0% found this document useful (0 votes)
11 views8 pages

Leaf Age Impact on Grape Resistance

This study investigated the influence of leaf age on induced resistance to downy mildew in grapevine leaves treated with the elicitor sulfated laminarin (PS3). The study found that PS3-induced resistance was higher in adult leaves (position P3) than in younger, not fully expanded leaves (position P1). Upon PS3 treatment and inoculation, adult P3 leaves produced more H2O2, phytoalexins, and phenolic compounds compared to younger P1 leaves. PS3 also significantly reduced stomatal colonization by zoospores in P3 leaves but not P1 leaves. Therefore, the higher defense reactions observed in adult leaves may explain their greater level of PS3-induced resistance compared

Uploaded by

Frontiers
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
11 views8 pages

Leaf Age Impact on Grape Resistance

This study investigated the influence of leaf age on induced resistance to downy mildew in grapevine leaves treated with the elicitor sulfated laminarin (PS3). The study found that PS3-induced resistance was higher in adult leaves (position P3) than in younger, not fully expanded leaves (position P1). Upon PS3 treatment and inoculation, adult P3 leaves produced more H2O2, phytoalexins, and phenolic compounds compared to younger P1 leaves. PS3 also significantly reduced stomatal colonization by zoospores in P3 leaves but not P1 leaves. Therefore, the higher defense reactions observed in adult leaves may explain their greater level of PS3-induced resistance compared

Uploaded by

Frontiers
Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Inuence of leaf age on induced resistance in grapevine against Plasmopara

viticola
Emilie Steimetz
a
, Sophie Trouvelot
a
, Katia Gindro
b
, Adeline Bordier
c
, Benot Poinssot
a
, Marielle Adrian
a
,
Xavier Daire
a,
*
a
Unit mixte de recherche INRA-CNRS-Universit de Bourgogne Agroecologie, INRA, 17, rue Sully BP 86510, 21065, Dijon cedex, France
b
Agroscope Changins-Wdenswil, P.O. Box 1012, Route de Duillier, CH-1260 Nyon, Switzerland
c
Laboratoires Gomar, CS 41908, Saint Jouan des Gurets, 35419, Saint Malo cedex, France
a r t i c l e i n f o
Article history:
Accepted 24 May 2012
Keywords:
Induced resistance
Priming
Age-related resistance
Vitis vinifera
Plasmopara viticola
Plant development
a b s t r a c t
Sulfated laminarin (PS3) has previously been shown to induce resistance of grapevine leaves against the
oomycete Plasmopara viticola, the causal agent of grape downy mildew. Here, we observed that the level
of PS3-induced resistance (PS3-IR) was higher in the adult leaf (in position P3) than in the younger, not
fully expanded leaf (in position P1, located above P3). By investigating grapevine defense reactions upon
PS3 treatment and inoculation, we found that the production of H
2
O
2,
of phytoalexins, and the deposition
of phenolics were more abundant in P3 than in P1 leaves. In addition, PS3 signicantly reduced stomatal
colonization by zoospores only in P3 leaves. Thus, the capacity of an adult leaf to express a higher level of
defense reactions during PS3-IR may partly explain why it exhibits a more elevated resistance when
compared to a young leaf, still in growth. These ndings have likely practical consequences in induced
resistance application.
2012 Elsevier Ltd. All rights reserved.
1. Introduction
Grapevine (Vitis vinifera L.) downy mildew is caused by the
oomycete Plasmopara viticola. Control of this disease relies on
frequent fungicide treatments, especially in temperate rainy areas.
For environmental concern, there is nowa need to reduce the use of
fungicides in crop protection. In this way, inducing plant resistance
by means of elicitors represents an attractive strategy to reduce
fungicide treatments. Elicitors are compounds that can mimic an
attack by avirulent pathogens. Their recognition triggers signaling
cascades that activate gene expression and, subsequently, an array
of defense reactions [1] which counteract pathogen development.
Out of the numerous eliciting compounds that have been found
over the last decades, carbohydrate polymers are of particular
interest. This because they derive fromalgae, plant or microbial cell
walls [2,3] which represent renewable and biodegradable natural
sources. Moreover, they are mostly deprived of toxicity. Galactur-
onic acid, chitosan, and glucan derived oligosaccharides are well
known elicitors [3,4] which are now referred to as microbial
associated molecular patterns (MAMP) [5]. Regarding induced
resistance (IR) in grapevine studies, Aziz et al. [6] showed that
laminarin, a b-1,3 glucan from the algae Laminaria digitata induces
resistance both against Botrytis cinerea, the causal agent of grape
gray mold, and P. viticola. Furthermore, the sulfated derivative of
laminarin (PS3) proved to be more effective than laminarin in
inducing resistance in tobacco against TMV [7]. The same held true
in the case of grapevine e P. viticola interaction (Daire et al.
unpublished). In this interaction, PS3 elicited the expression of
defense genes, primed H
2
O
2
production at the infection sites, cal-
lose and phenol depositions, and hypersensitive response-like cell
death [8]. Pharmacological approaches suggested that PS3-IR in
grapevine is dependent on callose synthesis and oxylipin pathway.
Plant resistance to bioagressors can be inuenced by various
factors. Among them, the plant developmental stage can be crucial,
as it is well known in the case of the so-called age-related resis-
tance (ARR). ARR, also termed ontogenic resistance, describes the
ability of whole plants or plant parts to resist or tolerate disease
when they age and mature. ARR occurs in many plant species and is
generally broad-spectrum [9]. In grapevine, the older leaves of the
bottom of the shoots present a higher resistance to powdery
mildew [10] and downy mildew [11] than the younger ones.
Little is known to date on the inuence of the age of organs on
induced resistance. As IR mobilizes the plant metabolism, one can
expect that the level of the plant response depends on exogenous
* Corresponding author. INRA, 17 rue Sully, BP86510, 21065, Dijon cedex, France.
E-mail address: [Link]@[Link] (X. Daire).
Contents lists available at SciVerse ScienceDirect
Physiological and Molecular Plant Pathology
j ournal homepage: www. el sevi er. com/ l ocat e/ pmpp
0885-5765/$ e see front matter 2012 Elsevier Ltd. All rights reserved.
[Link]
Physiological and Molecular Plant Pathology 79 (2012) 89e96
and endogenous factors. Interestingly, during the course of IR
experiments with grapevine and downy mildewin the greenhouse,
we found that the disease reduction rate was affected by leaf
position, i.e. leaf age. Indeed, the younger, not fully expanded leaves
were less protected following the treatment. This prompted us to
conduct this study in order to check whether the adult grapevine
leaves were more responsive to elicitor treatment than the younger
ones. For that purpose, we compared in both types of leaves several
defense events known to be induced during PS3-IR.
2. Material and methods
2.1. Plant material
Grapevine (V. vinifera L. cv. Marselan) herbaceous cuttings were
grown in individual pots (10 7 7 cm) containing a mixture of
peat and perlite (4:1, vol/vol) in a greenhouse at 25 4 and
18 7

