0% found this document useful (0 votes)
42 views40 pages

Advanced String Patterns: Wolfram Mathematica ® Tutorial Collection

Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
42 views40 pages

Advanced String Patterns: Wolfram Mathematica ® Tutorial Collection

Copyright
© All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd

Wolfram Mathematica Tutorial Collection

ADVANCED STRING PATTERNS


For use with Wolfram Mathematica

7.0 and later.


For the latest updates and corrections to this manual:
visit [Link]
For information on additional copies of this documentation:
visit the Customer Service website at [Link]/services/customerservice
or email Customer Service at info@[Link]
Comments on this manual are welcomed at:
comments@[Link]
Content authored by:
Oyvind Tafjord
Printed in the United States of America.
15 14 13 12 11 10 9 8 7 6 5 4 3 2
2008 Wolfram Research, Inc.
All rights reserved. No part of this document may be reproduced or transmitted, in any form or by any means,
electronic, mechanical, photocopying, recording or otherwise, without the prior written permission of the copyright
holder.
Wolfram Research is the holder of the copyright to the Wolfram Mathematica software system ("Software") described
in this document, including without limitation such aspects of the system as its code, structure, sequence,
organization, look and feel, programming language, and compilation of command names. Use of the Software unless
pursuant to the terms of a license granted by Wolfram Research or as otherwise authorized by law is an infringement
of the copyright.
Wolfram Research, Inc. and Wolfram Media, Inc. ("Wolfram") make no representations, express,
statutory, or implied, with respect to the Software (or any aspect thereof), including, without limitation,
any implied warranties of merchantability, interoperability, or fitness for a particular purpose, all of
which are expressly disclaimed. Wolfram does not warrant that the functions of the Software will meet
your requirements or that the operation of the Software will be uninterrupted or error free. As such,
Wolfram does not recommend the use of the software described in this document for applications in
which errors or omissions could threaten life, injury or significant loss.
Mathematica, MathLink, and MathSource are registered trademarks of Wolfram Research, Inc. J/Link, MathLM,
.NET/Link, and webMathematica are trademarks of Wolfram Research, Inc. Windows is a registered trademark of
Microsoft Corporation in the United States and other countries. Macintosh is a registered trademark of Apple
Computer, Inc. All other trademarks used herein are the property of their respective owners. Mathematica is not
associated with Mathematica Policy Research, Inc.
Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
General String Patterns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
Regular Expressions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
RegularExpression versus StringExpression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
String Manipulation Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
StringMatchQ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
StringFreeQ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
StringCases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
The Overlaps Option . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
StringPosition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
StringCount . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
StringReplace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
StringReplaceList . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
StringSplit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
For Perl Users . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
m/.../ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
s/.../.../ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
split(...) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
tr/.../.../ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24
Some Examples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Highlight Patterns . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
HTML Parsing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Find Money . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
Find Text in Files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
Tips and Tricks for Efficient Matching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
StringExpression versus RegularExpression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Conditions and PatternTests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Avoid Nested Quantifiers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Avoid Many Calls to a Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31
Rewrite General Expression Searches as String Searches . . . . . . . . . . . . . . . . . . . . . . . 32
Implementation Details . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Introduction
The general symbolic string patterns in Mathematica allow you to perform powerful string manipu -
lation efficiently. What follows discusses the details of string patterns, including usage and
implementation notes. The emphasis is on issues not mentioned elsewhere in the help system.
At the heart of Mathematica is a powerful language for describing patterns in general expres-
sions. This language is used in function definitions, substitutions, and searches, with constructs
like x_, a b, x .., and so on.
In[1]:= MatchQ[{a, b, c, d}, {___, x_, x_, ___}]
Out[1]= False
In[2]:= MatchQ[{a, b, c, c, d}, {___, x_, x_, ___}]
Out[2]= True
In[3]:= Cases[{a, 3, 4, b, c, 8}, _Integer]
Out[3]= {3, 4, 8]
A Mathematica string pattern uses the same constructs to describe patterns in a text string.
You can think of a string as a sequence of characters and apply the principles of general Mathe-
matica patterns. In addition there are several useful string-specific pattern constructs.
In[4]:= StringMatchQ["abcd", ___ ~~ x_ ~~ x_ ~~ ___]
Out[4]= False
In[5]:= StringMatchQ["abccd", ___ ~~ x_ ~~ x_ ~~ ___]
Out[5]= True
In[6]:= StringCases["a34bc8", DigitCharacter]
Out[6]= {3, 4, 8]
Regular expressions can be used as an alternative way to specify string patterns. These tend to
be more compact, but less readable.
In[7]:= StringMatchQ["abcd", RegularExpression[".+(.)\\1.+"]]
Out[7]= False
In[8]:= StringMatchQ["abccd", RegularExpression[".+(.)\\1.+"]]
Out[8]= True
In[9]:= StringCases["a34bc8", RegularExpression["\\d"]]
Out[9]= {3, 4, 8]
Here is a list of several functions that recognize string patterns.
StringMatchQ["s",patt] test whether s matches patt
StringFreeQ["s",patt] test whether s is free of substrings matching patt
StringCases["s",patt] give a list of the substrings of s that match patt
StringCases["s",lhs->rhs] replace each case of lhs by rhs
StringPosition["s",patt] give a list of the positions of substrings that match patt
StringCount["s",patt] count how many substrings match patt
