Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining , 2nd Edition

by
Tan, Steinbach, Kumar

01/27/2021 Introduction to Data Mining, 2nd Edition 1

Tan, Steinbach, Karpatne, Kumar
Outline

Attributes and Objects

Types of Data

Data Quality

Similarity and Distance

Data Preprocessing

01/27/2021 Introduction to Data Mining, 2nd Edition 2

Tan, Steinbach, Karpatne, Kumar
What is Data?

Kumpulan dari data Attributes

objects dan attributes
Sebuah attribute : property Tid Refund Marital Taxable
atau karakteristik dari objek Status Income Cheat

– Examples: warna mata 1 Yes Single 125K No

seseorang, temperature, etc. 2 No Married 100K No
– Atribut juga dikenal sebagai
3 No Single 70K No

Objects
variable, field, characteristic,
dimension, atau feature 4 Yes Married 120K No

Kumpulan atribut 5 No Divorced 95K Yes

menggambarkan suatu 6 No Married 60K No

object 7 Yes Divorced 220K No
– Objek juga dikenal sebagai 8 No Single 85K Yes
record, point, case, sample, 9 No Married 75K No
entity, or instance
10 No Single 90K Yes
10
Attribute Values

Attribute values adalah angka atau simbol yang ditetapkan pada

atribut untuk objek tertentu

Perbedaan antara atribut dan nilai atribut

– Atribut yang sama dapat dipetakan ke nilai atribut yang berbeda
◆ Example: tinggi dapat diukur dalam kaki atau meter

– Atribut yang berbeda dapat dipetakan ke kumpulan nilai yang sama

◆ Example: Attribute values untuk ID and age adalah bilangan
integer
– Namun, properti atribut dapat berbeda dari properti nilai yang
digunakan untuk merepresentasikan atribut

01/27/2021 Introduction to Data Mining, 2nd Edition 4

Tan, Steinbach, Karpatne, Kumar
 Measurement of Length
Cara Anda mengukur suatu atribut mungkin tidak sesuai
dengan properti atributnya.
5 A 1

B
7 2

C
This scale This scale
8 3
preserves preserves
only the the ordering
ordering D and additvity
property of properties of
length. 10 4 length.

15 5
Types of Attributes

Ada berbagai jenis atribut

– Nominal
◆ Examples: ID numbers, eye color, zip codes
– Ordinal
◆ Examples: rankings (e.g., rasa keripik kentang pada skala
1:10), grades, height {tall, medium, short}
– Interval
◆ Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio
◆ Examples: suhu dalam panjang, hitungan, waktu yang telah
berlalu (misalnya, waktu untuk berlari dalam perlombaan)
01/27/2021 Introduction to Data Mining, 2nd Edition 6
Tan, Steinbach, Karpatne, Kumar
Properties of Attribute Values

Jenis atribut bergantung pada properti/operasi

berikut yang dimilikinya::
– Distinctness: = 
– Order: < >
– Differences are + -
meaningful :
– Ratios are * /
meaningful
– Nominal attribute: distinctness
– Ordinal attribute: distinctness & order
– Interval attribute: distinctness, order & meaningful
differences
– Ratio attribute: all 4 properties/operations

01/27/2021 Introduction to Data Mining, 2nd Edition 7

Tan, Steinbach, Karpatne, Kumar
Difference Between Ratio and Interval

Apakah secara fisik bermakna untuk mengatakan bahwa suhu

10 ° adalah dua kali lipat dari suhu 5°
– the Celsius scale?
– the Fahrenheit scale?
– the Kelvin scale?

Pertimbangkan untuk mengukur tinggi badan di atas rata-rata.

– Jika tinggi badan Bill tiga inci di atas rata-rata dan tinggi
badan Bob enam inci di atas rata-rata, maka apakah kita
akan mengatakan bahwa Bob dua kali lebih tinggi dari Bill?
– Apakah situasi ini analog dengan suhu??

01/27/2021 Introduction to Data Mining, 2nd Edition 8

Tan, Steinbach, Karpatne, Kumar
 Attribute Description Examples Operations
Type
Nominal Nominal attribute zip codes, employee mode, entropy,
values only ID numbers, eye contingency
distinguish. (=, ) color, sex: {male, correlation, 2
Categorical
Qualitative

female} test

Ordinal Ordinal attribute hardness of minerals, median,

values also order {good, better, best}, percentiles, rank
objects. grades, street correlation, run
(<, >) numbers tests, sign tests
Interval For interval calendar dates, mean, standard
attributes, temperature in deviation,
differences between Celsius or Fahrenheit Pearson's
Quantitative
Numeric

values are correlation, t and

meaningful. (+, - ) F tests
Ratio For ratio variables, temperature in Kelvin, geometric mean,
both differences and monetary quantities, harmonic mean,
ratios are counts, age, mass, percent variation
meaningful. (*, /) length, current

This categorization of attributes is due to S. S. Stevens

 Attribute Transformation Comments
Type
Nominal Any permutation of values If all employee ID numbers
were reassigned, would it
make any difference?
Categorical
Qualitative

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better best
new_value = f(old_value) can be represented equally
where f is a monotonic function well by the values {1, 2, 3} or
by { 0.5, 1, 10}.