C (day and night, respectively) until they developed 6e8
leaves (ca 7 weeks later). Articial illumination was supple-
mented when the natural light was less than 200 mmol m
2
s
1
during the 16 h light period. Plants were watered with a fertiliza-
tion solution (0.25% Topfert2 solution NPK 10-10-
10 oligonutrients. Plantin. France). The factor leaf age in this
study corresponded to leaf positions indicated in Fig. 1. The youn-
gest leaf under study, called P1 (position 1), is nearly fully
expanded. Older leaves P2 and P3 are immediately located beneath
P1 and are considered as adult leaves. Only P1 and P3 were sub-
jected to analyses of defense reactions.
2.2. Elicitor treatment
Sulfated laminarin (PS3, provided by Gomar laboratories) was
prepared at 5 mg ml
1
(unless otherwise mentioned) in distilled
water with 0.05% adjuvant (condential) and applied to both the
upper and lower faces of leaves until the point of run-off using
a manual sprayer. Plants were maintained in the greenhouse in the
conditions described above. As controls, water and the adjuvant
alone were sprayed in the same manner. PS3 has no toxic effect on
P. viticola sporangia and zoospores [8].
2.3. Plant inoculation and disease assessment
A P. viticola isolate was maintained in the greenhouse on cv.
Marselan plants as previously described [8]. Sporangia were
collected from sporulating leaves using a brush and suspended in
distilled water at a concentration of 10
4
[Link]
1
. Inoculation
was performed 48 h post-elicitor treatment (hpt) by spraying the
freshly prepared suspension onto the lower face of the leaf. Plants
were then placed overnight in a humid chamber (relative humidity
of 100%), and then transferred back to the greenhouse, in the
conditions described above. For mock-inoculation used as control,
the leaf lower face was sprayed with water.
Six days post inoculation (dpi), plants were placed again in the
humid chamber overnight to provoke sporulation. Disease was
then assessed by measuring the leaf surface area covered by spor-
ulation. Five cuttings were used per condition. Nine independent
experiments were performed. Disease reduction rate is calculated
as follows: (1e (treated sporulating area/control sporulating
area)) 100.
2.4. Determination of the number of infected stomata
Forty-eight hpt, discs (diameter 1 cm) were punched out from
leaves, placed (lower face up) on a moist lter paper in a trans-
parent plastic box and inoculated with a 20 ml drop of a 10
5
spores ml
1
suspension. They were incubated at 20

C. Twenty-four
hours post-inoculation (hpi), discs were xed in methanol and
stained with aniline blue as previously described [8]. They were
mounted on microscope slides in the staining solution, the lower
side uppermost and observed by epiuorescence microscopy
(l
exc
340 nm, l
em
380 nm, stop lter LP430 nm) using a Leica
microscope. P. viticola structures uoresce blue in these conditions.
For each condition 10 discs were sampled on 5 plants. For each disc,
the number of infected stomata versus the total number of stomata
(expressed as percentage) was visually determined by observation
of 2 different microscopic elds (X 100). The counting was repeated
on three independent experiments. Analysis of variance was per-
formed as well as least signicant difference (LSD) test to detect
differences between treatments. These analyses were also applied
when necessary to the others experiments.
Fig. 1. Leaf positions (P1, P2 and P3) under study on a representative grape cutting (cv.
Marselan) grown in the greenhouse.
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 90
2.5. Localization and quantication of H
2
O
2
production in leaves
(DAB staining)
The production and localization of H
2
O
2
in leaves was assessed
at 1 and 3 dpi, using a diaminobenzidine (DAB) staining procedure
as previously described [8]. Image analysis was performed using
Visiolog 6 software (Noesis, France).
2.6. Cytological analysis
Leaf segments (2 mm5 mm) were randomly excised and xed
immediately in 2.5% glutaraldehyde (in 0.1 M sodium-cacodylate
buffer, pH 7.2) for 20e25 min under vacuum, then overnight at
4

C with gentle rotation. Samples were twice washed (10 min) in
the same buffer and post-xed in 1% osmium tetroxide (OsO
4
) in
the same buffer for 1 h at 4

