relationship with the value it points to:
my_file = "my_file.txt"
but don't be fooled! Variable names and strings are separate things.
I said above that variable names can be anything we want, but it's actually not quite
that simple there are some rules we have to follow. We are only allowed to use
letters, numbers, and underscores, so we can't have variable names that contain
odd characters like , ^ or %. We are not allowed to start a name with a number
(though we can use numbers in the middle or at the end of a name). Finally, we
can't use a word that's already built in to the Python language like "print".
It's also important to remember that variable names are case-sensitive, so
my_dna, MY_DNA, My_DNA and My_Dna are all separate variables.
Technically this means that you could use all four of those names in a Python
program to store different values, but please don't do this it is very easy to
become confused when you use very similar variable names.
24
Concatenation
We can concatenate (stick together) two strings using the + symbol1. This symbol
will join together the string on the left with the string on the right:
my_dna = "AATT" + "GGCC"
print(my_dna)
In the above example, the things being concatenated were strings, but we can also
use variables that point to strings:
upstream = "AAA"
my_dna = upstream + "ATGC"
# my_dna is now "AAAATGC"
25
It's important to realize that the result of concatenating two strings together is
itself a string. So it's perfectly OK to use a concatenation inside a print statement:
print("Hello" + " " + "world")
As we'll see in the rest of the book, using one tool inside another is quite a common
thing to do in Python.
If we want to actually use the return value, we need to store it in a variable, and
then do something useful with it (like printing it):
26
dna_length = len("AGTC")
print(dna_length)
There's another interesting thing about the len function: the result (or return
value) is not a string, it's a number. This is a very important idea so I'm going to
write it out in bold: Python treats strings and numbers differently.
We can see that this is the case if we try to concatenate together a number and a
string. Consider this short program which calculates the length of a DNA sequence
and then prints a message telling us the length:
# store the DNA sequence in a variable
my_dna = "ATGCGAGT"
# calculate the length of the sequence and store it in a variable
dna_length = len(my_dna)
# print a message telling us the DNA sequence lenth
print("The length of the DNA sequence is " + dna_length)
27
Happily, Python has a built-in solution a function called str which turns a
number1 into a string so that we can print it. Here's how we can modify our program
to use it I've removed the comments from this version to make it a bit more
compact:
my_dna = "ATGCGAGT"
dna_length = len(my_dna)
print("The length of the DNA sequence is " + str(dna_length))
The only thing we have changed is that we've replace dna_length with
str(dna_length) inside the print statement2. Notice that because we're using
one function (str) inside another function (print), our statement now ends with
two closing parentheses.
To finish our discussion of the str function, here's a formal description of it, with
all the technical terms in italics:
str is a function which takes one argument (whose type is number), and returns a
value (whose type is string) representing that number.
If you're unsure about the meanings of any of the words in italics, skip back to the
earlier parts of this chapter where we discussed them. Understanding how types
work is key to avoiding many of the frustrations which new programmers typically
encounter, so make sure the idea is clear in your mind before moving on with the
rest of this book.
Changing case
We can convert a string to lower case by using a new type of syntax a method that
belongs to strings. A method is like a function, but instead of being built in to the
1
2
28
Python language, it belongs to a particular type. The method we are talking about
here is called lower, and we say that it belongs to the string type. Here's how we
use it:
my_dna = "ATGC"
# print my_dna in lower case
print(my_dna.lower())
Notice how using a method looks different to using a function. When we use a
function like print or len, we write the function name first and the arguments go
in parentheses:
print("ATGC")
len(my_dna)
When we use a method, we write the name of the variable first, followed by a
period, then the name of the method, then the method arguments in parentheses.
For the example we're looking at here, lower, there is no argument, so the opening
and closing parentheses are right next to each other.
It's important to notice that the lower method does not actually change the
variable; instead it returns a copy of the variable in lower case. We can prove that it
works this way by printing the variable before and after running lower. Here's the
code to do so:
my_dna = "ATGC"
# print the variable
print("before: " + my_dna)
# run the lower method and store the result
lowercase_dna = my_dna.lower()
# print the variable again
print("after: " + my_dna)
29
before: ATGC
after: ATGC
Just like the len function, in order to actually do anything useful with the lower
method, we need to store the result (or print it right away).
Because the lower method belongs to the string type, we can only use it on
variables that are strings. If we try to use it on a number:
my_number = len("AGTC")
# my_number is 4
print(my_number.lower())
The error message is a bit cryptic, but hopefully you can grasp the meaning:
something that is a number (an int, or integer) does not have a lower method.
This is a good example of the importance of types in Python code: we can only use
methods on the type that they belong to.
Before we move on, let's just mention that there is another method that belongs to
the string type called upper you can probably guess what it does!
Replacement
Here's another example of a useful method that belongs to the string type:
replace. replace is slightly different from anything we've seen before it takes
two arguments (both strings) and returns a copy of the variable where all
occurrences of the first string are replaced by the second string. That's quite a longwinded description, so here are a few examples to make things clearer:
30
protein = "vlspadktnv"
# replace valine with tyrosine
print([Link]("v", "y"))
# we can replace more than one character
print([Link]("vls", "ymt"))
# the original variable is not affected
print(protein)
We'll take a look at more tools for carrying out string replacement in chapter 7.
31
pa
vlspad
vlspadktnv
There are two important things to notice here. Firstly, we actually start counting
from position zero, rather than one in other words, position 3 is actually the
fourth character1. This explains why the first character of the first line of output is
p and not s as you might think. Secondly, the positions are inclusive at the start,
but exclusive at the stop. In other words, the expression protein[3:5] gives us
everything starting at the third character, and stopping just before the fifth
character (i.e. characters three and four).
If we just give a single number in the square brackets, we'll just get a single
character:
protein = "vlspadktnv"
first_residue = protein[0]
We'll learn a lot more about this type of notation, and what we can do with it, in
chapter 4.
This seems very annoying when you first encounter it, but we'll see later why it's necessary.
32
Let's use our protein sequence one last time as an example. Remember that we have
to use our old friend str to turn the counts into strings so that we can print them.
Also, notice that here I have used a blank line to separate out the two bits of the
program (calculating the counts, and printing them). Python is perfectly happy
with this it just ignores blank lines, so it's fine to put them in in order to make
your programs more readable for humans.
protein = "vlspadktnv"
# count amino acid residues
valine_count = [Link]('v')
lsp_count = [Link]('lsp')
tryptophan_count = [Link]('w')
# now print the counts
print("valines: " + str(valine_count))
print("lsp: " + str(lsp_count))
print("tryptophans: " + str(tryptophan_count))
33
Remember that in Python we start counting from zero rather than one, so position
0 is the first character, position 4 is the fifth character, etc. A couple of examples:
protein = "vlspadktnv"
print(str([Link]('p')))
print(str([Link]('kt')))
print(str([Link]('w')))
Notice the behaviour of find when we ask it to locate a substring that doesn't exist
we get back the answer -1.
Both count and find have a pretty serious limitation: you can only search for
exact substrings. If you need to count the number of occurrences of a variable
protein motif, or find the position of a variable transcription factor binding site,
they will not help you. The whole of chapter 7 is devoted to tools that can do those
kinds of jobs.
Of the tools we've discussed in this section, three replace, count and find
require at least two strings to work, so be careful that you don't get confused about
the order remember that:
my_dna.count(my_motif)
34
Recap
We started this chapter talking about strings and how to work with them, but along
the way we had to take a lot of diversions, all of which were necessary to
understand how the different string tools work. Thankfully, that means that we've
covered most of the nuts and bolts of the Python language, which will make future
chapters go much more smoothly.
We've learned about some general features of the Python programming language
like
the way that types work, and the importance of understanding them
the difference between functions and methods, and how to use them both
And we've encountered some tools that are specifically for working with strings:
concatenation
special characters
35
Many of the above topics will crop up again in future chapters, and will be
discussed in more detail, but you can always return to this chapter if you want to
brush up on the basics. The exercises for this chapter will allow you to practice
using the string manipulation tools and to become familiar with them. They'll also
give you the chance to practice builder bigger programs by using the individual
tools as building blocks.
36
Exercises
Reminder: the descriptions of the exercises are deliberately terse and may be
somewhat ambiguous (just like requirements for programs you will write in real
life). See the solutions for in-depth discussions of the exercises.
Calculating AT content
Here's a short DNA sequence:
ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT
Write a program that will print out the AT content of this DNA sequence. Hint: you
can use normal mathematical symbols like add (+), subtract (-), multiply (*), divide
(/) and parentheses to carry out calculations on numbers in Python.
Reminder: if you're using Python 2 rather than Python 3, include this line at the
top of your program:
from __future__ import division
Complementing DNA
Here's a short DNA sequence:
ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT
37
The sequence contains a recognition site for the EcoRI restriction enzyme, which
cuts at the motif G*AATTC (the position of the cut is indicated by an asterisk).
Write a program which will calculate the size of the two fragments that will be
produced when the DNA sequence is digested with EcoRI.
38
39
Solutions
Calculating AT content
This exercise is going to involve a mixture of strings and numbers. Let's remind
ourselves of the formula for calculating AT content:
AT content=
A+T
length
There are three numbers we need to figure out: the number of As, the number of Ts,
and the length of the sequence. We know that we can get the length of the
sequence using the len function, and we can count the number of As and Ts using
the count method. Here are a few lines of code that we think will calculate the
numbers we need:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')
At this point, it seems sensible to check these lines before we go any further. So
rather than diving straight in and doing some calculations, let's print out these
numbers so that we can eyeball them and see if they look approximately right. We'll
have to remember to turn the numbers into strings using str so that we can print
them:
40
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')
print("length: " + str(length))
print("A count: " + str(a_count))
print("T count: " + str(t_count))
That looks about right, but how do we know if it's exactly right? We could go
through the sequence manually base by base, and verify that there are sixteen As
and eighteen Ts, but that doesn't seem like a great use of our time: also, what
would we do if the sequence were 51 kilobases rather than 51 bases? A better idea is
to run the exact same code with a much shorter test sequence, to verify that it
works before going ahead and running it on the larger sequence.
Here's a version that uses a very short test sequence with one of each of the four
bases:
test_dna = "ATGC"
length = len(test_dna)
a_count = test_dna.count('A')
t_count = test_dna.count('T')
print("length: " + str(length))
print("A count: " + str(a_count))
print("T count: " + str(t_count))
41
length: 4
A count: 1
T count: 1
Everything looks OK we can probably go ahead and run the code on the long
sequence. But wait; we know that the next step is going to involve doing some
calculations using the numbers. If we switch back to the long sequence now, then
we'll be in the same position as we were before we'll end up with an answer for
the AT content, but we won't know if it's the right one.
A better plan is to stick with the short test sequence until we've written the whole
program, and check that we get the right answer for the AT content (we can easily
see by glancing at the test sequence that the AT content is 0.5). Here goes we'll
use the add and divide symbols from the exercise hint:
test_dna = "ATGC"
length = len(test_dna)
a_count = test_dna.count('A')
t_count = test_dna.count('T')
at_content = a_count + t_count / length
print("AT content is " + str(at_content))
That doesn't look right. Looking back at the code we can see what has gone wrong
in the calculation, the division has taken precedence over the addition, so what we
have actually calculated is:
A+
T
length
42
To fix it, all we need to do is add some parentheses around the addition, so that the
line becomes:
at_content = (a_count + t_count) / length
and we can go ahead and run the program using the longer sequence, confident
that the code is working and that the calculations are correct. Here's the final
version:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')
at_content = (a_count + t_count) / length
print("AT content is " + str(at_content))
Complementing DNA
This one seems pretty straightforward we need to take our sequence and replace
A with T, T with A, C with G, and G with C. We'll have to make four separate calls to
replace, and use the return value for each on as the input for the next tone. Let's
try it:
43
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
# replace A with T
replacement1 = my_dna.replace('A', 'T')
# replace T with A
replacement2 = [Link]('T', 'A')
# replace C with G
replacement3 = [Link]('C', 'G')
# replace G with C
replacement4 = [Link]('G', 'C')
# print the result of the final replacement
print(replacement4)
We can see just by looking at the original sequence that the first letter is A, so the
first letter of the printed sequence should be its complement, T. But instead the
first letter is A. In fact, all of the bases in the printed sequence are either A or T.
This is definitely not what we want!
Let's try and track the problem down by printing out all the intermediate steps as
well:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 'T')
print(replacement1)
replacement2 = [Link]('T', 'A')
print(replacement2)
replacement3 = [Link]('C', 'G')
print(replacement3)
replacement4 = [Link]('G', 'C')
print(replacement4)
The output from this program makes it clear what the problem is:
44
TCTGTTCGTTTTCGTTTTGTTTTTGCTTTCTTTCTTTTTTTTCGTTGCGTTCTT
ACAGAACGAAAACGAAAAGAAAAAGCAAACAAACAAAAAAAACGAAGCGAACAA
AGAGAAGGAAAAGGAAAAGAAAAAGGAAAGAAAGAAAAAAAAGGAAGGGAAGAA
ACACAACCAAAACCAAAACAAAAACCAAACAAACAAAAAAAACCAACCCAACAA
The first replacement (the result of which is shown in the first line of the output)
works fine all the As have been replaced with Ts (for example, look at the first
character it's A in the original sequence and T in the first line of the output).
The second replacement is where it starts to go wrong: all the Ts are replaced by As,
including those that were there as a result of the first replacement. So during
the first two replacements, the first character is changed from A to T and then
straight back to A again.
How are we going to get round this problem? One option is to pick a temporary
alphabet of four letters and do each replacement twice:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 'H')
replacement2 = [Link]('T', 'J')
replacement3 = [Link]('C', 'K')
replacement4 = [Link]('G', 'L')
replacement5 = [Link]('H', 'T')
replacement6 = [Link]('J', 'A')
replacement7 = [Link]('K', 'G')
replacement8 = [Link]('L', 'C')
print(replacement8)
This gets us the result we are looking for. It avoids the problem with the previous
program by using another letter to stand in for each base while the replacements
are being done. For example, A is first converted to H and then later on H is
converted to T.
Here's a slightly more elegant way of doing it. We can take advantage of the fact
that the replace method is case-sensitive, and make all the replaced bases lower
45
case. Then, once all the replacements have been carried out, we can simply call
upper and change the whole sequence back to upper case. Let's take a look at how
this works:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
replacement1 = my_dna.replace('A', 't')
print(replacement1)
replacement2 = [Link]('T', 'a')
print(replacement2)
replacement3 = [Link]('C', 'g')
print(replacement3)
replacement4 = [Link]('G', 'c')
print(replacement4)
print([Link]())
The output lets us see exactly what's happening notice that in this version of the
program we print the final string twice, once as it is and then once converted to
upper case:
tCTGtTCGtTTtCGTtTtGTtTTTGCTtTCtTtCtTtTtTtTCGtTGCGTTCtT
tCaGtaCGtaatCGatatGataaaGCataCtatCtatatataCGtaGCGaaCta
tgaGtagGtaatgGatatGataaaGgatagtatgtatatatagGtaGgGaagta
tgactagctaatgcatatcataaacgatagtatgtatatatagctacgcaagta
TGACTAGCTAATGCATATCATAAACGATAGTATGTATATATAGCTACGCAAGTA
We can see that as the program runs, each base in turn is replaced by its
complement in lower case. Since the next replacement is only looking for upper
case characters, bases don't get changed back as they did in the first version of our
program.
46
Since the EcoRI enzyme cuts the DNA between the G and first A, we can figure out
that the first fragment will run from position 0 to position 21, and the second
fragment from position 22 to the last position, 54. Therefore the lengths of the two
fragments are 22 and 33.
Writing a program to figure out the lengths is just a question of applying the same
logic. We'll use the find method to figure out the position of the start of the EcoRI
motif, then add one to account for the fact that the positions start counting from
zero this will give us the length of the first fragment. From there we can get the
length of the second fragment by finding the length of the input sequence and
subtracting the length of the first fragment:
my_dna = "ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT"
frag1_length = my_dna.find("GAATTC") + 1
frag2_length = len(my_dna) - frag1_length
print("length of fragment one is " + str(frag1_length))
print("length of fragment two is " + str(frag2_length))
The output from this program confirms that it agrees with the answer we got
manually:
length of fragment one is 22
length of fragment two is 33
47
If we wanted to run the same program using a different restriction enzyme, we'd
have to change both the string that we used in the find method call, and the
number that we add in order to take account of the cut site.
It's worth noting that this program assumes that the DNA sequence definitely does
contain the restriction site we're looking for. If we try the same program using a
DNA sequence which doesn't contain the site, it will report a fragment of length 0
and a fragment whose length is equal to the total length of the DNA sequence.
While this is not strictly wrong, it's a little misleading if we were going to use this
program for real-life work, we'd probably prefer to have slightly different behaviour
depending on whether or not the DNA sequence contained the motif we're looking
for. We'll talk about how to implement that type of behaviour in chapter 6.
We know that that's not really how a splicosome works, but it's fine as a conceptual model.
48
my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATC
GATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[1:63]
exon2 = my_dna[91:10000]
print(exon1 + exon2)
but when we look more closely we can see that something is not right. The printed
coding sequence is supposed to start at the very first character of the input
sequence, but it's starting at the second. We have forgotten to take into account the
fact that Python starts counting from zero, so our numbers are all too high by one.
Let's try again:
my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATC
GATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:62]
exon2 = my_dna[90:10000]
print(exon1 + exon2)
Now the output looks correct the coding sequence starts at the very beginning of
the input sequence:
ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCATCGATCGA
TATCGATGCATCGACTACTAT
49
We have calculated the coding proportion as a fraction, but the exercise called for a
percentage. We can easily fix this by multiplying by 100. Notice that the symbol for
multiplication is not x, as you might think, but *. The final code:
my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATC
GATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:62]
exon2 = my_dna[90:10000]
coding_length = len(exon1 + exon2)
total_length = len(my_dna)
print(100 * coding_length / total_length)
50
77.23577235772358
Looking at the output, we see an upper case DNA sequence with a lower case
section in the middle, as expected:
ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGatcgatcgatcg
atcgatcgatcatgctATCATCGATCGATATCGATGCATCGACTACTAT
When we are applying several transformations to text, as in this exercise, there are
usually a number of different ways we can write the program. For example, we
could store the lower case version of the intron, rather than converting it to lower
case when printing:
intron = my_dna[62:90].lower()
51
Or we could avoid using variables for the introns and exons all together, and do
everything in one big print statement:
print(my_dna[0:62] + my_dna[62:90].lower() + my_dna[90:10000])
This last option is very concise, but a bit harder to read than the more verbose way.
