0% ont trouvé ce document utile (0 vote)
15 vues194 pages

Vidal

Transféré par

atlagh ayoub
Copyright
© All Rights Reserved
Nous prenons très au sérieux les droits relatifs au contenu. Si vous pensez qu’il s’agit de votre contenu, signalez une atteinte au droit d’auteur ici.
Formats disponibles
Téléchargez aux formats PDF, TXT ou lisez en ligne sur Scribd
0% ont trouvé ce document utile (0 vote)
15 vues194 pages

Vidal

Transféré par

atlagh ayoub
Copyright
© All Rights Reserved
Nous prenons très au sérieux les droits relatifs au contenu. Si vous pensez qu’il s’agit de votre contenu, signalez une atteinte au droit d’auteur ici.
Formats disponibles
Téléchargez aux formats PDF, TXT ou lisez en ligne sur Scribd

THESE DE DOCTORAT DE

L'UNIVERSITE DE NANTES
COMUE UNIVERSITE BRETAGNE LOIRE

ECOLE DOCTORALE N° 605


Biologie Santé
Spécialité : Médecine Régénératrice et Biomatériaux

Par
Luciano VIDAL
Large Bone Defects Reconstruction

by using vascularization and 3D Printing


Thèse présentée et soutenue à Nantes, le 20-12-2019
Unité de recherche : UMR 1238

Rapporteurs avant soutenance :


Nathalie, Chevallier Chargée de recherche, Unité d'Ingenierie et de Thérapie Cellulaire- EFS, Créteil.
Agnès, Dupret-Bories PH-HDR, IUCT Toulouse, Oncopole.

Composition du Jury :
Président :
Examinateurs : Françoise, Rédini Directeur de Recherche, INSERM, UMR 1238 Phy-Os.
Philippe, Rosset PU-PH, CHU Tours.
Christophe, Marquette Directeur de Recherche , Université de Lyon 1, CNRS 5246 ICBMS.

Dir. de thèse : Pierre, Layrolle Directeur de Recherche , INSERM, UMR 1238 Phy-Os.
Co-dir. de thèse : Alain, Hoornaert MCU, Université de Nantes. UMR 1238 Phy-Os.
Co-encadrant : Meadhbh, Brennan Post-Doc, INSERM, UMR 1238 Phy-Os.

1
« A mi familia Clara, Tahiel y Solal.

Gracias por acompañarme, sostenerme y siempre estar a mi lado.

Perdón por los momentos que les he robado este tiempo.

Son mi vida, LOS AMO !!! »

2
VALORIZATION OF THESIS WORK

Publications
1. Reconstruction of large skeletal defects: current clinical therapeutic strategies
and future directions using 3D printing. (Submitted to publication in Journal :
Frontiers in Bioengineeirng and Biotechnology - Special Issue: 3D Printing for
Implantable Medical Devices: From Surgical Reconstruction to Tissue/Organ
Regeneration);
Vidal L ; Kampleitner C ; Brennan MA ; Hoornaert A ; Layrolle P.

2. In situ production of a pre-vascularized synthetic bone graft for regeneration of


critical size defects in rabbits. (Submitted to publication in Journal :
Biomaterials).
Vidal L; Brennan MA ; Krissian S ; De Lima J ; Hoornaert A ; Rosset P ; Fellah
BH ; Layrolle P.

3. Regeneration of segmental defects in metatarsus of sheep with


vascularized and customized 3D-printed calcium phosphate scaffolds.
(Submitted to publication in Journal : Scientific Reports - Special Issue: 3D
bioprinting of cells, tissues and organs).
Vidal, L ; Kampleitner C ; Krissian S ; Hoffmann O ; Raymond S; Maazouz Y,
Ginebra MP; Rosset P; Layrolle P.

Publications in collaboration
1. Bone regeneration strategies with bone marrow stromal cells in orthopaedic
surgery.
Stanovici J, Le Nail LR, Brennan MA, Vidal L, Trichet V, Rosset P, Layrolle P.
Curr Res Transl Med. 2016 Apr-Jun;64(2):[Link].1016/[Link].
2016.04.006. Epub 2016 Jun 1. Review.

3
2. Bone microenvironment has an influence on the histological response of
osteosarcoma to chemotherapy: retrospective analysis and preclinical
modeling.
Crenn V, Biteau K, Amiaud J, Dumars C, Guiho R, Vidal L, Nail LL, Heymann
D, Moreau A, Gouin F, Redini F. Am J Cancer Res. 2017 Nov 1;7(11):2333-
2349. eCollection 2017.

3. Biocompatibility and osseointegration of nanostructured titanium dental


implants in minipigs. Clinical Oral Implants Research. (In Review).
Hoorrnaert A, Vidal L, Besnier R, Morlock JF, Louarn G, Layrolle P.

4. Epinephrine infiltration of adipose tissue impacts MCF7 breast cancer cells and
total lipid content. International Journal of Molecular Science. (In Press).
Avril P, Vidal L (co-first author), Barillé-Nion S, Le Nail LR, Rédini F, Layrolle
P, Pinault M, Chevalier S, Perrot P, Trichet V.

5. Osteogenic potential of human umbilical cord blood and bone marrow


mesenchymal stromal cells after chondrogenic and BMP-4 priming. Bone
Research. (In Review).
Brennan MA, Barilani M, Vidal L, Lavazza L, Lazzari L, Giordano R, Layrolle P.

4
Presentations in Congress

Oral Presentation

1. 29th Symposium and Annual Meeting of the International Society for Ceramics in
Medicine. October 2017. Best Oral Award. In situ production of a pre-
vascularized synthetic bone graft for regeneration of critical size defects in
rabbits.
2. Cancer and Biofabrication.1st Workshop- 3D Bioprinting in Cancer Research.
Cancéropôle Grand Ouest. July 2017. 3D Printing of biomaterial scaffolds from
CT Scan for bone regeneration after tumor resection.

Poster Presentation

1. 2nd Workshop "BIOFABRICATION & CANCER". Cancéropôles Grand Sud-


Ouest (GSO) et Grand Ouest (GO). June 2018. 3D Bioprinting of bone tumors
for modeling the osteosarcoma microenvironment.

2. EU - TERMIS Chapter (Tissue Engineering and Regenerative Medicine


International Society). May 2019. Reconstruction of Large bone defect in sheep
with customized 3D printed calcium phosphate scaffolds.

3. EU - TERMIS Chapter (Tissue Engineering and Regenerative Medicine


International Society). May 2019. An innovative bioink for 3D bioprinting of
mesenchymal stem cells.

4. EU -TERMIS Workshop: 3D Bioprinting in Cancer Research. August 2019.


Additive manufacture for in vitro modelling of human giant cell tumour of bone.

5
TABLE OF CONTENTS

General Summary in French

Summary

List of Abbreviations

1. General Introduction ………………........................................................... p 18

Bone Macroscopic Structure …………………………………….………….….p 18

Types of Bone ……………………………………………...………………….....p 18

Bone Tissue ………………………………………………………………………p 20

Bone Cells ……………………………………………………….………………. p 20

Extracellular Bone Matrix ………………………………………………………..p 21

Bone Microscopic Structure ……………………………………………………. p 22

The Haversian System …………………………………………….....…………p 24

Vasculature of Bone………………………………………………………………p 24

Bone Healing ………………………………………..……………………..…….p 27

State of the Art in Bone Regeneration ……………………………………….. p 29

Objectives of the Thesis ……….……………………………………..……….. p 33

2. Chapter I ……………………………………………………………….…………p 41

Reconstruction of large skeletal defects: current clinical therapeutic strategies and

future directions using 3D printing. (Paper I)

6
3. Chapter II …………………………………………………………………….…..p 78

In situ production of pre-vascularized synthetic bone grafts for regenerating critical-

sized defects in rabbits. (Paper II)

4. Chapter III ………………………………………………………………….…..p 120

Regeneration of segmental defects in metatarsus of sheep with vascularized and

customized 3D-printed calcium phosphate scaffolds. (Paper III)

5. General Discussion ………………………………………………………..…p 149

6. Conclusion ………………………………………………………………….....p 153

7. Future Perspectives ………………………………………………..………..p 155

8. References ………………………………………………………………...…..p 156

9. Annexe …………………………………………………………………………p 178

7
RÉSUMÉ

Suite à un traumatisme, l’os est capable de se réparer naturellement dans la plupart

des situations. La consolidation osseuse, est un processus de régénération

progressive et continue qui s’effectue en trois étapes principales. Dans un premier

temps, les macrophages produisent des cytokines inflammatoires comme les

interleukines-1 et -6 (IL-1, IL-6), le facteur de nécrose tumoral (TNF), la Chemokine C-

C Ligand 2 (CCL2) qui favorisent la dégradation du caillot de fibrine et le recrutement

de cellules stromales mésenchymateuses (CSM). Ensuite, les CSM produisent une

matrice extracellulaire composée de glycoprotéines qui évolue d’un cal mou de tissu

fibro-cartilagineux vers un tissu riche en fibres de collagène de type I dans lequel des

cristaux d’hydroxyapatite précipitent. Ce processus de minéralisation s’accompagne

d’une néo-vascularisation stimulée par la sécrétion de cytokines pro-angiogéniques

comme le fibroblast growth factor (FGF) ou le vascular endothelial growth factor

(VEGF). Les CSM se différencient progressivement en ostéoblastes et ostéocytes

enchâssés dans la matrice extracellulaire minéralisée. Au cours de cette dernière

étape, le cal osseux est remodelé sous l’action concertée des cellules multi-nucléées,

les ostéoclastes, capables de résorber la matrice extracellulaire minéralisée, et des

ostéoblastes qui la produisent. Ce processus de remodelage assure une consolidation

mécanique et rend à l’os sa forme initiale, avec la réapparition du canal médullaire. La

cicatrisation complète d’une fracture nécessite en général une immobilisation de 45

jours.