StringReplace["s",lhs->rhs] replace every substring that matches lhs
StringReplaceList["s",lhs->rhs] give a list of all ways of replacing lhs
StringSplit["s",patt] split s at every substring that matches patt
StringSplit["s",lhs->rhs] split at lhs, inserting rhs in its place
Functions that support string patterns.
General String Patterns
A general string pattern is formed from pattern objects similar to the general pattern objects in
Mathematica. To join several string pattern objects, use the StringExpression operator --.
In[10]:= FullForm["a" ~~ _]
Out[10]//FullForm= StringExpression["a", Blank[]]
StringExpression is closely related to StringJoin, except nonstrings are allowed and lists
are not flattened. For pure strings, they are equivalent.
In[11]:= "aa" ~~ "bbb" ~~ "c"
Out[11]= aabbbc
The list of objects that can appear in a string pattern closely matches the list for ordinary Mathe-
matica patterns. In terms of string patterns, a string is considered a sequence of characters,
that is, "abc" can be thought of as something like String[a, b, c], to which the ordinary pat-
tern constructs apply.
The following objects can appear in a symbolic string pattern.
2 Advanced String Patterns
"string" a literal string of characters
_ any single character
__ any substring of one or more characters
___ any substring of zero or more characters
x_ , x__ , x___ substrings given the name x
x:pattern pattern given the name x
pattern.. pattern repeated one or more times
pattern... pattern repeated zero or more times
patt
1
,patt
2
, or patt
1
patt
2
a pattern matching at least one of the patt
i
patt/;cond a pattern for which cond evaluates to True
pattern?test a pattern for which test yields True for each character
Whitespace a sequence of whitespace characters
NumberString the characters of a number
DatePattern[spec] the characters of a date
charobj an object representing a character class (see below)
RegularExpression["regexp"] substring matching a regular expression
StringExpression[] an arbitrary string expression
The following represent classes of characters.
{c
1
,c
2
,] any of the "c
i
"
Characters["c
1
c
2
"] any of the "c
i
"
CharacterRange["c
1
","c
2
"] any character in the range "c
1
" to "c
2
"
HexadecimalCharacter hexadecimal digit 09, af, AF
DigitCharacter digit 09
LetterCharacter letter
WhitespaceCharacter space, newline, tab or other whitespace character
WordCharacter letter or digit
Except[p] any character except ones matching p
The following represent positions in strings.
Advanced String Patterns 3
StartOfString start of the whole string
EndOfString end of the whole string
StartOfLine start of a line
EndOfLine end of a line
WordBoundary boundary between word characters and others
ExceptWordBoundary anywhere except a word boundary
The following determine which match will be used if there are several possibilities.
Shortest[p] the shortest consistent match for p
Longest[p] the longest consistent match for p (default)
Some nontrivial issues regarding these objects follow.
The _, __, and ___ wildcards match any characters including newlines. To match any character
except newline (analogous to the "." in regular expressions), use Except["\n"],
Except["\n"] .., and Except["\n"] ....
In[12]:= StringCases["line1\nline2\n", __]
Out[12]= {line1
line2
]
In[13]:= StringCases["line1\nline2\n", Except["\n"] ..]
Out[13]= {line1, line2]
In[14]:= StringCases["line1\nline2\n", RegularExpression[".+"]]
Out[14]= {line1, line2]
A list of patterns, such as {"a", "b", "c"], is equivalent to a list of alternatives, such as
"a" "b" "c". This is convenient in that functions like Characters and CharacterRange
can be used to specify classes of characters.
In[15]:= StringReplace["the cat in the hat", x : Characters["aeiou"] x <> x]
Out[15]= thee caat iin thee haat
4 Advanced String Patterns
When Condition (/;) is used, the patterns involved are treated as strings as far as the rest
of Mathematica is concerned, so you need to use ToExpression in some cases.
In[16]:= StringCases["a13 a18 a41 a42",
"a" ~~ x : DigitCharacter .. ~~ WordBoundary /; PrimeQ[ToExpression[x]] x]
Out[16]= {13, 41]
Similar to ordinary Mathematica patterns, the function in PatternTest (?) is applied to each
individual character.
In[17]:= StringCases["125378132", __ ?(ToExpression[] < 5 &)]
Out[17]= {12, 3, 132]
The Whitespace construct is equivalent to WhitespaceCharacter ...
In[18]:= StringReplace["13 \t 17 \n22 19", Whitespace - ","]
Out[18]= 13,17,22,19
You can insert a RegularExpression object into a general string pattern.
In[19]:= StringCases["a13b12c17a32", "a" ~~ x : RegularExpression["\\d+"] x]
Out[19]= {13, 32]
This inserts a lookbehind constraint (see "Regular Expressions") to ensure that you only pick
words preceded by "the ".
In[20]:= StringCases["the cat in the hat",
RegularExpression["(?<=the )"] ~~ WordCharacter ..]
Out[20]= {cat, hat]
StringExpression objects can be nested.
In[21]:= StringCases["ba3a1a78a2b7ba9", "b" ~~ ("a" ~~ DigitCharacter) ..]
Out[21]= {ba3a1a7, ba9]
The Except construct for string patterns takes a single argument that should represent a single
character or a class of single characters.
This deletes all nonvowel characters from the string.
In[22]:= StringReplace["the cat in the hat", Except[Characters["aeiou"]] - ""]
Out[22]= eaiea
When trying to match patterns of variable length (such as __ and patt ..), the longest possi-
ble match is tried first by default. To force the matcher to try the shortest match first, you can
wrap the relevant part of the pattern in Shortest[ ].
Advanced String Patterns 5
When trying to match patterns of variable length (such as __ and patt ..), the longest possi-
ble match is tried first by default. To force the matcher to try the shortest match first, you can
wrap the relevant part of the pattern in Shortest[ ].
In[23]:= StringCases["(ab) (cde)", "(" ~~ __ ~~ ")"]
Out[23]= {(ab) (cde)]
In[24]:= StringCases["(ab) (cde)", Shortest["(" ~~ __ ~~ ")"]]
Out[24]= {(ab), (cde)]
If for some reason you need a longest match within the short match, you can use Longest.
In[25]:= StringCases["(ab132cd)137(ef576gh)",
Shortest["(" ~~ ___ ~~ x : DigitCharacter .. ~~ ___ ~~ ")"] x]
Out[25]= {1, 5]
In[26]:= StringCases["(ab132cd)(ef576gh)",
Shortest["(" ~~ ___ ~~ Longest[x : DigitCharacter ..] ~~ ___ ~~ ")"] x]
Out[26]= {132, 576]
You could alternatively rewrite this pattern without use of Longest.
In[27]:= StringCases["(ab132cd)(ef576gh)",
"(" ~~ Shortest[___] ~~ x : DigitCharacter .. ~~ Shortest[___] ~~ ")" x]
Out[27]= {132, 576]
Regular Expressions
The regular expression syntax follows the underlying Perl Compatible Regular Expressions
(PCRE) library, which is close to the syntax of Perl. (See [1] for further information and documen-
tation.) A regular expression in Mathematica is denoted by the head RegularExpression.
The following basic elements can be used in regular expression strings.
6 Advanced String Patterns
c the literal character c
. any character except newline
[c
1
c
2
] any of the characters c
i
[c
1
-c
2
] any character in the range c
1
c
2