As the exercises in this book get longer, you'll notice that there are more and more
different ways to write the code you may end up with solutions that look very
different to the example solutions. When trying to choose between different ways
to write a program, always favour the solution that is clearest in intent and easiest
to read.
52
3:
1
2
i.e. files which you can open in a text editor and read, as opposed to binary files which cannot be read
directly.
In this book we'll mostly be talking about FASTA format as it's the simplest and most common format, but
there are many more.
53
Another reason for our interest in file input/output is the need for our Python
programs to work as part of a pipeline or work flow involving other, existing tools.
When it comes to using Python in the real world, we often want Python to either
accept data from, or provide data to, another program. Often the easiest way to do
this is to have Python read, or write, files in a format that the other program
already understands.
HTML files
In contrast, most files that you encounter day-to-day will be binary files ones
which are not made up of characters and lines, but of bytes. Examples include:
audio files
video files
54
If you're not sure whether a particular file is text or binary, there's a very simple
way to tell just open it up in a text editor. If the file displays without any problem,
then it's text (regardless of whether you can make sense of it or not). If you get an
error or a warning from your text editor, or the file displays as a collection of
indecipherable characters, then it's binary.
The examples and exercises in this chapter are a little different from those in the
previous one, because they rely on the existence of the files that we are going to
manipulate. If you want to try running the examples in this chapter, you'll need to
make sure that there is a file in your working directory called [Link] which has a
single line containing a DNA sequence. The easiest way to do this is to run the
examples while in the chapter_3 folder inside the exercises download1.
A file object is a new type which we haven't encountered before, and it's a little
more complicated than the string and number types that we saw in the previous
chapter. With strings and numbers it was easy to understand what they represented
a single bit of text, or a single number. A file object, in contrast, represents
something a bit less tangible it represents a file on your computer's hard drive.
If you haven't downloaded the example files yet, you'll find the link in the email that came with your
purchase of this book.
55
The way that we use file objects is a bit different to strings and numbers as well. If
you glance back at the examples from the previous chapter you'll see that most of
the time when we want to use a variable containing a string or number we just use
the variable name:
my_string = 'abcdefg'
print(my_string)
my_number = 42
print(my_number + 1)
In contrast, when we're working with file objects most of our interaction will be
through methods. This style of programming will seen unusual at first, but as we'll
see in this chapter, the file type has a well thought-out set of methods which let us
do lots of useful things.
The first thing we need to be able to do is to read the contents of the file. The file
type has a read method which does this. It doesn't take any arguments, and the
return value is a string, which we can store in a variable. Once we've read the file
contents into a variable, we can treat them just like any other string for example,
we can print them:
my_file = open("[Link]")
file_contents = my_file.read()
print(file_contents)
56
1 my_file_name = "[Link]"
2 my_file = open(my_file_name)
3 my_file_contents = my_file.read()
What's going on here? On line 1, we store the string [Link] in the variable
my_file_name. On line 2, we use the variable my_file_name as the argument
to the open function, and store the resulting file object in the variable my_file.
On line 3, we call the read method on the variable my_file, and store the
resulting string in the variable my_file_contents.
The important thing to understand about this code is that there are three separate
variables which have different types and which are storing three very different
things. my_file_name is a string, and it stores the name of a file on disk.
my_file is a file object, and it represents the file itself. my_file_contents is a
string, and it stores the text that is in the file.
Remember that variable names are arbitrary the computer doesn't care what you
call your variables. So this piece of code is exactly the same as the previous
example:
apple = "[Link]"
banana = open(apple)
grape = [Link]()
except it is harder to read! In contrast, the file name ([Link]) is not arbitrary it
must correspond to the name of a file on the hard drive of your computer.
A common error is to try to use the read method on the wrong thing. Recall that
read is a method that only works on file objects. If we try to use the read method
on the file name:
my_file_name = "[Link]"
my_contents = my_file_name.read()
57
we'll get an AttributeError Python will complain that strings don't have a
read method1:
AttributeError: 'str' object has no attribute 'read'
Another common error is to use the file object when we meant to use the file
contents. If we try to print the file object:
my_file_name = "[Link]"
my_file = open(my_file_name)
print(my_file)
We won't discuss the meaning of this line now: just remember that if you try to
print the contents of a file but instead you get some output that looks like the
above, you have almost definitely printed the file object rather than the file
contents.
From now on, I'll just show the relevant bits of output when discussing error message.
58
from this chapter, and the material we saw in the previous chapter, we get the
following code:
# open the file
my_file = open("[Link]")
# read the contents
my_dna = my_file.read()
# calculate the length
dna_length = len(my_dna)
# print the output
print("sequence is " + my_dna +
When we look at the output, we can see that the program is working almost
perfectly but there is something strange: the output has been split over two lines:
sequence is ACTGTACGTGCACTGATC
and length is 19
The explanation is simple once you know it: Python has included the new line
character at the end of the [Link] file as part of the contents. In other words, the
variable my_dna has a new line character at the end of it. If we could view the
my_dna variable directly1, we would see that it looks like this:
'ACTGTACGTGCACTGATC\n'
The solution is also simple. Because this is such a common problem, strings have a
method for removing new lines from the end of them. The method is called
rstrip, and it takes one string argument which is the character that you want to
remove. In this case, we want to remove the newline character (\n). Here's a
modified version of the code note that the argument to rstrip is itself a string
so needs to be enclosed in quotes:
In fact, we can do this there's a function called repr that returns a representation of a variable.
59
my_file = open("[Link]")
my_file_contents = my_file.read()
# remove the newline from the end of the file contents
my_dna = my_file_contents.rstrip("\n")
dna_length = len(my_dna)
print("sequence is " + my_dna + " and length is " + str(dna_length))
In the code above, we first read the file contents and then removed the newline, in
two separate steps:
my_file_contents = my_file.read()
my_dna = my_file_contents.rstrip("\n")
but it's more common to read the contents and remove the newline all in one go,
like this:
my_dna = my_file.read().rstrip("\n")
This is a bit tricky to read at first as we are using two different methods (read and
rstrip) in the same statement. The key is to read it from left to right we take the
my_file variable and use the read method on it, then we take the output of that
method (which we know is a string) and use the rstrip method on it. The result
of the rstrip method is then stored in the my_dna variable.
If you find it difficult write the whole thing as one statement like this, just break it
up and do the two things separately your programs will run just as well.
60
Missing files
What happens if we try to read a file that doesn't exist?
my_file = open("[Link]")
Ideally, we'd like to be able to check if a file exists before we try to open it we'll
see how to do that in chapter 9.
Linux users may be aware that we can redirect terminal output to a file using shell redirection, which can
get around some of these problems.
61
Most importantly, terminal output vanishes when you close your terminal program.
For small programs like the examples in this book, that's not a problem if you
want to see the output again you can just re-run the program. If you have a
program that requires a few hours to run, that's not such a great option.
1
2
62
Once we've opened a file for writing, we can use the file write method to write
some text to it. write works a lot like print it takes a single string argument but instead of printing the string to the screen it writes it to the file.
Here's how we use open with a second argument to open a file and write a single
line of text to it:
my_file = open("[Link]", "w")
my_file.write("Hello world")
Because the output is being written to the file in this example, you won't see any
output on the screen if you run it. To check that the code has worked, you'll have to
run it, then open up the file [Link] in your text editor and check that its contents
are what you expect1.
Remember that with write, just like with print, we can use any string as the
argument. This also means that we can use any method or function that returns a
string. The following are all perfectly OK:
# write "abcdef"
my_file.write("abc" + "def")
# write "8"
my_file.write(str(len('AGTGCTAG')))
# write "TTGC"
my_file.write("ATGC".replace('A', 'T'))
# write "atgc"
my_file.write("ATGC".lower())
# write contents of my_variable
my_file.write(my_variable)
.txt is the standard file name extension for a plain text file. Later in this book, when we generate output
files with a particular format, we'll use different file name extensions.
63
Closing files
There's one more important file method to look at before we finish this chapter
close. Unsurprisingly, this is the opposite of open (but note that it's a method,
whereas open is a function). We should call close after we're done reading or
writing to a file we won't go into the details here, but it's a good habit to get into
as it avoids some types of bugs that can be tricky to track down1. close is an
unusual method as it takes no arguments (so it's called with an empty pair of
parentheses) and doesn't return any useful value:
my_file = open("[Link]", "w")
my_file.write("Hello world")
# remember to close the file
my_file.close()
Specifically, it helps to ensure that output to a file is flushed, which is necessary when we want to make a
file available to another program as part of our work flow.
The extra r character before the string is necessary to prevent Python from trying to interpret the
backslash in the file path; see chapter 7 for an explanation.
64
my_file = open(r"c:\windows\Desktop\myfolder\[Link]")
Recap
We've taken a whole chapter to introduce the various ways of reading and writing
to files, because it's such an important part of building programs that are useful in
biology. We've seen how working with file contents is always a two-step process
we must open a file before reading or writing and looked at several common
pitfalls. We'll return to the theme of file manipulation in later chapters where we'll
address some of the shortcomings of the techniques we learned in this chapter:
All the examples in this chapter than involve reading files do so by reading
all the content into a single variable. Often, this is not what we want a
much more common requirement is to process a file line-by-line. In chapter
4 we'll learn about lists and loops, which will allow us to do exactly that.
Finally, another feature common to all our examples is that the names of
files are written as part of the code. We will generally want our real-life
programs to be more flexible, and capable of reading files that are specified
by the user. Chapter 9 also deals with the various forms of user input and in
it we'll learn how to make our programs accept file names flexibly.
65
Exercises
Splitting genomic DNA
Look in the chapter_3 folder for a file called genomic_dna.txt it contains the same
piece of genomic DNA that we were using in the final exercise from chapter 2. Write
a program that will split the genomic DNA into coding and non-coding parts, and
write these sequences to two separate files.
Hint: use your solution to the last exercise from chapter 2 as a starting point.
66
Write a program that will create a FASTA file for the following three sequences
make sure that all sequences are in upper case and only contain the bases A, T, G
and C.
Sequence header
DNA sequence
ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG
DEF456
actgatcgacgatcgatcgatcacgact
HIJ789
ACTGAC-ACTGT--ACTGTA----CATGTG
67
Solutions
Splitting genomic DNA
We have a head-start on this problem, because we have already tackled a similar
problem in the previous chapter. Let's remind ourselves of the solution we ended
up with for that exercise:
my_dna =
"ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATC
GATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT"
exon1 = my_dna[0:62]
intron = my_dna[62:90]
exon2 = my_dna[90:10000]
print(exon1 + [Link]() + exon2)
What changes do we need to make? Firstly, we need to read the DNA sequence from
a file instead of writing it in the code:
dna_file = open("genomic_dna.txt")
my_dna = dna_file.read()
Secondly, we need to create two new file objects to hold the output:
coding_file = open("coding_dna.txt", "w")
noncoding_file = open("noncoding_dna.txt", "w")
Finally, we need to concatenate the two exon sequences and write them to the
coding DNA file, and write the intron sequence to the non-coding DNA file:
coding_file.write(exon1 + exon2)
noncoding_file.write(intron)
68
Let's put it all together, with some blank lines to separate out the different parts of
the program:
# open the file and read its contents
dna_file = open("genomic_dna.txt")
my_dna = dna_file.read()
# extract the different bits of DNA sequence
exon1 = my_dna[0:62]
intron = my_dna[62:90]
exon2 = my_dna[90:10000]
# open the two output files
coding_file = open("coding_dna.txt", "w")
noncoding_file = open("noncoding_dna.txt", "w")
# write the sequences to the output files
coding_file.write(exon1 + exon2)
noncoding_file.write(intron)
FASTA format has alternating lines of header and sequence, so before we try any
sequence manipulation, let's try to write a program that produces the lines in the
right order. Rather than writing to a file, we'll print the output to the screen for now
69
that will make it easier to see the output right away. Once we've got it working,
we'll switch over to file output. Here's a few lines which will print data to the
screen:
print(header_1)
print(seq_1)
print(header_2)
print(seq_2)
print(header_3)
print(seq_3)
Not far off the lines are in the right order, but we forgot to include the greaterthan symbol at the start of the header. Also, we don't really need to print the
header and the sequence separately for each sequence we can include a newline
character in the print string in order to get them on separate lines. Here's an
improved version of the code:
print('>' + header_1 + '\n' + seq_1)
print('>' + header_2 + '\n' + seq_2)
print('>' + header_3 + '\n' + seq_3)
70
>ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG
>DEF456
actgatcgacgatcgatcgatcacgact
>HIJ789
ACTGAC-ACTGT--ACTGTA----CATGTG
Next, let's tackle the problems with the sequences. The second sequence is in lower
case, and it needs to be in upper case we can fix that using the upper string
method. The third sequence has a bunch of gaps that we need to remove. We
haven't come across a remove method.... but we do know how to replace one
character with another. If we replace all the gap characters with an empty string, it
will be the same as removing them1. Here's a version that fixes both sequences:
print('>' + header_1 + '\n' + seq_1)
print('>' + header_2 + '\n' + seq_2.upper())
print('>' + header_3 + '\n' + seq_3.replace('-', ''))
The final step is to switch from printed output to writing to a file. We'll open a new
file, and change the three print lines to write:
An empty string is just a pair of open and close quotation marks with nothing in between them.
71
After making these changes the code doesn't produce any output on the screen, so
to see what's happened we'll need to take a look at the [Link] file:
>ABC123
ATCGTACGATCGATCGATCGCTAGACGTATCG>DEF456
ACTGATCGACGATCGATCGATCACGACT>HIJ789
ACTGACACTGTACTGTACATGTG
This doesn't look right the second and third lines have been joined together, as
have the fourth and fifth. What has happened?
It looks like we've uncovered a difference between the print function and the
write method. print automatically puts a new line at the end of the string,
whereas write doesn't. This means we've got to be careful when switching
between them! The fix is quite simple, we'll just add a newline onto the end of each
string that gets written to the file:
output = open("[Link]", "w")
[Link]('>' + header_1 + '\n' + seq_1 + '\n')
[Link]('>' + header_2 + '\n' + seq_2.upper() + '\n')
[Link]('>' + header_3 + '\n' + seq_3.replace('-', '') + '\n')
The arguments for the write statements are getting quite complicated, but they are
all made up of simple building blocks. For example the last one, if we translated it
into English, would read "a greater-than symbol, followed by the variable header_3,
followed by a newline, followed by the variable seq_3 with all hyphens replaced with
nothing, followed by another newline".
72
Here's the final code, including the variable definition at the beginning, with blank
lines and comments:
# set the values of all the header variables
header_1 = "ABC123"
header_2 = "DEF456"
header_3 = "HIJ789"
# set
seq_1
seq_2
seq_3
Remember, the first argument to open is a string, so it's fine to use a concatenation
because we know that the result of concatenating two strings is also a string.
73
We'll also change the write statements so that we have one for each of the output
files. We need to be careful with the number here in order to make sure that we get
the right sequence in each file. Here's the final code, with comments.
# set the values of all the header variables
header_1 = "ABC123"
header_2 = "DEF456"
header_3 = "HIJ789"
# set
seq_1
seq_2
seq_3
the output
".fasta", "w")
".fasta", "w")
".fasta", "w")
Looking at the code above, it seems like there's a lot of redundancy there. Each of
the four sections of code setting the header values, setting the sequence values,
creating the output files, and writing data to the output files consists of three
nearly-identical statements. Although the solution works, it seems to involve a lot
of unnecessary typing! Also, having so much nearly-identical code seems likely to
cause errors if we need to change something. In the next chapter, we'll examine
some tools which will allow us to start removing some of that redundancy.
74
4:
We know that files are slightly different to strings and numbers because they can store a lot of information,
but each file object still only refers to a single file.
75
The limitations of this approach became clear quite quickly as we looked at the
solution code it only worked because the number of sequences were small, and we
knew the number in advance. If we were to repeat the exercise with three hundred
or three thousand sequences, the vast majority of the code would be given over to
storing variables and it would become completely unmanageable. And if we were
to try and write a program that could process an unknown number of input
sequences (for instance, by reading them from a file), we wouldn't be able to do it.
To make our programs able to process multiple pieces of data, we need an entirely
new type of structure which can hold many pieces of information at the same time
a list.
We've also dealt exclusively with programs whose statements are executed from top
to bottom in a very straightforward way. This has great advantages when first
starting to think about programming it makes it very easy to follow the flow of a
program. The downside of this sequential style of programming, however, is that it
leads to very redundant code like we saw at the end of the previous chapter:
# make three files to hold
output_1 = open(header_1 +
output_2 = open(header_2 +
output_3 = open(header_3 +
the output
".fasta", "w")
".fasta", "w")
".fasta", "w")
Again; it was only possible to solve the exercise in this manner because we knew in
advance the number of output files we were going to need. Looking at the code, it's
clear that these three lines consist of essentially the same statement being
executed multiple times, with some slight variations. This idea of repetition-withvariation is incredibly common in programming problems, and Python has built in
tools for expressing it loops.