C. Following osmiumtetroxide xation,


samples were washed in cacodylate buffer, dehydrated in a graded
ethanol series and treated with propylene oxide. Dehydrated
samples were subsequently embedded in Epon (Merck). For each
treatment, fragments from 9 independent leaves were embedded.
The same number of uninoculated control or PS3-treated leaves
were sampled and processed as the inoculated leaves. All samples
were used for observation in both light and electron microscopy.
The embedded samples were then sectioned using a Reichert
Ultracut E microtome (Leica) with diamond knives (Diatome).
Semithin (0.5 mm) sections fromthe tissue blocks were stained with
1% aqueous toluidine blue (in 1% sodiumtetraborate) and examined
under a bright-eld light microscope (Leica) in order to locate
infection sites. Ultrathin (90 nm) sections of these areas were
mounted on uncoated 300 mesh copper grids (Pelanne Instru-
ments), stained with uranyl acetate (2.5% in methanol), followed by
Reynolds lead citrate. Sections were examined using a Hitachi 600
electron microscope at an accelerating voltage of 75 kV. For each
leaf, sections were cut in 3 different zones along the foliar fragment
and, for each zone, at least 20 sections were observed.
2.7. Analysis of defense gene expression
For each time point (24 hpt and 48 hpi), leaf discs (1 cm diam-
eter) were harvested from two biological replicates, with 3 grape-
vine plants per replicate. In each replicate 10 discs were collected
per leaf (P1 and P3) per plant and pooled before extraction (30 discs
in total). These 30 discs per replicate corresponded to approxi-
mately 0.3 g of fresh tissue.
2.7.1. RNA extraction
Total RNA was isolated as described by Reid et al. [12]. DNA
contaminations wereremovedusingtheDNaseI-kit (SigmaeAldrich)
according to the manufacturers instructions. The concentration of
RNA extracts was determined by spectrophotometry.
2.7.2. Real-time qRT-PCR
The expression of 5 genes known to be up-regulated by PS3
treatment was monitored in this study (Table 1). Reverse
transcription and real time qPCR procedure was identical to that
describedbyGammet al. [13]. Briey, the absolute QPCRSYBRGreen
ROXMIX (ThermoFisher Scientic, Waltham, MA, USA) was used,
with a nal primer concentration of 500 mMand 5 ng of total cDNA.
Relative gene expression was determined with the formula fold
induction 2
DDCT
, where DDC
T
(C
T
GI [treated sample] C
T
GI
[control sample]) (C
T
RG [treated sample] C
T
RG [control
sample]). GI is the gene of interest, and RG the reference gene
VATP16 encoding a V-type proton ATPase used as internal control
for normalization [13]. The control sample is the adjuvant-treated
sample chosen to represent 1 X expression of the gene of interest.
For each experiment, values of the relative transcript accumu-
lation were calculated as the mean of the data fromthe 2 biological
replicates. The results presented are mean of four independent
experiments. Data were subjected to Student t-test.
2.8. Stilbene analysis
Droplets of 10 ml of PS3 (5 mg l
1
) were applied on the lower
surface of detached P1 and P3 leaves. Water or adjuvant droplets
were applied as a negative control. These droplets were then
removed after 24 h using soft paper, and replaced 48 hpt by an
aqueous suspension of sporangia at a concentration of
5 10
5
sporangia ml
1
. The leaves were then placed in humid
chambers. At 24, 48, and 72 hpt, three pieces of leaf corresponding
to the droplet surface were cut from each treated leaf. Leaf samples
were weighed and placed in a tube (1.5 ml) and 100 mL of methanol
were added. The tightly closed tubes were then placed in a ther-
moregulated shaker at 60