[^c
1
c
2
] any character except the c
i
p- p repeated zero or more times
p+ p repeated one or more times
p? zero or one occurrence of p
p{m,n] p repeated between m and n times
p-?, p+?, p ?? the shortest consistent strings that match
p-+, p++ , p?+ possessive match
(p
1
p
2
) strings matching the sequence p
1
, p
2
,
p
1
|p
2
strings matching p
1
or p
2

The following represent classes of characters.
\\d digit 09
\\D nondigit
\\s space, newline, tab or other whitespace character
\\S non-whitespace character
\\w word character (letter, digit or _)
\\W nonword character
[[:class:]] characters in a named class
[^[:class:]] characters not in a named class
The following named classes can be used: alnum, alpha, ascii, blank, cntrl, digit, graph, lower, print,
punct, space, upper, word, and xdigit.
The following represent positions in strings.
Advanced String Patterns 7
^ the beginning of the string (or line)
$ the end of the string (or line)
\\A the beginning of the string
\\z the end of the string
\\Z the end of the string (allowing for a single newline charac -
ter first)
\\b word boundary
\\B anywhere except a word boundary
The following set options for all regular expression elements that follow them.
(?i) treat uppercase and lowercase as equivalent (ignore case)
(?m) make ^ and $ match start and end of lines (multiline
mode)
(?s) allow . to match newline
(?x) disregard all whitespace and treat everything between ""
and "\n" as comments
(?-\#c) unset options
The following are lookahead/lookbehind constructs.
(?=p) the following text must match p
(?!p) the following text cannot match p
(?= p) the preceding text must match p
(?!p) the preceding text cannot match p
Discussion of a few issues regarding regular expressions follows.
This looks for runs of word characters of length between 2 and 4.
In[28]:= StringCases["a bb ccc dddd eeeee", RegularExpression["\\b\\w{2,4}\\b"]]
Out[28]= {bb, ccc, dddd]
8 Advanced String Patterns
With the possessive "+" quantifier, as many characters as possible are grabbed by the
matcher, and no characters are given up, even if the rest of the patterns require it.
In[29]:= StringCases["a2 b6", RegularExpression["\\w+\\d"]]
Out[29]= {a2, b6]
In[30]:= StringCases["a2 b6", RegularExpression["\\w++\\d"]]
Out[30]= {]
In[31]:= StringCases["a2 b6", RegularExpression["\\D++\\d"]]
Out[31]= {a2, b6]
[[ : xdigit :]] corresponds to characters in a hexadecimal number.
In[32]:= StringCases["ff, 13, 1a3, xyz, 3b", RegularExpression["[[:xdigit:]]+"]]
Out[32]= {ff, 13, 1a3, 3b]
The complete list of characters that need to be escaped in a regular expression consists of ., \,
?, (, ), {, ], [, ], ^, $, -, +, and |. For instance, to write a literal period, use "\\." and to write
a literal backslash, use "\\\\".
Inside a character class "[]", the complete list of escaped characters is ^, -, \, [, and ].
By default, ^ and $ match the beginning and end of the string, respectively. In multiline mode,
these match the beginning/end of lines instead.
In[33]:= StringCases["line1\nline2", RegularExpression["^.+"]]
Out[33]= {line1]
In[34]:= StringCases["line1\nline2", RegularExpression["(?m)^.+"]]
Out[34]= {line1, line2]
In multiline mode, \\ A and \\ Z can be used to denote the beginning and end of the string.
In[35]:= StringCases["line1\nline2", RegularExpression["(?m)\\A.+"]]
Out[35]= {line1]
Advanced String Patterns 9
The (? x) modifier allows you to add whitespace and comments to a regular expression for
readability.
In[36]:= StringCases["12.45 bc58.11",
RegularExpression["\<(?x)
\\d+ \\. remember to escape the period
\\d+\>"]]
Out[36]= {12.45, 58.11]
Named subpatterns are achieved by surrounding them with parentheses (subpatt); they then
become numbered subpatterns. The number of a given subpattern counts the opening parenthe-
sis, starting from the start of the pattern. You can refer to these subpatterns using \\ n for the
n
th
pattern later in the pattern, or by "$n" in the right-hand side of a rule. "$0" refers to all of
the matched pattern.
In[37]:= StringCases["a1b6a3b3a3c3a8b8", RegularExpression["(a(\\d))b\\2"]]
Out[37]= {a3b3, a8b8]
In[38]:= StringCases["a1b6a3b3a3c3a8b8",
RegularExpression["(a(\\d))b\\2"] - {"$0", "$1", "Number:$2"}]
Out[38]= {{a3b3, a3, Number:3], {a8b8, a8, Number:8]]
If you need a literal $ in this context (when the head of the left-hand side is
RegularExpression), you can escape it by using backslashes (for example, "\\$2").
In[39]:= StringCases["a1b6a3b3a3c3a8b8",
RegularExpression["(a(\\d))b\\2"] - {"$0", "$1", "Number:$2", "Literal:\\$2"}]
Out[39]= {{a3b3, a3, Number:3, Literal:$2], {a8b8, a8, Number:8, Literal:$2]]
If you happen to need a single literal backslash followed by a literal $ under these circum-
stances, you need to be a bit tricky and split into two strings temporarily.
In[40]:= StringCases["a1b6a3b3a3c3a8b8", RegularExpression["(a(\\d))b\\2"] :>
{"$0", "$1", "Number:$2", "Literal:\\" <> "\\$2"}]
Out[40]= {{a3b3, a3, Number:3, Literal:\$2], {a8b8, a8, Number:8, Literal:\$2]]
If you need to group a part of the pattern, but you do not want to count the group as a num-
bered subpattern, you can use the (? :patt) construct.
In[41]:= StringCases["a11b16c22b77", RegularExpression["(?:a|b)(\\d)\\1"]]
Out[41]= {a11, b77]
Lookahead and lookbehind patterns are used to ensure a pattern is matched without actually
including that text as part of the match.
10 Advanced String Patterns
This picks out words following the string "the ".
In[42]:= StringCases["the cat in the hat", RegularExpression["(?<=the )\\w+"]]
Out[42]= {cat, hat]
This tries to pick out all even numbers in the string, but it will find matches that include partial
numbers.
In[43]:= StringCases["a23b42c63d80, 123",
x : RegularExpression["\\d+"] /; Mod[ToExpression[x], 2] = 0]
Out[43]= {2, 42, 6, 80, 12]
Using lookbehind/lookahead, you can ensure that the characters before/after the match are not
digits (note that the lookbehind test is superfluous in this particular case).
In[44]:= StringCases["a23b42c63d80, 123",
x : RegularExpression["(?<!\\d)\\d+(?!\\d)"] /; Mod[ToExpression[x], 2] = 0]
Out[44]= {42, 80]
RegularExpression versus StringExpression
There is a close correspondence between the various pattern objects that can be used in general
symbolic string patterns and in regular expressions. Here is a list of examples of patterns written
as regular expressions and as symbolic string patterns.
regular expression general string
pattern
explanation
"abc" "abc" the literal string "abc"
"." Except["\n"] any character except newline
"(?s)." _ any character
"(?s).+" __ one or more characters (greedy)
"(?s).+?" Shortest[__] one or more characters (nongreedy)
"(?s).-" ___ zero or more characters
".-" Except["\n"]... zero or more characters (except newlines)
"a?b" "a" ""--"b" zero or one "a" followed by a "b" (that is,
"b" or "ab")
Advanced String Patterns 11
"[abef]" Characters[
"abef"]
any of the characters "a", "b", "e", or
"f"
"[abef]+" Characters[
"abef"]..
one or more of the characters "a", "b",
"e", or "f"
"[a-f]" CharacterRange[
"a","f"]
any character in the range between "a"
and "f"
"[^abef]" Except
Characters[
"abef"]
any character except the characters "a",
"b", "e", or "f"
"ab|efg" "ab" "efg" match the strings "ab" or "efg"
"(ab|ef)gh"
or "(?:ab|ef)gh"
("ab" "ef")--
"gh"
"ab" or "ef" followed by "gh" (that is,
"abgh" or "efgh")
"\\s" WhitespaceCh
aracter
any whitespace character
"\\s+" Whitespace one or more characters of whitespace
"(a|b)\\1" x:"a" "b"--x_ this will match either "aa" or "bb"
"\\d" DigitCharacter any digit character
"\\D" Except
DigitCharacter

any nondigit character


"\\d+" DigitCharacter
..
one or more digit characters
"\\w" WordCharacter
"_"
any digit, letter, or "_" character
"[[:alpha:]]"
LetterCharact
er
any letter character
"[^[:alpha:]]" Except
LetterCharact
er