Cependant, certaines fractures ou pertes osseuses ne peuvent pas se régénérer

spontanément. Ces défauts osseux de taille critique nécessitent une intervention

8
chirurgicale de reconstruction osseuse utilisant le plus souvent de l’os prélevé sur le

patient. Chaque année, plus d’un million de patients bénéficient d’une reconstruction

osseuse en Europe faisant de l’os le second tissu le plus transplanté après les

transfusions sanguines.

Cette thèse aborde les traitements actuels et les options futures pour la reconstruction

de grands défauts osseux, ce qui constitue aujourd’hui un défi pour les chirurgiens

orthopédistes et les chirurgiens plasticiens qui souhaitent éviter l’amputation et

améliorer la qualité de vie des patients. L’objectif de cette thèse est d’apporter de

nouvelles solutions chirurgicales pour la régénération de grands défauts osseux en

utilisant l’imagerie médicale, des biomatériaux anatomiques fabriqués par impression

3D et la vascularisation. Cette thèse est divisée en trois chapitres.

Le premier chapitre donne les différentes options chirurgicales actuelles et futures

dans la reconstruction de grands défauts osseux. Ces défauts osseux peuvent résulter

d’un traumatisme, d’une infection, d’une résection tumorale, des anomalies

squelettiques ou lorsque le processus de remodelage osseux est compromis (par

exemple, dans la nécrose avasculaire, la non-consolidation atrophique ou

l’ostéoporose). La technique de référence en matière de reconstruction osseuse est la

greffe autologue à lambeau libre qui contient les cellules du patient, ses facteurs de

croissance et un apport vasculaire. Cependant, ses principaux inconvénients sont la

morbidité au niveau du site de prélèvement, la microchirurgie laborieuse pour adapter

le greffon à l’anatomie du défaut osseux et sa vascularisation. Une autre option

possible est la technique de Masquelet qui consiste à placer dans le défaut osseux un

ciment à base de polymère pour induire une membrane vascularisée et qui est

remplacé après 6 semaines par des fragments d’os autologue. Cette technique de

Masquelet a prouvé son efficacité pour la régénération des défauts segmentaires de

9
plusieurs centimètres dans les os longs, mais nécessite toujours un prélèvement de

l'os iliaque autologue, ajoutant ainsi une morbidité avec deux interventions

chirurgicales consécutives. Il est important de souligner que le stock osseux du patient

est limité et que ces techniques de transplantation osseuse présentent de nombreuses

complications post-chirurgicales. Ainsi, les chirurgiens utilisent en seconde intention

les allogreffes osseuses massives provenant de banques de tissus pour la

reconstruction de défauts complexes du squelette. Néanmoins, ces allogreffes

présentent des risques de transfert de maladie et de rejet immunitaire. La méthode

utilisant le patient comme bioréacteur a démontré qu'il est possible de préparer de

manière exogène un substitut mandibulaire personnalisé dans le muscle et de le

transplanter dans un défaut osseux existant. Cependant, cette méthode ne s'applique

pas à l'urgence, nécessite deux sites chirurgicaux et au moins deux chirurgies affectant

la qualité de vie des patients. Depuis plusieurs années, des substituts osseux

synthétiques à base de phosphate de calcium ont été développés pour guider la

régénération osseuse. Cependant, les propriétés de régénération de ces substituts

osseux restent insuffisantes pour les défauts osseux importants en raison d'un

manque de vascularisation initiale. Enfin, dans ce chapitre, les futures directions pour

la reconstruction de grands défauts osseux sont proposées avec l’utilisation de

nouvelles technologies telles que l’impression 3D et le bioprinting 3D. Ces méthodes

de fabrication additive permettent de fabriquer des substituts osseux personnalisés

correspondant à l'anatomie du patient à partir d'images médicales. La bioimpression

3D permettra également d'inclure des cellules vivantes et la vascularisation afin de

produire ex vivo un organe osseux fonctionnel.

Le deuxième chapitre évalue une approche expérimentale consistant à produire in situ

un greffon osseux synthétique pré-vascularisé et à le greffer par la suite dans un défaut

10
osseux de taille critique chez le lapin. Des chambres imprimées en 3D contenant des

granules de phosphate de calcium biphasé (BCP), perfusées par un pédicule

vasculaire local, avec ou sans addition de la fraction vasculaire stromale (FSV) du tissu

adipeux ont été implantées dans un site sous-cutané chez des lapines de race blanche

de Nouvelle-Zélande. Après huit semaines, ces substituts osseux 3D présentaient de

nombreux vaisseaux sanguins provenant du pédicule vasculaire axial et une

production abondante de collagène, mais pas d'os. Transplantés dans des défauts

ulnaires segmentaires de taille critique de 15 mm, une régénération osseuse a été

observée pour les substituts osseux vascularisés après huit semaines

supplémentaires. Cependant, ces greffons n’ont pas été reconnectés au système

vasculaire local du défaut osseux. Cette étude chez l'animal a démontré l'intérêt de la

pré-vascularisation de greffes osseuses synthétiques pour la régénération de grands

défauts osseux, mais nécessite toujours deux chirurgies.

Le troisième chapitre concerne la régénération de grands défauts osseux chez la

brebis en une seule étape chirurgicale. Dans cette nouvelle approche, des

biomatériaux de phosphate de calcium et des guides chirurgicaux personnalisés ont

été imprimés en 3D à partir de scanners de tomodensitométrie préopératoires

permettant de visualiser le métatarse et le système vasculaire local. L’impression 3D

a permis la fabrication de biomatériaux 3D anatomiques comportant une porosité

interconnectée et contrôlée. Des défauts segmentaires de taille critique (35 mm) ont

été créés dans la région mesio-diaphysaire du métatarse. Ces défauts étaient soit

laissés vides, soit comblés avec un biomatériau 3D, ou en combinaison avec un

pédicule vasculaire axial translaté dans le défaut. La régénération osseuse évaluée à

1, 2 et 3 mois après l'implantation était significativement plus rapide et plus élevée

pour les biomatériaux 3D comportant une vascularisation axiale que pour ceux sans,

11
et a fortiori pour le défaut laissé vide. Cette étude pré-clinique a démontré la faisabilité

de la planification pour la reconstruction chirurgicale en une seule étape de grands

défauts osseux en utilisant des biomatériaux personnalisés imprimés en 3D et une

vascularisation axiale.

Cette thèse permet donc de proposer des alternatives chirurgicales prometteuses pour

la régénération de grands défauts osseux qui restent encore aujourd’hui très difficiles

à reconstruire. Néanmoins, nos études devront être confirmées par l’utilisation d’un

plus grand nombre d’animaux, de sites anatomiques plus complexes que les os longs

et de biomatériaux 3D plus résistants mécaniquement et possédant une dégradation

concertée avec la régénération osseuse. Ce travail permet d’envisager des

reconstructions du squelette complexes sans recours aux greffes grâce à l’apport de

l’imagerie médicale, la planification pré chirurgicale, la fabrication additive de

biomatériaux anatomiques et l’apport de la vascularisation.

12
SUMMARY

The present thesis addresses the actual treatments and future options for large bone

defect reconstruction that constitutes a challenge for orthopedists and plastic

surgeons. This thesis is divided into three chapters.

The first chapter consists of a review of the actual surgical options in large bone defects

reconstruction. These bone defects can arise due to trauma, infection, tumor resection,

skeletal abnormalities, or when the bone remodeling process is compromised (such as

in avascular necrosis, atrophic non-union, or osteoporosis). The gold standard

technique for bone reconstruction is autologous free flap transplantation that contains

patient’s own cells, growth factors and a vascularization bed. However, its main

disadvantages are morbidity, laborious microsurgery and shaping to the anatomy of

the bone defect. Another option is the Masquelet’s technique that consists of placing

a polymer cement to induce a vascularized membrane after 6 weeks before filling with

autologous bone. It has proven efficacy for regenerating segmental defects in long

bones but still requires to harvest autologous iliac bone, thus adding morbidity with two

consecutive surgeries. It is important to emphasize that the patient’s bone stock is

limited. Massive bone allografts from tissue banks are alternatives for reconstruction

of complex skeletal defects but present risks of disease transfer and immune rejection.

In patient bioreactor has also been demonstrated to prepare exogenously a

customized mandible replacement grown in muscle prior to transplantation to repair

the existing defect but the method is not applicable to emergency and requires two

surgical sites. Synthetic bone substitutes have insufficient regenerative properties for

large bone defects due to a lack of initial vascularization. Finally, in this chapter, we

described the future possible options for large bone defect reconstruction with the use

13
of new technology such as 3D printing and 3D Bioprinting. These additive

manufacturing methods allow to fabricate customized bone substitutes fitting the

anatomy of the patient from medical images. 3D bioprinting will also permit to include

living cells and vascularization.

The second chapter evaluates an experimental approach consisting of the in

situ production of a pre-vascularized synthetic bone graft and its subsequent

transplantation to a critical-sized bone defect in rabbits. 3D printed chambers

containing biphasic calcium phosphate (BCP) granules, perfused by a local vascular

pedicle, with or without the addition of stromal vascular fraction (SVF) were

subcutaneously implanted into New Zealand White female rabbits. After eight weeks,

these 3D constructs exhibited many blood vessels sprouting from the axial vasculature

and abundant collagen production, but no bone. When transplanted into 15 mm

critical-sized segmental ulnar defects for a further eight weeks, these constructs

enhanced bone regeneration although they were not reconnected to the local

vasculature of the defect. This animal study demonstrated the benefit of pre-

vascularization of synthetic bone grafts for regenerating large bone defects but

required two surgeries.

The third chapter aimed to investigate the feasibility of regenerating large bone defects

in one surgical step by using 3D-printed customized calcium phosphate scaffolds with

or without vascularization. Pre-operative computed tomography scans were performed

to visualize the metatarsus and vasculature and to fabricate customized scaffolds and

surgical guides by 3D printing. Critical-sized segmental defects created in the mid-

diaphyseal region of the metatarsus were either left empty or treated with the 3D

scaffold alone or in combination with an axial vascular pedicle. Bone regeneration

evaluated 1, 2, and 3 months post-implantation was significantly faster and higher for

14
3D scaffolds comprising an axial vascuture than without and a fortiori for the left empty

defect. This pre clinical study demonstrated the feasibility of pre-surgical planning and

reconstruction of large bone defects with 3D-printed personalized scaffolds and axial

vascularization in a one step surgery.