C for 10 min and then placed in an ice
bath for 5 min. The methanolic extracts (30 mL) were analyzed for
stilbenes as described by Pezet et al. [14]. The results are expressed
in mmol mg
1
FW. Experiment was repeated once.
3. Results
3.1. Inuence of the leaf position on P. viticola infection and PS3-IR
Fig. 2 illustrates typical results of greenhouse protection tests. In
control plants, the severity of downy mildew in the young leaf (P1)
reached 90%, while it decreased in the next older ones, dropping
approximately by 80 and 50% in P2 and P3, respectively. In PS3-
treated plants, the disease severity was strongly reduced in leaves
in the 3 positions, especially in P3. Indeed, over 9 independent
assays, the mean reduction of sporulating area reached 97% for P3
whereas it was 90% for P2 and 60% for P1. Firstly, this conrmed
that grapevine leaves expressed ARR against downy mildew.
Secondly, this indicates that PS3-induced resistance level depended
on leaf position, i.e. leaf age.
3.2. Inuence of the leaf position on stomata colonization by
P. viticola
Colonization of stomata is the rst step of infection process of
grapevine tissues by P. viticola. For that reason, we aimed to check
Table 1
Sequences (5
0
to 3
0
) of primers used to analyze the expression of grapevine defense genes by RT-qPCR.
Gene name Gene description NCBI gene identier Forward primer Reverse primer
SAMT1 Salicylate O-methyltransferase XM_002262982.1 CTGAAGTGAACTGGAATGCGTACC ACAAGCAATGGCTCTGCAAC
DRP 206 Dirigent-like protein XM_002276412.1 TGCCTATCAGGGCAAGAAGAAGCA GGGTCATCAAACACCACCACATCAC
PR2-2 Glucanase 2 XM_002278087.1 TCAGCCGTCCTCGGCAAATCA TTGGCCAGGAGTGGGGAGCC
PR3-4c Chitinase 4c XM_002275480.1 GCAACCGATGTTGACATATCA CGTCGCCCTAGCAAGTGAG
STS Stilbene synthase XM_002265193.1 AGGAAGCAGCATTGAAGGCTC TGCACCAGGCATTTCTACACC
VATP16 V-type proton ATPase XM_002269086.1 CTTCTCCTGTATGGGAGCTG CCATAACAACTGGTACAATCGAC
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 91
whether leaf age, as well as PS3 could inuence stomata coloni-
zation. No obvious difference in the percentage of colonized
stomata could be observed between the leaf positions in control
plants (Fig. 3). In PS3-treated plants, the number of colonized
stomata of P1 leaves was not signicantly different from that of
control plants. However, it was signicantly lower in P3 leaves.
3.3. H
2
O
2
production
H
2
O
2
production was assessed in P1 and P3 leaves, 1 and 3 dpi.
As previously reported [8], no production could be observed in
untreated plants, either inoculated or not (not shown). In PS3-
treated plants, H
2
O
2
production was detectable in leaves only
once plants had been inoculated with P. viticola. It was observed in
both P1 and P3 samples, but was more abundant in the latter
(Fig. 4A and B). Staining quantication using image analysis
Fig. 3. Inuence of leaf position and PS3-treatement on grapevine stomata coloniza-
tion by zoospores of P. viticola. Percentage of infected stomata was determined by
microscopic observation under UV light after staining with aniline blue. Plants were
inoculated 48 h after PS3-treatment (5 g l
1
) and samples harvested 24 h post-
inoculation. Sample with the same letter are not statistically different (p < 0.05).
Fig. 4. Differential H
2
O
2
accumulation in response to PS3-treatment and inoculation in
P1 and P3 leaves. H
2
0
2
was detected using DAB staining. In these representative
samples, brown precipitates revealing H
2
O
2
accumulation are less abundant in P1 (A)
leaves than in P3 leaves (B). Arrows indicate stained stomata. DAB deposition was
quantied using image analyse at 1 dpi (3 dpt) and 3 dpi (5dpt). (*) indicates signicant
differences (p < 0,01) between P1 and P3 leaves.
Fig. 2. Inuence of grape (cv. Marselan) leaf position on PS3-induced resistance
against Plasmopara viticola. Disease severity was assessed as the percentage of leaf area
bearing sporulation. Control consisted of adjuvant alone. Values are means of nine
independent experiments (5 cuttings per condition). PS3 was sprayed at 5 g l
1
. Plants
were inoculated 2 days later and observation took place 5 dpi. Error bars correspond to
standard deviation. Disease reduction rate following inducer application was 60%, 90%
and 97% in P1, P2 and P3, respectively.
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 92
indicated that stained area was roughly three times higher in P3
than in P1 leaves (Fig. 4C). Moreover, the localization of the H
2
O
2
production in P1 and P3 was slightly different. Whereas in P1 leaves
H
2
O
2
was detected mostly in stomata (Fig. 4A), in P3 leaves (Fig.4B)
staining occurred also in the mesophyll cells.
3.4. Cytological changes
PS3-treatment primes an HR-like cell death, accumulation of
phenolic compounds and allows reduction of pathogen coloniza-
tion [8]. Here, we aimed to check whether these reactions differed
according to the age of the leaf. Neither P. viticola nor PS3 treatment
alone provoked obvious reactions in host cells, whatever the leaf
position (data not shown). As shown in Fig. 5, in treated P1 sample,
at 6 dpi, representative semithin section of leaf (Fig. 5A) revealed
hyphae in intercellular spaces together with host cells exhibiting
a disorganized cytoplasm. At higher magnication using trans-
mission electron microscopy (Fig.5B), one could clearly observe
that host cells, in which haustoria had penetrated (see arrow head),
underwent an HR-like process, as indicated by cytoplasm disorga-
nization and collapsed haustoria. Obvious differences were found
in treated P3 samples (Fig.5C and D), in which pathogen structures
are scarce or even absent, and might be necrotic as it was suggested
by the presence of debris in some intercellular spaces (Fig. 5D). In
addition, mesophyll cells in infected areas harbored some distorted
chloroplasts (Fig. 5D and E, arrow head) and granular electron
dense deposits corresponding likely to phenol compounds (Fig. 5D,
arrows).
3.5. Expression of defense-related genes in P1 and P3 grapevine
leaves
The expression of ve genes known to be induced by PS3 was
compared in P1 and P3 leaves at 24 hpt and 48 hpi (or 96 hpt;
Table 2). Thus, the transcript accumulation was quantied by RT-
qPCR for genes encoding a putative dirigent-like protein