any nonletter character


"^abf" or "\\Aabc" StartOfString--
"abf"
the string "abf" at the start of the string
"(?m)^abf" StartOfLine--
"abf"
the string "abf" at the start of a line
"wxz$" or "wxz\\z" "wxz"--
EndOfString
the string "wxz" at the end of the string
"wxz\\Z" "wxz"--
"\n" ""--
EndOfString
the string "wxz" at the end of the string or
before newline at the end of the string
Pattern objects that can be used in general string patterns, but not in regular expressions,
include conditions (/;) and pattern tests (?) that can access general Mathematica code during
the match.
12 Advanced String Patterns
Pattern objects that can be used in general string patterns, but not in regular expressions,
include conditions (/;) and pattern tests (?) that can access general Mathematica code during
the match.
Some special constructs in regular expressions are not directly available in general string pat-
terns. These include lookahead/lookbehinds and repeats of a given length. They can be embed-
ded into a larger general string pattern by inserting a RegularExpression object.
String Manipulation Functions
The following discusses some particulars and subtleties in the various string manipulation func-
tions (see the reference pages for more information on these functions).
StringMatchQ
StringMatchQ is used to check whether a whole string matches a certain pattern.
In[45]:= StringMatchQ["test", "t" ~~ __ ~~ "t"]
Out[45]= True
In[46]:= StringMatchQ["tester", "t" ~~ __ ~~ "t"]
Out[46]= False
StringMatchQ is special in that it also allows the metacharacters - and to be entered as
wildcards (for backward compatibility reasons). - is equivalent to Shortest[___]
(RegularExpression["(?s).-?"]) and is equivalent to Except[CharacterRange["A", "Z"]]
(RegularExpression["[^A-Z]"]).
The following three patterns are therefore equivalent.
In[47]:= StringMatchQ["test", _ ~~ "e+"]
Out[47]= True
In[48]:= StringMatchQ["test", _ ~~ "e" ~~ Shortest[___]]
Out[48]= True
In[49]:= StringMatchQ["test", RegularExpression["(?s).e.+?"]]
Out[49]= True
Note that technically the appearance of Shortest does not make a difference here, since we are
only looking for a possible match.
Advanced String Patterns 13
Note that technically the appearance of Shortest does not make a difference here, since we are
only looking for a possible match.
If you need to access parts of the string matched by subpatterns in the pattern, use
StringCases instead.
StringMatchQ has a SpellingCorrection option for finding matches allowing for a small
number of discrepancies. This only works for patterns consisting of a single literal string.
In[50]:= StringMatchQ["alpha", "alpa", SpellingCorrection - True]
Out[50]= True
StringFreeQ
StringFreeQ is used to check whether a string contains a substring matching the pattern.
You cannot extract the matching substring; to do this you would use StringCases.
In[51]:= StringFreeQ["abcde", "b" ~~ __ ~~ "d"]
Out[51]= False
In[52]:= StringFreeQ["abcde", RegularExpression["b.+d"]]
Out[52]= False
StringCases
StringCases is a general purpose function for finding occurrences of patterns in a string, pick-
ing out subpatterns, and processing the results.
Find substrings matching a pattern.
In[53]:= StringCases["a1b2a26d15a42", "a" ~~ _]
Out[53]= {a1, a2, a4]
Pick apart the matching substring.
In[54]:= StringCases["a1b2a26d15a42", "a" ~~ x : DigitCharacter .. - x]
Out[54]= {1, 26, 42]
In[55]:= StringCases["a1b2a26d15a42", RegularExpression["a(\\d+)"] - "$1"]
Out[55]= {1, 26, 42]
Restrict the number of matches.
14 Advanced String Patterns
Restrict the number of matches.
In[56]:= StringCases["a b c d e", LetterCharacter, 3]
Out[56]= {a, b, c]
You can use a list of rules.
In[57]:= StringCases["a13bF5b1Aa33", {"a" ~~ x : DigitCharacter .. - f1[x],
"b" ~~ x : (DigitCharacter CharacterRange["A", "F"]) .. - hex[x]}]
Out[57]= {f1[13], hex[F5], hex[1A], f1[33]]
You can also give a list of strings as the first argument for efficient processing of many strings
(see "Tips and Tricks for Efficient Matching" for a discussion).
In[58]:= StringCases[{"cat", "in", "the", "hat"}, __ ~~ "t" ~~ EndOfString]
Out[58]= {{cat], {], {], {hat]]
In[59]:= Flatten[]
Out[59]= {cat, hat]
The Overlaps Option
The Overlaps option for StringCases, StringPosition, and StringCount deals with how the
matcher proceeds after finding a match. It has three possible settings: False, True, or All. The
default is False for StringCases and StringCount, while it is True for StringPosition.
With Overlaps -> False, the matcher continues the match testing at the character following
the last matched substring.
In[60]:= StringCases["(a(b)c(d)", Shortest["(" ~~ __ ~~ ")"]]
Out[60]= {(a(b), (d)]
With Overlaps -> True, the matcher continues at the character following the first character
of the last matched substring (when a single pattern is involved).
In[61]:= StringCases["(a(b)c(d)", Shortest["(" ~~ __ ~~ ")"], Overlaps - True]
Out[61]= {(a(b), (b), (d)]
Advanced String Patterns 15
With Overlaps -> All, the matcher keeps starting at the same position until no more new
matches are found.
In[62]:= StringCases["(a(b)c(d)", Shortest["(" ~~ __ ~~ ")"], Overlaps - All]
Out[62]= {(a(b), (a(b)c(d), (b), (b)c(d), (d)]
If multiple patterns are given in a list, Overlaps -> True will cause the matcher to start at
the same position once for each of the patterns before proceeding to the next character.
In[63]:= StringCases["(a(b)c(d)",
{Shortest["(" ~~ __ ~~ ")"], Shortest["(" ~~ __ ~~ "("]}, Overlaps - True]
Out[63]= {(a(b), (a(, (b), (b)c(, (d)]
In[64]:= StringCases["(a(b)c(d)",
{Shortest["(" ~~ __ ~~ ")"], Shortest["(" ~~ __ ~~ "("]}, Overlaps - False]
Out[64]= {(a(b), (d)]
Note that with Overlaps -> True, there can thus be a difference between specifying a list of
patterns and using the alternatives operator (|).
In[65]:= StringCases["ab", {_, __}, Overlaps - True]
Out[65]= {a, ab, b, b]
In[66]:= StringCases["ab", _ __, Overlaps - True]
Out[66]= {a, b]
StringPosition
StringPosition works much like StringCases, except the positions of the matching
substrings are returned.
In[67]:= StringPosition["a1b2a26d15a42", "a" ~~ _]
Out[67]= {{1, 2], {5, 6], {11, 12]]
In[68]:= StringTake["a1b2a26d15a42", ] & /
Out[68]= {a1, a2, a4]
The Overlaps option is True by default (see "The Overlaps Option" for more details on
this option).
In[69]:= StringPosition["(a(b)c(d)", Shortest["(" ~~ __ ~~ ")"]]
Out[69]= {{1, 5], {3, 5], {7, 9]]
Note that even empty strings can be matches.
16 Advanced String Patterns
Note that even empty strings can be matches.
In[70]:= StringPosition["abc", ___]
Out[70]= {{1, 3], {2, 3], {3, 3], {4, 3]]
StringCount
StringCount returns the number of matching substrings (which are found by
StringPosition or StringCases). It is useful for cases with many matches where memory
for storing all the substrings might be an issue.
In[71]:= StringCount["abaababba", "a" ~~ ___ ~~ "b", Overlaps - All]
Out[71]= 12
In[72]:= StringCases["abaababba", "a" ~~ ___ ~~ "b", Overlaps - All] // Length
Out[72]= 12
Note that Overlaps -> False is the default for StringCount.
StringReplace
StringReplace is used for substituting substrings matching the given patterns.
In[73]:= StringReplace["abcde", {"a" - "A", "cd" - "XX"}]
Out[73]= AbXXe
Named patterns can be used as strings on the right-hand side of the replacement rules. Note
the use of RuleDelayed () to avoid premature evaluation.
In[74]:= StringReplace["this is a test", x : WordCharacter .. StringReverse[x]]
Out[74]= siht si a tset