15
LIST OF ABBREVIATIONS

BCP: Biphase calcium phosphate

BMP: Bone Morphogenetic Protein

β-TCP: Beta-tricalcium phosphate

CAD: computer-aided design (CAD)

CAO: Computer assisted ordering (CAO)

CCL2: Chemokine C-C Ligand 2

CD: Differentiation Cluster

CSM: Mesenchymal stromal stem cells

DMEM: Dulbecco's modified eagle medium

EDTA: Ethylene Diamine Tetra Acetic

FGF: Fibroblast growth factor

HA: Hydroxyapatite

IL-1 / IL-6: Interleukins 1 and 6

IV: Intravenous injection

MCAM: Melanoma Cell Adhesion Molecule

MEC: Extracellular Matrix (MEC)

MMPs: Matrix metalloproteinases

NZW: New-Zealand White

P / S: Penicillin / Streptomycin

PBS: Salted buffered phosphate

PCL: Polycaprolactone

PDGF: Platelet-derived growth factor

16
PLA: Polylactic acid

PLGA: Poly(lactic-co-glycolic acid)

PLLA: Poly-L-Lactic Acid

SD: Standard Deviation

SEM: Scanning Electron Microscopy

STL: Stereolithography

SVF: Vascular Stromal Fraction

CT: CT Scanner, Computed Tomography

MT: Masson's Trichrome Staining

TE: Tissue Engineering

TERMIS: Tissue Engineering and Regenerative Medicine International Society

TGF-β : Transforming growth factor-β

TNF: Tumor necrosis factor

VEGF: Vascular endothelial growth factor (VEGF)

17
GENERAL INTRODUCTION

The reconstruction of large de bone defects caused by trauma, infection, and tumor

resection is a challenge for orthopedists and plastic surgeons. Bone is a vascularized

connective tissue responsible for the support and protection of the organs of the body

(Neto and Ferreira, 2018). Bone tissue is in a constant remodeling process to adapt

itself to the mechanical demands of the body and to repair small lesions that may occur

(Hadjidakis and Androulakis, 2006). However, large critical size bone defects, defined

by Schmitz and Hollinger as a defect of a magnitude that the bone itself is unable to

recover through its natural regeneration, require a medical reconstructive intervention

(Schmitz and Hollinger, 1986). Chapter 1 of this manuscript is part of the introduction.

In this chapter 1, we describe the current treatments for large bone defects

reconstruction as well as future options for this type of reconstruction.

Bone Macroscopic Structure

Types of Bone

There are two types of bones in the human skeleton, flat bones (ex: mandible, ilium,

scapula) and long bones (ex: radius, tibia, femur). These types of bones not only differ

by their anatomical structure but also by their primary development. Briefly, flat bones

result from an intramembranous development while long bones undergo endochondral

ossification, with cartilage as an intermediate stage.

In the case of long bones, different parts can be distinguished as in Figure 1. The shaft

of the bone, called the diaphysis, consists of a hollow cylinder of dense, or compact,

bone surrounding a marrow space. The compact bone in this location is the cortical

bone. The methaphysis refers to the widened portion of bone situated in between the

18
diaphysis and the epiphysis. The metaphysis is occupied by cancellous, or trabecular

bone, is organized into a three-dimensional latticework of inter-connecting struts of

bone (trabeculae) that transmits forces between the joint and the shaft of the bone.

This porous light bone composed of bone struts of 0.5mm of thickness, encloses

spaces of 0.5mm to 1mm.

The epiphysis is the end of the long bone which supports the articular cartilage of the

joint. The external surface of bone is called periosteum and the internal surface is the

endosteum. Cortical bone fulfills a structural function and mechanical support, whereas

trabecular bone serves to maintain mineral homeostasis at it contains the bone

marrow.

Figure 1: Long Bone Architecture.

19
Bone Tissue

Bone is a highly specialized connective tissue, formed by cells and of an extracellular

bone matrix, that has different functions. It protects vital organs against trauma. It

provides a rigid frame for organs and soft tissues performing the function of support,

and it allows the locomotion (Mechanical Function). Bone participates in mineral

storage and growth factors secretion (Metabolic Function). Moreover, bone tissue has

also a hematopoietic function as it hosts bone marrow containing hematopoietic and

mesenchymal stem cells (Forriol, 2009).

Bone Cells

There are five types of bone cells:

- Osteoprogenitor cells that derive from the bone marrow mesenchymal cells and

will differentiate into osteoblasts.

- Osteoblasts are mononuclear cells that produce the bone extracellular matrix

and are responsible for bone formation. They originate from mesenchymal stem

cells. They secrete a wide variety of macromolecules such as collagen, alkaline

phosphatase, osteonectin, fibronectin, vitronectin, osteopontin, and bone

sialoprotein.

- Osteocytes are osteoblasts that have matured by being trapped inside the bone

extracellular matrix. They make up 90% of mature bone cells. They have low

synthesis activity, but it is believed that they are responsible for bone

remodeling.

- Bone Lining cells correspond to osteoblasts that have concluded the synthesis

of bone matrix and entered in a quiescent phase. These cells are localized in

20
the periosteum and the endosteum (Everts et al., 2002; Henriksen et al., 2009;

Matsuo and Irie, 2008).

- Osteoclasts, are large and rounded multinucleated cells, specializing in bone

resorption dissolving the proteinaceous bone matrix by the enzymatic activity of

cathepsin K and matrix metalloproteinase 9. This activity is balanced with bone

formation carried out by osteoblasts. They derive from the same hematopoietic

precursors that give rise to monocytes and macrophages (Figure 2).

Figure 2 : Classification of bone cells based on source and function (Lian et al.,

2012).

Extracellular Bone Matrix

The bone extracellular matrix is a complex connective tissue composed of an organic

matrix (35% of total bone mass). This matrix presents mainly collagen fiber type I,

approximately 90% of the extracellular matrix, and an inorganic matrix consisting of

carbonated hydroxyapatite (HA) crystals. Only 20% of the bone is water. Non-

collageneous bone proteins play an essential role in bone remodeling and

osteogenesis. This group includes various growth factors, such as transforming growth

21
factor beta and bone morphogenetic proteins, cytokines, osteonectin, osteopontin,

osteocalcin, bone sialoproteins, phosphoproteins thrombospondin, proteoglycans,

Hyaluronic acid and phospholipids are also components of this extracellular matrix

(Glimcher, 1989; Rho et al., 1998).

During life, bone tissue is continuously renewed by remodeling in order to repair the

physiological micro-fractures but also to adapt to new mechanical constraints.

Osteoclasts are responsible for the resorption of the bone tissues via acidification and

enzymatic digestion processes. The formation of new bone is provided by osteoblasts,

which can synthesize a matrix, which will imbibe carbonated hydroxyapatite to form

bone tissue.

Bone Microscopic Sructure

The principal mineral component in bone (45% of total bone mass), is calcium and

phosphate in the form of hydroxyapatite. Osteoblasts secrete this mineral component

in matrix vesicles. This crystalline precipitates of mineral permeate collagen type I

protein substrate. At first, the bone is immature with its randomly oriented collagen

fibers. This bone is named woven bone. Osteoclasts reabsorb this immature bone and

replace it by new bone, the lamellar bone formed by osteoblasts in which collagen type

I fibers are ordered and layered in alternating directions. This ordered extracellular

matrix is a complex process. This procedure starts in the osteoblast and continues

after secretion to form the triple-helicoidal molecule, called tropocollagen. This

alternating orientation of collagen fibers in different layers is essential to the

mechanical strength and elasticity of the bone (Table 1). A capsule of collagen fibers

covers the surface of the bone. These fibers ore organize parallel to the surface of the

bone. This capsule is called circumferential lamella. This proteinaceous matrix, known

as osteoid, is the microenvironment where the mineral precipitates (Figure 3). Bone

22
morphogenetic platelet-derived growth factor, fibroblast growth factor, and other

proteins as vitronectin control and regulate the hydroxyapatite crystals precipitation.

This mineral precipitation impregnates the osteoid forming the composite material, the

bone (Boskey and Robey, 2013; Combes and Rey, 2010; Ottani et al., 2001).

Table 1 : Values of maximum resistance and elastic modulus of human

cortical bone for the different types of mechanical tests (Caeiro JR, 2013)

Figure 3 : Bone’s microstructure. Macmillan Publishers Ltd:

Nature Communication.(Fielder and Nair, 2019)

23
The Haversian System

Cortical bone is too thick to allows the adequate nutrient of osteocytes. The Haversian

system, composed of concentric cylinders of bone surrounding blood vessels and a

nerve, ensure cortical bone vascularization (Figure 4). Blood vessels are located in a

central Haversian canal oriented parallel to the long axis of the bone. One Haversian

canal and its concentric lamella are called an osteon. The Haversian systems are

interconnected by Volkmann's canal.

Figure 4 : The Haversian System. (Johannesdottir et al. 2018)

Vasculature of Bone

Bone is a highly vascularized tissue. This vascularization has a very important role in

bone development, regeneration, and bone remodeling. The blood supply brings

24
oxygen, nutrients, and at the same time, growth factors that will stimulate bones cells

activity. As described before, bone has two types of development, endochondral

ossification, and intramembranous ossification (Figure 5). In both models,

angiogenesis constitutes a crucial stage. This angiogenesis is dependent on the

vascular endothelial growth factor (VEGF) produced by hypertrophic chondrocytes

(endochondral ossification) or by the differentiation of the mesenchymal cells

(intramembranous ossification) (Brandi and Collin-Osdoby, 2006; Dai and Rabie,

2007; Hankenson et al., 2011; Niedźwiedzki and Filipowska, 2015; Tomlinson and

Silva, 2013)

Figure 5 : Stages of blood vessel invasion during bone development.