Interval new_value = a * old_value + b Thus, the Fahrenheit and

where a and b are constants Celsius temperature scales
Quantitative
Numeric

differ in terms of where their

zero value is and the size of a
unit (degree).
Ratio new_value = a * old_value Length can be measured in
meters or feet.

This categorization of attributes is due to S. S. Stevens

Discrete and Continuous Attributes

Discrete Attribute
– Hanya memiliki himpunan nilai yang terbatas atau tak terbatas
– Examples: kode pos, jumlah, atau himpunan kata dalam
kumpulan dokumen
– Sering direpresentasikan sebagai variabel integer.
– Note: atribut biner adalah kasus khusus dari atribut diskrit
Continuous Attribute
– Memiliki angka riil sebagai nilai atribut
– Examples: temperature, height, or weight.
– Secara praktis, nilai riil hanya dapat diukur dan
direpresentasikan menggunakan jumlah digit yang terbatas.
– Continuous attributes biasanya direpresentasikan sebagai
variabel floating-point.

01/27/2021 Introduction to Data Mining, 2nd Edition 11

Tan, Steinbach, Karpatne, Kumar
Asymmetric Attributes

Hanya kehadiran (nilai atribut bukan nol) yang dianggap

penting
◆ Kata-kata yang ada dalam dokumen
◆ Item yang ada dalam transaksi pelanggan

Jika kita bertemu seorang teman di toko grosir, apakah

kita akan mengatakan hal berikut??
““Saya melihat pembelian kita sangat mirip karena kita tidak
membeli sebagian besar barang yang sama.”.”

01/27/2021 Introduction to Data Mining, 2nd Edition 12

Tan, Steinbach, Karpatne, Kumar
Critiques of the attribute categorization

Incomplete
– Asymmetric binary
– Cyclical
– Multivariate
– Partially ordered
– Partial membership
– Relationships between the data

Data real bersifat approximate and noisy

– Hal ini dapat mempersulit pengenalan jenis atribut yang tepat
– Memperlakukan satu jenis atribut sebagai atribut lainnya mungkin
kurang lebih benar

01/27/2021 Introduction to Data Mining, 2nd Edition 13

Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types

Jenis operasi yang Anda pilih harus "bermakna" untuk

jenis data yang Anda miliki :
– Kekhasan, urutan, interval yang bermakna, dan rasio yang
bermakna hanyalah empat (di antara banyak kemungkinan)
properti data

– Tipe data yang Anda lihat – sering kali berupa angka atau string –
mungkin tidak mencakup semua properti atau mungkin
menunjukkan properti yang tidak ada

– Analisis mungkin bergantung pada properti data lainnya

◆ Banyak analisis statistik hanya bergantung pada distribusi

– Pada akhirnya, apa yang bermakna dapat bersifat khusus untuk

domain

01/27/2021 Introduction to Data Mining, 2nd Edition 14

Tan, Steinbach, Karpatne, Kumar
Important Characteristics of Data

– Dimensionality (number of attributes)

◆ Data berdimensi tinggi membawa sejumlah tantangan

– Sparsity
◆ Hanya kehadiran yang diperhitungkan

– Resolution
◆ Pola bergantung pada skala

– Size
◆ Jenis analisis mungkin bergantung pada ukuran data

01/27/2021 Introduction to Data Mining, 2nd Edition 15

Tan, Steinbach, Karpatne, Kumar
Types of data sets
Record
– Data Matrix
– Document Data
– Transaction Data
Graph
– World Wide Web
– Molecular Structures
Ordered
– Spatial Data
– Temporal Data
– Sequential Data
– Genetic Sequence Data

01/27/2021 Introduction to Data Mining, 2nd Edition 16

Tan, Steinbach, Karpatne, Kumar
Record Data

Data yang terdiri dari kumpulan record, yang masing-

masing terdiri dari serangkaian atribut yang tetap
Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10

01/27/2021 Introduction to Data Mining, 2nd Edition 17

Tan, Steinbach, Karpatne, Kumar
Data Matrix

Jika objek data memiliki kumpulan atribut numerik yang

sama, maka objek data tersebut dapat dianggap sebagai
poin dalam ruang multidimensi, di mana setiap dimensi
mewakili atribut yang berbeda.