(DRP206), two PR proteins: the b-1,3 glucanase (PR2-2) and chiti-
nase 4c (PR3-4c), a putative salicylate O-methyltransferase (SAMT1)
and a stilbene synthase (STS) involved in phytoalexin biosynthesis.
Fig. 5. Comparison of cytological changes induced in P1 and P3 following PS3 treatment and P. viticola inoculation at 6 dpi (A and C: light micrographs. B, D and E: transmission
electron micrographs). Abe: abaxial epidermis. Ade: adaxial epidermis. Ch: chloroplast. Hy: intercellular hyphae. IS: intercellular space. Pm: palisade mesophyll. S: stomata. Sm:
spongy mesophyll. Arrow heads indicate haustorium (B) or altered chloroplast (D and E) and arrows, electron dense deposits (D).
Table 2
Expression of 5 defense-related genes in P1 and P3 grapevine leaves in response to
PS3 treatment and inoculation with P. viticola. DRP 206: dirigent-like protein, PR2-2:
b 1,3-glucanase, PR3-4c: chitinase 4c, SAMT1: salicylate O-methyltransferase, STS:
stilbene synthase. Samples were harvested 24 h post-treatment and 48 h post-
inoculation (96 h post-treatment). Results are expressed as the fold increase in
transcript level compared to the control (adjuvant) and are means of 4 independent
biological repetitions standard deviation of the mean.
24 hpt 48 hpi
P1 P3 P1 P3
DRP206 4.8 2 1.9 1.8 2.9 2.4 6.2 4.8
PR2-2 2.0 0.9 1.2 0.7 1.5 0.7 2.3 1.4
PR3-4c 1.4 1.1 1.7 0.6 1.7 0.6 1.7 1.4
SAMT1 1.7 0.4 1.6 0.9 0.8 0.3 2.8 0.9
a
STS 5.6 8.2 1.6 1 2.0 1.2 1.9 1.6
a
indicates a signicant difference between P1 and P3 (p < 0,01) at 48 hpi.
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 93
At 24 hpt, gene activation was not signicantly different between
P1 and P3 leaves. At 48 hpi, only the salicylate O-methyltransferase
(SAMT1) gene activation is signicantly higher in P3 leaf. Thus,
excepted for SAMT1 gene at 48 hpi, these results did not reveal
a clear-cut difference in gene expression between P1 and P3 leaves.
3.6. Stilbene production
The production of resveratrol, - and d-viniferins and pter-
ostilbene was followed in P1 and P3 leaves, from 0 hpt to 3 dpi (5
dpt). No or few amounts of stilbene were found in controls and in
PS3-treated samples before inoculation (data not shown). The
stilbene level was still low in all conditions at 1 dpi though it had
slightly increased in PS3-treated P3 samples (Table 3). At 2 dpi (not
shown), phytoalexin concentrations were still low in water control
but had risen above the background in the other conditions,
including the adjuvant control, indicating that this treatment
induced some defense reactions of the plant. At 3 dpi, a slight
increase in stilbene contents was recorded in water control (total of
14.9 and 23.1 mmol mg
1
FW in P1 and P3 leaves, respectively),
presumably as a plant response to the developing infection.
Although stilbene production in adjuvant control was not negli-
gible (total of 38.8 and 44.5 mmol mg
1
FW in P1 and P3 leaves,
respectively), it was clearly higher in PS3-treated samples (total of
62.6 and 119 mmol mg
1
FW in P1 and P3 leaves). Epsilon- and d-
viniferin concentrations were higher than resveratrol and pter-
ostilbene in P3 leaves whereas it was the opposite in P1 leaves.
These results indicated that PS3 primed stilbene synthesis in both
P1 and P3 leaves, and that higher amounts of viniferins accumu-
lated in the P3 leaves than in P1 leaves.
4. Discussion
This study provides evidence that in grapevine PS3-IR level
against P. viticola depends on leaf age, the young leaf tissues being
less protected following the treatment than the older ones.
Comparing P1 and P3 leaves, our work clearly establishes that
a higher IR correlates with a higher expression of a set of defense
reactions, i.e. the P3 adult leaf turns out to be more responsive to
PS3 treatment than the P1 young leaf.
Colonization of stomata by zoospores is the rst step of the
infection of grapevine tissues by P. viticola and is crucial for
a further successful pathogen development. Stomatal colonization
rate is similar in untreated P1, P3 leaf as well as in the PS3-treated
P1 leaf. This shows that colonization rate is not affected by leaf age
and conrms that PS3 has no direct effect on P. viticola spores. As
a striking result, PS3 treatment markedly reduced colonization in
P3 leaves. How zoospores can target and reach stomata still
remains unknown, making it difcult to explain if PS3 inuences
this step. It has been shown that elicitors can induce stomatal
movements [15] and pathogen-induced stomatal closure is
considered part of the plant immune system [16]. Thus, it would be
worthwhile to check whether PS3 could induce such closure during
grapevine-P. viticola interaction. In some cases grapevine defense
reactions were reported to take place in stomata. For example, the
tolerance of the hybrid Solaris and the resistance of some Vitis
species to P. viticola were associated to callose secretion [17] and
phenolic compounds at the stomatal level [18]. In PS3-treated
leaves inoculated by P. viticola, H
2
O
2
production occurs rst in
guard cells, and then in epidermis and parenchyma cells [8]. From
all these data, it can be assumed that P3 leaves guard cells have
a higher capacity to produce defense reactions, including H
2
O
2
, or
to produce them earlier than younger leaves.
Following PS3 treatment, H
2
O
2
production reached a higher
level in P3 inoculated leaf. This conrms the overall good correla-
tion between PS3-IR and H
2
O
2
production in challenged tissues,
making this ROS production a reliable marker of priming in
grapevine. Further, ROS production as an effective component of
grapevine defense against P. viticola is reinforced by recent data
showing that BABA-IR depends on H
2
O
2
production via a NADPH
oxidase [19].
Stilbenes are well known grape phytoalexins, including resver-
atrol and its derivatives. They are accumulated in response to
various stresses and are often associated with resistance to patho-
gens [20,21]. Among stilbenes, viniferins and pterostilbenes are
highly toxic to P. viticola zoospores while resveratrol is moderately
toxic [22]. Here, we found that stilbene accumulation, especially
viniferins, is primed by PS3 and is higher in P3 than in P1 leaves.
Correlation between higher protection level and elevated viniferin