(Liu Y et al. 2014)


25
During bone regeneration it was described that osteogenic precursor cells interact with

endothelial cells type H enriched in the bone metaphysis at the endosteal surface. As

shown in figure 6 Notch signaling activation and Noggin production regulates

osteoprogenitor cells and osteogenesis (Kenswil et al., 2018; Kusumbe et al., 2014;

Ramasamy et al., 2014)

Figure 6 : Endothelial Notch signaling regulates osteogenesis (Filipowska et al. 2017).

The central nutrient artery, the epiphyseal metaphyseal vessels, and finally, the

periosteal vessels are the three main systems for the long bone blood supply (Figure

7). The central nutrient artery supplies the entire medullar cavity and the 2/3 of the

outer cortical bone. Periosteal arteries penetrate the outer cortical bone supplying the

other 1/3. At the microscopic level, blood vessels of the long bones localize within the

Haversian and Volkmann’s canals in compact bone and further pass above the

medullary cavity, penetrating the spongy bone. In flat bones periosteal arteries deliver

the blood supply (Filipowska et al., 2017).

26
Figure 7 : Long bone vascular system. Arteries (red) Veins (blue) (Filipowska et al.

2017) (Brookes M, 1963)

Bone Healing

Following a trauma, a bone fracture is able to repair itself naturally in most cases. Bone

healing is a progressive and continuous regeneration process that takes place in three

main stages. In a first step, macrophages produce inflammatory cytokines such as

interleukins-1 and -6 (IL-1, IL-6), tumor necrosis factor (TNF), Chemokine CC Ligand

27
2 (CCL2) that promote degradation. Fibrin clot and recruitment of mesenchymal

stromal stem cells (MSCs). In a second step, MSCs differentiate into osteoblasts that

produce an extracellular matrix composed of glycoproteins that evolve from a soft

callus of fibro-cartilaginous tissue to a tissue rich in type I collagen fibers that

progressively become impregnated with hydroxyapatite crystals. This latter process is

accompanied by neovascularization stimulated by the secretion of pro-angiogenic

cytokines such as fibroblast growth factor (FGF) or vascular endothelial growth factor

(VEGF). MSCs progressively differentiate into osteoblasts and osteocytes embedded

in the mineralized extracellular matrix. In this last step, a bone callus is remodeled

under the concerted action of multinucleated cells, osteoclasts, capable of resorbing

the mineralized extracellular matrix, and osteoblasts that produce it. This remodeling

process provides mechanical consolidation and returns the bone to its original shape,

with the recurrence of the medullary canal. Complete healing of a fracture usually

requires 45 days (Matsuo and Irie, 2008). However, some fractures or bone loss, which

may be due to trauma, bone resection related to infection or tumor, cannot regenerate

spontaneously (Figure 8).

28
Figure 8 : Fracture healing process, biological events, and cellular activities at

different phases. Macmillan Publishers Ltd: Nature Reviews Rheumatology. (Einhorn

and Gerstenfeld, 2015)

State of the Art in Bone Regeneration

Large bone defects of critical size require a bone reconstruction surgery using most

often bone taken from the patient, sol called autologous bone grafting. Every year,

more than one million patients benefit from bone reconstruction in Europe (Gómez-

Barrena et al., 2011). The treatment of bone loss is based on autologous, allogeneic,

or xenogeneic bone grafts and more recently to synthetic bone substitutes. The

selection of the ideal bone graft is based on several factors such as the viability of the

tissues, the shape, and volume of the defect. Autologous bone transplantation is still

the gold standard for bone reconstruction because the autograft contains the patient's

29
cells and growth factors that promote tissue regeneration (Brydone et al., 2010;

Dimitriou et al., 2011; Myeroff and Archdeacon, 2011; Oryan et al., 2014).

Nevertheless, the reconstruction of large bone defects resulting from severe trauma or

the resection of tumors and infections remains a challenge for orthopedic and plastic

surgeons. In these severe cases, a bone flap with its vascular pedicle is taken from the

patient's fibula and then transplanted into the site to be reconstructed, while

vascularization is performed by microsurgery of the vessels (Figure 9) (Bakri et al.,

2008; Campanacci et al., 2014; Garrigues et al., 2009; Innocenti et al., 2009). Although

autologous bone graft transplantation remains the gold standard in bone regeneration,

this technique has some disadvantages for the patient. The main problem is the need

for a second operative site to harvest bone graft, which can lead to morbidity, severe

pain, hematoma, infections, and wounds (Sawin et al., 1998). Besides, the amount and

possibilities of taking bone from the patient are limited. Finally, complex surgical

reconstructions require the shaping of the graft to adapt to the anatomical shape of the

defect and microsurgical techniques to ensure its vascularization. Alternatively,

allogeneic and xenogeneic bone grafts that do not require sampling from the patient

are less osteogenic and may induce immunogenic rejection (Bucholz, 2002; De Long

et al., 2007).

30
Figure 9 : Principle of transplantation of an autologous vascularized bone graft from

the fibula (Textbook of Complex General Surgical Oncology -Shane Y. Morita, Charles

M. Balch, V. Suzanne Klimberg, Timothy M. Pawlik, Mitchell C. Posner, Kenneth K.

Tanabe).

Synthetic bone substitutes made of calcium phosphates have osteoconductive

properties thus able to guide bone growth. However, these biomaterials have

insufficient regenerative properties for large bone defect regeneration. Many groups

have therefore added MSCs or BMPs to calcium phosphate biomaterials to regenerate

bone and the field of tissue engineering has emerged.

Tissue engineering is potentially a promising alternative to autologous bone grafting

(Rosset et al., 2014; Tang et al., 2016). Tissue engineering involves associating a

biocompatible material with cells or biological factors in order to replace or repair

tissues or organs and thus restore and regenerate their function within the body

(Hutmacher et al., 2007; Kneser et al., 2006a; Langer and Vacanti, 1993). In bone

31
regeneration, a matrix (scaffold) serving as a support for cells and healing is needed.

Among different biomaterials, calcium phosphate bioceramics that are chemically

comparable to bone mineral are the most suitable because they have osteoconductive

or guided bone regeneration properties (Albrektsson and Johansson, 2001; Fellah et

al., 2006). The mesenchymal stromal stem cells present in human tissues in a very

small proportion intervene in the healing of connective tissues, such as bone. These

cells can be isolated from bone marrow or adipose tissue and amplified in culture. As

shown in Figure 10, the vascular, stromal fraction of adipose tissue contains

mesenchymal stromal stem cells and endothelial cells that can stimulate bone healing

and angiogenesis.

Figure 10 : Obtaining stromal vascular fraction (SVF) from adipose tissue and culturing

mesenchymal stromal stem cells (MSCs) according to (Scherberich et al., 2013).

Numerous pre-clinical studies have demonstrated that the combination of MSCs with

biphasic calcium phosphate (BCP) biomaterials can induce bone formation and

facilitate the healing of critical-size defects (Brennan et al., 2014; Corre et al., 2015;

Gamblin et al., 2014; Mankani et al., 2006). Some clinical trials have demonstrated the

feasibility of amplifying autologous MSCs in culture from a bone marrow sample and

associating them with a BCP biomaterial to regenerate unconsolidated fractures or

bone loss in small volumes (Gómez-Barrena et al., 2011; Quarto et al., 2001).

32
However, these tissue engineering techniques do not yet allow the regeneration of

large bone defects because of the absence of a sufficient vascular network to ensure

cell survival and tissue healing (Kanczler and Oreffo, 2008; Lovett et al., 2009). In this

context, several teams proposed the pre-vascularization of the bone filling material by

implantation in an ectopic site before transplanting it into the defect to be

reconstructed. Proof of concept has been demonstrated at the pre-clinical level by

ectopic implantation in the ewe of a chamber containing the BCP biomaterial and an

arteriovenous fistula (vascular loop). After 6 and 12 weeks of implantation, abundant

microvasculature was observed in the chamber contents (Beier et al., 2010; Erol and

Sira, 1980; Kaempfen et al., 2015; Kneser et al., 2006b; Kokemueller et al., 2010;

Warnke et al., 2006). Large defects at the mandibular level have been successfully

reconstructed in a few patients using this technique of transplanting a pre-vascularized

biomaterial into an intramuscular site (Mesimäki et al., 2009; Warnke et al., 2004); In

these studies, the pre-vascularization of the biomaterial appears to dominate for cell

survival and bone regeneration.

Objectives of the Thesis

The aim of the present Philosophy Doctor (PhD) thesis was to develop new strategies

for large bone defects regeneration by using vascularization and 3D printing.

Specific objectives of the thesis were:

1) To review the current surgical techniques and possible future methods for

regeneration of large bone defects (Paper I)

2) To study the effect of pre-vascularization of a synthetic bone substitute

contained in a 3D printed chamber prior to its transplantation into a segmental

critical size defect in the ulna of rabbits (Paper II).

33
3) To develop and produce surgical guides and personalized 3D printed scaffolds

for bone large defect reconstruction with local vascularization in a one-step

surgery in segmental metatarsus of sheep. (Paper III).