Kumpulan data tersebut dapat direpresentasikan oleh

matriks berukuran m x n, di mana terdapat m baris, satu
untuk setiap objek, dan n kolom, satu untuk setiap atribut
Projection Projection Distance Load Thickness
of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1

01/27/2021 Introduction to Data Mining, 2nd Edition 18

Tan, Steinbach, Karpatne, Kumar
Document Data

Setiap dokumen menjadi ‘term’ vector

– Setiap “term” adalah komponen (atribut) dari vektor
– Nilai setiap komponen adalah berapa kali istilah yang
bersangkutan muncul dalam dokumen.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0

01/27/2021 Introduction to Data Mining, 2nd Edition 19

Tan, Steinbach, Karpatne, Kumar
Transaction Data

Jenis khusus dari data, dimana :

– Setiap transaksi melibatkan satu set item.
– Misalnya, perhatikan toko grosir. Rangkaian produk yang dibeli
oleh pelanggan selama satu kali berbelanja merupakan
transaksi, sedangkan produk-produk individual yang dibeli
merupakan barang-barang.
– Dapat mewakili data transaksi sebagai record data

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
01/27/2021 Introduction to Data Mining, 2nd Edition 20
Tan, Steinbach, Karpatne, Kumar
 Graph Data

Examples: Generic graph, a molecule, and webpages

2
5 1
2
5

Benzene Molecule: C6H6

01/27/2021 Introduction to Data Mining, 2nd Edition 21
Tan, Steinbach, Karpatne, Kumar
Ordered Data

Sequences of transactions
Items/Events

An element of
the sequence
01/27/2021 Introduction to Data Mining, 2nd Edition 22
Tan, Steinbach, Karpatne, Kumar
Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG

01/27/2021 Introduction to Data Mining, 2nd Edition 23

Tan, Steinbach, Karpatne, Kumar
Ordered Data

Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean

01/27/2021 Introduction to Data Mining, 2nd Edition 24

Tan, Steinbach, Karpatne, Kumar
Data Quality

Kualitas data yang buruk berdampak negatif pada banyak

upaya pemrosesan data

Data mining example: model klasifikasi untuk mendeteksi

resiko pinjaman orang dibangun menggunakan data yang
buruk
– Beberapa kandidat yang memiliki kredibilitas baik namun
ditolak pinjamannya
– Lebih banyak pinjaman diberikan kepada individu yang
gagal bayar

01/27/2021 Introduction to Data Mining, 2nd Edition 25

Tan, Steinbach, Karpatne, Kumar
Data Quality …

Seperti apa masalah kualitas data?

Bagaimana kita dapat mendeteksi masalah pada
data?
Apa yang dapat kita lakukan untuk mengatasi
masalah tersebut?
Contoh masalah kualitas data:
– Noise and outliers
– Wrong data
– Fake data
– Missing values
– Duplicate data
01/27/2021 Introduction to Data Mining, 2nd Edition 26
Tan, Steinbach, Karpatne, Kumar
Noise

Bagi objek, noise adalah objek yang asing

Bagi atribut, noise mengacu pada modifikasi nilai asli
– Examples: distorsi suara seseorang saat berbicara di telepon yang buruk
dan “snow" di layar televisi
– Gambar di bawah ini menunjukkan dua gelombang sinus dengan
magnitudo yang sama dan frekuensi yang berbeda, gelombang yang
digabungkan, dan dua gelombang sinus dengan noise acak
◆ Magnitudo dan bentuk sinyal asli akan terdistorsi

01/27/2021 Introduction to Data Mining, 2nd Edition 27

Tan, Steinbach, Karpatne, Kumar
Outliers

Outliers objek data dengan karakteristik yang

sangat berbeda dibandingkan sebagian besar
objek data lainnya dalam kumpulan data.
– Case 1: Outlier adalah noise yang mengganggu
analisis data

– Case 2: Outliers adalah

tujuan analisis
◆ Credit card fraud
◆ Intrusion detection

Penyebabnya ?

01/27/2021 Introduction to Data Mining, 2nd Edition 28

Tan, Steinbach, Karpatne, Kumar
Missing Values

Reasons for missing values

– Informasi tidak dikumpulkan (misalnya, orang
menolak memberikan usia dan berat badan mereka))
– Atribut mungkin tidak berlaku untuk semua kasus
(misalnya, pendapatan tahunan tidak berlaku untuk
anak-anak)
Handling missing values
– Hilangkan objek atau variabel data
– Estimasie missing values
◆ Example: time series dari temperature
◆ Example: hasil sensus

– Abaikan nilai yang hilang selama analisis

01/27/2021 Introduction to Data Mining, 2nd Edition 29

Tan, Steinbach, Karpatne, Kumar
Duplicate Data

Data set dapat mencakup objek data yang

merupakan duplikat, atau hampir duplikat satu
sama lain
– Masalah utama saat menggabungkan data dari
sumber yang heterogen
Examples:
– Orang yang sama dengan beberapa alamat email
Data cleaning
– Proses penanganan masalah data duplikat
Kapan data duplikat tidak boleh dihapus?