When using regular expressions, it is convenient to remember that "$0" on the right-hand side
refers to the whole matched substring.
In[75]:= StringReplace["this is a test", RegularExpression["\\w+"] StringReverse["$0"]]
Out[75]= siht si a tset
Advanced String Patterns 17
You can limit the number of replacements made by specifying a third argument.
In[76]:= StringReplace["this is a test", x : WordCharacter .. StringReverse[x], 1]
Out[76]= siht is a test
Note that the replacement does not have to be a string. If the result is not a string, a
StringExpression is returned.
In[77]:= StringReplace["some <b>bold</b> and <i>italics</i>.",
Shortest["<" ~~ x___ ~~ ">"] Tag[x]]
Out[77]= some -- Tag[b] -- bold -- Tag[/b] -- and -- Tag[i] -- italics -- Tag[/i] -- .
In[78]:= InputForm[]
Out[78]//InputForm= StringExpression["some ", Tag["b"], "bold", Tag["/b"], " and ", Tag["i"], "italics", Tag["/i"], "."]
There is limited support for using the old MetaCharacters option in conjunction with general
string patterns, but this option is deprecated and its use should be avoided.
StringReplaceList
StringReplaceList returns a list of strings where a single string replacement has been
made in all possible ways.
In[79]:= StringReplaceList["abaac", "a" ~~ x_ ToUpperCase[x]]
Out[79]= {Baac, abAc, abaC]
If a list of strings is given as input, the output is a nested list of results.
In[80]:= StringReplaceList[{"abaac", "baaba"}, "a" ~~ x_ ToUpperCase[x]]
Out[80]= {{Baac, abAc, abaC], {bAba, baBa]]
StringSplit
StringSplit is useful for splitting a string into many strings at delimiters matching a pattern.
By default, the splits happen at runs of whitespace.
In[81]:= StringSplit["this is a test"]
Out[81]= {this, is, a, test]
18 Advanced String Patterns
For instance, to split a normal sentence into words, you need to also include punctuation in the
delimiter.
In[82]:= StringSplit["A sentence: with commas, semicolons; etc...!?",
Characters[":,;.!? "] ..]
Out[82]= {A, sentence, with, commas, semicolons, etc]
By default, empty strings at the beginning and the end of the result are removed.
In[83]:= StringSplit[":a:b:c:", ":"]
Out[83]= {a, b, c]
These can be included by specifying All as a third argument.
In[84]:= StringSplit[":a:b:c:", ":", All]
Out[84]= {, a, b, c, ]
The third argument can also be a number giving the maximum number of strings to split into.
In[85]:= StringSplit["this is a test", Whitespace, 2]
Out[85]= {this, is a test]
This splits a string into individual lines.
In[86]:= StringSplit["line1\nthis is line 2\nline3", "\n"]
Out[86]= {line1, this is line 2, line3]
You can also split at patterns that match positions, such as StartOfLine. This keeps the
newline characters in the result.
In[87]:= StringSplit["line1\nthis is line 2\nline3", StartOfLine]
Out[87]= {line1
, this is line 2
, line3]
You can keep the delimiters, or parts of the delimiters, in the output by using a rule as the
second argument.
In[88]:= StringSplit["this is a test", " " - " "]
Out[88]= {this, , is, , a, , test]
In[89]:= StringSplit["this is a test", " " - ":"]
Out[89]= {this, :, is, :, a, :, test]
Advanced String Patterns 19
In[90]:= StringSplit["the <tag1>first</tag1> and the <tag2>second</tag2>",
Shortest["<" ~~ __ ~~ ">"]]
Out[90]= {the , first, and the , second]
In[91]:= StringSplit["the <tag1>first</tag1> and the <tag2>second</tag2>",
Shortest["<" ~~ x__ ~~ ">"] Tag[x]]
Out[91]= {the , Tag[tag1], first, Tag[/tag1], and the , Tag[tag2], second, Tag[/tag2]]
You can give a list of patterns and rules as well; the delimiters matching the patterns will be
left out of the result.
In[92]:= StringSplit["the <tag1>first</tag1> and the <tag2>second</tag2>",
{Whitespace, Shortest["<" ~~ x__ ~~ ">"] Tag[x]}] // InputForm
Out[92]//InputForm= {"the", "", Tag["tag1"], "first", Tag["/tag1"], "", "and", "the", "", Tag["tag2"], "second", Tag["/tag2"]}
For Perl Users
Overview
With the addition of general string patterns, Mathematica can be a powerful alternative to lan-
guages like Perl and Python for many general, everyday programming tasks. For people familiar
with Perl syntax, and the way Perl does string manipulation, the following rough guide shows
how to get similar functionality in Mathematica.
Here is an overview of the Mathematica functions involved in constructing Perl-like functions.
20 Advanced String Patterns
Perl construct Mathematica
function
explanation
m/.../ StringFreeQ or
StringCases
match a string with a regular expression,
possibly extracting subpatterns
s/.../.../ StringReplace replace substrings matching a regular
expression
split (...) StringSplit split a string at delimiters matching a
regular expression
tr/.../.../ StringReplace replace characters by other characters
/i IgnoreCase->
True or "(?i)"
case-insensitive modifier
/s "(?s)" force "." to match all characters (including
newlines)
/x "(?x)" ignore whitespace and allow extended
comments in regular expression
/m "(?m)" multiline mode ("^" and "$" match
start/end of lines)
Following are some common Perl constructs in more detail.
m/ .../
The match operator m / regex / tests whether a string contains a substring matching the regex.
For simple matches of this sort in Mathematica, use StringFreeQ.
Here is a Perl snippet for testing whether a string contains a "b" somewhere after an "a".
$string = "sdakdb";
if ($string =~ m/a.*b/){
print "Match!";
}
Here is a Mathematica version of the same test.
In[93]:= string = "sdakdb";
If[! StringFreeQ[string, RegularExpression["a.+b"]], Print["Match!"]]
Match!
If parts of the matched string need to be accessed later, using $1, $2, in Perl, the best Mathe-
matica function to use is normally StringCases.
Here is Perl code for extracting an error message.
Advanced String Patterns 21
Here is Perl code for extracting an error message.
$res = "ERROR = paper jam";
if ($res =~ m/ERROR = (.*)/){
print "Hey, you should check the $1!";
}
Here is a Mathematica version.
In[95]:= res = "ERROR = paper jam";
With[{test = StringCases[res, RegularExpression["ERROR = (.+)"] - "$1"]},
If[test =!= {}, Print["Hey, you should check the ", test[[1]], "!"]]]
Hey, you should check the paper jam!
Here is Perl code for extracting several subpatterns at once.
$date = "88/6/13";
($year, $month, $day) = $date =~ m/^(\d+)/(\d+)/(\d+)$/;
In Mathematica, this is done with StringCases.
In[97]:= date = "88/6/13";
{year, month, day} = StringCases[date,
RegularExpression["^(\\d+)/(\\d+)/(\\d+)$"] -> {"$1", "$2", "$3"}][[1]]
Out[98]= {88, 6, 13]
This is similar to assigning all the matches to an array using the / g modifier.
$text = "[Link]";
@nums = $text =~ m/\d+/g;
The same thing is easily done with StringCases in Mathematica.
In[99]:= text = "[Link]";
nums = StringCases[text, RegularExpression["\\d+"]]
Out[100]= {128, 32, 13, 117]
s/ .../ .../
The obvious Mathematica version of the Perl s /... /... / substitution operator is
StringReplace.
$text = "abcagh";
$text =~ s/a./XX/;
22 Advanced String Patterns
The default Perl behavior is to do a single replacement.
In[101]:= text = "abcagh";
StringReplace[text, RegularExpression["a."] -> "XX", 1]
Out[102]= XXcagh
The / g modifier in Perl does global replacement of all matches.
$text =~ s/a./XX/g
In[103]:= StringReplace[text, RegularExpression["a."] -> "XX"]
Out[103]= XXcXXh
Using the evaluation / e modifier, Perl can use subpatterns as part of the replacement. This is
easily done in Mathematica.
$text = "13 27 3";
$text =~ s/(\d+)/$1$1/eg
In[104]:= text = "13 27 3";
StringReplace[text, RegularExpression["(\\d+)"] "$1$1"]
Out[105]= 1313 2727 33
split( ...)