76
Each individual item in a list is called an element. To get a single element from the
list, write the variable name followed by the index of the element you want in
square brackets:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
conserved_sites = [24, 56, 132]
print(apes[0])
first_site = conserved_sites[2]
If we want to go in the other direction i.e. we know which element we want but
we don't know the index we can use the index method:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
chimp_index = [Link]("Pan troglodytes")
# chimp_index is now 1
Remember that in Python we start counting from zero rather than one, so the first
element of a list is always at index zero. If we give a negative number, Python starts
counting from the end of the list rather than the beginning so it's easy to get the
last element from a list:
last_ape = apes[-1]
77
What if we want to get more than one element from a list? We can give a start and
stop position, separated by a colon, to specify a range of elements:
ranks = ["kingdom","phylum", "class", "order", "family"]
lower_ranks = ranks[2:5]
# lower ranks are class, order and family
Does this look familiar? It's the exact same notation that we used to get substrings
back in chapter 2, and it works in exactly the same way numbers are inclusive at
the start and exclusive at the end. The fact that we use the same notation for
strings and lists hints at a deeper relationship between the two types. In fact, what
we were doing when extracting substrings in chapter 2 was treating a string as
though it were a list of characters. This idea that we can treat a variable as
though it were a list when it's not is a powerful one in Python and we'll come back
to it later in this chapter.
78
The output shows that the number of elements in apes really has changed:
There are 3 apes
Now there are 4 apes
We can concatenate two lists just as we did with strings, by using the plus symbol:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
monkeys = ["Papio ursinus", "Macaca mulatta"]
primates = apes + monkeys
print(str(len(apes)) + " apes")
print(str(len(monkeys)) + " monkeys")
print(str(len(primates)) + " primates")
As we can see from the output, this doesn't change either of the two original lists
it makes a brand new list which contains elements from both:
3 apes
2 monkeys
5 primates
If we want to add elements from a list onto the end of an existing list, changing it
in the process, we can use the extend method. extend behaves like append but
takes a list as its argument rather than a single element.
Here are two more list methods that change the variable they're used on: reverse
and sort. Both reverse and sort work by changing the order of the elements in
79
the list. If we want to print out a list to see how this works, we need to used str
(just as we did when printing out numbers):
ranks = ["kingdom","phylum", "class", "order", "family"]
print("at the start : " + str(ranks))
[Link]()
print("after reversing : " + str(ranks))
[Link]()
print("after sorting : " + str(ranks))
If we take a look at the output, we can see how the order of the elements in the list
is changed by these two methods:
at the start : ['kingdom', 'phylum', 'class', 'order', 'family']
after reversing : ['family', 'order', 'class', 'phylum', 'kingdom']
after sorting : ['class', 'family', 'kingdom', 'order', 'phylum']
Writing a loop
Imagine we wanted to take our list of apes:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
We can sort in other ways too, but that's beyond the scope of this book
80
but this is very repetitive and relies on us knowing the number of elements in the
list. What we need is a way to say something along the lines of "for each element in
the list of apes, print out the element, followed by the words ' is an ape'". Python's loop
syntax allows us to express those instructions like this:
for ape in apes:
print(ape + " is an ape")
Let's take a moment to look at the different parts of this loop. We start by writing
for x in y, where y is the name of the list we want to process and x is the name
we want to use for the current element each time round the loop.
x is just a variable name (so it follows all the rules that we've already learned about
variable names), but it behaves slightly differently to all the other variables we've
seen so far. In all previous examples, we create a variable and store something in it,
and then the value of that variable doesn't change unless we change it ourselves. In
contrast, when we create a variable to be used in a loop, we don't set its value the
value of the variable will be automatically set to each element of the list in turn,
and it will be different each time round the loop.
Importantly, the loop variable x only exists inside the loop it gets created at the
start of each loop iteration, and disappears at the end. This means that once the
loop has finished running for the last time, that variable is gone forever. When a
variable is restricted to a block of code like this, we call it the variable's scope we
will see several more examples later in the book.
81
This first line of the loop ends with a colon, and all the subsequent lines (just one,
in this case) are indented. Indented lines can start with any number of tab or space
characters, but they must all be indented in the same way. This pattern a line
which ends with a colon, followed by some indented lines is very common in
Python, and we'll see it in several more places throughout this book. A group of
indented lines is often called a block of code1.
In this case, we refer to the indented bock as the body of the loop, and the lines
inside it will be executed once for each element in the list. To refer to the current
element, we use the variable name that we wrote in the first line. The body of the
loop can contain as many lines as we like, and can include all the functions and
methods that we've learned about, with one important exception: we're not allowed
to change the list while inside the body of the loop2.
Here's an example of a loop with a more complicated body:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
for ape in apes:
name_length = len(ape)
first_letter = ape[0]
print(ape + " is an ape. Its name starts with " + first_letter)
print("Its name has " + str(name_length) + " letters")
The body of the loop in the code above has four statements, two of which are
print statements, so each time round the loop we'll get two lines of output. If we
look at the output we can see all six lines:
1
2
If you're familiar with any other programming languages, you might know code blocks as things that are
surrounded with curly brackets the indentation does the same job in Python
Changing the list while looping can cause Python to become confused about which elements have already
been processed and which are yet to come.
82
Homo sapiens is
Its name has 12
Pan troglodytes
Its name has 15
Gorilla gorilla
Its name has 15
Why is the above approach better than printing out these six lines in six separate
statements? Well, for one thing, there's much less redundancy here we only
needed to write two print statements. This also means that if we need to make a
change to the code, we only have to make it once rather than three separate times.
Another benefit of using a loop here is that if we want to add some elements to the
list, we don't have to touch the loop code at all. Consequently, it doesn't matter
how many elements are in the list, and it's not a problem if we don't know how
many are going to be in it at the time when we write the code.
Indentation errors
Unfortunately, introducing tools like loops that require an indented block of code
also introduces the possibility of a new type of error an IndentationError.
Notice what happens when the indentation of one of the lines in the block does not
match the others:
apes = ["Homo sapiens", "Pan troglodytes", "Gorilla gorilla"]
for ape in apes:
name_length = len(ape)
first_letter = ape[0]
print(ape + " is an ape. Its name starts with " + first_letter)
print("Its name has " + str(name_length) + " letters")
When we run this code, we get an error message before the program even starts to
run:
83
When you encounter an IndentationError, go back to your code and doublecheck that all the lines in the block match up. Also double-check that you are using
either tabs or spaces for indentation, not both. The easiest way to do this, as
mentioned in chapter 1, is to enable tab emulation in your text editor.
character
character
character
character
character
character
is
is
is
is
is
is
m
a
r
t
i
n
The process of repeating a set of instructions for each element of a list (or
character in a string) is called iteration, and we often talk about iterating over a list
or string.
84
We can see from the output that the string has been split wherever there was a
comma leaving us with a list of strings:
['melanogaster', 'simulans', 'yakuba', 'ananassae']
Of course, once we've created a list in this way we can iterate over it using a loop,
just like any other list.
If you're interested in how this "pretending" actually works, look up the Python documentation for iterators
but be prepared to do quite a bit of reading!
85
file = open("some_input.txt")
for line in file:
# do something with the line
A quick warning: when you're writing a program that reads data from a file, it's best
to use either the read method (to store the entire contents in a variable) or the
loop method (to deal with each line separately). If you try to mix them, you might
get unexpected behaviour. The reason for this is that Python keeps track of its
position in each file, so if you read the contents of a file object using the read
method, and then later try to process it one line at a time with a loop, you won't get
any input because Python thinks it's already at the end of the file. If you absolutely
have to use one method and then the other, you can get round this problem by
closing and then re-opening the file.
and we want to print out the first three residues, then the first four residues, etc.
etc.:
vls
vlsp
vlspa
vlspad
...etc...
One way to tackle the problem would be to use a loop we could extract a substring
from the protein sequence and print it in the body of the loop, and the only thing
86
that would need to change is the stop position in the substring. But what are we
going to iterate over? We can't just iterate over the protein string, because that will
give us individual residues, which is not what we want. We can manually assemble a
list of stop positions, and loop over that:
stop_positions = [3,4,5,6,7,8,9,10]
for stop in stop_positions:
substring = protein[0:stop]
print(substring)
but this seems cumbersome, and only works if we know the length of the protein
sequence in advance.
A better solution is to use the range function. range is a built-in Python function
that generates lists of numbers for us to loop over. The behaviour of the range
function depends on how many arguments we give it. Below are a few examples,
with the output following directly after the code.
With a single argument, range will count up from zero to that number, excluding
the number itself:
for number in range(6):
print(number)
0
1
2
3
4
5
87
With two numbers, range will count up from the first number (inclusive1) to the
second (exclusive):
for number in range(3, 8):
print(number)
3
4
5
6
7
With three numbers, range will count up from the first to the second with the step
size given by the third:
for number in range(2, 14, 4):
print(number)
2
6
10
Recap
In this chapter we've seen several tools that work together to allow our programs to
deal elegantly with multiple pieces of data. Lists let us store many elements in a
single variable, and loops let us process those elements one by one. In learning
about loops, we've also been introduced to the block syntax and the importance of
indentation in Python.
1
The rules for ranges are the same as for array notation inclusive on the low end, exclusive on the high end
so you only have to memorize them once!
88
We've also seen several useful ways in which we can use the notation we've learned
for working with lists with other types of data. Depending on the circumstances, we
can use strings, files, and ranges as if they were lists. This is a very helpful feature of
Python, because once we've become familiar with the syntax for working with lists,
we can use it in many different place. Learning about these tools has also helped us
make sense of some interesting behaviour that we observed in earlier chapters.
89
Exercises
Note: all the files mentioned in these exercises can be found in the chapter_4 folder
of the exercises download.
90
Solutions
Processing DNA in a file
This seems a bit more complicated than previous exercises we are being asked to
write a program that does two things at once! so lets tackle it one step at a time.
First, we'll write a program that simply reads each sequence from the file and prints
it to the screen:
file = open("[Link]")
for dna in file:
print(dna)
We can see from the output that we've forgotten to remove the newlines from the
ends of the DNA sequences there is a blank line between each:
ATTCGATTATAAGCTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
ATTCGATTATAAGCACTGATCGATCGATCGATCGATCGATGCTATCGTCGT
ATTCGATTATAAGCATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC
ATTCGATTATAAGCACTATCGATGATCTAGCTACGATCGTAGCTGTA
ATTCGATTATAAGCACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA
but we'll ignore that for now. The next step is to remove the first 14 bases of each
sequence. We know that we want to take a substring from each sequence, starting
at the fifteenth character, and continuing to the end. Unfortunately, the sequences
are all different lengths, so the stop position is going to be different for all of them.
We'll have to calculate the position of the last character for each sequence, by using
the len function to calculate the length.
91
Here's what the code looks like with the substring part added:
file = open("[Link]")
for dna in file:
last_character_position = len(dna)
trimmed_dna = dna[14:last_character_position]
print(trimmed_dna)
As before, we are simply printing the trimmed DNA sequence to the screen, and
from the output we can confirm that the first 14 bases have been removed from
each sequence:
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
ACTGATCGATCGATCGATCGATCGATGCTATCGTCGT
ATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC
ACTATCGATGATCTAGCTACGATCGTAGCTGTA
ACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA
Now that we know our code is working, we'll switch from printing to the screen to
writing to a file. We'll have to open the file before the loop, then write the trimmed
sequences to the file inside the loop:
file = open("[Link]")
output = open("[Link]", "w")
for dna in file:
last_character_position = len(dna)
trimmed_dna = dna[14:last_character_position]
[Link](trimmed_dna)
92
Opening up the [Link] file, we can see that the result looks good. It didn't
matter that we never removed the newlines, because they appear in the correct
place in the output file anyway:
TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
ACTGATCGATCGATCGATCGATCGATGCTATCGTCGT
ATCGATCACGATCTATCGTACGTATGCATATCGATATCGATCGTAGTC
ACTATCGATGATCTAGCTACGATCGTAGCTGTA
ACTAGCTAGTCTCGATGCATGATCAGCTTAGCTGATGATGCTATGCA
Now the final step printing the lengths to the screen requires just one more line
of code. Here's the final program in full, with comments:
# open the input file
file = open("[Link]")
# open the output file
output = open("[Link]", "w")
# go through the input file one line at a time
for dna in file:
# calculate the position of the last character
last_character_position = len(dna)
# get the substring from the 15th character to the end
trimmed_dna = dna[14:last_character_position]
# print out the trimmed sequence
[Link](trimmed_dna)
# print out the length to the screen
print("processed sequence with length " + str(len(trimmed_dna)))
93
This gives us a loop in which we are dealing with a different exon each time round.
If we look at the output, we can see that we still have a newline at the end of each
line, but we'll not worry about that for now:
5,58
72,133
190,276
340,398
Now we have to split up each line into a start and stop position. The split method
is probably a good choice for this job let's see what happens when we split each
line using a comma as the delimiter:
exon_locations = open("[Link]")
for line in exon_locations:
positions = [Link](',')
print(positions)
The output shows that each line, when split, turns into a list of two elements:
94
['5', '58\n']
['72', '133\n']
['190', '276\n']
['340', '398\n']
The second element of each list has a newline on the end, because we haven't
removed them. Let's try assigning the start and stop position to sensible variable
names, and printing them out individually:
exon_locations = open("[Link]")
for line in exon_locations:
positions = [Link](',')
start = positions[0]
stop = positions[1]
print("start is " + start + ", stop is " + stop)
The output shows that this approach works the start and stop variables take
different values each time round the loop:
start is 5, stop is 58
start is 72, stop is 133
start is 190, stop is 276
start is 340, stop is 398
Now let's try putting these variables to use. We'll read the genomic sequence from
the file all in one go using read there's no need to process each line separately,
as we just want the entire contents. Then we'll use the exon coordinates to extract
one exon each time round the loop, and print it to the screen:
95
1 genomic_dna = open("genomic_dna.txt").read()
2 exon_locations = open("[Link]")
3 for line in exon_locations:
4
positions = [Link](',')
5
start = positions[0]
6
stop = positions[1]
7
exon = genomic_dna[start:stop]
8
print("exon is: " + exon)
Unfortunately, when we run this code we get an error at line 7:
File "multiple_exons_from_genomic_dna.py", line 7, in <module>
exon = genomic_dna[start:stop]
TypeError: slice indices must be integers or None or have an __index__
method
What has gone wrong? Recall that the result of using split on a string is a list of
strings this means that the start and stop variables in our program are also
strings (because they're just individual elements of the positions list). The
problem comes when we try to use them as numbers in line 7. Fortunately, it's
easily fixed we just have to use the int function to turn our strings into
numbers:
start = int(positions[0])
stop = int(positions[1])
96
but instead we have a single exon variable that stores one exon at a time. Here's
one way to get the complete coding sequence: before the loop starts we'll create a
new variable called coding_sequence and assign it to an empty string. Then,
each time round the loop, we'll add the current exon on to the end, and store the
result back in the same variable. When the loop has finished, the variable will
contain all the exons. This is what the code looks like (with line numbers as the
program is getting quite long):
1
2
3
4
5
6
7
8
9
10
genomic_dna = open("genomic_dna.txt").read()
exon_locations = open("[Link]")
coding_sequence = ""
for line in exon_locations:
positions = [Link](',')
start = int(positions[0])
stop = int(positions[1])
exon = genomic_dna[start:stop]
coding_sequence = coding_sequence + exon
print("coding sequence is : " + coding_sequence)
On line 3 we create the coding_sequence variable, and on line 9, inside the loop,
we add the current exon on to the end. This is an unusual type of variable
assignment, because the coding_sequence variable is on both the left and right
side of the equals sign. The trick to understanding line 9 is to read the right-hand
side of the statement first i.e. "concatenate the current coding_sequence and the
current exon, then store the result of that concatenation in coding_sequence".
On line 10, instead of printing the exon, we're printing the coding sequence, and we
can see from the output how the coding sequence is gradually built up as we go
round the loop:
97
The final step is to save the coding sequence to a file. We can do this at the end of
the program with three lines of code. Here's the final code with comments:
98
99
5:
my_dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT"
length = len(my_dna)
a_count = my_dna.count('A')
t_count = my_dna.count('T')
at_content = (a_count + t_count) / length
print("AT content is " + str(at_content))
If we discount the first line (whose job is to store the input sequence) and the last
line (whose job is to print the result), we can see that it takes four lines of code to
calculate the AT content1. This means that every place in our code where we want
to calculate the AT content of a sequence, we need these same four lines and we
have to make sure we copy them exactly, without any mistakes.
It would be much simpler if Python had a built-in function (let's call it
get_at_content) for calculating AT content. If that were the case, then we could
just run get_at_content in the same way we run print, or len, or open.
Although, sadly, Python does not have such a built-in function, it does have the
next best thing a way for us to create our own functions.
Creating our own function to carry out a particular job has many benefits. It allows
us to re-use the same code many times within a program without having to copy it
out each time. Additionally, if we find that we have to make a change to the code,
1
100
we only have to do it in one place. Splitting our code into functions also allows us
to tackle larger problems, as we can work on different bits of the code
independently. We can also re-use code across multiple programs.
Defining a function
Let's go ahead and create our get_at_content function. Before we start typing,
we need to figure out what the inputs (the number and types of the function
arguments) and outputs (the type of the return value) are going to be. For this
function, that seems pretty obvious the input is going to be a single DNA
sequence, and the output is going to be a decimal number. To translate these into
Python terms: the function will take a single argument of type string, and will
return a value of type number1. Here's the code:
def get_at_content(dna):
length = len(dna)
a_count = [Link]('A')
t_count = [Link]('T')
at_content = (a_count + t_count) / length
return at_content
Reminder: if you're using Python 2 rather than Python 3, include this line at the
top of your program:
from __future__ import division
The first line of the function definition contains a several different elements. We
start with the word def, which is short for define (writing a function is called
defining it). Following that we write the name of the function, followed by the
names of the argument variables in parentheses. Just like we saw before with
1
In fact, we can be a little bit more specific: we can say that the return value will be of type float a
floating point number (i.e. one with a decimal point).
101
normal variables, the function name and the argument names are arbitrary we
can use whatever we like.