concentrations conrms that these compounds are likely of primary
importance for resistance against P. viticola. Likewise, pterostilbene
is found only in treated samples that undergo IR, suggesting that it
also plays a signicant role in PS3-IR against P. viticola.
Cytological observations complete the picture of difference
between P1 and P3 responses to PS3. First of all, pathogen is less
abundant in P3 leaf, conrming that it is more resistant. Secondly,
while HR-like response is found in both P1 and P3 tissues, some
reactions such as electron dense deposits, currently considered as
phenolics, are particularly marked in the adult leaf (large vacuolar
electron dense granules). In addition, distorted chloroplasts were
observed more frequently in P3 leaves, suggesting that some
defense reactions are stronger in older tissues. Alteration of chlo-
roplasts is in accordance with the fact that photosynthesis is
strongly reduced in leaf area undergoing an HR process [23].
Unlike the aforementioned defense events, studying the
expression of 5 defense genes known to be PS3-responsive did not
Table 3
Concentration of stilbene phytoalexins in P1 and P3 leaves following PS3 treatment (2.5 g l
1
) and inoculation with P. viticola. Results are expressed in mmol mg
1
fresh weight.
Values are means and standard deviation of the mean (n 3). Experiment was repeated once with similar results.
Water Adjuvant PS3
P1 P3 P1 P3 P1 P3
24 hpi
Resveratrol 2.15 0.17 0.23 0.04 0.50 0.04 0.13 0.02 2.95 0.11 2.29 0.09
-viniferin 0.00 0.00 0.13 0.01 0.20 0.01 0.21 0.04 0.22 0.03 5.23 0.13
d-viniferin 0.00 0.00 0.00 0.00 0.20 0.14 0.22 0.03 0.52 0.06 3.94 0.11
Pterostilbene 0.00 0.00 0.00 0.00 0.11 0.02 0.21 0.03 0.23 0.03 0.00 0.00
72 hpi
Resveratrol 9.03 0.09 14.42 0.14 4.44 0.13 26.34 1.04 19.13 1.01 8.10 0.31
-viniferin 2.82 0.22 4.14 0.21 18.21 1.02 8.33 0.12 14.23 1.04 56.33 1.37
d-viniferin 3.12 0.20 4.63 0.15 15.94 0.92 6.94 0.61 12.22 0.50 40.51 1.17
Pterostilbene 0.00 0.00 0.00 0.00 0.33 0.01 3.01 0.11 17.12 0.85 14.14 0.75
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 94
permit to clearly differentiate adult and young leaf responses.
Salicylate O-methyltransferase gene (SAMT1) is the only gene the
expression of which is signicantly higher in P3 leaf. This putative
gene encodes an enzyme catalysing the synthesis of methyl
salicylate (MeSA) from salicylic acid, a well-known plant defense
messenger. This result suggests that MeSA might play a role in
PS3-IR.
Altogether our data demonstrate that the growth stage of
a plant organ can markedly inuence induced resistance.
Regarding grapevine, this is likely a general rule for in our
experiments we observed similar effect with other elicitors, such
as oligogalacturonides or BTH, and with other pathogen, such as
Erysiphe necator, the causal agent of grape powdery mildew
(unpublished data). Another example of the importance of
phenology in grape defense expression is provided by the
response of the reproductive organs to UV-C irradiation. This
harsh treatment does not elicit phytoalexin production and other
defense responses in owers and berries at fruit set whereas it
does in older berries [24].
In the case of rice, Iwai et al. [25] showed that probenazole,
which is used for the protection of rice plants from Magnaporthe
grisea (blast fungus), was effective in inducing resistance in adult
plants but not in young ones. This was correlated to the lack of SA
and PR proteins accumulation in the young plants following the
treatment. In contrast, Sharma et al. [26], studying BABA-IR in
tomato against Phytophthora infestans, observed that the degree of
protection was generally higher in the younger leaves. However,
this may be due to acropetal accumulation of BABA, as previously
shown [27].
The enhanced capability of an adult leaf to mount a defense
could explain why it becomes more resistant following PS3-
treatment as compared to a younger leaf sill in growth. In addi-
tion, one should keep in mind that the adult leaf is undergoing ARR.
Mechanisms underlying ARR have only recently been studied.
During aging, accumulation of phenols, PR proteins and strength-
ening of cell wall constitute a physical and chemical barrier that
renders tissues less prone to pathogen colonization [28]. However,
ARR can also imply active mechanisms. It was shown in tobacco and
Arabidopsis that it acts in an SA-dependent manner [29,30]. In the
case of grapevine, ARR may result of preformed defenses such as
higher constitutive peroxidase and glucanase activities in older
leaves as formerly shown [11] or of lignication and phenolic
compounds accumulation. However, it does not depend probably
on the PS3-induced defense reactions examined here. Indeed, we
failed to detect any of themin untreated inoculated P3 samples. It is
possible that the induced defenses in adult grape leaf synergisti-
cally interact with preformed defenses responsible for ARR, actually
resulting in enhanced resistance.
Why a young organ is less responsive to resistance inducers still
remains to be uncovered. Because defense is a costly event,
requiring nutrients and mobilization of primary metabolism for
energy [23], it is conceivable that a young tissue cannot achieve
both defense and growth in the same time, the latter having
priority. For instance, recent investigations demonstrated that
expression of defense and resistance to pathogen is favored in rice
plant with reduced growth and low auxin level [31].
The limited ability of some resistance inducers to protect
growing organs may partly explain why they exhibit low perfor-
mance in eld experiments. This should be taken into account to t
induced resistance into disease control strategies.
Acknowledgments
This work was achieved in the frame of the Destim project,
funded by the French Fonds Unique Interministriel (FUI). We
thank Charles Schneider (INRA) for his kind help in image analysis,
C. Arnould (INRA) and J. Relot (CMAB, Dijon, France) for their
technical assistance in electron microscopy.
Reference
[1] Garcia-Brugger A, Lamotte O, Vandelle E, Bourque S, Lecourieux D, Poinssot B,
et al. Early signaling events induced by elicitors of plant defenses. Molecular
Plant-Microbe Interactions 2006;19:711e24.
[2] Darvill AG, Albersheim P, McNeil M, Lau JM, York WS, Stevenson TT, et al.