01/27/2021 Introduction to Data Mining, 2nd Edition 30

Tan, Steinbach, Karpatne, Kumar
Similarity and Dissimilarity Measures

Similarity measure
– Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity measure
– Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
01/27/2021 Introduction to Data Mining, 2nd Edition 31
Tan, Steinbach, Karpatne, Kumar
 Similarity/Dissimilarity for Simple Attributes

The following table shows the similarity and dissimilarity

between two objects, x and y, with respect to a single, simple
attribute.

01/27/2021 Introduction to Data Mining, 2nd Edition 32

Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

Euclidean Distance

where n is the number of dimensions (attributes) and

xk and yk are, respectively, the kth attributes
(components) or data objects x and y.

Standardization is necessary, if scales differ.

01/27/2021 Introduction to Data Mining, 2nd Edition 33

Tan, Steinbach, Karpatne, Kumar
Euclidean Distance

3
point x y
2 p1
p1 0 2
p3 p4
1
p2 2 0
p2 p3 3 1
0 p4 5 1
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 34
Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

Minkowski Distance is a generalization of Euclidean

Distance

Where r is a parameter, n is the number of dimensions

(attributes) and xk and yk are, respectively, the kth
attributes (components) or data objects x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 35

Tan, Steinbach, Karpatne, Kumar
Minkowski Distance: Examples

r = 1. City block (Manhattan, taxicab, L1 norm) distance.

– A common example of this for binary vectors is the
Hamming distance, which is just the number of bits that are
different between two binary vectors

r = 2. Euclidean distance

r → . “supremum” (Lmax norm, L norm) distance.

– This is the maximum difference between any component of
the vectors

Do not confuse r with n, i.e., all these distances are

defined for all numbers of dimensions.

01/27/2021 Introduction to Data Mining, 2nd Edition 36

Tan, Steinbach, Karpatne, Kumar
Minkowski Distance

L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0
point x y
p1 0 2 L2 p1 p2 p3 p4
p2 2 0 p1 0 2.828 3.162 5.099
p3 3 1 p2 2.828 0 1.414 3.162
p4 5 1 p3 3.162 1.414 0 2
p4 5.099 3.162 2 0

L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0

Distance Matrix
01/27/2021 Introduction to Data Mining, 2nd Edition 37
Tan, Steinbach, Karpatne, Kumar
 Mahalanobis Distance

𝐦𝐚𝐡𝐚𝐥𝐚𝐧𝐨𝐛𝐢𝐬 𝐱, 𝐲 = ((𝐱 − 𝐲)𝑇 Ʃ−1 (𝐱 − 𝐲))-0.5

 is the covariance matrix

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

01/27/2021 Introduction to Data Mining, 2nd Edition 38
Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance

Covariance
Matrix:
0.3 0.2
= 
C
 0.2 0.3
B A: (0.5, 0.5)
B: (0, 1)
A
C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4

01/27/2021 Introduction to Data Mining, 2nd Edition 39

Tan, Steinbach, Karpatne, Kumar
Common Properties of a Distance

Distances, such as the Euclidean distance,

have some well known properties.
1. d(x, y)  0 for all x and y and d(x, y) = 0 if and only
if x = y.
2. d(x, y) = d(y, x) for all x and y. (Symmetry)
3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between

points (data objects), x and y.

A distance that satisfies these properties is a

metric
01/27/2021 Introduction to Data Mining, 2nd Edition 40
Tan, Steinbach, Karpatne, Kumar
Common Properties of a Similarity

Similarities, also have some well known

properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y.

(does not always hold, e.g., cosine)
2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data

objects), x and y.