The first line ends with a colon, just like the first line of the loops that we were
looking at in the previous chapter. And just like loops, this line is followed by a
block of indented lines the function body. The function body can have as many
lines of code as we like, as long as they all have the same indentation. Within the
function body, we can refer to the arguments by using the variable names from the
first line. In this case, the variable dna refers to the sequence that was passed in as
the argument to the function.
The last line of the function causes it to return the AT content that was calculated
in the function body. To return from a function, we simply write return followed
by the value that the function should output.
There are a couple of important things to be aware of when writing functions.
Firstly, we need to make a clear distinction between defining a function, and
running it (we refer to running a function as calling it). The code we've written
above will not cause anything to happen when we run it, because we've not actually
asked Python to execute the get_at_content function we have simply defined
what it is. The code in the function will not be executed until we call the function
like this:
get_at_content("ATGACTGGACCA")
If we simply call the function like that, however, then the AT content will vanish
once it's been calculated. In order to use the function to do something useful, we
must either store the result in a variable:
at_content = get_at_content("ATGACTGGACCA")
Or use it directly:
102
Secondly, it's important to understand that the argument variable dna does not
hold any particular value when the function is defined1. Instead, its job is to hold
whatever value is given as the argument when the function is called. In this way it's
analogous to the loop variables we saw in the previous chapter: loop variables hold
a different value each time round the loop, and function argument variables hold a
different value each time the function is called.
Finally, be aware that the same scoping rules that applied to loops also apply to
functions any variables that we create as part of the function only exist inside the
function, and cannot be accessed outside. If we try to use a variable that's created
inside the function from outside:
def get_at_content(dna):
length = len(dna)
a_count = [Link]('A')
t_count = [Link]('T')
at_content = (a_count + t_count) / length
return at_content
print(a_count)
Indeed, it doesn't actually exist when it's defined, only when it runs.
103
def get_at_content(dna):
length = len(dna)
a_count = [Link]('A')
t_count = [Link]('T')
at_content = (a_count + t_count) / length
return at_content
my_at_content = get_at_content("ATGCGCGATCGATCGAATCG")
print(str(my_at_content))
print(get_at_content("ATGCATGCAACTGTAGC"))
print(get_at_content("aactgtagctagctagcagcgta"))
Looking at the output, we can see that the first function call works fine the AT
content is calculated to be 0.45, is stored in the variable my_at_content, then
printed. However, the output for the next two calls is not so great. The call at line
10 produces a number with way too many figures after the decimal point, and the
call at line 11, with the input sequence in lower case, gives a result of 0.0, which is
definitely not correct:
0.45
0.5294117647058824
0.0
104
lower case problem by converting the input sequence to upper case before starting
the calculation. Here's the new version of the function, with the same three
function calls:
def get_at_content(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, 2)
my_at_content = get_at_content("ATGCGCGATCGATCGAATCG")
print(str(my_at_content))
print(get_at_content("ATGCATGCAACTGTAGC"))
print(get_at_content("aactgtagctagctagcagcgta"))
We can make the function even better though: why not allow it to be called with
the number of significant figures as an argument1? In the above code, we've picked
two significant figures, but there might be situations where we want to see more.
Adding the second argument is easy; we just add it to the argument variable list on
the first line of the function definition, and then use the new argument variable in
the call to round. We'll throw in a few calls to the new version of the function with
different arguments to check that it works:
An even better solution would be to specify the number of significant figures in the string representation
of the number when it's printed.
105
106
where we define the function, and the part where we use it and we can make
changes to one part without worrying about the effects on the other part.
This is a very powerful idea, because without it, the size of programs we can write is
limited to the number of lines of code we can hold in our head at one time. Some of
the example code in the solutions to exercises in the previous chapter were starting
to push at this limit already, even for relatively simple problems. By contrast, using
functions allows us to build up a complex program from small building blocks, each
of which individually is small enough to understand in its entirety.
Because using functions is so important, future solutions to exercises will use them
when appropriate, even when it's not explicitly mentioned in the problem text. I
encourage you to get into the habit of using functions in your solutions too.
but such functions tend not to be very useful. For example, we can write a version
of get_at_content that doesn't require any arguments by setting the value of
the dna variable inside the function:
def get_at_content():
dna = "ACTGATGCTAGCTA"
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, 2)
107
but that's obviously not very useful. Occasionally you may be tempted to write a
no-argument function that works like this:
1 def get_at_content():
2
length = len(dna)
3
a_count = [Link]().count('A')
4
t_count = [Link]().count('T')
5
at_content = (a_count + t_count) / length
6
return round(at_content, 2)
7
8 dna = "ACTGATCGATCG"
9 print(get_at_content())
At first this seems like a good idea it works because the function gets the value of
the dna variable that is set on line 81. However, this breaks the encapsulation that
we worked so hard to achieve. The function now only works if there is a variable
called dna set in the bit of the code where the function is called, so the two pieces
of code are no longer independent.
If you find yourself writing code like this, it's usually a good idea to identify which
variables from outside the function are being used inside it, and turn them into
arguments.
It doesn't matter that the variable is set after the function is defined all that matters it that it's set before
the function is called on line 9.
108
When you first start writing functions, it's very tempting to do this kind of thing.
You think "OK, I need to calculate and print the AT content I'll write a function that
does both". The trouble with this approach is that it results in a function that is less
flexible. Right now you want to print the AT content to the screen, but what if you
later discover that you want to write it to a file, or use it as part of some other
calculation? You'll have to write more functions to carry out these tasks.
The key to designing flexible functions is to recognize that the job calculate and
print the AT content is actually two separate jobs calculating the AT content, and
printing it. Try to write your functions in such a way that they just do one job. You
can then easily write code to carry out more complicated jobs by using your simple
functions as building blocks.
109
to know that the DNA sequence comes first, followed by the number of significant
figures.
There's a feature in Python called keyword arguments which allows us to call
functions in a slightly different way. Instead of giving a list of arguments in
parentheses:
get_at_content("ATCGTGACTCG", 2)
we can supply a list of argument variable names and values joined by equals signs:
get_at_content(dna="ATCGTGACTCG", sig_figs=2)
This style of calling functions1 has several advantages. It doesn't rely on the order
of arguments, so we can use whichever order we prefer. These two statements
behave identically:
get_at_content(dna="ATCGTGACTCG", sig_figs=2)
get_at_content(sig_figs=2, dna="ATCGTGACTCG")
It's also clearer to read what's happening when the argument names are given
explicitly.
We can even mix and match the two styles of calling the following are all
identical:
get_at_content("ATCGTGACTCG", 2)
get_at_content(dna="ATCGTGACTCG", sig_figs=2)
get_at_content("ATCGTGACTCG", sig_figs=2)
Although we're not allowed to start off with keyword arguments then switch back
to normal this will cause an error:
1
It works with methods too, including all the ones we've seen so far.
110
get_at_content(dna="ATCGTGACTCG", 2)
Keyword arguments can be particularly useful for functions and methods that have
a lot of arguments, and we'll use them where appropriate in the examples and
exercise solutions in the rest of this book.
Now we have the best of both worlds. If the function is called with two arguments,
it will use the number of significant figures specified; if it's called with one
argument, it will use the default value of two significant figures. Let's see some
examples:
get_at_content("ATCGTGACTCG")
get_at_content("ATCGTGACTCG", 3)
get_at_content("ATCGTGACTCG", sig_figs=4)
111
The function takes care of filling in the default value for sig_figs for the first
function call where none is supplied:
0.45
0.455
0.4545
Function argument defaults allow us to write very flexible functions which can
have varying numbers of arguments. It only makes sense to use them for arguments
where a sensible default can be chosen there's no point specifying a default for
the dna argument in our example. They are particularly useful for functions where
some of the options are only going to be used infrequently.
Testing functions
When writing code of any type, it's important to periodically check that your code
does what you intend it to do. If you look back over the solutions to exercises from
the first few chapters, you can see that we generally test our code at each step by
printing some output to the screen and checking that it looks OK. For example, in
chapter 2 when we were first calculating AT content, we used a very short test
sequence to verify that our code worked before running it on the real input.
The reason we used a test sequence was that, because it was so short, we could
easily work out the answer by eye and compare it to the answer given by our code.
This idea running code on a test input and comparing the result to an answer
that we know to be correct1 is such a useful one that Python has a built-in tool
for expressing it: assert. An assertion consists of the word assert, followed by a
call to our function, then two equals signs, then the result that we expect2.
1
2
112
For example, we know that if we run our get_at_content function on the DNA
sequence "ATGC" we should get an answer of 0.5. This assertion will test whether
that's the case:
assert get_at_content("ATGC") == 0.5
Notice the two equals signs we'll learn the reason behind that in the next chapter.
The way that assertion statements work is very simple; if an assertion turns out to
be false (i.e. if Python executes our function on the input "ATGC" and the answer
isn't 0.5) then the program will stop and we will get an AssertionError.
Assertions are useful in a number of ways. They provide a means for us to check
whether our functions are working as intended and therefore help us track down
errors in our programs. If we get some unexpected output from a program that uses
a particular function, and the assertion tests for that function all pass, then we can
be confident that the error doesn't lie in the function but in the code that calls it.
They also let us modify a function and check that we haven't introduced any errors.
If we have a function that passes a series of assertion tests, and we make some
changes to it, we can re-run the assertion tests and, assuming they all pass, be
confident that we haven't broken the function1.
Assertions are also useful as a form of documentation. By including a collection of
assertion tests alongside a function, we can show exactly what output is expected
from a given input.
Finally, we can use assertions to test the behaviour of our function for unusual
inputs. For example, what is the expected behaviour of get_at_content when
given a DNA sequence that includes unknown bases (usually represented as N)? A
sensible way to handle unknown bases would be to exclude them from the AT
content calculation in other words, the AT content for a given sequence shouldn't
1
This idea is very similar to a process in software development called regression testing.
113
This assertions fails for the current version of get_at_content. However, we can
easily modify the function to remove all N characters before carrying out the
calculation:
def get_at_content(dna, sig_figs=2):
dna = [Link]('N', '')
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return round(at_content, sig_figs)
get_at_content("A") == 1
get_at_content("G") == 0
get_at_content("ATGC") == 0.5
get_at_content("AGG") == 0.33
get_at_content("AGG", 1) == 0.3
get_at_content("AGG", 5) == 0.33333
Recap
In this chapter, we've seen how packaging up code into functions helps us to
manage the complexity of large programs and promote code reuse. We learned how
114
to define and call our own functions along with various new ways to supply
arguments to functions. We also looked at a couple of things that are possible in
Python, but rarely advisable writing functions without arguments or return
values. Finally, we explored the use of assertions to test our functions, and
discussed how we can use them to catch errors before they become a problem.
The remaining chapters in this book will make use of functions in both the
examples and the exercise solutions, so make sure you are comfortable with the
new ideas from this chapter before moving on.
115
Exercises
Percentage of amino acid residues, part one
Write a function that takes two arguments a protein sequence and an amino acid
residue code and returns the percentage of the protein that the amino acid makes
up. Use the following assertions to test your function:
assert
assert
assert
assert
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP",
"M")
"r")
"L")
"Y")
==
==
==
==
5
10
50
0
Reminder: if you're using Python 2 rather than Python 3, include this line at the
top of your program:
from __future__ import division
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP",
my_function("MSRSLLLRFLLFLLLLPPLP")
["M"]) == 5
['M', 'L']) == 55
['F', 'S', 'L']) == 70
== 65
116
Solutions
Percentage of amino acid residues, part one
This is a similar problem to ones that we've tackled before, but we'll have to pay
attention to the details. Let's start with a piece of code that does the calculation for
a specific protein sequence and amino acid code, and then turn it into a function.
Calculating the percentage is very similar to calculating the AT content, but we will
need to multiple the result by 100 to get a percentage rather than a fraction:
protein = "MSRSLLLRFLLFLLLLPPLP"
aa = "R"
aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
print(percentage)
Now we'll make this code into a function by turning the two variables protein and
aa into arguments, and returning the percentage rather than printing it. We'll add
in the assertions at the end of the program to test if the function is doing its job:
def get_aa_percentage(protein, aa):
aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
return percentage
# test
assert
assert
assert
assert
"M")
"r")
"L")
"Y")
==
==
==
==
5
10
50
0
117
Running the code shows that one of the assertions is failing the error message
tells us which assertion is the failed one:
assert get_aa_percentage("MSRSLLLRFLLFLLLLPPLP", "r") == 10
AssertionError
Our function fails to work when the protein sequence is in upper case, but the
amino acid residue code is in lower case. Looking at the assertions, we can make an
educated guess that the next one (with the protein in lower case and the amino
acid in upper case) is probably going to fail as well. Let's try to fix both of these
problems by converting both the protein and the amino acid string to upper case at
the start of the function. We'll use the same trick as we did before of converting a
string to upper case and then storing the result back in the same variable:
def get_aa_percentage(protein, aa):
# convert both inputs to upper case
protein = [Link]()
aa = [Link]()
aa_count = [Link](aa)
protein_length = len(protein)
percentage = aa_count * 100 / protein_length
return percentage
118
There are actually two ways to approach this problem. We can use a loop to go
through each of the given amino acid residues in turn, counting up the number of
times they occur in the protein sequence, to get a total count. Or, we can treat the
protein sequence string as a list (as described in the previous chapter) and ask, for
each position, whether the character at that position is a member of the list of
amino acid residues. We'll use the first method here; in the next chapter we'll learn
about the tools necessary to implement the second.
We'll need some way to keep a running total of matching amino acids as we go
round the loop, so we'll create a new variable outside the loop and update it each
time round. The code inside the loop will be quite similar to that from the previous
exercise. Here's the code with some print statements so we can see exactly what is
happening:
protein = "MSRSLLLRFLLFLLLLPPLP"
aa_list = ['M', 'L', 'F']
# the total variable will hold the total number of matching residues
total = 0
for aa in aa_list:
print("counting number of " + aa)
aa = [Link]()
aa_count = [Link](aa)
# add the number for this residue to the total count
total = total + aa_count
print("running total is " + str(total))
percentage = total * 100 / len(protein)
print("final percentage is " + str(percentage))
When we run the code, we can see how the running total increases each time round
the loop:
119
counting number of M
running total is 1
counting number of L
running total is 11
counting number of F
running total is 13
final percentage is 65.0
Now let's take the code and, just like before, turn the protein string and the amino
acid list into arguments to create a function:
def get_aa_percentage(protein, aa_list):
protein = [Link]()
protein_length = len(protein)
total = 0
for aa in aa_list:
aa = [Link]()
aa_count = [Link](aa)
total = total + aa_count
percentage = total * 100 / protein_length
return percentage
This function passes all the assertion tests except the last one, which tests the
behaviour when run with only one argument. In fact, Python never even gets as far
as testing the result from running the function, as we get an error indicating that
the function didn't complete:
TypeError: get_aa_percentage() takes exactly 2 arguments (1 given)
Fixing the error takes only one change: we add a default value for aa_list in the
first line of the function definition:
120
121
6:
Conditional tests
122
1
2
3
4
5
6
7
8
9
10
print(3 == 5)
print(3 > 5)
print(3 <=5)
print(len("ATGC") > 5)
print("GAATTC".count("T") > 1)
print("ATGCTT".startswith("ATG"))
print("ATGCTT".endswith("TTT"))
print("ATGCTT".isupper())
print("ATGCTT".islower())
print("V" in ["V", "W", "L"])
If we look at the output, we can see use the line numbers to match up each
condition with its result:
1
2
3
4
5
6
7
8
9
10
False
False
True
False
True
True
False
True
False
True
But what's actually being printed here? At first glance, it looks like we're printing
the strings "True" and "False", but those strings don't appear anywhere in our code.
What is actually being printed is the special built-in values that Python uses to
represent true and false they are capitalized so that we know they're these special
values.
We can show that these values are special by trying to print them. The following
code runs without errors (note the absence of quotation marks):
print(True)
print(False)
123
causes a NameError.
There's a wide range of things that we can include in conditions, and it would be
impossible to give an exhaustive list here. The basic building blocks are:
Many data types also provide methods that return True or False values, which are
often a lot more convenient to use than the building blocks above. We've already
seen a few in the code sample above: for example, strings have a startswith
method that returns true if the string starts with the string given as an argument.
We'll mention these true/false methods when they come up.
Notice that the test for equality is two equals signs, not one. Forgetting the second
equals sign will cause an error.
Now that we know how to express tests as conditions, let's see what we can do with
them.
A discussion of what this actually means in Python is beyond the scope of this book, so we'll avoid using
this comparison for the chapter.
124
if statements
The simplest kind of conditional statement is an if statement. Hopefully the syntax
is fairly simple to understand:
expression_level = 125
if expression_level > 100:
print("gene is highly expressed")
We write the word if, followed by a condition, and end the first line with a colon.
There follows a block of indented lines of code (the body of the if statement), which
will only be executed if the condition is true. This colon-plus-block pattern should
be familiar to you from the chapters on loops and functions.
Most of the time, we want to use an if statement to test a property of some variable
whose value we don't know at the time when we are writing the program. The
example above is obviously useless, as the value of the expression_level
variable is not going to change!
Here's a slightly more interesting example: we'll define a list of gene accession
names and print out just the ones that start with "a":
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
print(accession)
125
If you take a close look at the code above, you'll see something interesting the
lines of code inside the loop are indented (just as we've seen before), but the line of
code inside the if statement is indented twice once for the loop, and once for
the if. This is the first time we've seen multiple levels of indentation, but it's very
common once we start working with larger programs whenever we have one loop
or if statement nested inside another, we'll have this type of indentation.
Python is quite happy to have as many levels of indentation as needed, but you'll
need to keep careful track of which lines of code belong at which level. If you find
yourself writing a piece of code that requires more than three levels of indentation,
it's generally an indication that that piece of code should be turned into a function.
else statements
Closely related to the if statement is the else statement. The examples above use
a yes/no type of decision-making: should we print the gene accession number or
not? Often we need an either/or type of decision, where we have two possible
actions to take. To do this, we can add on an else clause after the end of the body
of an if statement:
expression_level = 125
if expression_level > 100:
print("gene is highly expressed")
else:
print("gene is lowly expressed")
The else statement doesn't have any condition of its own rather, the else
statement body is execute when the if statement to which it's attached is not
executed.