Structure and function of plant cell wall polysaccharides. Journal of Cell
Science 1985;2(Supplement):203e17.
[3] Ct F, Hahn M. Oligosaccharins: stuctures and signal transduction. Plant
Molecular Biology 1994;26:1379e411.
[4] Klarzynski O, Plesse B, Joubert JM, Yvin JC, Kopp M, Kloareg B, et al. Linear
bta-1,3 glucans are elicitors of defense responses in tobacco. Plant Physiology
2000;124:1027e37.
[5] Jones JDG, Dangl JL. The plant immune system. Nature 2006;444:323e9.
[6] Aziz A, Poinssot B, Daire X, Adrian M, Bzier A, Lambert B, et al. Laminarin
elicits defense responses in grapevine and induces protection against Botrytis
cinerea and Plasmopara viticola. Molecular Plant-Microbe Interactions 2003;
16:1118e28.
[7] Mnard R, Alban S, de Ruffray P, Jamois F, Franz G, Fritig B, et al. b-1,3 glucan
sulfate, but not beta-1,3 glucan, induces the salicylic acid signaling pathway in
tobacco and Arabidopsis. Plant Cell 2004;16:3020e32.
[8] Trouvelot S, Varnier AL, Allegre M, Mercier L, Baillieul F, Arnould C, et al. A b-
1,3 glucan sulfate induces resistance in grapevine against Plasmopara viticola
through priming of defense responses, including HR-like cell death. Molecular
Plant-Microbe Interactions 2008;21:232e43.
[9] Develey-Riviere MP, Galiana E. Resistance to pathogens and host develop-
mental stage: a multifaceted relationship within the plant kingdom. New
Phytologist 2007;175:405e16.
[10] Doster MA, Schnathorst WC. Effects of leaf maturity and cultivar resistance on
development of the powdery mildew fungus on grapevines. Phytopathology
1985;75:318e21.
[11] Reuveni M. Relationships between leaf age, peroxydase and beta-1,3-
glucanase activity, and resistance to downy mildew. Journal of Phytopa-
thology 1998;146:525e30.
[12] Reid KE, Olsson N, Schlosser J, Peng F, Lund ST. An optimized grapevine
RNA isolation procedure and statistical determination of reference genes
for real-time RT-PCR during berry development. BMC Plant Biology 2006;
6:27.
[13] Gamm M, Heloir M-C, Kelloniemi J, Poinssot B, Wendehenne D, Adrian M.
Identication of reference genes suitable for qRT-PCR in grapevine
and application for the study of the expression of genes involved in
pterostilbene synthesis. Molecular Genetics and Genomics 2011;285:
273e85.
[14] Pezet R, Perret C, Jean Denis JB, Tabacchi R, Gindro K, Viret O. Delta-Viniferin,
a resveratrol dehydrodimer: one of the major stilbenes synthesized by
stressed grapevine leaves. Journal of Agricultural and Food Chemistry 2003;
51:5488e92.
[15] Lee S, Choi H, Suh S, Doo I, Oh K, Choi E, et al. Oligogalacturonic acid and
chitosan reduce stomatal Aperture by inducing the Evolution of Reactive
Oxygen species from guard cells of tomato and Commelina communis. Plant
Physiology 1999;121:147e52.
[16] Melotto M, Underwood W, Koczan J, Nomura K, He SY. Plant stomata function
in Innate Immunity against bacterial invasion. Cell 2006;126:969e80.
[17] Gindro K, Pezet R, Viret O. Histological study of the responses of two Vitis
vinifera cultivars (resistant and susceptible) to Plasmopara viticola infections.
Plant Physiology and Biochemistry 2003;41:846e53.
[18] Dai GH, Andary C, Mondolot-Cosson L, Boubals D. Histochemical studies on
the interaction between three species of grapevine, Vitis vinifera, V. rupestris
and V. rotundifolia and the downy mildew fungus, Plasmopara viticola. Phys-
iological and Molecular Plant Pathology 1995;46:177e88.
[19] Dubreuil-Maurizi C, Trouvelot S, Frettinger P, Pugin A, Wendehenne D,
Poinssot B. beta-Aminobutyric acid primes an NADPH oxidase-dependent
Reactive Oxygen species production during grapevine-triggered Immunity.
Molecular Plant-Microbe Interactions 2010;23:1012e21.
[20] Alonso-Villaverde V, Voinesco F, Viret O, Spring J-L, Gindro K. The effective-
ness of stilbenes in resistant vitaceae: ultrastructural and biochemical events
during Plasmopara viticola infection process. Plant Physiology and Biochem-
istry 2011;49:265e74.
[21] Gindro K, Spring J, Pezet R, Richter H, Viret O. Histological and biochemical
criteria for objective and early selection of grapevine cultivars resistant to
Plasmopara viticola. Vitis 2006;45:191e6.
[22] Pezet R, Gindro K, Viret O, Richter H. Effects of resveratrol, viniferins and
pterostilbene on Plasmopara viticola zoospore mobility and disease develop-
ment. Vitis 2004;43:145e8.
[23] Bolton MD. Primary metabolism and plant defensedfuel for the re. Molec-
ular Plant-Microbe Interactions 2009;22:487e97.
[24] Petit AN, Baillieul F, Vaillant-Gaveau N, Jacquens L, Conreux A, Jeandet P, et al.
Low responsiveness of grapevine owers and berries at fruit set to UV-C
irradiation. Journal of Experimental Botany 2009;60. ARR.
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 95
[25] Iwai T, Seo S, Mitsuhara I, Ohashi Y. Probenazole-induced accumulation of
salicylic acid confers resistance to Magnaporthe grisea in adult rice plants.
Plant and Cell Physiology 2007;48:915e24.
[26] Sharma K, Butz AF, Finckh MR. Effects of host and pathogen genotypes on
inducibility of resistance in tomato (Solanum lycopersicum) to Phytophthora
infestans. Plant Pathology 2011;59:1062e71.
[27] Cohen Y. 3-aminobutyric acid induces systemic resistance against Per-
onospore tabacina. Physiological and Molecular Plant Pathology 1994;44:
273e88.
[28] Hugot K, Riviere MP, Moreilhon C, Dayem MA, Cozzitorto J, Arbiol G, et al.
Coordinated regulation of genes for secretion in tobacco at late developmental
stages: association with resistance against oomycetes. Plant Physiology 2004;
134:858e70.
[29] Hugot K, Aime S, Conrod S, Poupet A, Galiana E. Developmental regulated
mechanisms affect the ability of a fungal pathogen to infect and colonize
tobacco leaves. Plant Journal 1999;20:163e70.
[30] Kus JV, Zaton K, Sarkar R, Cameron R. Age-related resistance in Arabidopsis is
a developmentally regulated defense response to Pseudomonas syringae. Plant
Cell 2002;14:479e90.
[31] Domingo C, Andres F, Tharreau D, Iglesias DJ, Talon M. Constitutive expression of
OsGH3.1 reduces auxincontent andEnhances defense response andresistance to
afungal pathogeninrice. Molecular Plant-MicrobeInteractions 2009;22:201e10.
E. Steimetz et al. / Physiological and Molecular Plant Pathology 79 (2012) 89e96 96