01/27/2021 Introduction to Data Mining, 2nd Edition 41

Tan, Steinbach, Karpatne, Kumar
Similarity Between Binary Vectors
Common situation is that objects, x and y, have only
binary attributes

Compute similarities using the following quantities

f01 = the number of attributes where x was 0 and y was 1
f10 = the number of attributes where x was 1 and y was 0
f00 = the number of attributes where x was 0 and y was 0
f11 = the number of attributes where x was 1 and y was 1

Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (f11 + f00) / (f01 + f10 + f11 + f00)

J = number of 11 matches / number of non-zero attributes

= (f11) / (f01 + f10 + f11)

01/27/2021 Introduction to Data Mining, 2nd Edition 42

Tan, Steinbach, Karpatne, Kumar
SMC versus Jaccard: Example

x= 1000000000
y= 0000001001

f01 = 2 (the number of attributes where x was 0 and y was 1)

f10 = 1 (the number of attributes where x was 1 and y was 0)
f00 = 7 (the number of attributes where x was 0 and y was 0)
f11 = 0 (the number of attributes where x was 1 and y was 1)

SMC = (f11 + f00) / (f01 + f10 + f11 + f00)

= (0+7) / (2+1+0+7) = 0.7

J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0

01/27/2021 Introduction to Data Mining, 2nd Edition 43

Tan, Steinbach, Karpatne, Kumar
Cosine Similarity

If d1 and d2 are two document vectors, then

cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,
where <d1,d2> indicates inner product or vector dot
product of vectors, d1 and d2, and || d || is the length of
vector d.

Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2
<d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42) 0.5 = 6.481
|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449
cos(d1, d2 ) = 0.3150

01/27/2021 Introduction to Data Mining, 2nd Edition 44

Tan, Steinbach, Karpatne, Kumar
Correlation measures the linear relationship
between objects

01/27/2021 Introduction to Data Mining, 2nd Edition 45

Tan, Steinbach, Karpatne, Kumar
Visually Evaluating Correlation

Scatter plots
showing the
similarity from
–1 to 1.

01/27/2021 Introduction to Data Mining, 2nd Edition 46

Tan, Steinbach, Karpatne, Kumar
 Drawback of Correlation

x = (-3, -2, -1, 0, 1, 2, 3)

y = (9, 4, 1, 0, 1, 4, 9)

yi = xi2

mean(x) = 0, mean(y) = 4
std(x) = 2.16, std(y) = 3.74

corr = (-3)(5)+(-2)(0)+(-1)(-3)+(0)(-4)+(1)(-3)+(2)(0)+3(5) / ( 6 * 2.16 * 3.74 )

=0

01/27/2021 Introduction to Data Mining, 2nd Edition 47

Tan, Steinbach, Karpatne, Kumar
Correlation vs Cosine vs Euclidean Distance
Compare the three proximity measures according to their behavior under
variable transformation
– scaling: multiplication by a value
– translation: adding a constant
Property Cosine Correlation Euclidean Distance
Invariant to scaling Yes Yes No
(multiplication)
Invariant to translation No Yes No
(addition)

Consider the example

– x = (1, 2, 4, 3, 0, 0, 0), y = (1, 2, 3, 4, 0, 0, 0)
– ys = y * 2 (scaled version of y), yt = y + 5 (translated version)

Measure (x , y) (x , ys) (x , yt)

Cosine 0.9667 0.9667 0.7940

Correlation 0.9429 0.9429 0.9429

Euclidean Distance 1.4142 5.8310 14.2127

01/27/2021 Introduction to Data Mining, 2nd Edition 48

Tan, Steinbach, Karpatne, Kumar
Correlation vs cosine vs Euclidean distance

Choice of the right proximity measure depends on the domain

What is the correct choice of proximity measure for the
following situations?
– Comparing documents using the frequencies of words
◆ Documents are considered similar if the word frequencies are similar

– Comparing the temperature in Celsius of two locations

◆ Two locations are considered similar if the temperatures are similar in
magnitude

– Comparing two time series of temperature measured in Celsius

◆ Two time series are considered similar if their “shape” is similar, i.e., they
vary in the same way over time, achieving minimums and maximums at
similar times, etc.

01/27/2021 Introduction to Data Mining, 2nd Edition 49

Tan, Steinbach, Karpatne, Kumar
Comparison of Proximity Measures

Domain of application
– Similarity measures tend to be specific to the type of
attribute and data
– Record data, images, graphs, sequences, 3D-protein
structure, etc. tend to have different measures
However, one can talk about various properties that
you would like a proximity measure to have
– Symmetry is a common one
– Tolerance to noise and outliers is another
– Ability to find more types of patterns?
– Many others possible
The measure must be applicable to the data and
produce results that agree with domain knowledge
01/27/2021 Introduction to Data Mining, 2nd Edition 50
Tan, Steinbach, Karpatne, Kumar
Information Based Measures

Information theory is a well-developed and

fundamental disciple with broad applications

Some similarity measures are based on

information theory
– Mutual information in various versions
– Maximal Information Coefficient (MIC) and related
measures
– General and can handle non-linear relationships
– Can be complicated and time intensive to compute