Here's an example which uses if and else to split up a list of accession names into
two different files accessions that start with "a" go into the first file, and all other
accessions go into the second file:
126
Notice how there are multiple indentation levels as before, but that the if and
else statements are at the same level.
elif statements
What if we have more than two possible branches? For example, say we want three
files of accession names: ones that start with "a", ones that start with "b", and all
others. We could have a second if statement nested inside the else clause of the
first if statement:
file1 = open("[Link]", "w")
file2 = open("[Link]", "w")
file3 = open("[Link]", "w")
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
else:
if [Link]('b'):
[Link](accession + "\n")
else:
[Link](accession + "\n")
This works, but is difficult to read we can quickly see that we need an extra level
of indentation for every additional choice we want to include. To get round this,
127
Python has an elif statement, which merges together else and if and allows us
to rewrite the above example in a much more elegant way:
file1 = open("[Link]", "w")
file2 = open("[Link]", "w")
file3 = open("[Link]", "w")
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
elif [Link]('b'):
[Link](accession + "\n")
else:
[Link](accession + "\n")
Notice how this version of the code only needs two levels of indention. In fact,
using elif we can have any number of branches and still only require a single
extra level of indentation:
for accession in accs:
if [Link]('a'):
[Link](accession + "\n")
elif [Link]('b'):
[Link](accession + "\n")
elif [Link]('c'):
[Link](accession + "\n")
elif [Link]('d'):
[Link](accession + "\n")
elif [Link]('e'):
[Link](accession + "\n")
else:
[Link](accession + "\n")
128
while loops
Here's one final thing we can do with conditions: use them to determine when to
exit a loop. In chapter 4 we learned about loops that iterate over a collection of
items (like a list, a string or a file). Python has another type of loop called a while
loop. Rather than running a set number of times, a while loop runs until some
condition is met. For example, here's a bit of code that increments a count variable
by one each time round the loop, stopping when the count variable reaches ten:
count = 0
while count<10:
print(count)
count = count + 1
Because normal loops in Python are so powerful1, while loops are used much less
frequently than in other languages, so we won't discuss them further.
but this brings in an extra, unneeded level of indention. A better way is to join up
the two condition with and to make a complex expression:
E.g. the example code here could be better accomplished with a range.
129
This version is nicer in two ways: it doesn't require the extra level of indentation,
and the condition reads in a very natural way. We can also use or to join up two
conditions, to produce a complex condition that will be true if either of the two
simple conditions are true:
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for accession in accs:
if [Link]('a') or [Link]('b'):
print(accession)
We can even join up complex conditions to make more complex conditions here's
an example which prints accessions if they start with either "a" or "b" and end with
"4":
accs = ['ab56', 'bh84', 'hv76', 'ay93', 'ap97', 'bd72']
for acc in accs:
if ([Link]('a') or [Link]('b')) and [Link]('4'):
print(acc)
130
131
print(is_at_rich("ATTATCTACTA"))
print(is_at_rich("CGGCAGCGCT"))
The output shows that the function returns True or False just like the other
conditions we've been looking at:
True
False
Because the last four lines of our function are devoted to evaluating a condition
and returning True or False, we can write a slightly more compact version. In this
example we evaluate the condition, and then return the result right away:
def is_at_rich(dna):
length = len(dna)
a_count = [Link]().count('A')
t_count = [Link]().count('T')
at_content = (a_count + t_count) / length
return at_content > 0.65
This is a little more concise, and also easier to read once you're familiar with the
idiom.
Recap
In this short chapter, we've dealt with two things: conditions, and the statements
that use them.
132
We've seen how simple conditions can be joined together to make more complex
ones, and how the concepts of truth and falsehood are built in to Python on a
fundamental level. We've also seen how we can incorporate True and False in our
own functions in a way that allows them to be used as part of conditions.
We've been introduced to four different tools that use conditions if, else, elif,
and while in approximate order of usefulness. You'll probably find, in the
programs that you write and in your solutions to the exercises in this book, that
you use if and else very frequently, elif occasionally, and while almost never.
133
Exercises
In the chapter_6 folder in the exercises download, you'll find a text file called
[Link], containing some made-up data for a number of genes. Each line contains
the following fields for a single gene in this order: species name, sequence, gene
name, expression level. The fields are separated by commas (hence the name of the
file csv stands for Comma Separated Values). Think of it as a representation of a
table in a spreadsheet each line is a row, and each field in a line is a column. All
the exercises for this chapter use the data read from this file.
Reminder: if you're using Python 2 rather than Python 3, include this line at the
top of your programs:
from __future__ import division
Several species
Print out the gene names for all genes belonging to Drosophila melanogaster or
Drosophila simulans.
Length range
Print out the gene names for all genes between 90 and 110 bases long.
AT content
Print out the gene names for all genes whose AT content is less than 0.5 and whose
expression level is greater than 200.
134
Complex condition
Print out the gene names for all genes whose name begins with "k" or "h" except
those belonging to Drosophila melanogaster.
135
Solutions
Several species
These exercises are somewhat more complicated than previous ones, and they're
going to require material from multiple different chapters to solve. The first
problem is to deal with the format of the data file. Open it up in a text editor and
take a look before continuing.
We know that we're going to have to open the file (chapter 3) and process the
contents line-by-line (chapter 4). To deal with each line, we'll have to split it to
make a list of columns (chapter 4), then apply the condition (this chapter) in order
to figure out whether or not we should print it. Here's a program that will read each
line from the file, split it using commas as the delimiter, then assign each of the
four columns to a variable and print the gene name:
data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
print(name)
Notice that we use rstrip to remove the newline from the end of the current line
before splitting it. We know the order of the fields in the line because they were
mentioned in the exercise description, so we can easily assign them to the four
variables. This program doesn't do anything useful, but we can check the output to
confirm that it gets the names right:
136
kdy647
jdg766
kdy533
hdt739
hdu045
teg436
Now we can add in the condition. We want to print the name if the species is either
Drosophila melanogaster or Drosophila simulans. If the species name is neither of
those two, then we don't want to do anything. This is a yes/no type decision, so we
need an if statement:
data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if species == "Drosophila melanogaster" or species == "Drosophila
simulans":
print(name)
The line containing the if statement is quite long, so it wraps around onto the next
line on this page, but it's still just a single line in the program file. We can check the
output we get:
kdy647
jdg766
kdy533
against the contents of the file, and confirm that the program is working.
137
Length range
We can re-use a large part of the code from the previous exercise to help solve this
one. We have another complex condition: we only want to print names for genes
whose length is between 90 and 110 bases in other words, genes whose length is
greater than 90 and less than 110. We'll have to calculate the length using the len
function. Once we've done that the rest of the program is quite straightforward:
data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if len(sequence) > 90 and len(sequence) < 110:
print(name)
AT content
This exercise has a complex condition like the others, but it also requires us to do a
bit more calculation we need to be able to calculate the AT content of each
sequence. Rather than starting from scratch, we'll simply use the function that we
wrote in the previous chapter and include it at the start of the program. Once we've
done that, it's just a case of using the output from get_at_content as part of
the condition:
138
Complex condition
There are no calculations to carry out for this exercise the complexity comes from
the fact that there are three components to the condition, and they have to be
joined together in the right way:
data = open("[Link]")
for line in data:
columns = [Link]("\n").split(",")
species = columns[0]
sequence = columns[1]
name = columns[2]
expression = columns[3]
if ([Link]('k') or [Link]('h')) and species !=
"Drosophila melanogaster":
print(name)
The line containing the if statement is quite long, so it wraps around onto the next
line on this page, but it's still just a single line in the program file. There are two
139
different ways to express the requirement that the name is not Drosophila
melanogaster. In the above example we've used the not-equals sign (!=) but we
could also have used the not boolean operator:
if ([Link]('k') or [Link]('h')) and not species ==
"Drosophila melanogaster":
140
has
has
has
has
has
has
high AT content
medium AT content
medium AT content
low AT content
medium AT content
medium AT content
141
7:
Regular expressions
protein domains
runs of mononucleotides
However, it's not just sequence data that can have interesting patterns. As we
discussed in chapter 3, most of the other types of data we have to deal with in
biology comes in the form of strings1 inside text files things like:
taxonomic names
gene names
BLAST searches
Note that although many of the things in this list are numerical data, they're still read in to Python
programs as strings and need to be manipulated as such.
142
In previous chapters, we've looked at some programming tasks that involve pattern
recognition in strings. We've seen how to count individual amino acid residues (and
even groups of amino acid residues) in protein sequences (chapter 5), and how to
identify restriction enzyme cut sites in DNA sequences (chapter 2). We've also seen
how to examine parts of gene names and match them against individual characters
(chapter 6).
The common theme among all these problems is that they involve searching for a
fixed set of characters. But there are many problems that we want to solve that
require more flexible patterns. For example:
Given a gene accession name, extract the part between the third character
and the underscore
1
2
143
Modules in Python
The functions and data types that we've discussed so far in this book have been
ones that are likely to be needed in pretty much every program tools for dealing
with strings and numbers, for reading and writing files, and for manipulating lists
of data. As such, they are automatically made available when we start to create a
Python program. If we want to open a file, we simply write a statement that uses
the open function.
However, there's another category of tools in Python which are more specialized.
Regular expressions are one example, but there is a large list of specialized tools
which are very useful when you need them1, but are not likely to be needed for the
majority of programs. Examples include tools for doing advanced mathematical
calculations, for downloading data from the web, for running external programs,
and for manipulating date/time information. Each collection of specialized tools
really just a collection of specialized functions and data types is called a module.
For reasons of efficiency, Python doesn't automatically make these modules
available in each new program, as it does with the more basic tools. Instead, we
have to explicitly load each module of specialized tools that we want to use inside
our program. To load a module we use the import statement2. For example, the
module that deals with regular expressions is called re, so if we want to write a
program that uses the regular expression tools we must include the line:
import re
at the top of our program. When we then want to use one of the tools from a
module, we have to prefix it with the module name3. For example, to use the
1
2
3
144
regular expression search function (which we'll discuss later in this chapter) we
have to write:
[Link](pattern, string)
If we forget to import the module which we want to use, or forget to include the
module name as part of the function call, we will get a NameError.
We'll encounter various other module in the rest of this book. For the rest of this
chapter specifically, all code examples will require the import re statement in
order to work. For clarity, we won't include it, so if you want try running any of the
code in this chapter, you'll need to add it at the top.
Raw strings
Writing regular expression patterns, as we'll see in the very next section of this
chapter, requires us to type a lot of special characters. Recall from chapter 2 that
certain combinations of characters are interpreted by Python to have special
meaning. For example, \n means start a new line, and \t means insert a tab
character.
Unfortunately, there are a limited number of special characters to go round, so
some of the characters that have a special meaning in regular expressions clash
with the characters that already have a special meaning. Python's way round this
problem is to have a special rule for strings: if we put the letter r immediately
before the opening quotation mark, then any special characters inside the string
are ignored:
145
print(r"\t\n")
The r stands for raw, which is Python's description for a string where special
characters are ignored. Notice that the r goes outside the quotation marks it is
not part of the string itself. We can see from the output that the above code prints
out the string just as we've written it:
\t\n
without any tabs or new lines. You'll see this special raw notation used in all the
regular expression code examples in this chapter.
Notice that we've used the raw notation for the pattern, even though it's not strictly
necessary as it doesn't contain any special characters.
Alternation
The above example isn't particularly interesting, as the restriction motif has no
variation. Let's try it with the AvaII motif, which cuts at two different motifs:
146
GGACC and GGTCC. We can use the techniques we learned in the previous chapter
to make a complex condition using or:
dna = "ATCGCGAATTCAC"
if [Link](r"GGACC", dna) or [Link](r"GGTCC", dna):
print("restriction site found!")
But a better way is to capture the variation in the AvaII site using a regular
expression:
dna = "ATCGCGAATTCAC"
if [Link](r"GG(A|T)CC", dna):
print("restriction site found!")
Here we're using the alternation feature of regular expressions. Inside parentheses,
we write the alternatives separated by a pipe character, so (A|T) means either A or
T. This lets us write a single pattern GG(A|T)CC which captures the variation
in the motif.
Character groups
The BisI restriction enzyme cuts at an even wider range of motifs the pattern is
GCNGC, where N represents any base. We can use the same alternation technique
to search for this pattern:
dna = "ATCGCGAATTCAC"
if [Link](r"GC(A|T|G|C)GC", dna):
print("restriction site found!")
However, there's another regular expression feature that lets us write the pattern
more concisely. A pair of square brackets with a list of characters inside them can
represent any one of these characters. So the pattern GC[ATGC]GC will match
147
GCAGC, GCTGC, GCGGC and GCCGC. Here's the same program using character
groups:
dna = "ATCGCGAATTCAC"
if [Link](r"GC[ATGC]GC", dna):
print("restriction site found!")
If we want a character in a pattern to match any character in the input, we can use
a period the pattern [Link] would match all four possibilities. However, the
period would also match any character which is not a DNA base, or even a letter.
Therefore, the whole pattern would also match GCFGC, GC&GC and GC9GC, which
may not be what we want.
Sometimes it's easier, rather than listing all the acceptable characters, to specify
the characters that we don't want to match. Putting a caret ^ at the start of a
character group like this [^XYZ] will negate it, and match any character that isn't in
the group.
Quantifiers
The regular expression features discussed above let us describe variation in the
individual characters of patterns. Another group of features, quantifiers, let us
describe variation in the number of times a section of a pattern is repeated.
A question mark immediately following a character means that that character is
optional it can match either zero or one times. So in the pattern GAT?C the T is
optional, and the pattern will match either GATC or GAC. If we want to apply a
question mark to more than one character, we can group the characters in
parentheses. For example, in the pattern GGG(AAA)?TTT the group of three As is
optional, so the pattern will match either GGGAAATTT or GGGTTT.
A plus sign immediately following a character or group means that the character or
group must be present but can be repeated any number of times in other words,
148
it will match one or more times. For example, the pattern GGGA+TTT will match
three Gs, followed by one or more As, followed by three Ts. So it will match
GGGATTT, GGGAATT, GGGAAATT, etc. but not GGGTTT.
An asterisk immediately following a character or group means that the character or
group is optional, but can also be repeated. In other words, it will match zero or
more times. For example, the pattern GGGA*TTT will match three Gs, followed by
zero or more As, followed by three Ts. So it will match GGGTTT, GGGATTT,
GGGAATTT, etc.
If we want to specify a specific number of repeats, we can use curly brackets.
Following a character or group with a single number inside curly brackets will
match exactly that number of repeats. For example, the pattern GA{5}T will match
GAAAAAT but not GAAAAT or GAAAAAAT. Following a character or group with a
pair of numbers inside curly brackets separated with a comma allows us to specify
an acceptable range of number of repeats. For example, the pattern GA{2,4}T will
match GAAT, GAAAT and GAAAAT but not GAT or GAAAAAT.
Positions
The final set of regular expression tools we're going to look at don't represent
characters at all, but rather positions in the input string. The caret symbol ^
matches the start of a string, and the dollar symbol $ matches the end of a string.
The pattern ^AAA will match AAATTT but not GGGAAATTT. The pattern GGG$ will
match AAAGGG but not AAAGGGCCC.
149
Combining
The real power of regular expressions comes from combining these tools. We can
use quantifiers together with alternations and character groups to specify very
flexible patterns. For example, here's a complex pattern to identify full-length
eukaryotic messenger RNA sequences:
^ATG[ATGC]{30,1000}A{5,10}$
As you can see, regular expressions can be quite tricky to read until you're familiar
with them! However, it's well worth investing a bit of time learning to use them, as
the same notation is used across multiple different tools. The regular expression
skills that you learn in Python are transferable to other programming languages,
command line tools, and text editors.
The features we've discussed above are the ones most useful in biology, and are
sufficient to tackle all the exercises at the end of the chapter. However, there are
many more regular expression features available in Python. If you want to become
a regular expression master, it's worth reading up on greedy vs. minimal quantifiers,
back-references, lookahead and lookbehind assertions, and built-in character classes.
Before we move on to look at some more sophisticated uses of regular expressions,
it's worth noting that there's a method similar to [Link] called [Link].
The difference is that [Link] will identify a pattern occurring anywhere in
the string, whereas [Link] will only identify a pattern if it matches the entire
string. Most of the time we want the former behaviour.
150
In the above code, we're searching inside a DNA sequence for GA, followed by three
bases, followed by AC. By calling the group method on the resulting match object,
If a match isn't found, then the same thing applies; the function doesn't return False, but a different
built-in value None that evaluates as false. If this doesn't make sense, don't worry.
151
we can see the part of the DNA sequence that matched, and figure out what the
middle three bases were:
GACGTAC
What if we want to extract more than one bit of the pattern? Say we want to match
this pattern:
GA[ATGC]{3}AC[ATGC]{2}AC
That's GA, followed by three bases, followed by AC, followed by two bases, followed
by AC again. We can surround the bits of the pattern that we want to extract with
parentheses this is called capturing it:
GA([ATGC]{3})AC([ATGC]{2})AC
We can now refer to the captured bits of the pattern by supplying an argument to
the group method. group(1) will return the bit of the string matched by the
section of the pattern in the first set of parentheses, group(2) will return the bit
matched by the second, etc.:
dna = "ATGACGTACGTACGACTG"
# store the match object in the variable m
m = [Link](r"GA([ATGC]{3})AC([ATGC]{2})AC", dna)
print("entire match: " + [Link]())
print("first bit: " + [Link](1))
print("second bit: " + [Link](2))
The output shows that the three bases in the first variable section were CGT, and
the two bases in the second variable section were GT:
152
Remember that we start counting from zero, so in this case, the match starting at
the third base has a start position of two:
start: 2
end: 13
We can get the start and end positions of individual groups by supplying a number
as the argument to start and end:
dna = "ATGACGTACGTACGACTG"
m = [Link](r"GA([ATGC]{3})AC([ATGC]{2})AC", dna)
print("start: " + str([Link]()))
print("end: " + str([Link]()))
print("group one start: " + str([Link](1)))
print("group one end: " + str([Link](1)))
print("group two start: " + str([Link](2)))
print("group two end: " + str([Link](2)))
153
In this particular case, we could figure out the start and end positions of the
individual groups from the start and end positions of the whole pattern:
start: 2
end: 13
group one
group one
group two
group two
start: 4
end: 7
start: 9
end: 11
but that might not always be possible for patterns that have variable length
repeats.