34
REFERENCES

1. Albrektsson, T., and Johansson, C. (2001). Osteoinduction, osteoconduction


and osseointegration. Eur Spine J 10, S96–S101.
2. Bakri, K., Stans, A., Mardini, S., and Moran, S. (2008). Combined Massive
Allograft and Intramedullary Vascularized Fibula Transfer: The Capanna
Technique for Lower-Limb Reconstruction. Seminars in Plastic Surgery 22,
234–241.
3. Beier, J.P., Horch, R.E., Hess, A., Arkudas, A., Heinrich, J., Loew, J., Gulle, H.,
Polykandriotis, E., Bleiziffer, O., and Kneser, U. (2010). Axial vascularization of
a large volume calcium phosphate ceramic bone substitute in the sheep AV loop
model. J Tissue Eng Regen Med 4, 216–223.
4. Boskey, A.L., and Robey, P.G. (2013). The Composition of Bone. In Primer on
the Metabolic Bone Diseases and Disorders of Mineral Metabolism, (John Wiley
& Sons, Ltd), pp. 49–58.
5. Brandi, M.L., and Collin-Osdoby, P. (2006). Vascular biology and the skeleton.
J. Bone Miner. Res. 21, 183–192.
6. Brennan, M.Á., Renaud, A., Amiaud, J., Rojewski, M.T., Schrezenmeier, H.,
Heymann, D., Trichet, V., and Layrolle, P. (2014). Pre-clinical studies of bone
regeneration with human bone marrow stromal cells and biphasic calcium
phosphate. Stem Cell Res Ther 5.
7. Brydone, A.S., Meek, D., and Maclaine, S. (2010). Bone grafting, orthopaedic
biomaterials, and the clinical need for bone engineering. Proc Inst Mech Eng H
224, 1329–1343.
8. Bucholz, R.W. (2002). Nonallograft osteoconductive bone graft substitutes.
Clin. Orthop. Relat. Res. 44–52.
9. Caeiro JR (2013). Biomechanics and bone ( & II ) : Trials in different hierarchical
levels of bone and alternative tools for the determination of bone strength. p.
10. Campanacci, D.A., Puccini, S., Caff, G., Beltrami, G., Piccioli, A., Innocenti, M.,
and Capanna, R. (2014). Vascularised fibular grafts as a salvage procedure in
failed intercalary reconstructions after bone tumour resection of the femur. Injury
45, 399–404.
11. Combes, C., and Rey, C. (2010). Amorphous calcium phosphates: Synthesis,
properties and uses in biomaterials. Acta Biomaterialia 6, 3362–3378.

35
12. Corre, P., Merceron, C., Longis, J., Khonsari, R.H., Pilet, P., Thi, T.N., Battaglia,
S., Sourice, S., Masson, M., Sohier, J., et al. (2015). Direct comparison of
current cell-based and cell-free approaches towards the repair of craniofacial
bone defects - A preclinical study. Acta Biomater 26, 306–317.
13. Cruess, R.L., and Dumont, J. (1975). Fracture healing. Can J Surg 18, 403–
413.
14. Dai, J., and Rabie, A.B.M. (2007). VEGF: an essential mediator of both
angiogenesis and endochondral ossification. J. Dent. Res. 86, 937–950.
15. De Long, W.G., Einhorn, T.A., Koval, K., McKee, M., Smith, W., Sanders, R.,
and Watson, T. (2007). Bone grafts and bone graft substitutes in orthopaedic
trauma surgery. A critical analysis. J Bone Joint Surg Am 89, 649–658.
16. Dimitriou, R., Jones, E., McGonagle, D., and Giannoudis, P.V. (2011). Bone
regeneration: current concepts and future directions. BMC Medicine 9.
17. Einhorn, T.A., and Gerstenfeld, L.C. (2015). Fracture healing: mechanisms and
interventions. Nat Rev Rheumatol 11, 45–54.
18. Erol, O.O., and Sira, M. (1980). New capillary bed formation with a surgically
constructed arteriovenous fistula. Plast. Reconstr. Surg. 66, 109–115.
19. Everts, V., Delaissé, J.M., Korper, W., Jansen, D.C., Tigchelaar-Gutter, W.,
Saftig, P., and Beertsen, W. (2002). The bone lining cell: its role in cleaning
Howship’s lacunae and initiating bone formation. J. Bone Miner. Res. 17, 77–
90.
20. Fellah, B.H., Weiss, P., Gauthier, O., Rouillon, T., Pilet, P., Daculsi, G., and
Layrolle, P. (2006). Bone repair using a new injectable self-crosslinkable bone
substitute. J. Orthop. Res. 24, 628–635.
21. Fielder, M., and Nair, A.K. (2019). Effects of hydration and mineralization on the
deformation mechanisms of collagen fibrils in bone at the nanoscale. Biomech
Model Mechanobiol 18, 57–68.
22. Filipowska, J., Tomaszewski, K.A., Niedźwiedzki, Ł., Walocha, J.A., and
Niedźwiedzki, T. (2017). The role of vasculature in bone development,
regeneration and proper systemic functioning. Angiogenesis 20, 291–302.
23. Forriol, F. (2009). Growth factors in cartilage and meniscus repair. Injury 40
Suppl 3, S12-16.
24. Gamblin, A.-L., Brennan, M.A., Renaud, A., Yagita, H., Lézot, F., Heymann, D.,
Trichet, V., and Layrolle, P. (2014). Bone tissue formation with human
36
mesenchymal stem cells and biphasic calcium phosphate ceramics: The local
implication of osteoclasts and macrophages. Biomaterials 35, 9660–9667.
25. Garrigues, G.E., Aldridge, J.M., Friend, J.K., and Urbaniak, J.R. (2009). Free
Vascularized Fibular Grafting for treatment of osteonecrosis of the femoral head
secondary to hip dislocation. Microsurgery 29, 342–345.
26. Glimcher, M.J. (1989). Mechanism of calcification: role of collagen fibrils and
collagen-phosphoprotein complexes in vitro and in vivo. Anat. Rec. 224, 139–
153.
27. Gómez-Barrena, E., Rosset, P., Müller, I., Giordano, R., Bunu, C., Layrolle, P.,
Konttinen, Y.T., and Luyten, F.P. (2011). Bone regeneration: stem cell therapies
and clinical studies in orthopaedics and traumatology. J Cell Mol Med 15, 1266–
1286.
28. Hadjidakis, D.J., and Androulakis, I.I. (2006). Bone remodeling. Ann. N. Y.
Acad. Sci. 1092, 385–396.
29. Hankenson, K.D., Dishowitz, M., Gray, C., and Schenker, M. (2011).
Angiogenesis in bone regeneration. Injury 42, 556–561.
30. Henriksen, K., Neutzsky-Wulff, A.V., Bonewald, L.F., and Karsdal, M.A. (2009).
Local communication on and within bone controls bone remodeling. Bone 44,
1026–1033.
31. Hutmacher, D.W., Schantz, J.T., Lam, C.X.F., Tan, K.C., and Lim, T.C. (2007).
State of the art and future directions of scaffold-based bone engineering from a
biomaterials perspective. J Tissue Eng Regen Med 1, 245–260.
32. Innocenti, M., Abed, Y.Y., Beltrami, G., Delcroix, L., Manfrini, M., and Capanna,
R. (2009). Biological reconstruction after resection of bone tumors of the
proximal tibia using allograft shell and intramedullary free vascularized fibular
graft: long-term results. Microsurgery 29, 361–372.
33. Kaempfen, A., Todorov, A., Güven, S., Largo, R.D., Jaquiéry, C., Scherberich,
A., Martin, I., and Schaefer, D.J. (2015). Engraftment of Prevascularized, Tissue
Engineered Constructs in a Novel Rabbit Segmental Bone Defect Model. Int J
Mol Sci 16, 12616–12630.
34. Kanczler, J.M., and Oreffo, R.O.C. (2008). Osteogenesis and angiogenesis: the
potential for engineering bone. Eur Cell Mater 15, 100–114.
35. Kenswil, K.J.G., Jaramillo, A.C., Ping, Z., Chen, S., Hoogenboezem, R.M.,
Mylona, M.A., Adisty, M.N., Bindels, E.M.J., Bos, P.K., Stoop, H., et al. (2018).
37
Characterization of Endothelial Cells Associated with Hematopoietic Niche
Formation in Humans Identifies IL-33 As an Anabolic Factor. Cell Reports 22,
666–678.
36. Kneser, U., Schaefer, D.J., Polykandriotis, E., and Horch, R.E. (2006a). Tissue
engineering of bone: the reconstructive surgeon’s point of view. Journal of
Cellular and Molecular Medicine 10, 7–19.
37. Kneser, U., Polykandriotis, E., Ohnolz, J., Heidner, K., Grabinger, L., Euler, S.,
Amann, K.U., Hess, A., Brune, K., Greil, P., et al. (2006b). Engineering of
vascularized transplantable bone tissues: induction of axial vascularization in
an osteoconductive matrix using an arteriovenous loop. Tissue Eng. 12, 1721–
1731.
38. Kokemueller, H., Spalthoff, S., Nolff, M., Tavassol, F., Essig, H., Stuehmer, C.,
Bormann, K.-H., Rücker, M., and Gellrich, N.-C. (2010). Prefabrication of
vascularized bioartificial bone grafts in vivo for segmental mandibular
reconstruction: experimental pilot study in sheep and first clinical application.
International Journal of Oral and Maxillofacial Surgery 39, 379–387.
39. Kusumbe, A.P., Ramasamy, S.K., and Adams, R.H. (2014). Coupling of
angiogenesis and osteogenesis by a specific vessel subtype in bone. Nature
507, 323–328.
40. Langer, R., and Vacanti, J.P. (1993). Tissue engineering. Science 260, 920–
926.
41. Lian, J.B., Stein, G.S., van Wijnen, A.J., Stein, J.L., Hassan, M.Q., Gaur, T., and
Zhang, Y. (2012). MicroRNA control of bone formation and homeostasis. Nat
Rev Endocrinol 8, 212–227.
42. Lovett, M., Lee, K., Edwards, A., and Kaplan, D.L. (2009). Vascularization
Strategies for Tissue Engineering. Tissue Engineering Part B: Reviews 15, 353–
370.
43. Mankani, M.H., Kuznetsov, S.A., Wolfe, R.M., Marshall, G.W., and Robey, P.G.
(2006). In vivo bone formation by human bone marrow stromal cells:
reconstruction of the mouse calvarium and mandible. Stem Cells 24, 2140–
2149.
44. Marsh, D. (1998). Concepts of fracture union, delayed union, and nonunion.
Clin. Orthop. Relat. Res. S22-30.
45. Matsuo, K., and Irie, N. (2008). Osteoclast-osteoblast communication. Arch.
38
Biochem. Biophys. 473, 201–209.
46. Mesimäki, K., Lindroos, B., Törnwall, J., Mauno, J., Lindqvist, C., Kontio, R.,
Miettinen, S., and Suuronen, R. (2009). Novel maxillary reconstruction with
ectopic bone formation by GMP adipose stem cells. Int J Oral Maxillofac Surg
38, 201–209.
47. Myeroff, C., and Archdeacon, M. (2011). Autogenous bone graft: donor sites
and techniques. J Bone Joint Surg Am 93, 2227–2236.
48. Neto, A.S., and Ferreira, J.M.F. (2018). Synthetic and Marine-Derived Porous
Scaffolds for Bone Tissue Engineering. Materials (Basel) 11.
49. Niedźwiedzki, T., and Filipowska, J. (2015). Bone remodeling in the context of
cellular and systemic regulation: the role of osteocytes and the nervous system.
J. Mol. Endocrinol. 55, R23-36.
50. Oryan, A., Alidadi, S., Moshiri, A., and Maffulli, N. (2014). Bone regenerative
medicine: classic options, novel strategies, and future directions. J Orthop Surg
Res 9, 18.
51. Ottani, V., Raspanti, M., and Ruggeri, A. (2001). Collagen structure and
functional implications. Micron 32, 251–260.
52. Quarto, R., Mastrogiacomo, M., Cancedda, R., Kutepov, S.M., Mukhachev, V.,
Lavroukov, A., Kon, E., and Marcacci, M. (2001). Repair of Large Bone Defects
with the Use of Autologous Bone Marrow Stromal Cells. New England Journal
of Medicine 344, 385–386.
53. Ramasamy, S.K., Kusumbe, A.P., Wang, L., and Adams, R.H. (2014).
Endothelial Notch activity promotes angiogenesis and osteogenesis in bone.
Nature 507, 376–380.
54. Rho, J.Y., Kuhn-Spearing, L., and Zioupos, P. (1998). Mechanical properties
and the hierarchical structure of bone. Med Eng Phys 20, 92–102.
55. Rosset, P., Deschaseaux, F., and Layrolle, P. (2014). Cell therapy for bone
repair. Orthop Traumatol Surg Res 100, S107-112.
56. Sawin, P.D., Traynelis, V.C., and Menezes, A.H. (1998). A comparative analysis
of fusion rates and donor-site morbidity for autogeneic rib and iliac crest bone
grafts in posterior cervical fusions. J. Neurosurg. 88, 255–265.
57. Scherberich, A., Di Maggio, N.D., and McNagny, K.M. (2013). A familiar
stranger: CD34 expression and putative functions in SVF cells of adipose tissue.
World J Stem Cells 5, 1–8.
39
58. Schmitz, J.P., and Hollinger, J.O. (1986). The critical size defect as an
experimental model for craniomandibulofacial nonunions. Clin. Orthop. Relat.
Res. 299–308.
59. Tang, D., Tare, R.S., Yang, L.-Y., Williams, D.F., Ou, K.-L., and Oreffo, R.O.C.
(2016). Biofabrication of bone tissue: approaches, challenges and translation
for bone regeneration. Biomaterials 83, 363–382.
60. Tomlinson, R.E., and Silva, M.J. (2013). Skeletal Blood Flow in Bone Repair
and Maintenance. Bone Research 1, 311–322.
61. Warnke, P.H., Springer, I.N.G., Wiltfang, J., Acil, Y., Eufinger, H., Wehmöller,
M., Russo, P. a. J., Bolte, H., Sherry, E., Behrens, E., et al. (2004). Growth and
transplantation of a custom vascularised bone graft in a man. Lancet 364, 766–
770.
62. Warnke, P.H., Wiltfang, J., Springer, I., Acil, Y., Bolte, H., Kosmahl, M., Russo,
P.A.J., Sherry, E., Lützen, U., Wolfart, S., et al. (2006). Man as living bioreactor:
fate of an exogenously prepared customized tissue-engineered mandible.
Biomaterials 27, 3163–3167.