01/27/2021 Introduction to Data Mining, 2nd Edition 51

Tan, Steinbach, Karpatne, Kumar
Information and Probability

Information relates to possible outcomes of an event

– transmission of a message, flip of a coin, or measurement
of a piece of data

The more certain an outcome, the less information

that it contains and vice-versa
– For example, if a coin has two heads, then an outcome of
heads provides no information
– More quantitatively, the information is related the
probability of an outcome
◆ The smaller the probability of an outcome, the more information it
provides and vice-versa
– Entropy is the commonly used measure
01/27/2021 Introduction to Data Mining, 2nd Edition 52
Tan, Steinbach, Karpatne, Kumar
Entropy

For
– a variable (event), X,
– with n possible values (outcomes), x1, x2 …, xn
– each outcome having probability, p1, p2 …, pn
– the entropy of X , H(X), is given by
𝑛

𝐻 𝑋 = − ෍ 𝑝𝑖 log 2 𝑝𝑖
𝑖=1

Entropy is between 0 and log2n and is measured in

bits
– Thus, entropy is a measure of how many bits it takes to
represent an observation of X on average
01/27/2021 Introduction to Data Mining, 2nd Edition 53
Tan, Steinbach, Karpatne, Kumar
Entropy Examples

For a coin with probability p of heads and

probability q = 1 – p of tails
𝐻 = −𝑝 log 2 𝑝 − 𝑞 log 2 𝑞
– For p= 0.5, q = 0.5 (fair coin) H = 1
– For p = 1 or q = 1, H = 0

What is the entropy of a fair four-sided die?

01/27/2021 Introduction to Data Mining, 2nd Edition 54

Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data: Example

Hair Color Count p -plog2p

Black 75 0.75 0.3113
Brown 15 0.15 0.4105
Blond 5 0.05 0.2161
Red 0 0.00 0
Other 5 0.05 0.2161
Total 100 1.0 1.1540

Maximum entropy is log25 = 2.3219

01/27/2021 Introduction to Data Mining, 2nd Edition 55

Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data

Suppose we have
– a number of observations (m) of some attribute, X,
e.g., the hair color of students in the class,
– where there are n different possible values
– And the number of observation in the ith category is mi
– Then, for this sample
𝑛
𝑚𝑖 𝑚𝑖
𝐻 𝑋 = − ෍ log 2
𝑚 𝑚
𝑖=1

For continuous data, the calculation is harder

01/27/2021 Introduction to Data Mining, 2nd Edition 56
Tan, Steinbach, Karpatne, Kumar
Mutual Information

Information one variable provides about another

Formally, 𝐼 𝑋, 𝑌 = 𝐻 𝑋 + 𝐻 𝑌 − 𝐻(𝑋, 𝑌), where

H(X,Y) is the joint entropy of X and Y,

𝐻 𝑋, 𝑌 = − ෍ ෍ 𝑝𝑖𝑗log 2 𝑝𝑖𝑗
𝑖 𝑗
Where pij is the probability that the ith value of X and the jth value of Y
occur together

For discrete variables, this is easy to compute

Maximum mutual information for discrete variables is

log2(min( nX, nY ), where nX (nY) is the number of values of X (Y)

01/27/2021 Introduction to Data Mining, 2nd Edition 57

Tan, Steinbach, Karpatne, Kumar
 Mutual Information Example

Student Count p -plog2p Student Grade Count p -plog2p

Status Status
Undergrad 45 0.45 0.5184
Undergrad A 5 0.05 0.2161
Grad 55 0.55 0.4744
Undergrad B 30 0.30 0.5211
Total 100 1.00 0.9928
Undergrad C 10 0.10 0.3322

Grade Count p -plog2p Grad A 30 0.30 0.5211

A 35 0.35 0.5301 Grad B 20 0.20 0.4644

B 50 0.50 0.5000 Grad C 5 0.05 0.2161
C 15 0.15 0.4105 Total 100 1.00 2.2710
Total 100 1.00 1.4406

Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624

01/27/2021 Introduction to Data Mining, 2nd Edition 58

Tan, Steinbach, Karpatne, Kumar
Maximal Information Coefficient
Reshef, David N., Yakir A. Reshef, Hilary K. Finucane, Sharon R. Grossman, Gilean McVean, Peter
J. Turnbaugh, Eric S. Lander, Michael Mitzenmacher, and Pardis C. Sabeti. "Detecting novel
associations in large data sets." science 334, no. 6062 (2011): 1518-1524.