The Perl split command is similar to StringSplit in Mathematica.
$text = "ab:cd:efg";
split(/:/, $text)
In[106]:= text = "ab:cd:efg";
StringSplit[text, ":"]
Out[107]= {ab, cd, efg]
You can specify the number of blocks to split into in both Perl and Mathematica.
split(/:/, $text,2)
In[108]:= StringSplit[text, ":", 2]
Out[108]= {ab, cd:efg]
Advanced String Patterns 23
A split with capturing parentheses in the pattern, for which the captured substrings are
included in the result, can be done in Mathematica using rules in the second argument of
StringSplit. Compared to Perl, in Mathematica it is easy to then apply a function to these
substrings.
$text = "test with <tag1>tags</tag1> and <b>more</b>";
split(/<([^>]*)>/, $text)
In[109]:= text = "test with <tag1>tags</tag1> and <b>more</b>";
StringSplit[text, RegularExpression["<([^>]+)>"] - "$1"] // InputForm
Out[110]//InputForm= {"test with ", "tag1", "tags", "/tag1", " and ", "b", "more", "/b"}
In[111]:= text = "test with <tag1>tags</tag1> and <b>more</b>";
StringSplit[text, RegularExpression["<([^>]+)>"] Tag["$1"]] // InputForm
Out[112]//InputForm= {"test with ", Tag["tag1"], "tags", Tag["/tag1"], " and ", Tag["b"], "more", Tag["/b"]}
tr/ .../ .../
The Perl tr command can be simulated using Mathematica StringReplace together with the
appropriate list of rules.
Here is the simplest form where the characters "a", "b", and "c" are replaced by "X", "Y",
and "Z", respectively.
$text = "abcdef";
$text =~ tr/abc/XYZ/
This generates the appropriate rules in Mathematica using Thread.
In[113]:= text = "abcdef";
StringReplace[text, Thread[Rule[Characters["abc"], Characters["XYZ"]]]]
Out[114]= XYZdef
Here is an example where the replacement list is shorter than the character list, so "d", "e",
and "f" are all replaced by "Z".
$text = "abcdefghi";
$text =~ tr/abcdef/WXYZ/
In[115]:= text = "abcdefghi";
StringReplace[text, Append[
Thread[Rule[Characters["abc"], Characters["WXY"]]], Characters["def"] - "Z"]]
Out[116]= WXYZZZghi
24 Advanced String Patterns
Character ranges in Perl are emulated using CharacterRange in Mathematica.
$text = "this and that";
$text =~ tr/a-z/x/
In[117]:= text = "this and that";
StringReplace[text, CharacterRange["a", "z"] - "x"]
Out[118]= xxxx xxx xxxx
With the / d modifier, the surplus characters are instead deleted.
$text = "abcdefghi";
$text =~ tr/abcdef/WXYZ/d
In[119]:= text = "abcdefghi";
StringReplace[text, Append[
Thread[Rule[Characters["abcd"], Characters["WXYZ"]]], Characters["ef"] - ""]]
Out[120]= WXYZghi
With the / c modifier, the complement of the character list is used.
$text =~ tr/aeh/ /c
In[121]:= StringReplace[text, Except[Characters["aeh"]] - " "]
Out[121]= a e h
In[122]:= StringReplace[text, RegularExpression["[^aeh]"] - " "]
Out[122]= a e h
The / s modifier squeezes down to one any run of characters translating into the same
character.
$text = "abbcccddddeeeeeeffeeded";
$text =~ tr/abcde/ABCD/s
You get the same effect in Mathematica using Repeated (..).
In[123]:= text = "abbcccddddeeeeeeffeeded ";
StringReplace[text,
Append[Thread[Rule[Repeated / Characters["abc"], Characters["ABC"]]],
Characters["de"] .. - "D"]]
Out[124]= ABCDffD
Some Examples
Some brief examples of practical uses of string patterns are presented in this section.
Highlight Patterns
Advanced String Patterns 25
Highlight Patterns
This defines a 1000-base random DNA string.
In[131]:= SeedRandom[1234];
dna = StringJoin[Table[{"a", "c", "g", "t"}[[RandomInteger[{1, 4}]]], {1000}]]
Out[131]= acaaccgccgcgaattctcacaaacgtcgagtgtgatatagaaaatcccagatcacactatagggtggaaaccaggtgatagttgcctctgcca
tgcatatgcgattaaatgttcgttgaatatgagtaaagaatctaagcgtagtttttatagtaaagaccccgcgcctctgcgcgtgatagtg
ttaccgacgcatctcgatgttgtacatgtagcactgtacgtaatcattatacgatttccataacgtaagctgggtaacagacctaacgtag
ggttcatctacgcgcttatcctccgacctaggattgcgtctagaaaactgaacaagtaaaccgtactcctttatccgccgacagtccagaa
cagtctgacttccagctacttaatggtttcccagatttcctgcggaatacctcgaccgtgtggccattgctccaccaccgcaattcgcctc
ttctgcacaggtccacgcacgttttccctgagcataaaaacccagcaatacgaaaggttctctacacatcagcagcttcccgagtgacctg
attggggctgcgctataacgtcggtcgcgtttccatcaggacgcatgcagcgacgcctgcagcagcagtccccttcacagcgtacagggct
ctggtaagggcagccagtttcgctaacggtcctgttgcttacatgcgcatacaattatgccaaacggacacgtgctatccagacgaggtgt
cgtaaaggggatttctaagtgaccagaattactgtcagacgaccttaagatagtcaggctttcagcggtagataggcgggatgaatcgaaa
gcaatgacaaggcccggtcgccagagagacaggcttagtattcagtaagcagtagcgcgacatacccgaaactccgcgcgggtatagagta
catctactaggtgtgtatctgcagcacattagggctattcagaccgttaattccggcctgaggccatgccgacagaacaaattgcct
This highlights parts of the DNA that match a certain pattern.
In[132]:= StringReplace]dna,
x : ["ag" ~~ _ ~~ _ ~~ "t" ~~ _ ~~ "ca"| "\!\(\+StyleBox[\"" <> x <>
"\",FontColor->RGBColor[1,0,0],FontSize->18,FontWeight->\"Bold\"]\)"
Out[132]= acaaccgccgcgaattctcacaaacgtcgagtgtgatatagaaaatcccagatcacactatagggtggaaaccaggtgatagttgcctctgcca
tgcatatgcgattaaatgttcgttgaatatgagtaaagaatctaagcgtagtttttatagtaaagaccccgcgcctctgcgcgtgatagtg
ttaccgacgcatctcgatgttgtacatgtagcactgtacgtaatcattatacgatttccataacgtaagctgggtaacagacctaacg
tagggttcat
ctacgcgcttatcctccgacctaggattgcgtctagaaaactgaacaagtaaaccgtactcctttatccgccgacagtccagaacagtctg
acttccagctacttaatggtttcccagatttcctgcggaatacctcgaccgtgtggccattgctccaccaccgcaattcgcctcttctgca
caggtccacgcacgttttccctgagcataaaaacccagcaatacgaaaggttctctacacatcagcagcttcccgagtgacctgattgggg
ctgcgctataacgtcggtcgcgtttccatcaggacgcatgcagcgacgcctgcagcagcagtccccttcacagcgtacagggctctgg
taagggcagccagtttcgctaacggtcctgttgcttacatgcgcatacaattatgccaaacggacacgtgctatccagacgaggtgtcgta
aaggggatttctaagtgaccagaattactgtcagacgaccttaagatagtcaggctttcagcggtagataggcgggatgaatcgaaagcaa
tgacaaggcccggtcgccagagagacaggcttagtattcagtaagcagtagcgcgacatacccgaaactccgcgcgggtat
agagtaca
tctactaggtgtgtatctgcagcacattagggctattcagaccgttaattccggcctgaggccatgccgacagaacaaattgcct
26 Advanced String Patterns
Here is the same result using a regular expression.
In[133]:= StringReplace[dna, RegularExpression["ag..[Link]"]
"\!\(\+StyleBox[\"$0\",FontColor->RGBColor[1,0,0],FontSize->18,FontWeight->\"
Bold\"]\)"]
Out[133]= acaaccgccgcgaattctcacaaacgtcgagtgtgatatagaaaatcccagatcacactatagggtggaaaccaggtgatagttgcctctgcca
tgcatatgcgattaaatgttcgttgaatatgagtaaagaatctaagcgtagtttttatagtaaagaccccgcgcctctgcgcgtgatagtg
ttaccgacgcatctcgatgttgtacatgtagcactgtacgtaatcattatacgatttccataacgtaagctgggtaacagacctaacg
tagggttcat
ctacgcgcttatcctccgacctaggattgcgtctagaaaactgaacaagtaaaccgtactcctttatccgccgacagtccagaacagtctg
acttccagctacttaatggtttcccagatttcctgcggaatacctcgaccgtgtggccattgctccaccaccgcaattcgcctcttctgca
caggtccacgcacgttttccctgagcataaaaacccagcaatacgaaaggttctctacacatcagcagcttcccgagtgacctgattgggg
ctgcgctataacgtcggtcgcgtttccatcaggacgcatgcagcgacgcctgcagcagcagtccccttcacagcgtacagggctctgg
taagggcagccagtttcgctaacggtcctgttgcttacatgcgcatacaattatgccaaacggacacgtgctatccagacgaggtgtcgta
aaggggatttctaagtgaccagaattactgtcagacgaccttaagatagtcaggctttcagcggtagataggcgggatgaatcgaaagcaa
tgacaaggcccggtcgccagagagacaggcttagtattcagtaagcagtagcgcgacatacccgaaactccgcgcgggtat
agagtaca
tctactaggtgtgtatctgcagcacattagggctattcagaccgttaattccggcctgaggccatgccgacagaacaaattgcct
HTML Parsing
String patterns are useful for taking raw HTML and extracting information from it.
Advanced String Patterns 27
Here is the source from [Link].
In[134]:= text = "\<<html><head><meta http-equiv='content-type'
content='text/html;charset=UTF-8'><title>Google</title><style><!--body,td
,a,p,.h{font-family:arial,sans-serif;}
.h{font-size:20px;}
.q{color:0000cc;}
//-->
</style>
<script>
<!--function sf(){[Link]();}
//-->
</script>
</head><body bgcolor=ffffff text=000000 link=0000cc