Recall that putting a caret ^ at the start of a character group negates it. The output
shows how the function works the return value is a list of strings:
['ACT', 'GCAT', 'GCTACGT', 'ACGAT', 'CGA', 'TCG']
154
Notice that the return value of the findall method is not a match object it is a
straightforward list of strings:
['ATTATAT', 'AAATTATA']
155
Recap
Just as in the previous chapter, we learned about two distinct concepts (conditions,
and the statements that use them) in this chapter we learned about regular
expressions, and the functions that use them.
We started with a brief introduction to two concepts that, while not part of the
regular expression tools, are necessary in order to use them libraries and raw
strings. We got a far-from-complete overview of features that can be used in regular
expression patterns, and a quick look at the range of different things we can do
with them. Just as regular expressions themselves can range from simple to
complex, so can their uses. We can use regular expressions for simple tasks like
determining whether or not a sequence contains a particular motif, or for
complicated ones like identifying messenger RNA sequences by using complex
patterns.
Before we move on to the exercises, it's important to recognize that for any given
pattern, there are probably multiple ways to describe it using a regular expression.
Near the start of the chapter, we came up with the pattern GG(A|T)CC to describe
the AvaII restriction enzyme recognition site, but it could also be written as
GG[AT]CC,
(GGACC|GGTCC)
(GGA|GGT)CC
G{2}[AT]C{2}
156
As with other situations where there are multiple different ways to write the same
thing, it's best to be guided by what is clearest to read.
157
Exercises
Accession names
Here's a list of made-up gene accession names:
xkn59438, yhdck2, eihd39d9, chdsye847, hedle3455, xjhd53e, 45da, de37dp
Write a program that will print only the accession names that satisfy the following
criteria treat each criterion separately:
contain the letters d and e in that order with a single letter between them
start with x or y
Double digest
In the chapter_7 file inside the exercises download, there's a file called [Link]
which contains a made-up DNA sequence. Predict the fragment lengths that we will
get if we digest the sequence with two made-up restriction enzymes AbcI, whose
recognition site is ANT*AAT, and AbcII, whose recognition site is GCRW*TG
(asterisks indicate the position of the cut site).
158
Solutions
Accession names
Obviously, the bulk of the work here is going to be coming up with the regular
expression patterns to select each subset of the accession names. Here's the easy
bit storing the accession names in a list and then processing them in a loop (the
first line wraps round because it's too long to fit on the page):
accs = ["xkn59438", "yhdck2", "eihd39d9", "chdsye847", "hedle3455",
"xjhd53e", "45da", "de37dp"]
for acc in accs:
# print if it passes the test
Now we can tackle the different criteria one by one. For each example, the code
(bordered by solid lines) is followed immediately by the output (bordered by dotted
lines).
The first criterion is straightforward accessions that contain the number 5. We
don't even have to use any fancy regular expression features:
for acc in accs:
if [Link](r"5", acc):
print("\t" + acc)
xkn59438
hedle3455
xjhd53e
45da
Now for accessions that contain the letters d or e. We can use either alternation or a
character group. Here's a solution using alternation:
159
yhdck2
eihd39d9
chdsye847
hedle3455
xjhd53e
45da
de37dp
The next one accessions that contain both the letters d and e, in that order is a
bit more tricky. We can't just use a simple alternation or a character group, because
they match any of their constituent parts, and we need both d and e. One way to
think of the pattern is d, followed by some other letters and numbers, followed by e.
We have to be careful with our quantifiers, however at first glance the pattern
d.+e looks good, but it will fail to match the accession where e follows d directly.
To allow for the fact that d might be immediately followed by e, we need to use the
asterisk:
for acc in accs:
if [Link](r"d.*e", acc):
print("\t" + acc)
chdsye847
hedle3455
xjhd53e
de37dp
160
hedle3455
The next requirement d and e in any order is more difficult. We could do it with
an alternation using the pattern (d.*e|e.*d), which translates as d then e, or e
then d. In this case, I think it's clearer to carry out two separate regular expression
searches and combine them into a complex condition:
for acc in accs:
if [Link](r"d.*e", acc) or [Link](r"e.*d", acc):
print("\t" + acc)
hedle3455
de37dp
xkn59438
yhdck2
xjhd53e
161
We can modify this quite easily to add the requirement that the accession ends
with e. As before, we need to use .* in the middle to match any number of any
character, resulting in quite a complex pattern:
for acc in accs:
if [Link](r"^(x|y).*e$", acc):
print("\t" + acc)
xjhd53e
To match three or more numbers in a row, we need a more specific quantifier the
curly brackets and a character group which contains all the numbers:
for acc in accs:
if [Link](r"[0123456789]{3,100}", acc):
print("\t" + acc)
xkn59438
chdsye847
hedle3455
We can actually make this a bit more concise. The character group of all digits is
such a common one that there's a built-in shorthand for it: \d. We can also take
advantage of a shorthand in the curly bracket quantifier if we leave off the upper
bound, then it matches with no upper limit. The more concise version:
for acc in accs:
if [Link](r"\d{3,}", acc):
print("\t" + acc)
162
xkn59438
chdsye847
hedle3455
The final requirement is quite simple and only requires a character group and an
end-of-string anchor to solve:
for acc in accs:
if [Link](r"d[arp]$", acc):
print("\t" + acc)
45da
de37dp
Double digest
This is a hard problem, and there are several ways to approach it. Let's simplify it by
first figuring out what the fragment lengths would be if we digested the sequence
with just a single restriction enzyme1. We'll open and read the file all in one go
(there's no need to process it line-by-line as it's just a single sequence), then we'll
use [Link] to figure out the positions of all the cut sites.
The patterns themselves are relatively simple: N means any base, so the pattern for
the AbcI site is A[ATGC]TAAT. The ambiguity code R means A or G and the code W
means A or T, so the pattern for AbcII is GC[AG][AT]TG. Here's the code to
calculate the start positions of the matches for AbcI:
For the purposes of this exercise, we are of course ignoring all the interesting chemical kinetics of
restriction enzymes and assuming that all enzymes cut with complete specificity and efficiency.
163
import re
dna = open("[Link]").read().rstrip("\n")
print("AbcI cuts at:")
for match in [Link](r"A[ATGC]TAAT", dna):
print([Link]())
but it's not quite right it's telling us the positions of the start of each match, but
the enzyme actually cuts 3 base pairs upstream of the start. To get the position of
the cut site, we need to add three to the start of each match:
import re
dna = open("[Link]").read().rstrip("\n")
print("AbcI cuts at:")
for match in [Link](r"A[ATGC]TAAT", dna):
print([Link]() + 3)
Now we've got the cut positions, how are we going to work out the fragment sizes?
One way is to go through each cut site in order and measure the distance between
it and the previous one that will give us the length of a single fragment. To make
this work we'll have to add "imaginary" cut sites at the very start and end of the
sequence:
164
1
2
3
4
5
6
7
import re
dna = open("[Link]").read().rstrip("\n")
all_cuts = [0]
for match in [Link](r"A[ATGC]TAAT", dna):
all_cuts.append([Link]() + 3)
all_cuts.append(len(dna))
print(all_cuts)
Now we can write a second loop to go through the all_cuts list and, for each cut
position, work out the size of the fragment that will be created by figuring out the
distance to the previous cut site (i.e. the previous element in the list). To make this
work, however, we can't just use a normal loop we have to start at the second
element of the list (because the first element has no previous element) and we have
to work with the index of each element, rather than the element itself. We'll use the
range function to generate the list of indexes that we want to process we need to
go from index 1 (i.e. the second element of the list) to the last index (which is the
length of the list):
165
1 for i in range(1,len(all_cuts)):
2
this_cut_position = all_cuts[i]
3
previous_cut_position = all_cuts[i-1]
4
fragment_size = this_cut_position - previous_cut_position
5
print("one fragment size is " + str(fragment_size))
The loop variable i is used to store each value that is generated by the range
function (line 1). For each value of i we get the cut position at that index (line 2)
and the cut position at the previous index (line 3) and then figure out the distance
between them (line 4). The output shows how, for two cuts, we get three
fragments:
one fragment size is 1143
one fragment size is 485
one fragment size is 384
Now for the final part of the solution: how do we do the same thing for two
different enzymes? We can add in the second enzyme pattern with the appropriate
cut site offset and append the cut positions to the all_cuts variable:
import re
dna = open("[Link]").read().rstrip("\n")
all_cuts = [0]
# add cut positions for AbcI
for match in [Link](r"A[ATGC]TAAT", dna):
all_cuts.append([Link]() + 3)
# add cut positions for AbcII
for match in [Link](r"GC[AG][AT]TG", dna):
all_cuts.append([Link]() + 4)
# add the final position
all_cuts.append(len(dna))
print(all_cuts)
166
We get zero, then the two cut positions for the first enzyme in ascending order,
then the two cut positions for the second enzyme in ascending order, then the
position of the end of the sequence. The method for turning a list of cut positions
into fragment sizes that we developed above isn't going to work with this list,
because it relies on the list of positions being in ascending order. If we try it with
the list of cut positions produced by the above code, we'll end up with obviously
incorrect fragment sizes:
one
one
one
one
one
fragment
fragment
fragment
fragment
fragment
size
size
size
size
size
is
is
is
is
is
1143
485
-1140
1089
434
Happily, Python's built-in sort function can come to the rescue. All we need to do
is sort the list of cut positions before processing it, and we get the right answers.
Here's the complete, final code:
167
import re
dna = open("[Link]").read().rstrip("\n")
print(str(len(dna)))
all_cuts = [0]
# add cut positions for AbcI
for match in [Link](r"A[ATGC]TAAT", dna):
all_cuts.append([Link]() + 3)
# add cut positions for AbcII
for match in [Link](r"GC[AG][AT]TG", dna):
all_cuts.append([Link]() + 4)
# add the final position
all_cuts.append(len(dna))
sorted_cuts = sorted(all_cuts)
print(sorted_cuts)
for i in range(1,len(sorted_cuts)):
this_cut_position = sorted_cuts[i]
previous_cut_position = sorted_cuts[i-1]
fragment_size = this_cut_position - previous_cut_position
print("one fragment size is " + str(fragment_size))
168
8:
Chapter 8: Dictionaries
Dictionaries
How will our code change if we want to generate a complete list of base counts for
the sequence? We'll add a new variable for each base:
dna = "ATCGATCGATCGTACGCTGA"
a_count = [Link]("A")
t_count = [Link]("T")
g_count = [Link]("G")
c_count = [Link]("C")
and now our code is starting to look rather repetitive. It's not too bad for the four
individual bases, but what if we want to generate counts for the 16 dinucleotides:
dna = "ATCGATCGATCGTACGCTGA"
aa_count = [Link]("AA")
at_count = [Link]("AT")
ag_count = [Link]("AG")
...etc. etc.
or the 64 trinucleotides:
169
Chapter 8: Dictionaries
dna = "ATCGATCGATCGTACGCTGA"
aaa_count = [Link]("AAA")
aat_count = [Link]("AAT")
aag_count = [Link]("AAG")
...etc. etc.
For trinucleotides and longer, the situation is particularly bad. The DNA sequence
is 20 bases long, so it only contains 18 overlapping trinucleotides in total. This
means that we'll end up with 64 different variables, at least 46 of which will hold
the value zero.
One possible way round this is to store the values in a list. If we use three nested
loops, we can generate all possible trinucleotides, calculate the count for each one,
and store all the counts in a list:
dna = "AATGATCGATCGTACGCTGA"
all_counts = []
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
print("count is " + str(count) + " for " + trinucleotide)
all_counts.append(count)
print(all_counts)
170
Chapter 8: Dictionaries
Although the code is above is quite compact, and doesn't require huge numbers of
variables, the output shows two problems with this approach:
count is 0 for AAA
count is 1 for AAT
count is 0 for AAG
count is 0 for AAC
count is 0 for ATA
count is 0 for ATT
count is 1 for ATG
count is 2 for ATC
many lines removed
[0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0,
2, 0, 0, 0, 0, 0, 2, 0, 0, 2, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0,
0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0]
Firstly, the data are still incredibly sparse the vast majority of the counts are zero.
Secondly, the counts themselves are now disconnected from the trinucleotides. If
we want to look up the count for a single trinucleotide for example, TGA we
first have to figure out that TGA was the 25th trinucleotide generated by our loops.
Only then can we get the element at the correct index:
print("count for TGA is " + str(all_counts[24]))
171
Chapter 8: Dictionaries
We can try various tricks to get round this problem. What if we generated two lists
one of counts, and one of the trinucleotides themselves?
dna = "AATGATCGATCGTACGCTGA"
all_trinucleotides = []
all_counts = []
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
all_trinucleotides.append(trinucleotide)
all_counts.append(count)
print(all_counts)
print(all_trinucleotides)
Now we have two lists of the same length, with a one-to-one correspondence
between the elements:
[0, 1, 0, 0, 0, 0, 1, 2, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 1, 0, 0, 0, 0,
2, 0, 0, 0, 0, 0, 2, 0, 0, 2, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0,
0, 0, 0, 0, 0, 1, 0, 1, 1, 0, 1, 0, 0, 0, 0]
['AAA', 'AAT', 'AAG', 'AAC', 'ATA', 'ATT', 'ATG', 'ATC', 'AGA', 'AGT',
'AGG', 'AGC', 'ACA', 'ACT', 'ACG', 'ACC', 'TAA', 'TAT', 'TAG', 'TAC',
'TTA', 'TTT', 'TTG', 'TTC', 'TGA', 'TGT', 'TGG', 'TGC', 'TCA', 'TCT',
'TCG', 'TCC', 'GAA', 'GAT', 'GAG', 'GAC', 'GTA', 'GTT', 'GTG', 'GTC',
'GGA', 'GGT', 'GGG', 'GGC', 'GCA', 'GCT', 'GCG', 'GCC', 'CAA', 'CAT',
'CAG', 'CAC', 'CTA', 'CTT', 'CTG', 'CTC', 'CGA', 'CGT', 'CGG', 'CGC',
'CCA', 'CCT', 'CCG', 'CCC']
This allows us to look up the count for a given trinucleotide in a slightly more
appealing way we can look up the index of the trinucleotide in the
all_trinucleotides list, then get the count at the same index in the
all_counts list:
172
Chapter 8: Dictionaries
i = all_trinucleotides.index('TGA')
c = all_counts[i]
print('count for TGA is ' + str(c))
This is a little bit nicer, but still has major drawbacks. We're still storing all those
zeros, and now we have two lists to keep track of. We need to be incredibly careful
when manipulating either of the two lists to make sure that they stay perfectly
synchronized if we make any change to one list but not the other, then there will
no longer be a one-to-one correspondence between elements and we'll get the
wrong answer when we try to look up a count.
This approach is also slow1. To find the index of a given trinucleotide in the
all_trinucleotides list, Python has to look at each element one at a time until
it finds the one we're looking for. This means that as the size of the list grows2, the
time taken to look up the count for a given element will grow alongside it.
If we take a step back and think about the problem in more general terms, what we
need is a way of storing pairs of data (in this case, trinucleotides and their counts)
in a way that allows us to efficiently look up the count for any given trinucleotide.
This problem of storing paired data is incredibly common in programming. We
might want to store:
1
2
As a rule, we've avoided talking about performance in this book, but we'll break the rule in this case.
For instance, imagine carrying out the same exercise with the approximately one million unique 10-mers.
173
Chapter 8: Dictionaries
All these are examples of what we call key-value pairs. In each case we have pairs of
keys and values:
Key
trinucleotide
name
name
codon
name
sample
word
Value
count
protein sequence
restriction enzyme motif
amino acid residue
email address
coordinates
definition
The last example in this table words and their definitions is an interesting one
because we have a tool in the physical world for storing this type of data a
dictionary. Python's tool for solving this type of problem is also called a dictionary
(usually abbreviated to dict) and in this chapter we'll see how to create and use
them.
Creating a dictionary
The syntax for creating a dictionary is similar to that for creating a list, but we use
curly brackets rather than square ones. Each pair of data, consisting of a key and a
value, is called an item. When storing items in a dictionary, we separate them with
commas. Within an individual item, we separate the key and the value with a colon.
Here's a bit of code that creates a dictionary of restriction enzymes (using data
from the previous chapter) with three items:
enzymes = { 'EcoRI':r'GAATTC', 'AvaII':r'GG(A|T)CC', 'BisI':'GC[ATGC]GC' }
174
Chapter 8: Dictionaries
In this case, the keys and values are both strings1. Splitting the dictionary
definition over several lines makes it easier to read:
enzymes = {
'EcoRI' : r'GAATTC',
'AvaII' : r'GG(A|T)CC',
'BisI' : r'GC[ATGC]GC'
}
but doesn't affect the code at all. To retrieve a bit of data from the dictionary i.e.
to look up the motif for a particular enzyme we write the name of the dictionary,
followed by the key in square brackets:
print(enzymes['BisI'])
The code looks very similar to using a list, but instead of giving the index of the
element we want, we're giving the key for the value that we want to retrieve.
Dictionaries are a very useful way to store data, but they come with some
restrictions. The only types of data we are allowed to use as keys are strings and
numbers2, so we can't, for example, create a dictionary where the keys are file
objects. Values can be whatever type of data we like. Also, keys must be unique
we can't store multiple values for the same key.