Applies mutual information to two continuous

variables
Consider the possible binnings of the variables into
discrete categories
– nX × nY ≤ N0.6 where
◆ nX is the number of values of X
◆ nY is the number of values of Y
◆ N is the number of samples (observations, data objects)
Compute the mutual information
– Normalized by log2(min( nX, nY )
Take the highest value
01/27/2021 Introduction to Data Mining, 2nd Edition 59
Tan, Steinbach, Karpatne, Kumar
General Approach for Combining Similarities

Sometimes attributes are of many different types, but an

overall similarity is needed.
1: For the kth attribute, compute a similarity, sk(x, y), in the
range [0, 1].
2: Define an indicator variable, k, for the kth attribute as
follows:
k = 0 if the kth attribute is an asymmetric attribute and
both objects have a value of 0, or if one of the objects
has a missing value for the kth attribute
k = 1 otherwise
3. Compute

01/27/2021 Introduction to Data Mining, 2nd Edition 60

Tan, Steinbach, Karpatne, Kumar
Using Weights to Combine Similarities

May not want to treat all attributes the same.

– Use non-negative weights 𝜔𝑘

σ𝑛
𝑘=1 𝜔𝑘 𝛿𝑘 𝑠𝑘 (𝐱,𝐲)
– 𝑠𝑖𝑚𝑖𝑙𝑎𝑟𝑖𝑡𝑦 𝐱, 𝐲 = σ𝑛
𝑘=1 𝜔𝑘 𝛿𝑘

Can also define a weighted form of distance

01/27/2021 Introduction to Data Mining, 2nd Edition 61

Tan, Steinbach, Karpatne, Kumar
Data Preprocessing

Aggregation
Sampling
Discretization and Binarization
Attribute Transformation
Dimensionality Reduction
Feature subset selection
Feature creation

01/27/2021 Introduction to Data Mining, 2nd Edition 62

Tan, Steinbach, Karpatne, Kumar
Aggregation

Combining two or more attributes (or objects) into a single

attribute (or object)
Purpose
– Data reduction - reduce the number of attributes or objects
– Change of scale
◆ Cities aggregated into regions, states, countries, etc.
◆ Days aggregated into weeks, months, or years
– More “stable” data - aggregated data tends to have less variability

01/27/2021 Introduction to Data Mining, 2nd Edition 63

Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia

This example is based on precipitation in

Australia from the period 1982 to 1993.
The next slide shows
– A histogram for the standard deviation of average
monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in
Australia, and
– A histogram for the standard deviation of the average
yearly precipitation for the same locations.
The average yearly precipitation has less
variability than the average monthly precipitation.
All precipitation measurements (and their
standard deviations) are in centimeters.
01/27/2021 Introduction to Data Mining, 2nd Edition 64
Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia …

Variation of Precipitation in Australia

Standard Deviation of Average Standard Deviation of

Monthly Precipitation Average Yearly Precipitation
01/27/2021 Introduction to Data Mining, 2nd Edition 65
Tan, Steinbach, Karpatne, Kumar
Sampling
Sampling is the main technique employed for data
reduction.
– It is often used for both the preliminary investigation of
the data and the final data analysis.

Statisticians often sample because obtaining the

entire set of data of interest is too expensive or
time consuming.

Sampling is typically used in data mining because

processing the entire set of data of interest is too
expensive or time consuming.

01/27/2021 Introduction to Data Mining, 2nd Edition 66

Tan, Steinbach, Karpatne, Kumar
Sampling …

The key principle for effective sampling is the

following:

– Using a sample will work almost as well as using the

entire data set, if the sample is representative

– A sample is representative if it has approximately the

same properties (of interest) as the original set of data

01/27/2021 Introduction to Data Mining, 2nd Edition 67

Tan, Steinbach, Karpatne, Kumar
Sample Size

8000 points 2000 Points 500 Points

01/27/2021 Introduction to Data Mining, 2nd Edition 68

Tan, Steinbach, Karpatne, Kumar
Types of Sampling
Simple Random Sampling
– There is an equal probability of selecting any particular
item
– Sampling without replacement
◆ As each item is selected, it is removed from the
population
– Sampling with replacement
◆ Objects are not removed from the population as they
are selected for the sample.
◆ In sampling with replacement, the same object can
be picked up more than once
Stratified sampling
– Split the data into several partitions; then draw random
samples from each partition

01/27/2021 Introduction to Data Mining, 2nd Edition 69

Tan, Steinbach, Karpatne, Kumar
Sample Size
What sample size is necessary to get at least one
object from each of 10 equal-sized groups.

01/27/2021 Introduction to Data Mining, 2nd Edition 70

Tan, Steinbach, Karpatne, Kumar
Discretization

Discretization is the process of converting a

continuous attribute into an ordinal attribute
– A potentially infinite number of values are mapped
into a small number of categories
– Discretization is used in both unsupervised and
supervised settings

01/27/2021 Introduction to Data Mining, 2nd Edition 71

Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Data consists of four groups of points and two outliers. Data is one-
dimensional, but a random y component is added to reduce overlap.