vlink=551a8b alink=ff0000 onLoad=sf()><center><table border=0
cellspacing=0 cellpadding=0><tr><td><img src='/images/[Link]'
width=276 height=110 alt='Google'></td></tr></table><br>
<form action='/search' name=f><script><!--function
qs(el) {if ([Link]&&[Link])
{var qe=encodeURIComponent([Link]);if
([Link]('q='),-1) {[Link]=[Link](new
RegExp('q=[^&$]+'),'q='+qe);} else {[Link]+='&q='+qe;}}return 1;}
//-->
</script><table border=0 cellspacing=0
cellpadding=4><tr><td nowrap class=q><font size=-1><b><font
color=000000>Web</font></b>&nbsp;&nbsp;&nbsp;&nbsp;<a
id=1a class=q href='/imghp?hl=en&tab=wi' onClick='return
qs(this);'>Images</a>&nbsp;&nbsp;&nbsp;&nbsp;<a id=2a
class=q href='/grphp?hl=en&tab=wg' onClick='return
qs(this);'>Groups</a>&nbsp;&nbsp;&nbsp;&nbsp;<a id=4a
class=q href='/nwshp?hl=en&tab=wn' onClick='return
qs(this);'>News</a>&nbsp;&nbsp;&nbsp;&nbsp;<a id=5a
class=q href='/froogle?hl=en&tab=wf' onClick='return
qs(this);'>Froogle</a>&nbsp;&nbsp;&nbsp;&nbsp;<b><a
href='/options/[Link]'
class=q>more&nbsp;&raquo;</a></b></font></td></tr></table> <table
cellspacing=0 cellpadding=0><tr><td width=25>&nbsp;</td><td
align=center><input type=hidden name=hl value=en><span
id=hf></span><input type=hidden name=ie value='UTF-8'><input
maxLength=256 size=55 name=q value=''><br><input
type=submit value='Google Search' name=btnG><input
type=submit value='I'm Feeling Lucky' name=btnI></td><td
valign=top nowrap width=25><font size=-2>&nbsp;&nbsp;<a
href=/advanced_search?hl=en>Advanced&nbsp;Search</a><br>&nbsp;&nbsp;<a
href=/preferences?hl=en>Preferences</a><br>&nbsp;&nbsp;<a
href=/language_tools?hl=en>Language
Tools</a></font></td></tr></table></form><br><br><font
size=-1><a href='/ads/'>Advertising&nbsp;Programs</a>- <a
href='/services/'>Business&nbsp;Solutions</a>- <a href=/[Link]>About
Google</a><span id=hp style='behavior:url(defaulthomepage)'></span>
<script>
//<!--if (![Link]('[Link]
{[Link]('<p><a href=\'/[Link]\'
28 Advanced String Patterns
In[134]:=
//<!--if (![Link]('[Link]
{[Link]('<p><a href=\'/[Link]\'
onClick=\'[Link]='url(defaulthomepage)';setHomePage('[Link]
.[Link]/');\'>Make Google Your Homepage!</a>');}
//-->
</script></font><p><font size=-2>&copy;2004 Google-Searching
4,285,199,774 web pages</font></p></center></body></html>\>";
In[135]:= StringLength[text]
Out[135]= 2639
This extracts all the direct hyperlinks in the source.
In[136]:= StringCases[text, Shortest["<a" ~~
__ ~~ "href=" ~~ ref__ ~~ (WhitespaceCharacter ">") ~~ ___ ~~ ">"] ref]
Out[136]= {'/imghp?hl=en&tab=wi', '/grphp?hl=en&tab=wg', '/nwshp?hl=en&tab=wn',
'/froogle?hl=en&tab=wf', '/options/[Link]', /advanced_search?hl=en, /preferences?hl=en,
/language_tools?hl=en, '/ads/', '/services/', /[Link], \'/[Link]\']
This deletes everything inside tags >.
In[137]:= StringReplace[text, Shortest["<" ~~ ___ ~~ ">"] - ""]
Out[137]= Google
Web&nbsp;&nbsp;&nbsp;&nbsp;Images&nbsp;&nbsp;&nbsp;&nbsp;Groups&nbsp;&nbsp;&nbsp;&nbsp;News&
nbsp;&nbsp;&nbsp;&nbsp;Froogle&nbsp;&nbsp;&nbsp;&nbsp;more&nbsp;&raquo;
&nbsp;&nbsp;&nbsp;Advanced&nbsp;Search&nbsp;&nbsp;Preferences&nbsp;&nbsp;Language
ToolsAdvertising&nbsp;Programs- Business&nbsp;Solutions- About Google
//Make Google Your Homepage!');]
//-->
&copy;2004 Google-Searching 4,285,199,774 web pages
Find Money
Here is some text to scan for strings that look like dollar amounts.
In[138]:= text = "This $100 sentence can be bought for $85.00, at 15 discount"
Out[138]= This $100 sentence can be bought for $85.00, at 15% discount
This is one way to do the search using symbolic string patterns.
In[139]:= StringCases[text, "$" ~~ DigitCharacter .. ~~ (("." ~~ DigitCharacter ..) "")]
Out[139]= {$100, $85.00]
Advanced String Patterns 29
Here is the same search using regular expressions (note that you must remember to escape
the dollar sign).
In[140]:= StringCases[text, RegularExpression["\\$\\d+(\.\\d+)?"]]
Out[140]= {$100, $85.00]
There is also a built-in pattern object, NumberString, for this particular situation.
In[141]:= StringCases[text, "$" ~~ NumberString]
Out[141]= {$100, $85.00]
Find Text in Files
Here is a very simple grep-like function for finding lines in a text file containing text matching a
given pattern.
In[142]:= Grep[file_, patt_] := With[{data = Import[file, "Lines"]},
Pick[Transpose[{Range[Length[data]], data}], StringFreeQ[data, patt], False]]
This creates a sample text file.
In[143]:= Export["[Link]", {"this is a line",
"a line with 2 numbers 5", "third line and more", "line 4"}, "Lines"]
Out[143]= [Link]
This returns the line numbers and lines in "[Link]" containing any digit characters.
In[144]:= Grep["[Link]", DigitCharacter] // TableForm
Out[144]//TableForm=
2 a line with 2 numbers 5
4 line 4
This finds lines containing "a" as a standalone word.
In[145]:= Grep["[Link]", RegularExpression["\\ba\\b"]] // TableForm
Out[145]//TableForm=
1 this is a line
2 a line with 2 numbers 5
Tips and Tricks for Efficient Matching
This section addresses some issues involving efficiency in string pattern matching.
30 Advanced String Patterns
StringExpression versus RegularExpression
Since a string pattern written in Mathematica syntax is immediately translated to a regular
expression and then compiled and cached, there is very little overhead in using the Mathematica
syntax as opposed to the regular expression syntax directly. An exception to this happens when
many different patterns are used a few times; in that case the overhead might be noticeable.
Conditions and PatternTests
If a pattern contains Condition (/;) or PatternTest (?) statements, the general Mathemat-
ica evaluator must be invoked during the match, thus slowing it down. If a pattern can be
written without such constructs, it will typically be faster.
In[146]:= SeedRandom[1234];
test = StringJoin[Table[FromCharacterCode[RandomInteger[{48, 80}]], {200}]];
In[147]:= StringCases[test, DigitCharacter ..] // Length // Timing
Out[147]= {0. Second, 45]
In[148]:= StringCases[test, __ ?DigitQ] // Length // Timing
Out[148]= {0.03 Second, 45]
Avoid Nested Quantifiers
Because of the nondeterministic finite automaton (NFA) algorithm used in the match, patterns
involving nested quantifiers (such as __ and patt .. or the regular expression equivalents) can
become arbitrarily slow. Such patterns can usually be "unrolled" into more efficient versions (see
Friedl [2] for additional information).
Avoid Many Calls to a Function
If you are searching through a long list of strings for certain matches, it is more efficient to
feed the whole list to a string function at once, rather than using something like Select and
StringMatchQ (see the earlier dictionary example for an illustration). Here is another example
that generates a list of 2000 strings with 10 characters each and searches for the strings that
start with an "a" and contain "ggg" as a substring.
In[149]:= SeedRandom[1234]; test = Table[StringJoin[
{"a", "c", "g", "t"}[[]] & / Table[RandomInteger[{1, 4}], {10}]], {2000}];
Advanced String Patterns 31
In[150]:= Take[test, 3]
Out[150]= {acaaccgccg, cgaattctca, caaacgtcga]
Here is the slower version, using Select and StringMatchQ.
In[151]:= Select[test, StringMatchQ[, "a" ~~ ___ ~~ "ggg" ~~ ___] &] // Timing
Out[151]= {0.01 Second, {acgtagggtt, attagggcta, atagggctct, aagggccgtc, agtgttaggg, aggggtggca, aggggcggag,
agcgggactc, acagagggtg, atgggacatc, agggataaga, accacgggct, aaaagggcat, agtaagggac, agggtagtta,
agctacgggc, ataagccggg, atagggagaa, acttgatggg, acagtgaggg, agggcaggga, agggttctag,
agaggggaac, atgcagggat, atcgtagggc, aggggaagct, agtggggctg, aaacaaggga, aagtgggatg,