In real-life programs, it's relatively rare that we'll want to create a dictionary all in
one go like in the example above. More often, we'll want to create an empty
dictionary, then add key/value pairs to it (just as we often create an empty list and
then add elements to it).
To create an empty dictionary we simply write a pair of curly brackets on their own,
and to add elements, we use the square-brackets notation on the left-hand side of
1
2
The values are actually raw strings, but that's not important.
Not strictly true; we can use any immutable type, but that is beyond the scope of this book.
175
Chapter 8: Dictionaries
an assignment. Here's a bit of code that stores the restriction enzyme data one item
at a time:
enzymes = {}
enzymes['EcoRI'] = r'GAATTC'
enzymes['AvaII] = r'GG(A|T)CC'
enzymes['BisI'] = r'GC[ATGC]GC'
We can delete a key from a dictionary using the pop method. pop actually returns
the value and deletes the key at the same time:
enzymes = {
'EcoRI' : r'GAATTC',
'AvaII' : r'GG(A|T)CC',
'BisI' : r'GC[ATGC]GC'
}
# remove the EcoRI enzyme from the dict
[Link]('EcoRI')
Let's take another look at the trinucleotide count example from the start of the
chapter. Here's how we store the trinucleotides and their counts in a dictionary:
dna = "AATGATCGATCGTACGCTGA"
counts = {}
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
counts[trinucleotide] = count
print(counts)
We can see from the output that the trinucleotides and their counts are stored
together in one variable:
176
Chapter 8: Dictionaries
We still have a lot of repetitive counts of zero, but looking up the count for a
particular trinucleotide is now very straightforward:
print(counts['TGA'])
We no longer have to worry about either "memorizing" the order of the counts or
maintaining two separate lists.
Let's now see if we can find a way of avoiding storing all those zero counts. We can
add an if statement that ensures that we only store a count if it's greater than
zero:
dna = "AATGATCGATCGTACGCTGA"
counts = {}
for base1 in ['A', 'T', 'G', 'C']:
for base2 in ['A', 'T', 'G', 'C']:
for base3 in ['A', 'T', 'G', 'C']:
trinucleotide = base1 + base2 + base3
count = [Link](trinucleotide)
if count > 0:
counts[trinucleotide] = count
print(counts)
177
Chapter 8: Dictionaries
When we look at the output from the above code, we can see that the amount of
data we're storing is much smaller just the counts for the trinucleotides that are
greater than zero:
{'ATG': 1, 'ACG': 1, 'ATC': 2, 'GTA': 1, 'CTG': 1, 'CGC': 1, 'GAT': 2,
'CGA': 1, 'AAT': 1, 'TGA': 2, 'GCT': 1, 'TAC': 1, 'TCG': 2, 'CGT': 1}
Now we have a new problem to deal with. Looking up the count for a given
trinucleotide works fine when the count is positive:
print(counts['TGA'])
But when the count is zero, the trinucleotide doesn't appear as a key in the
dictionary:
print(counts['AAA'])
There are two possible ways to fix this. We can check for the existence of a key in a
dictionary (just like we can check for the existence of an element in a list), and only
try to retrieve it once we know it exists:
if 'AAA' in counts:
print(counts('AAA'))
178
Chapter 8: Dictionaries
Alternatively, we can use the dictionary's get method. get usually works just like
using square brackets: the following two lines do exactly the same thing:
print(counts['TGA'])
print([Link]('TGA'))
The thing that makes get really useful, however, is that it can take an optional
second argument, which is the default value to be returned if the key isn't present
in the dictionary. In this case, we know that if a given trinucleotide doesn't appear
in the dictionary then its count is zero, so we can give zero as the default value and
use get to print out the count for any trinucleotide:
print("count
print("count
print("count
print("count
for
for
for
for
TGA
AAA
GTA
TTT
is
is
is
is
"
"
"
"
+
+
+
+
str([Link]('TGA',
str([Link]('AAA',
str([Link]('GTA',
str([Link]('TTT',
0)))
0)))
0)))
0)))
As we can see from the output, we now don't have to worry about whether or not
each trinucleotide appears in the dictionary get takes care of everything and
returns zero when appropriate:
count
count
count
count
for
for
for
for
TGA
AAA
GTA
TTT
is
is
is
is
2
0
1
0
179
Chapter 8: Dictionaries
But it seems inefficient to go through the whole process of generating all possible
trinucleotides again, when the information we want the list of trinucleotides is
already in the dictionary. A better approach would be to read the list of keys
directly from the dictionary, which is what the keys method does.
180
Chapter 8: Dictionaries
print([Link]())
Looking at the output1 confirms that this is the list of trinucleotides we want to
consider (remember that we're looking for trinucleotides with a count of two, so we
don't need to consider ones that aren't in the dictionary as we already know that
they have a count of zero):
['ATG', 'ACG', 'ATC', 'GTA', 'CTG', 'CGC', 'GAT', 'CGA', 'AAT', 'TGA',
'GCT', 'TAC', 'TCG', 'CGT']
Using keys, our code for printing out all the trinucleotides that appear twice in the
DNA sequence becomes a lot more concise:
for trinucleotide in [Link]():
if [Link](trinucleotide) == 2:
print(trinucleotide)
This version prints exactly the same set of trinucleotides as the more verbose
method:
ATC
GAT
TGA
TCG
Before we move on, take a moment to compare the output immediately above this
paragraph with the output from the three-loop version from earlier in this section.
You'll notice that while the set of trinucleotides is the same, the order in which
they appear is different. This illustrates an important point about dictionaries
they are inherently unordered. That means that when we use the keys method to
1
If you're using Python 3 you might see slightly different output here, but all the code examples will work
just the same
181
Chapter 8: Dictionaries
iterate over a dictionary, we can't rely on processing the items in the same order
that we added them. This is in contrast to lists, which always maintain the same
order when looping. If we want to control the order in which keys are printed we
can use the sorted method to sort the list before processing it:
for trinucleotide in sorted([Link]()):
if [Link](trinucleotide) == 2:
print(trinucleotide)
We can use the items method to iterate over pairs of data, rather than just keys:
for key, value in my_dict.items():
# do something with key and value
The items method does something slightly different from all the other methods
we've seen so far in this book; rather than returning a single value, or a list of
values, it returns a list of pairs of values. That's why we have to give two variable
names at the start of the loop. Here's how we can use the items method to process
our dictionary of trinucleotide counts just like before:
182
Chapter 8: Dictionaries
Recap
We started this chapter by examining the problem of storing paired data in Python.
After looking at a couple of unsatisfactory ways to do it using tools that we've
already learned about, we introduced a new type of data structure the dictionary
which offers a much nicer solution to the problem of storing paired data.
Later in the chapter, we saw that the real benefit of using dictionaries is the
efficient lookup they provide. We saw how to create dictionaries and manipulate
the items in them, and several different ways to look up values for known keys. We
also saw how to iterate over all the items in dictionary.
In the process, we uncovered a few restrictions on what dictionaries are capable of
we're only allowed to use a couple of different data types for keys, they must be
unique, and we can't rely on their order. Just as a physical dictionary allows us to
rapidly look up the definition for a word but not the other way round, Python
dictionaries allow us to rapidly look up the value associated with a key, but not the
reverse.
183
Chapter 8: Dictionaries
Exercises
DNA translation
Write a program that will translate a DNA sequence into protein. Your program
should use the standard genetic code which can be found at this URL1.
[Link]
184
Chapter 8: Dictionaries
Solutions
DNA translation
The description of this exercise is very short, but it hides quite a bit of complexity!
To translate a DNA sequence we need to carry out a number of different steps. First,
we have to split up the sequence into codons. Then, we need to go through each
codon and translate it into the corresponding amino acid residue. Finally, we need
to create a protein sequence by adding all the amino acid residues together.
We'll start off by figuring out how to split a DNA sequence into codons. Because
this exercise is quite tricky, we'll pick a very short test DNA sequence to work on
just three codons:
dna = "ATGTTCGGT"
How are we going to split up the DNA sequence into groups of three bases? It's
tempting to try to use the split method, but remember that the split method
only works if the things you want to split are separated by a delimiter. In our case,
there's nothing separating the codons, so split will not help us.
Something that might be able to help us is substring notation. We know that this
allows us to extract part of a string, so we can do something like this:
dna = "ATGTTCGGT"
codon1 = dna[0:3]
codon2 = dna[3:6]
codon3 = dna[6:9]
print(codon1, codon2, codon3)
185
Chapter 8: Dictionaries
but it's not a great solution, as we have to fill in the numbers manually. Since the
numbers follow a very predictable pattern, it should be possible to generate them
automatically. The start position for each substring is initially zero, then goes up by
three for each successive codon. The stop position is just the start position plus
three.
Recall that the job of the range function is to generate sequences of numbers. In
order to generate the sequence of substring start positions, we need to use the
three-argument version of range, where the first argument is the number to start
at, the second argument is the number to finish at, and the third argument is the
step size. For our DNA sequence above, the number to start at is zero, and the step
size is three. The number to finish at it not six but seven, because ranges are
exclusive at the finish. This bit of code shows how we can use the range function
to generate the list of start positions:
for start in range(0,7,3):
print(start)
0
3
6
To find the stop position for a given start position we just add three, so we can
easily split our DNA into codons using a loop:
dna = "ATGTTCGGT"
for start in range(0,7,3):
codon = dna[start:start+3]
print("one codon is" + codon)
186
Chapter 8: Dictionaries
This works fine for our test DNA sequence, but if we give it a shorter sequence we
will get incomplete and empty codons:
dna = "ATGTT"
for start in range(0,7,3):
codon = dna[start:start+3]
print(codon)
and if we give it a longer sequence, we will miss out the fourth and subsequent
codons:
dna = "ATGTTCGGTGAAGCGGGCTAGAT"
for start in range(0,7,3):
codon = dna[start:start+3]
print("one codon is " + codon)
Clearly we need to modify the second argument to range the position to finish
the sequence of numbers in order to take into account the length of the DNA
sequence. At this point, we have to confront the problem of what to do if we're
given a DNA sequence whose length is not an exact multiple of three. Clearly, we
cannot translate an incomplete codon, so we want the start position of the final
187
Chapter 8: Dictionaries
codon to equal to the length of the DNA sequence minus two. This guarantees that
there will always be two more characters following the position of the final codon
start i.e. enough for a complete codon.
Here's the modified code:
dna = "ATGTTCGGT"
# calculate the start position for the final codon
last_codon_start = len(dna) 2
# process the dna sequence in three base chunks
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
print("one codon is " + codon)
Now that we know how to split a DNA sequence up into codons, let's turn our
attention to the problem of translating those codons. If we pull up the URL from
the exercise description in a web browser, we can see the standard codon
translation table in various formats. Storing this translation table seems like a
perfect job for a dictionary: we have codons (keys) and amino acid residues (values)
and we want to be able to look up the amino acid for a given codon.
188
Chapter 8: Dictionaries
Here's a bit of code it's actually a single statement, spread out over multiple lines
which creates a dictionary to hold the translation table:
gencode = {
'ATA':'I', 'ATC':'I',
'ACA':'T', 'ACC':'T',
'AAC':'N', 'AAT':'N',
'AGC':'S', 'AGT':'S',
'CTA':'L', 'CTC':'L',
'CCA':'P', 'CCC':'P',
'CAC':'H', 'CAT':'H',
'CGA':'R', 'CGC':'R',
'GTA':'V', 'GTC':'V',
'GCA':'A', 'GCC':'A',
'GAC':'D', 'GAT':'D',
'GGA':'G', 'GGC':'G',
'TCA':'S', 'TCC':'S',
'TTC':'F', 'TTT':'F',
'TAC':'Y', 'TAT':'Y',
'TGC':'C', 'TGT':'C',
'ATT':'I',
'ACG':'T',
'AAA':'K',
'AGA':'R',
'CTG':'L',
'CCG':'P',
'CAA':'Q',
'CGG':'R',
'GTG':'V',
'GCG':'A',
'GAA':'E',
'GGG':'G',
'TCG':'S',
'TTA':'L',
'TAA':'_',
'TGA':'_',
'ATG':'M',
'ACT':'T',
'AAG':'K',
'AGG':'R',
'CTT':'L',
'CCT':'P',
'CAG':'Q',
'CGT':'R',
'GTT':'V',
'GCT':'A',
'GAG':'E',
'GGT':'G',
'TCT':'S',
'TTG':'L',
'TAG':'_',
'TGG':'W'}
We can look up the amino acid for a given codon using either of the two methods
that we learned about:
print(gencode['CAT'])
print([Link]('GTC'))
H
V
189
Chapter 8: Dictionaries
If we look up the amino acid for each codon inside the loop of our original code, we
can print both the codon and the amino acid translation1:
dna = "ATGTTCGGT"
last_codon_start = len(dna) - 2
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link](codon)
print("one codon is " + codon)
print("the amino acid is " + aa)
one
the
one
the
one
the
codon
amino
codon
amino
codon
amino
is ATG
acid is M
is TTC
acid is F
is GGT
acid is G
This is starting to look promising. The final step is to actually do something with
the amino acid residues rather than just printing them. A nice idea is to take our
cue from the way that a ribosome behaves and add each new amino acid residue
onto the end of a protein to create a gradually-growing string:
From now on, we won't include the statement which creates the dictionary in our code samples as it takes
up too much room, so if you want to try running these yourself you'll need to add it back at the top.
190
1
2
3
4
5
6
7
8
Chapter 8: Dictionaries
dna = "ATGTTCGGT"
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link](codon)
protein = protein + aa
print("protein sequence is " + protein)
In the above code, we create a new variable to hold the protein sequence
immediately before we start the loop (line 3), then add a single character onto the
end of that variable each time round the loop (line 7). By the time we exit the loop,
we have built up the complete protein sequence and we can print it out (line 8):
protein sequence is MFG
This looks like a very useful bit of code, so let's turn it into a function. Our function
will take one argument the DNA sequence as a string and will return a string
containing the protein sequence1:
def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link](codon)
protein = protein + aa
return protein
We can now test our function by printing out the protein translation for a few more
test sequences:
1
You'll notice that this function relies on the gencode variable which is defined outside the function
something that I told you not to do in chapter 5. This is an exception to the rule: defining the gencode
variable inside the function means that it would have to be created anew each time we wanted to translate
a DNA sequence.
191
Chapter 8: Dictionaries
print(translate_dna("ATGTTCGGT"))
print(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG"))
print(translate_dna("actgatcgtagctagctgacgtatcgtat"))
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
The output from this code shows that we run into a problem with the third
sequence:
MFG
IDRSLLIDQ
Traceback (most recent call last):
File "dna_translation.py", line 30, in <module>
print(translate_dna("actgatcgtagctagctgacgtatcgtat"))
File "dna_translation.py", line 25, in translate_dna
protein = protein + aa
TypeError: cannot concatenate 'str' and 'NoneType' objects
The problem occurs when we try to look up the amino acid for the first codon of the
third sequence "act". Because the third sequence is in lower case but the
translation table dictionary is in upper case, the key isn't found, the get method
returns None, and we get an error. Fixing it is straightforward we just need to
convert the codon to upper case before looking up the amino acid:
def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link]([Link]())
protein = protein + aa
return protein
Now the output shows that the first three sequences are fine, but that our function
has a problem translating the fourth sequence:
192
Chapter 8: Dictionaries
MFG
IDRSLLIDQ
TDRSLLTYR
Traceback (most recent call last):
File "dna_translation.py", line 31, in <module>
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
File "dna_translation.py", line 25, in translate_dna
protein = protein + aa
TypeError: cannot concatenate 'str' and 'NoneType' objects
Glancing at the input sequences, it's not clear what the problem is. Let's try
printing the codons as they're translated in order to identify the one that's causing
the error:
def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
print("about to translate codon: " + codon)
aa = [Link]([Link]())
protein = protein + aa
return protein
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
193
Chapter 8: Dictionaries
There is an unknown base in the middle of the DNA sequence, which causes our
function to try to look up the amino acid for the codon NAC, which causes an error
because that codon isn't in the dictionary. How should we fix this? We could add an
if statement to the function which only translates the DNA sequence if it doesn't
contain any unambiguous bases, but that seems a little too conservative there are
plenty of situations in which we might want to generate a protein sequence for a
DNA sequence that has unknown bases. We could add an if statement inside the
loop which only translates a given codon if it doesn't contain any unambiguous
bases, but that would lead to protein translations of an incorrect length we know
that the codon NAC will translate to an amino acid, we just don't know which one it
will be.
The most sensible solution seems to be to translate any codon with an unknown
base into the symbol for an unknown amino acid residue, which is X. The optional
second argument to the get function makes it very easy to do just that:
194
Chapter 8: Dictionaries
def translate_dna(dna):
last_codon_start = len(dna) - 2
protein = ""
for start in range(0,last_codon_start,3):
codon = dna[start:start+3]
aa = [Link]([Link](), 'X')
protein = protein + aa
return protein
and now we can translate all four of our test sequences correctly:
print(translate_dna("ATGTTCGGT"))
print(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG"))
print(translate_dna("actgatcgtagcttgcttacgtatcgtat"))
print(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG"))
MFG
IDRSLLIDQ
TDRSLLTYR
TIDRXVRSYS
At this point, it's a good idea to turn these test sequences into assert statements
that way, we can easily re-test the function if we make some changes to it in the
future:
assert(translate_dna("ATGTTCGGT")) == "MFG"
assert(translate_dna("ATCGATCGATCGTTGCTTATCGATCAG")) == "IDRSLLIDQ"
assert(translate_dna("actgatcgtagcttgcttacgtatcgtat")) == "TDRSLLTYR"
assert(translate_dna("ACGATCGATCGTNACGTACGATCGTACTCG")) == "TIDRXVRSYS"
195
9:
196
particular, many of the file manipulation functions take paths as arguments, which
differ considerably between operating systems. A path is the short bit of text that
tells you the location of a file in the file system. On Linux and OSX machines, the
path to a file or folder typically looks like this:
/path/to/my/[Link]
Moreover, the success of the code examples for many functions relies on the files
and folders actually being present on the computer on which the examples are run.