40
CHAPTER I

Reconstruction of large skeletal defects : current clinical

therapeutic strategies and future directions using 3D printing

Luciano Vidal1,§, Carina Kampleitner2,§, Meadhbh Á Brennan1,3, Alain Hoornaert1,3,

Pierre Layrolle1*

1 Inserm, UMR 1238, PHY-OS, Bone sarcomas and remodeling of calcified tissues,

Faculty of Medicine, University of Nantes, Nantes, France

2 Department of Pharmacology and Toxicology, University of Vienna, Vienna, Austria

3 Harvard School of Engineering and Applied Sciences, Harvard University,

Cambridge, Massachusetts 02138, USA

4 CHU Nantes, Department of Implantology, Faculty of Dental Surgery, University of

Nantes, Nantes, France

§ These authors contributed equally to this work.

* Correspondence:

Pierre Layrolle, PhD, Director of Research

[Link]@[Link]

Keywords: large bone defects, bone regeneration, tissue engineering,

vascularization, three-dimensional printing

41
Abstract

The healing of bone fractures is a well-orchestrated physiological process involving

multiple cell types and signaling molecules interacting at the fracture site to replace

and repair bone tissue without scar formation. However, when the lesion is too large,

normal healing is compromised. These so-called non-union bone fractures, mostly

arising due to trauma, tumor resection or disease, represent a major therapeutic

challenge for orthopedic and reconstructive surgeons. In this review, we firstly present

the current commonly employed surgical strategies comprising auto-, allo- and

xenograft transplantations as well as synthetic biomaterials. Further to this, we discuss

the multiple factors influencing the effectiveness of the reconstructive therapy. One

essential parameter is adequate vascularization that ensures the vitality of the bone

grafts and therefore supports the regeneration process, with deficient vascularization

presenting as a serious problem frequently encountered in current management

strategies. To address this challenge, vascularized bone grafts, including free or

pedicled fibula flaps, or in situ approaches using the Masquelet induced membrane, or

the patient`s body as a bioreactor, comprise feasible alternatives. Finally, we highlight

future challenges and novel strategies such as 3D printing and bioprinting which could

overcome some of the current challenges in the field of bone defect reconstruction,

with the benefit of fabricating personalized and vascularized scaffolds.

42
1. Introduction

The reconstruction of large bone defects caused by trauma, disease or tumor resection

is a fundamental challenge for orthopedic and plastic surgeons. Their critical size

exceeds the intrinsic capacity of self-regeneration and consequently bone repair is

delayed and impaired. This type of lesion is termed a nonunion bone fracture and

requires additional treatment with bone graft materials in order to restore pre-existing

function (Dimitriou et al., 2011). Successful bone augmentation procedures should

include an osteoconductive scaffold with sufficient mechanical stability, an

osteoinductive stimulus to induce osteogenesis, and should enable osseointegration

and vascularity (Albrektsson and Johansson, 2001; Giannoudis et al., 2008). The

currently available treatment strategies of bone loss are based on autologous,

allogeneic or xenogeneic bone transplantation, as well as synthetic biomaterials.

Although autologous bone grafting still represents the gold standard technique for large

bone reconstruction, several factors limit its application. A major restricting parameter

is the volume of bone needed to treat this type of injury, as well as the associated pain

and possible donor site complications due to the additional surgical intervention at the

bone harvest site. Similar disadvantages are observed for allogenic bone grafts

including morbidity, immunogenic reactions, transfer of diseases and limited

osteogenic properties. Furthermore, many of these standard clinical grafting

approaches fail due to the lack of adequate vascularization. Insufficient vascularity of

the fracture site reduces the exchange of gas, nutrients and waste between the tissue

and the blood system, as well as the delivery of cells to the site of injury, leading to

inner graft necrosis (Mercado-Pagan et al., 2015; Fernandez de Grado et al., 2018).

To circumvent this problem, vascularized bone transfers, either pedicled or free flaps,

represent an excellent option that ensures bone vitality and avoids graft resorption.

43
Nevertheless, complex fractures and their reconstructions require modeling of the

transferred bone to adapt to the anatomical shape and extensive microsurgical

techniques to connect the graft to the blood system. Some patient bioreactor attempts

have also been made whereby a customized bone graft is implanted ectopically in the

patient for several weeks before transferring it into the bone defect. Innovative

fabrication approaches in the field of bone tissue engineering include 3D printing and

bioprinting to enable ex vivo personalized bone graft based on anatomical medical

imaging. They are generally composed of calcium phosphate/polymer composites or

porous titanium. To enhance the material healing properties, 3D printed scaffolds can

potentially include cells, growth factors, and vasculature. In this review, we present the

current techniques clinically available for the reconstruction of critical-sized bone

defects and point out future challenges and possibilities of new treatment modalities

using customized and vascularized bone grafts with a focus on 3D printing and

bioprinting fabrication methods.

2. Present management strategies for large bone lesions

The current reconstructive options for large bone defects including autologous iliac

grafting, autologous vascularized fibula transplantation, Masquelet’s induced

membrane, massive allografts and in vivo patient bioreactor strategies are presented

in Figure 1 and discussed in this section.

44
Figure 1 : Current biological bone reconstruction techniques. Bone defects arising due

to the resection of tumors or non-union fractures can be treated with the various

methods indicated, with the benefits (+) and disadvantages (-) of each technique

outlined.

2.1. Bone grafts

The leading treatment for bone defect reconstruction remains bone grafting. The

purpose of a bone graft is to support the repair process through osteoinduction,

osteoconduction, and osteogenesis (Albrektsson and Johansson, 2001; Oryan et al.,

2014). They can be categorized into different types based on the tissue source:

autologous, allogeneic and xenogeneic bone grafts, as well as synthetic and biological

biomaterials (Brydone et al., 2010). The selection of the ideal bone graft depends on

45
several factors including the geometry, size and tissue viability of the bone defect, the

biological and biomechanically characteristics of the bone graft, and the known

advantages and associated complications of each graft option (Laurencin et al., 2014).