aagagggaat, agggacggag, attcgggagc, aataactggg, agggcgccca, agaggggatt, agggacgaag,
aagggatatt, agggcaggtg, agaacgggta, aattgggtct, agcgggtagg, actcgggccc, agggcctcct,
aagggagggg, aagggcatgt, aagttgaggg, aaaacggggt, agagggcgta, aagtctaggg, agggagcgtc]]
If you instead feed the whole list to StringMatchQ at once, it will be much faster. Then Pick
can be used to extract the wanted elements.
In[152]:= Pick[test, StringMatchQ[test, "a" ~~ ___ ~~ "ggg" ~~ ___]] // Timing
Out[152]= {0. Second, {acgtagggtt, attagggcta, atagggctct, aagggccgtc, agtgttaggg, aggggtggca, aggggcggag,
agcgggactc, acagagggtg, atgggacatc, agggataaga, accacgggct, aaaagggcat, agtaagggac, agggtagtta,
agctacgggc, ataagccggg, atagggagaa, acttgatggg, acagtgaggg, agggcaggga, agggttctag,
agaggggaac, atgcagggat, atcgtagggc, aggggaagct, agtggggctg, aaacaaggga, aagtgggatg,
aagagggaat, agggacggag, attcgggagc, aataactggg, agggcgccca, agaggggatt, agggacgaag,
aagggatatt, agggcaggtg, agaacgggta, aattgggtct, agcgggtagg, actcgggccc, agggcctcct,
aagggagggg, aagggcatgt, aagttgaggg, aaaacggggt, agagggcgta, aagtctaggg, agggagcgtc]]
Alternatively, you could use StringCases, which is also fast. Note that you need to anchor
the pattern using StartOfString to ensure that the "a" is at the start (the EndOfString is
superfluous in this particular case).
In[153]:= Flatten[StringCases[test,
StartOfString ~~ "a" ~~ ___ ~~ "ggg" ~~ ___ ~~ EndOfString]] // Timing
Out[153]= {0. Second, {acgtagggtt, attagggcta, atagggctct, aagggccgtc, agtgttaggg, aggggtggca, aggggcggag,
agcgggactc, acagagggtg, atgggacatc, agggataaga, accacgggct, aaaagggcat, agtaagggac, agggtagtta,
agctacgggc, ataagccggg, atagggagaa, acttgatggg, acagtgaggg, agggcaggga, agggttctag,
agaggggaac, atgcagggat, atcgtagggc, aggggaagct, agtggggctg, aaacaaggga, aagtgggatg,
aagagggaat, agggacggag, attcgggagc, aataactggg, agggcgccca, agaggggatt, agggacgaag,
aagggatatt, agggcaggtg, agaacgggta, aattgggtct, agcgggtagg, actcgggccc, agggcctcct,
aagggagggg, aagggcatgt, aagttgaggg, aaaacggggt, agagggcgta, aagtctaggg, agggagcgtc]]
Rewrite General Expression Searches as String Searches
Because the string-matching algorithm is different than the algorithm Mathematica uses for
general expression matching (string matching can assume a finite alphabet and a flat structure,
for instance), there are cases where it is advantageous to translate a normal expression-match-
ing problem to a string-matching problem. A typical case is matching a long list of symbols
against a pattern involving several occurrences of __ and ___.
As an example, assume you want to find primes (after prime number 1000000, say) that have
at least four identical digits. Using ordinary pattern matching, it could be accomplished like this.
32 Advanced String Patterns
As an example, assume you want to find primes (after prime number 1000000, say) that have
at least four identical digits. Using ordinary pattern matching, it could be accomplished like this.
In[154]:= Select[Array[Prime, 1000, 1 000 000],
MatchQ[IntegerDigits[], {___, x_, ___, x_, ___, x_, ___, x_, ___}] &] // Timing
Out[154]= {0.16 Second, {15488881, 15491117, 15491171, 15491711, 15493333, 15493999,
15496111, 15499111, 15499199, 15499399, 15499499, 15499919, 15499997, 15500557,
15501119, 15501121, 15501151, 15501553, 15501559, 15501911, 15502111]]
By converting the list of integers to a string, you can use string matching instead.
In[155]:= Select[Array[Prime, 1000, 1 000 000],
StringMatchQ[FromCharacterCode[48 + IntegerDigits[]],
StringExpression[___, x_, ___, x_, ___, x_, ___, x_, ___]] &] // Timing
Out[155]= {0.05 Second, {15488881, 15491117, 15491171, 15491711, 15493333, 15493999,
15496111, 15499111, 15499199, 15499399, 15499499, 15499919, 15499997, 15500557,
15501119, 15501121, 15501151, 15501553, 15501559, 15501911, 15502111]]
By using the previous tips of using Pick or StringCases, you can speed it up even more.
In[156]:= With[{list = Array[Prime, 1000, 1 000 000]},
Pick[list, StringMatchQ[FromCharacterCode[48 + IntegerDigits[]] & / list,
StringExpression[___, x_, ___, x_, ___, x_, ___, x_, ___]]]] // Timing
Out[156]= {0.04 Second, {15488881, 15491117, 15491171, 15491711, 15493333, 15493999,
15496111, 15499111, 15499199, 15499399, 15499499, 15499919, 15499997, 15500557,
15501119, 15501121, 15501151, 15501553, 15501559, 15501911, 15502111]]
In[157]:= Flatten[StringCases[FromCharacterCode[48 + IntegerDigits[]] & /
Array[Prime, 1000, 1 000 000], StringExpression[StartOfString,
___, x_, ___, x_, ___, x_, ___, x_, ___, EndOfString]]] // Timing
Out[157]= {0.04 Second, {15488881, 15491117, 15491171, 15491711, 15493333,
15493999, 15496111, 15499111, 15499199, 15499399, 15499499, 15499919, 15499997,
15500557, 15501119, 15501121, 15501151, 15501553, 15501559, 15501911, 15502111]]
For long sequences, the difference can be significant.
In[158]:= test = Range[100]; test[[{50, 75}]] = 5;
In[159]:= Position[test, 5]
Out[159]= {{5], {50], {75]]
In[160]:= MatchQ[test, {___, x_, ___, x_, ___, x_, ___}] // Timing
Out[160]= {0.121 Second, True]
In[161]:= teststr = FromCharacterCode[test];
In[162]:= StringPosition[teststr, FromCharacterCode[5]]
Out[162]= {{5, 5], {50, 50], {75, 75]]
Advanced String Patterns 33
In[163]:= StringMatchQ[teststr, StringExpression[___, x_, ___, x_, ___, x_, ___]] // Timing
Out[163]= {0. Second, True]
Implementation Details
String pattern matching in Mathematica is built on top of the PCRE (Perl Compatible Regular
Expressions) library by Philip Hazel [1].
In some cases the pre-5.1 Mathematica algorithms are used (for example, when the pattern is
just a single, literal string).
Any symbolic string pattern is first translated to a regular expression. You can see this transla-
tion by using the internal StringPattern`PatternConvert function.
In[164]:= StringPattern`PatternConvert ["a" "" ~~ DigitCharacter ..] // InputForm
Out[164]//InputForm= {"(?ms)a?\\d+", {}, {}, {}, Hold[None]}
The first element returned is the regular expression, while the rest of the elements have to do
with conditions, replacement rules, and named patterns.
The regular expression is then compiled by PCRE, and the compiled version is cached for future
use when the same pattern appears again. The translation from symbolic string pattern to
regular expression only happens once.
Mathematica conditions in the pattern are handled by external call-outs from the PCRE library to
the Mathematica evaluator, so this will slow down the matching.
Explicit RegularExpression objects embedded into a general string pattern will be spliced into
the final regular expression (surrounded by noncapturing parentheses "(?:...)"), so the count-
ing of named patterns can become skewed compared to what you might expect.
Because PCRE currently does not support preset character classes with characters beyond charac -
ter code 255, the word and letter character classes (such as WordCharacter and
LetterCharacter) only include character codes in the Unicode range 0255. Thus
LetterCharacter and _?LetterQ do not give equivalent results beyond character code 255.
Because of a similar PCRE restriction, case-insensitive matching (for example, with
IgnoreCase -> True) will only apply to letters in the Unicode range 0127 (that is, the normal
English letters "a""z" and "A""Z").
References
34 Advanced String Patterns
References
[1] Hazel, P. "PCREPerl Compatible Regular Expressions." 2008. [Link]
[2] Friedl, J. E. F. Mastering Regular Expressions. (2nd ed.) O'Reilly & Associates, 2002.
Advanced String Patterns 35

You might also like