Common questions

Powered by AI

H2O2 production is significantly higher in mature leaves (P3) compared to young leaves (P1) in PS3-treated and P. viticola-inoculated plants. In P1 leaves, H2O2 accumulates primarily in the stomata, while in P3 leaves, it is present in both stomata and mesophyll cells, indicating a more extensive defensive response .

In younger grapevine leaves (P1), PS3 treatment leads to visible intercellular hyphae and disorganized cytoplasm in host cells with haustoria, indicating HR-like cell death. In contrast, older leaves (P3) show scarce pathogen structures, necrotic debris in intercellular spaces, and phenolic compound deposits, suggesting a more robust and efficient defensive response .

Younger grapevine leaves (P1) exhibit higher severity of downy mildew with 90% sporulation, compared to older leaves (P2 and P3), which show a reduction of 80% and 50% respectively. PS3-induced resistance inversely correlates with leaf age, being most effective in P3 leaves with a 97% reduction, followed by 90% in P2, and least effective for P1 with a 60% reduction .

Stilbenes, including resveratrol and viniferins, act as phytoalexins contributing to the defense against P. viticola. After PS3 treatment, stilbene production is initially low but increases significantly by 3 dpi, particularly in P3 leaves compared to P1. This suggests that mature leaves have a higher capacity for stilbene synthesis, enhancing their defensive capabilities .

PS3-induced resistance is more effective in older grapevine leaves (P3) due to enhanced defenses such as increased H2O2 production and stronger cytological responses. Mature leaves also produce more stilbenes and have a higher expression of critical defense genes like SAMT1, which are less pronounced in younger leaves (P1). Developmental stage influences the interaction between PS3-induced defenses and preformed mechanisms, leading to better overall resistance in mature leaves .

Field application of PS3 faces challenges like variability in leaf development stages, as young leaves less effectively utilize PS3 due to prioritizing growth over defense. Field conditions might also affect PS3 uptake and subsequent defense activation. Moreover, temporal and spatial application needs alignment with leaf developmental status for maximum efficacy .

While PS3-induced resistance in grapevine shows promising results, generalizing to other species requires considering specific host-pathogen interactions, developmental stages, and environmental factors. The phenomenon resembles the systemic acquired resistance (SAR) seen in plants but depends on factors unique to each plant species, such as inherent metabolic rates and resource allocation between growth and defense .

Understanding the enhanced resistance of mature leaves due to PS3-induced defenses and ARR indicates strategies should focus on optimizing treatments for older leaves. Such treatments enhance existing defenses and maximize effectiveness. Given young leaves prioritize growth over defense, timing and application techniques might be adjusted to incorporate PS3 alongside growth stages, improving disease control while minimizing economic costs .

Preformed defenses, such as higher baseline peroxidase and glucanase activities, combine synergistically with PS3-induced responses like heightened H2O2 production and gene expression to amplify the defensive capacity of mature leaves. This dual defense mechanism creates a multi-layered barrier against downy mildew, with physical and chemical aspects working in tandem .

At 24 hpt, there is no significant difference in defense-related gene expression between young (P1) and mature (P3) leaves. However, at 48 hpi, the expression of the SAMT1 gene is significantly higher in mature (P3) leaves, implying a stronger or more sustained response in older leaves. Other genes showed marginal differences in expression between leaf ages .

You might also like