The code examples in this chapter will use Linux-style paths, and will refer to
folders and files on my computer, so if you want to try running them, you'll
probably need to change the paths to refer to files on your own computer.
The above code assumes that the file [Link] is in the folder where we are running
our Python program. If it's elsewhere in the filesystem, then we have to give the
complete path:
[Link]("/home/martin/biology/[Link]", "/home/martin/biolgy/[Link]")
197
If we specify a different folder, but the same file name, in the second argument,
then the function will move the file from one folder to another:
[Link]("/home/martin/biology/[Link]", "/home/martin/python/[Link]")
Of course, we can move and rename a file in one step if you like:
[Link]("/home/martin/biology/[Link]", "/home/martin/python/[Link]")
If we try to move a file to a folder that doesn't exist we'll get an error. We need to
create the new folder first with the [Link] function:
[Link]("/home/martin/python")
If we need to create a bunch of directories all in one go, we can use the [Link]
function (note the s on the end of the name):
[Link]("/a/long/path/with/lots/of/folders")
To copy a file or folder we use the shutil module. We can copy a single file with
[Link]:
[Link]("/home/martin/[Link]", "/home/martin/[Link]")
198
[Link]("/home/martin/original_folder",
"/home/martin/copy_folder")
199
To list the contents of a different folder, we just give the path as an argument:
for file_name in [Link]("/home/martin"):
print("one file name is " + file_name)
200
c:\windows\Program files\myprogram\[Link]
As before, if you want to try running any of these examples, make sure that you
change the paths to point to real executables on your computer.
Running a program
The functions for running external program reside in the subprocess module.
The reasoning behind the name is slightly convoluted: when talking about
operating systems, a running program is called a process, and a program that is
started by another program is called a subprocess.
To run an external program, use the [Link] function. This function
takes a single string argument containing the path to the executable you want to
run:
import subprocess
[Link]("/bin/date")
Any output that is produced by the external program is printed straight to the
screen in this case, the output from the Linux date program:
Fri Jul 26 15:15:26 BST 2013
201
July
Just like when reading file contents, the output from an external program can run
over multiples lines that end with new line characters, so you probably need to use
rstrip to remove them before carrying out any processing.
When data is mixed in with the code in this manner, it is said to be hard-coded.
For larger pieces of data, like longer DNA sequences and spreadsheet-like data,
we've typically read the information from an external text file. For many purposes,
this is a better solution than hard-coding the data, as it allows the separation of
202
data and code, making our programs easier to read. However, in all the examples
we've seen so far, the names of the files from which the data are read are still hardcoded.
Both of these approaches to getting data in to our program have the same
shortcomings if we want to change the input data, we have to open up the code
and edit it. In the case of hard-coded variables, we have to edit the statement where
the variables are created. In the case of files, we have two choices we can either
edit the contents of the file, or edit the hard-coded file name.
Real-life useful programs don't generally work that way. Instead, they generally
allow us to specify input files and options at the time when we run the program,
rather than when we're writing it. This allows programs to be much more flexible
and easier to use, especially for a person who didn't write the code in the first place.
In the next couple of sections we're going to see a couple of tools for getting user
input, but more importantly we're going to talk about the transition from writing a
program that's only useful to you, to writing one that can be used by other people.
This involves starting to think about the experience of using a program from the
perspective of a user.
There are many reasons why you might need your programs to be usable by
somebody who's not familiar with the code. If you write a program that solves a
problem for you, chances are that it could solve a problem for your colleagues and
collaborators as well. If you write a program that forms a significant part of a piece
of work which you later want to publish, you many have to make sure that whoever
is peer-reviewing your paper can get your program working as well. Of course,
making your program easier to use for other people means that it will also be easier
to use for you, a few months after you have written it when you have completely
forgotten how the code works!
203
The input function behaves a little differently to other functions and methods
we've seen, because it has to wait for something to happen before it can return a
value the user has to type in a string and press enter. The user input will be
returned as a string (so if we need to use is as something else e.g. a number we'll
have to do the conversion manually) and will end with a new line (so we might
want to use rstrip to remove it).
Capturing user input in this way requires us to think quite carefully about how our
program behaves. Programs that we write to carry out analysis of large datasets will
often take a considerable amount of time to run, so it's important that we minimize
the chances of the user having to re-run them. When using the input function,
there are two situations in particular that we want to avoid.
One is the situation where we have a long-running program that requires some
user input, but doesn't make this fact clear to the user. What can happen in this
scenario is that the user starts the program running and then switches their
attention to something else, assuming that the program will continue to make
progress in the background. If the user doesn't notice (or is not at their computer)
when the program reaches the point where it requires input and halts, the program
may be stuck waiting for input for a long time.
The other scenario to avoid is that where a program runs for some time before
asking the user for input, then fails to work due to an incorrect input or typo,
requiring the user to re-start the program from scratch.
204
A good way to avoid both of these problems is to design our programs such that
they collect all necessary user input at the start, before any long-running tasks are
carried out. We can also reduce the chances of incorrect input on the part of the
user by offering clear instructions and documentation.
An important part of user input is input validation checking that the input
supplied by the user makes sense. For example, you might require that a particular
input is a number between some minimum and maximum values, or that it's a DNA
sequence without ambiguous bases, or that it's the name of a file that must exist. A
good strategy for input validation is to check the input as soon as it's received, and
give the user a second chance to enter their input if it's found to be invalid.
One big drawback of getting user input interactively is that it makes it harder to
run a program unsupervised as part of a work flow. For most biological analyses,
specifying program options when it's run using command line arguments is a better
approach.
In the above code, one two and three are the command line options. To use
command line arguments in our Python scripts, we import the sys module. We can
then access the command line arguments by using the special list [Link].
Running the following code:
1
Not to be confused with the arguments that we give to functions, although they do a similar job.
205
import sys
print([Link])
shows how the elements of [Link] are made up of the arguments given on the
command line:
['[Link]', 'one', 'two', 'three']
Note that the first element of [Link] is always the name of the program itself,
so the first command line argument is at index one, the second at index two, etc.
Just like with input, options and filenames given on the command line are stored
as strings, so if, for example, we want to use a command line argument as a number,
we'll have to convert it with int.
Command line arguments are a good way of getting input for your Python
programs for a number of reasons. All the data your program needs will be present
at the start of your program, so you can do any necessary input validation (like
checking that files are present) before starting any processing. Also, your program
will be able to be run as part of a shell script, and the options will appear in the
user's shell history.
Recap
We started this chapter by examining two features of Python that allow your
programs to interact with the operating system file manipulation and external
processes. We learned which functions to use for common file system operations,
206
and which modules they belong to. We also ssaw two ways to call external programs
from within your Python program.
When using these techniques to solve real life problems, or when working on the
exercises, remember that you may encounter errors that are nothing to do with
your program. For instance, when trying to manipulate files you may get an error if
a specified file doesn't exist or you don't have the necessary permissions to rename
it. Similarly, if you get unexpected output when running an external program the
problem may lie with the external program or with the way that you're calling it,
rather than with your Python program. This is in contrast to the rest of the
exercises in this book, which are mostly self-contained. If you run into difficulties
when using the tools in this chapter, check the external factors as well as checking
your program code.
In the last portion of the chapter, we saw two different ways to get user input when
your program runs. Using command line arguments is generally better for the type
of programming that forms part of scientific research.
207
Exercises
In the chapter_9 folder in the exercises download there is a collection of files with
the extension .dna which contain DNA sequences of varying length, one per line.
Use this set of files for both exercises.
Kmer counting
Write a program that will calculate the number of all kmers of a given length across
all DNA sequences in the input files and display just the ones that occur more than
a given number of times. You program should take two command line arguments
the kmer length, and the cutoff number.
208
Solutions
Binning DNA sequences
The first job is to figure out how to read all the DNA sequences. We can get a list of
all the files in the folder by using [Link], but we'll have to be careful to only
read DNA sequences from files that have the right file name extension. Here's a bit
of code to start off with:
import os
for file_name in [Link]("."):
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
We can check the output to make sure that we're only going to process the correct
files:
reading
reading
reading
reading
reading
reading
reading
reading
reading
reading
sequences
sequences
sequences
sequences
sequences
sequences
sequences
sequences
sequences
sequences
from
from
from
from
from
from
from
from
from
from
[Link]
[Link]
[Link]
[Link]
[Link]
[Link]
[Link]
[Link]
[Link]
[Link]
The next step is to read the DNA sequences from each file. For each file that passes
the name test, we'll open it, then process it one line at a time and calculate the
length of the DNA sequence:
209
Notice how we've used rstrip to remove the new line character we don't want to
include it in the count of the sequence length, since it's not a base. With ten files,
and ten DNA sequences per file, this program generates over a hundred lines of
output here's the first few:
reading
found a
found a
found a
found a
found a
found a
found a
found a
found a
found a
reading
found a
found a
found a
432
818
604
879
619
500
119
341
303
469
121
442
520
This looks good we're getting a range of different sizes. Next we have to figure out
which bin each of the sequences should go in. Because the limits of the bins follow
a regular pattern, we can use the range function to generate them. We can
generate a list of the lower limits for each bin by taking a range of numbers from
210
100 to 1000 with a step size of 100, then adding 99 to get the upper limit of the bin.
We'll go through this process for each sequence, checking if it belongs in each bin
in turn:
# go through each file in the folder
for file_name in [Link]("."):
# check if it ends with .dna
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
# open the file and process each line
dna_file = open(file_name)
for line in dna_file:
# calculate the sequence length
dna = [Link]("\n")
length = len(dna)
print("sequence length is " + str(length))
# go through each bin and check if the sequence belongs in it
for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
if length >= bin_lower and length < bin_upper:
print("bin is " + str(bin_lower) + " to " + str(bin_upper))
There are quite a few levels of indentation in the above code, so you might have to
read it through a few times. We have
211
The first few lines of the output show that this approach works:
reading sequences from [Link]
sequence length is 432
bin is 400 to 499
sequence length is 818
bin is 800 to 899
sequence length is 604
bin is 600 to 699
sequence length is 879
bin is 800 to 899
sequence length is 619
bin is 600 to 699
sequence length is 500
bin is 500 to 599
sequence length is 119
The final step is to create the new folders, and write each DNA sequence to the
appropriate one. We can re-use our range idea to generate the folder names and
create them. The name of the folder for a given bin is the lower limit, followed by
an underscore, followed by the upper limit:
for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
[Link](bin_folder_name)
When we want to write out DNA sequence to a file in a particular folder, we can use
the same naming scheme to work out the name of the folder. Of course, we also
have to figure out what to call the individual files of DNA sequences. The exercise
description didn't specify any kind of naming scheme, so we'll keep things simple
and store the first DNA sequence in a file called [Link], the second in a file called
[Link], etc. We'll need to create an extra variable to hold the number of DNA
sequences we've seen, and to increment it after writing each DNA sequence. Here's
the whole script it's by far the largest program that we've written so far:
212
import os
# create a new folder for each bin
for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
[Link](bin_folder_name)
# create a variable to hold the sequence number
seq_number = 1
# process all files that end in .dna
for file_name in [Link]("."):
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
dna_file = open(file_name)
# for each line, calculate the sequence length
for line in dna_file:
dna = [Link]("\n")
length = len(dna)
print("sequence length is " + str(length))
# figure out which bin the sequence belongs in
for bin_lower in range(100,1000,100):
bin_upper = bin_lower + 99
if length >= bin_lower and length < bin_upper:
# once we know the correct bin, write out the sequence
print("bin is " + str(bin_lower) + " to " + str(bin_upper))
bin_folder_name = str(bin_lower) + "_" + str(bin_upper)
output_path = bin_folder_name + '/' + str(seq_number) + '.dna'
output = open(output_path, "w")
[Link](dna)
[Link]()
# increment the sequence number
seq_number = seq_number+1
213
Kmer counting
To come up with a plan of attack for this exercise, we must first think about the
order in which we process the data. Can we simply read a single DNA sequence,
count the k-mers, and print the counts like we did for the trinucleotide example in
chapter 8? No, because we only want to print the k-mers which occur more than a
given number of times across all sequences. In other words, we don't know which
k-mers we want to print the counts for until we have finished processing all
sequences.
So, we will have to tackle this problem in two stages. First, we will go through each
sequence one-by-one and gradually build up a list of k-mer counts. Second, we will
go through the list of counts and print only the ones whose count is above the
cutoff.
How will we generate the k-mer counts? A good first step would be to figure out
how to split a DNA sequence into overlapping k-mers of any given length. We can
use a similar approach to the one taken in the DNA translation exercise in chapter
8: use the range function to generate a list of the start positions of each k-mer,
then use substring notation to extract the k-mer from the sequence. Here's a bit of
code that prints all k-mers of a given size. We'll use a short test DNA sequence for
now:
test_dna = "ACTGTAGCTGTACGTAGC"
print(test_dna)
kmer_size = 4
for start in range(0,len(test_dna)-(kmer_size-1),1):
kmer = test_dna[start:start+kmer_size]
print(kmer)
The tricky bit is figuring out the arguments to the range function. We know that we
want to start at zero and increase by one each time. The finish position is the
length of the sequence, minus the k-mer size (to make sure there is one k-mer's
214
worth of bases after it) minus one (to allow for the fact that the finish position is
exclusive). The range function generates the start positions for each k-mer, and to
get the end positions we just add the k-mer size. We can examine the output from
this code and check that it agrees with out intuition:
ACTGTAGCTGTACGTAGC
ACTG
CTGT
TGTA
GTAG
TAGC
AGCT
GCTG
CTGT
TGTA
GTAC
TACG
ACGT
CGTA
GTAG
TAGC
To make it easier to test this bit of code, we'll turn it into a function. The function
will take two arguments. The first argument will be the DNA sequence as a string,
and the second argument will be the k-mer size as a number. Instead of printing the
list of k-mers, it will return a list of them. Here's the code for the function and three
statements to test it:
215
print(split_dna("AATGCTGCAT", 4))
print(split_dna("AATGCTGCAT", 5))
print(split_dna("AATGCTGCAT", 6))
As we can see from the output, running the function multiple times with the same
DNA sequence but different k-mer lengths gives different results, as expected:
['AATG', 'ATGC', 'TGCT', 'GCTG', 'CTGC', 'TGCA', 'GCAT']
['AATGC', 'ATGCT', 'TGCTG', 'GCTGC', 'CTGCA', 'TGCAT']
['AATGCT', 'ATGCTG', 'TGCTGC', 'GCTGCA', 'CTGCAT']
Now we can put this function together with the code we developed for looping
through files from the previous exercise. To count up the k-mers, we will create an
empty dictionary at the start of the program (line 11), then for each k-mer we find,
we will look up the current count for it in the dictionary (line 19). If the k-mer is
not found in the dictionary (i.e. this is the first time we've seen that particular kmer) then we will say that the current count is zero. We'll then add one to the
current count (line 20) and store the result back in the dictionary (line 21).
216
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
import os
kmer_size = 6
def split_dna(dna, kmer_size):
kmers = []
for start in range(0,len(dna)-(kmer_size-1),1):
kmer = dna[start:start+kmer_size]
[Link](kmer)
return kmers
kmer_counts = {}
for file_name in [Link]("."):
if file_name.endswith(".dna"):
print("reading sequences from " + file_name)
dna_file = open(file_name)
for line in dna_file:
dna = [Link]("\n")
for kmer in split_dna(dna, kmer_size):
current_count = kmer_counts.get(kmer, 0)
new_count = current_count + 1
kmer_counts[kmer] = new_count
print(kmer_counts)
This program generates a lot of output! Here are the first few lines so we can see
that it's working:
{'gcagag': 11, 'aaataa': 13, 'ctttag': 11, 'gcagac': 14, 'ctttaa': 12,
'gcagaa': 15 etc. etc.
As planned, we end up with a big dictionary where the keys are kmers and the
values are their counts.
Next, we have to process the kmer_counts dictionary. We'll go through the items
in a loop, and if the count is greater than some cutoff, we'll print the count. For
testing, we'll fix the cutoff at 23 (later on we'll make this a command-line option).
Here's the code to process the dictionary:
217
count_cutoff = 23
for kmer, count in kmer_counts.items():
if count > count_cutoff:
print(kmer + " : " + str(count))
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
:
26
26
25
25
24
25
24
24
28
26
24
26
24
24
25
25
25
25
27
24
Nearly done. The final step is to replace the hard-coded values for the k-mer size
and the count cutoff with values read from the command line. We just have to
import the sys module, and convert the arguments to numbers using the int
function. As specified in the exercise description, the first command line argument
is the k-mer size and the second is the cutoff. Here's the final code with comments:
218
import os
import sys
# convert command line arguments to variables
kmer_size = int([Link][1])
count_cutoff = int([Link][2])
# define the function to split dna
def split_dna(dna, kmer_size):
kmers = []
for start in range(0,len(dna)-(kmer_size-1),1):
kmer = dna[start:start+kmer_size]
[Link](kmer)
return kmers
# create an empty dictionary to hold the counts
kmer_counts = {}
# process each file with the right name
for file_name in [Link]("."):
if file_name.endswith(".dna"):
dna_file = open(file_name)
# process each DNA sequence in a file
for line in dna_file:
dna = [Link]("\n")
# increase the count for each k-mer that we find
for kmer in split_dna(dna, kmer_size):
current_count = kmer_counts.get(kmer, 0)
new_count = current_count + 1
kmer_counts[kmer] = new_count
# print k-mers whose counts are above the cutoff
for kmer, count in kmer_counts.items():
if count > count_cutoff:
print(kmer + " : " + str(count))
219
Now we can specify the k-mer length on the command line when we run the
program. With a k-mer length of 6 and a cutoff of 25:
python kmer_counting.py 6 25
we get
agagat
agcggg
gagtgg
ccggtt
ttctga
ggacgt
the output
: 26
: 26
: 28
: 26
: 26
: 27
:
:
:
:
:
:
908
924
905
904
910
905