2.1.1. Autografts

Autologous bone grafting, still the clinical standard reconstruction technique, entails

harvesting bone tissue from an anatomical donor site and transplanting it to the

recipient defect site (Sanan and Haines, 1997). The iliac crest is the preferred

harvesting site for this type of transplant, whereby approximately 20 cm3 of cancellous

bone is collected and used as a bone block or morselized into bone chips in order to

fill a bone defect (Athanasiou et al., 2010). Autologous bone contains the patient’s own

osteogenic cells and osteoinductive proteins, such as BMP-2, BMP-7, and PDGF,

providing and optimal osteogenic, osteoinductive, and osteoconductive properties

without risk of viral transmissions, while pain, hematoma, and possible visceral injuries

at the donor site and extended surgery time because of the two surgical sites are the

main drawbacks (Albrektsson and Johansson, 2001; Parikh, 2002). Another

disadvantage of cancellous bone grafting is that large amounts of bone graft cannot

be obtained for critical-sized defect reconstruction (Oryan et al., 2013). Successful

repair depends on osteogenic cell survival and tissue viability after transplantation to

the recipient site, while neovascularization plays a determinant role. To overcome the

disadvantage of limited vascularization, free vascularized bone flaps have been

employed. Taylor et al reported the first successful large bone defect reconstruction

using a free vascularized bone transfer (Taylor et al., 1975). Vascularized bone grafts,

such as an autologous vascularized fibula flap, iliac crest flap, rib flap, and radius flap,

allow the reconstruction of large bone defects and are often used as a last resort to

avoid limb amputation for patients. Fibula and iliac crest free flaps have been used for

46
the pelvis, head of long bones, and neck reconstruction. Free flaps are particularly

suitable for mandible reconstructions after ballistic trauma or tumor resections. An

optimal option for bone large defect reconstruction using autografts is a vascularized

cortical autografts (Rizzo and Moran, 2008). For a hemimandible, the iliac crest flap

has an adequate bone height to ensure osseointegration (Taylor, 1982; 1983; 1985)

and allows optimal shape reconstruction of the mandible ramus. However, for an angle

to angle mandible reconstruction, fibula free flap is preferred. As shown in Figure 2,

the fibula is dissected, harvested with a vascular pedicle, shaped and transplanted into

the bone defect where it is reconnected to the local vasculature. This vascularized

bone graft contains the patient’s own cells, growth factors and a vascularization bed

thereby reducing graft resorption, enhances healing and permitting better diffusion of

antibiotics. Hidalgo et al. evaluated the fibula flap for mandible reconstruction and

reported long-term outstanding functional and aesthetic results, without bone

resorption in non-irradiated and irradiated patients (Hidalgo and Pusic, 2002). Free

fibula flap transfers for mandibular and maxillary reconstruction achieved 98.7% graft

survival in some studies (Peng et al., 2005; Taylor et al., 2016). Further to this, pelvic

ring reconstruction employing a double-barreled free vascularized autologous patient

fibula grafts after resection of malignant pelvic bone tumors was reported (Ogura et

al., 2015). Additionally, lumbosacral spinal defects reconstruction was also achieved

with the use of a fibula free flap (Moran et al., 2009). The major complications of free

flaps are post-operative vascular thrombosis and associated tissue necrosis, laborious

microsurgery to reconnect to the vasculature, and the need for sculpting of the graft to

fit the anatomy of the bone defect. Furthermore, this technique requires extended

anesthesia, specialized technical surgical skills and the sacrifice of blood vessels.

47
2.1.2. Allografts

Bone allografts are harvested from living donors during joint replacement (e.g., femoral

heads) or from cadavers, and stored frozen and processed and transplanted into

another patient (Keating and McQueen, 2001). Given the limitations of autografts,

allografts became an alternative to large bone defect reconstruction. Allografts are

used as powders, chips or complete bone structural forms, so called massive allografts

and can be provided as a fresh graft, fresh-frozen, freeze-dried, demineralized, de-

lipidized by solvents or supercritical carbon dioxide, and sterilized by irradiation

(Bostrom and Seigerman, 2005; Zimmermann and Moghaddam, 2011). The primary

advantage of allografts is their immediate availability in different sizes and shapes

(Muscolo et al., 2004). They are composed of the extracellular bone matrix containing

growth factors that stimulate regeneration, do not present complications associated

with donor site harvesting, and present favorable mechanical strength (Mankin et al.,

1996). For these reasons, allografts are particularly interesting for complex skeletal

reconstruction after resection of bone tumors in pelvic bones of young patients.

However, allografts present variable osteoinductive and osteoconductive properties

and have lower osteogenic potential compared to autografts. Other disadvantages are

the possibility of immune rejection, transmitting diseases and the lack of a pre-

vascularized construct (Gomes et al., 2008). To overcome the latter disadvantage,

Capanna et al. in 1993 described a technique for the reconstruction of large

metadiaphyseal bone defects, combining a massive allograft to support a centrally

located autologous fibula flap with the aim of improving allograft incorporation and

decreasing the risk of mechanical instability (Capanna et al., 1993). This technique has

proven efficacy for large bone defect reconstruction (Bakri et al., 2008). Other clinical

studies described the use of allografts alone or associated with other therapies such

48
as autologous concentrated bone marrow-derived cell (Putzier et al., 2009; Faldini et

al., 2011; Scaglione et al., 2014).

Figure 2: Fibula Free Flap. The anatomy including the tibia, fibula and major vessels

is indicated. The surgical steps comprising the fibula free flap, the gold standard clinical

technique for large bone defect reconstruction, is demonstrated.

2.1.3. Xenografts

Xenografts, are harvested from different species and transplanted for patient bone

defect repair, with the most commonly used of bovine, porcine, or coral origin. The

primary advantages are the high availability, favorable porosity for bone tissue

ingrowth and comparable mechanical strength to native bone. However, similar to

allografts, xenografts, when treated for clinical use, lose their osteoinductive and

osteoconductive abilities (Dimitriou et al., 2011; Friesenbichler et al., 2014). Moreover,

a significant disadvantage of xenografts is the possible transmission of zoonotic

diseases and immune rejection. Finally, xenografts have ethical and religious

concerns. Karalashvili et al. described the use of decellularized bovine bone graft in a

49
zygomatic large bone defect reconstruction and reported long-term retention of graft

shape without resorption and bone integration (Karalashvili et al., 2017). Bovine

cancellous xenografts have also been used in the treatment of tibial fractures in elderly

patients and showed favorable healing outcomes (Bansal et al., 2009). However, the

number of published studies using xenografts in large bone defect reconstruction is

still limited and indeed clinical studies using bovine bone has showed poor results,

describing graft rejection and failure in host tissue integration (Elliot and Richards,

2011; Patil et al., 2011; Shibuya et al., 2012; Ledford et al., 2013).

2.1.4. Synthetic biomaterials

Langer and Vacanti described tissue engineering by the use of biocompatible materials

associated with cells and, or biological factors, in order to replace or repair tissues or

organs. Various biomaterials have been employed in the treatment of bone defects.

Calcium phosphate ceramics (CaP ceramics) are synthetic materials composed of

calcium hydroxyapatites, therefore possessing a composition similar to the native bone

matrix. Calcium phosphate ceramics are primarily produced by sintering at high

temperatures and are available with variable porosity and in construct or granules

format, with their main advantage being their osteoconductivity (Albrektsson and

Johansson, 2001; Lee et al., 2006; Samavedi et al., 2013). Calcium phosphate

ceramics most commonly employed in bone reconstruction are biphasic calcium

phosphate (BCP), tricalcium phosphate (TCP), and hydroxyapatites (HA).

Hydroxyapatites present excellent osteoconductive and osseointegration properties

and their macroporosity and pore interconnectivity allow excellent cell adhesion and

proliferation, leading to osteoconduction and osteoinduction after transplantation in

vivo, as well as revascularization of the implant (Bucholz et al., 1987; Eggli et al., 1988).

50
Tricalcium phosphate has higher pore interconnectivity than HA which is crucial for

neovascularization and osteoconduction (Ogose et al., 2006), however, this higher

interconnectivity gives TCP lower mechanical properties compared to HA and TCP is

reabsorbed faster than HA after implantation (Torres et al., 2011). Biphasic calcium

phosphate (BCP) is the combination of TCP and HA. BCP exploits the main

advantages of both TCP and HA as they can be combined in various ratios (Daculsi et

al., 1989). Calcium phosphate cement (CPC) differs from calcium phosphate ceramics

because they are made at ambient temperatures from hydrolysis and are regarded as

biomimetic. CPC can be used as filler by injection and for creating 3D printing

constructs (Brown and Chow, 1983; Brown, 1987; Bertol et al., 2016), however their

slow degradation may delay bone formation (Lodoso-Torrecilla et al., 2018). Bioactive

glass or bioglass is a synthetic silicate-based ceramic. It is rapidly resorbed in the first

two weeks after implantation allowing a rapid new bone and vascularized implant

ingrowth (Gerhardt and Boccaccini, 2010; Kurien et al., 2013). Synthetic bone

substitutes are an excellent alternative to biological grafts in small bone defect

reconstruction. However, due to the insufficient strength to sustain the body load and

insufficient neovascularization ingrowth, bone substitutes are not the best option for

large bone defect reconstruction (Stanovici et al., 2016). Their association with

recombinant human growth factors and/or stem cell therapies could be a solution for

this main disadvantage (Gomez-Barrena et al., 2011; Gomez-Barrena et al., 2019).

Orthounion is an ongoing clinical trial studying the use of bone marrow mesenchymal

stem cells combined with a bone substitute to fill the non-union in a surgical procedure

(Verboket et al., 2018). Another ongoing clinical trial, Maxibone, is studying the safety

and efficacy of autologous cultured stem cells and calcium phosphate biomaterials in

alveolar bone augmentation (Gjerde et al., 2018).