01/27/2021 Introduction to Data Mining, 2nd Edition 72

Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Equal interval width approach used to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 73

Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

Equal frequency approach used to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 74

Tan, Steinbach, Karpatne, Kumar
Unsupervised Discretization

K-means approach to obtain 4 values.

01/27/2021 Introduction to Data Mining, 2nd Edition 75

Tan, Steinbach, Karpatne, Kumar
Discretization in Supervised Settings

– Many classification algorithms work best if both the independent

and dependent variables have only a few values
– We give an illustration of the usefulness of discretization using
the following example.

01/27/2021 Introduction to Data Mining, 2nd Edition 76

Tan, Steinbach, Karpatne, Kumar
Binarization

Binarization maps a continuous or categorical

attribute into one or more binary variables

01/27/2021 Introduction to Data Mining, 2nd Edition 77

Tan, Steinbach, Karpatne, Kumar
Attribute Transformation

An attribute transform is a function that maps the

entire set of values of a given attribute to a new
set of replacement values such that each old
value can be identified with one of the new values
– Simple functions: xk, log(x), ex, |x|
– Normalization
Refers to various techniques to adjust to
◆
differences among attributes in terms of frequency
of occurrence, mean, variance, range
◆ Take out unwanted, common signal, e.g.,
seasonality
– In statistics, standardization refers to subtracting off
the means and dividing by the standard deviation
01/27/2021 Introduction to Data Mining, 2nd Edition 78
Tan, Steinbach, Karpatne, Kumar
Example: Sample Time Series of Plant Growth
Minneapolis

Net Primary
Production (NPP)
is a measure of
plant growth used
by ecosystem
scientists.

Correlations between time series

Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.7591 -0.7581
Atlanta 0.7591 1.0000 -0.5739
Sao Paolo -0.7581 -0.5739 1.0000
01/27/2021 Introduction to Data Mining, 2nd Edition 79
Tan, Steinbach, Karpatne, Kumar
 Seasonality Accounts for Much Correlation
Minneapolis
Normalized using
monthly Z Score:
Subtract off monthly
mean and divide by
monthly standard
deviation

Correlations between time series

Correlations between time series
Minneapolis Atlanta Sao Paolo
Minneapolis 1.0000 0.0492 0.0906
Atlanta 0.0492 1.0000 -0.0154
Sao Paolo 0.0906 -0.0154 1.0000
01/27/2021 Introduction to Data Mining, 2nd Edition 80
Tan, Steinbach, Karpatne, Kumar
Curse of Dimensionality

When dimensionality
increases, data becomes
increasingly sparse in the
space that it occupies

Definitions of density and

distance between points,
which are critical for
clustering and outlier
detection, become less
meaningful •Randomly generate 500 points
•Compute difference between max and
min distance between any pair of points
01/27/2021 Introduction to Data Mining, 2nd Edition 81
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction

Purpose:
– Avoid curse of dimensionality
– Reduce amount of time and memory required by data
mining algorithms
– Allow data to be more easily visualized
– May help to eliminate irrelevant features or reduce
noise

Techniques
– Principal Components Analysis (PCA)
– Singular Value Decomposition
– Others: supervised and non-linear techniques

01/27/2021 Introduction to Data Mining, 2nd Edition 82

Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA

Goal is to find a projection that captures the

largest amount of variation in data
x2

x1
01/27/2021 Introduction to Data Mining, 2nd Edition 83
Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA

01/27/2021 Introduction to Data Mining, 2nd Edition 84

Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection

Another way to reduce dimensionality of data

Redundant features
– Duplicate much or all of the information contained in
one or more other attributes
– Example: purchase price of a product and the amount
of sales tax paid
Irrelevant features
– Contain no information that is useful for the data
mining task at hand
– Example: students' ID is often irrelevant to the task of
predicting students' GPA
Many techniques developed, especially for
classification
01/27/2021 Introduction to Data Mining, 2nd Edition 85
Tan, Steinbach, Karpatne, Kumar
Feature Creation

Create new attributes that can capture the

important information in a data set much more
efficiently than the original attributes

Three general methodologies:

– Feature extraction
◆ Example: extracting edges from images
– Feature construction
◆ Example: dividing mass by volume to get density
– Mapping data to new space
◆ Example: Fourier and wavelet analysis

01/27/2021 Introduction to Data Mining, 2nd Edition 86

Tan, Steinbach, Karpatne, Kumar
Mapping Data to a New Space

Fourier and wavelet transform

Frequency

Two Sine Waves + Noise Frequency

01/27/2021 Introduction to Data Mining, 2nd Edition 87

Tan, Steinbach, Karpatne, Kumar