51
2.1.5. Megaprothesis

After trauma or resection of a malignant or benign aggressive tumor, the reconstruction

of large bone defects is necessary to prevent amputation. The use of metal

megaprotheses began in the 70s, and in the 90s, it became popular. Megaprothesis

replace the affected bone tissue instead of regenerating bone tissue and there has

been a significant evolution of their components since inception in order to ensure

corrosion resistance, to avoid fractures of the material, for better fixation, and to

guarantee osseointegration. Modular endoprosthesis today allow the association of

different components to customize large bone defect reconstruction (Hattori et al.,

2011). Prostheses may have a coating of hydroxyapatite and silver for

osseointegration and to prevent infection and various studies have showed excellent

limb survival after surgery with a follow up of up at 20 years (Mittermayer et al., 2001;

Gosheger et al., 2006; Jeys and Grimer, 2009; Shehadeh et al., 2010). There are two

significant complications after reconstruction with mega prosthesis, mechanical and

non- mechanical complications. Implant design may cause inherent mechanical

complications and those reported in the literature include aseptic loosening, failure of

soft tissue attachments, and prosthesis stem fractures. These complication rates are

between 5 and 48%, as described in the literature (Ahlmann et al., 2006; Gosheger et

al., 2006; Holl et al., 2012) and robust modular mega prosthesis have helped to reduce

this mechanical complication (Choong et al., 1996; Jawad and Brien, 2014). Non-

mechanical complications include infection, tumor relapse, and wound healing

disorders. Infection and wound necrosis are common complications in oncological

cases due to malnutrition, immunosuppression, lack of local tissue vascularization, and

extensive implant reconstruction (Jeys et al., 2005; Jeys and Grimer, 2009; Pala et al.,

2015). Silver coated prosthesis, antibiotics therapy, and meticulous surgery techniques

52
may reduce these complications, however, non-mechanical complications are the

primary threat in large bone defect reconstruction using mega prosthesis.

2.2. Masquelet induced membrane technique

The induced membrane method known as the Masquelet technique consists of a two-

stage operative procedure. The first stage includes a debridement of the defect site,

soft-tissue repair and the insertion of a cement spacer composed of polymethyl

methacrlyate (PMMA) that allows the maintenance of the bone height and stability, and

the formation of a pseudosynovial membrane due to a foreign-body reaction. In the

second step, performed 6 to 8 weeks later, the cement spacer is removed and the

cavity is refilled with an autologous cancellous bone graft (e.g., from the iliac crests),

while preserving the induced membrane. This membrane has various functions, in

particular it prevents the resorption of the cancellous bone graft, supports

vascularization and corticalization, and functions as a delivery system for

osteomodulatory and angiogenic growth factors like transforming growth factor

(TGFβ), bone morphogenetic protein 2 (BMP2) and vascular endothelial derived

growth factor (VEGF)) (Masquelet, 2003; Pelissier et al., 2004; Masquelet and Begue,

2010). This innovative technique is indicated in acute and chronic infected or

noninfected massive bone defects of any size (4-25 cm) and shape, at different

anatomical sites in children and adults (Masquelet et al., 2000; Azi et al., 2019). Its

consolidation rate varies from 82 to 100% with delays ranging from 4 months to one

year. The main complications include infection, failure of a step in the surgical

procedure (persisting infection or non-union), re-fracture and severe bone graft

resorption (Morelli et al., 2016; Han et al., 2017). Different studies reported the

Masquelet`s approach as effective, for instance Sivakumar et al. and Mathieu et al.

53
described the use of the induced membrane technique in the management of large

bone defect reconstruction in open fractures of the femur, tibia, and fibula bones

(Sivakumar et al., 2016; Mathieu et al., 2019). A recently published review reported the

application of the induced membrane technique in patients with osteomyelitis,

suggesting this technique is an excellent alternative to solve long bone infected defects

by controlling the local infection (Careri et al., 2019).

2.3. Ilizarov method

The Ilizarov method is a convenient tool for the treatment of patients suffering from

poly‐trauma conditions, with multiple fractures, osteomyelitis, and infected non-unions.

The principle of the Ilizarov’s technique is to stimulate bone growth by bone distraction

that produces neovascularization, and stimulates new bone formation (Aronson et al.,

1989; Ilizarov, 1990). The surgical procedure consists of the use of an external circular

fixator and a corticotomy. The external fixator stabilizes the bone and allows early

weight-bearing. A distraction of 0.25 mm, four times per day, commencing after a delay

of 5 to 10 days post surgery is performed and an osteogenesis activity occurs in the

bone gap (Spiegelberg et al., 2010). The length of bone that can be produced by this

technique is up to 20 cm per limb segment. Barbarossa et al. conducted a study of 30

patients with osteomyelitis and infected non-union of the femur treated with the Ilirazov

technique and reported efficacy in saving the limbs with osteomyelitis (Barbarossa et

al., 2001). Large blood vessels expressing smooth muscle α-actin were shown to co-

express BMP2 which was involved in enhancing osteogenesis activity at the site

(Matsubara et al., 2012). The Ilizarov’s bone distraction technique also offers the

possibility of correcting a defect of axis, and allows a lengthening of the limb, however,

it has associated drawbacks such as several weeks lag time required to heal large

54
segmental defects, with extended hospital recovery and discomfort for patients, as well

as risks of osteomyelitis along the transcutaneous pins.

3. Future directions in large bone defect reconstruction

3.1. In-patient bioreactor

The principle of this approach is to use the patient as their own bioreactor, and entails

the fabrication of a customized bone graft utilizing medical imaging and 3D printing,

and the implantation of these osteoinductive materials in ectopic sites such as under

the skin or in muscles. After several weeks, the pre-fabricated bone graft is used for

large skeletal reconstruction. The possibility of producing substitute organs or body

parts inside human bodies, therefore using the body as a living bioreactor was

introduced (Cao et al., 1997; Vacanti and Langer, 1999) and Orringer et al. first treated

an angle to angle mandible and total lower-lip reconstruction with a prefabricated

osteocutaneous free flap. A dacron-polyurethane tray was packed with autologous

cancellous bone graft and with BMP7. This tray was implanted in the fascia above the

scapula for generating a composite pre-fabricated flap (Orringer et al., 1999). Warnke

et al. developed the bone-muscle-flap prefabrication technique for maxillofacial

reconstruction. They grew a subtotal mandible composed of a titanium mesh cage filled

with bone bovine mineral blocks, bone mineral granules associated with BMP7, and

autologous bone marrow concentrated cells inside the latissimus muscle and

vascularization was provided by the thoracodorsal pedicle. Seven weeks

postoperatively, the prefabricated bone muscle flap was microsurgically transplanted

with its vascular pedicle in the mandible. Vascular supply of the free flap was

successfully maintained. A favorable aesthetic and functional outcome was obtained.

(Warnke et al., 2004). Mesimäki et al. then described a 3 step surgery method to

55
reconstruct a large bone maxillary defect by forming a prevascularized construct by

filling a titanium mesh cage with autologous adipose-derived stem cells (ASCs), BMP2

and beta TCP granules and inserting it in the patient’s left rectus abdominis muscle,

with vascularization provided by the inferior epigastric artery, and subsequent

transplantation for maxillary bone reconstruction (Mesimaki et al., 2009). Other studies

described the use of the pectoralis major - hydroxyapatite blocks flap, pedicled using

the thoracoacromial artery, for mandible reconstruction (Heliotis et al., 2006; Tatara et

al., 2014). A further alternative comprised a polymethylmethacrylate chamber filled

with autograft implanted against the periosteum of the iliac crest which after eight

weeks was transplanted to the mandibular site, with the donor periosteum sutured with

the local periosteum to reestablish the vascularization (Cheng et al., 2006).

Kokemueller et al. reported hemimandible reconstruction by utilizing cylinders of beta-

tricalcium phosphate loaded with cells and morcellized autologous bone graft that were

implanted in the latissimus dorsi muscle with a central vascular bundle and

transplanted after six months (Kokemueller et al., 2010). The main advantage of the

patient bioreactor method compared to the alternative surgical treatments proposed

for large bone defects reconstructions (e.g., autologous vascularized fibula, iliac crest)

is that it avoids the process of harvesting native bone and creating further skeletal

defects. However, this method does not apply to emergency cases and requires at

least two surgical sites.

3.2. 3D printing techniques and production of personalized surgical guides

and scaffolds

Three-dimensional (3D) printing is an emerging technology that permits the

manufacture of complex-shaped structures with high precision using layer-by-layer

56
printing of different materials. The structures of the defects to be reconstructed in

patients are identified based on digital images obtained from a computed tomography

(CT) scan or magnetic resonance imaging (MRI) and by using computer-aided design

(CAD) software, 3D printing technology and bioprinting can develop 3D medical

models (Colin and Boire, 1997; Winder and Bibb, 2005). The 3D printing technologies

used for polymer scaffold construction are: (1) fused deposition modeling (FDM), (2)

selective laser sintering (SLS), and (3) stereolithography (SLA). The fused deposition

method is the most popular technique developed in the 1980s and based on

construction by melting deposition. The material commonly used is a thermoplastic

polymer, in powder or filament format, which feeds an extruder tip that melts the plastic

and at its exit is deposited on a surface at a much lower temperature so that it solidifies

rapidly. The extruder tip moves in the x and y planes to print layer by layer the pattern

of the scaffold (Xu et al., 2014). The resolution of the printed construct is defined by

multiple factors: nozzle diameter, print speed, and number and height of the layers

(Yang et al., 2018). This technique is simple, rapid, and cost-effective, however, there

are limited choices of biocompatible, medical-grade thermoplastic polymers available.

Selective laser sintering uses a CO2 laser that sinters, layer by layer, the material in a

powder state, forming the final piece. The final piece needs to be cleaned to withdraw

the powder excess and to provide smoothness to the construct surface. SLS allows

the fabrication of large and sophisticated structures (Deckard, 1989; Mazzoli, 2013).

Stereolithography (SLA) produces 3D models by tracing a beam of UV light or a laser

on a base of a photosensitive resin that polymerizes (Mondschein et al., 2017). The

main benefit of this 3D printing technology is the high level of detail and the excellent

surface resolution (Ji et al., 2018).

57
Figure 3: Workflow involved in customizable bone construct fabrication. 1) CT scans

of the patient’s bone are acquired. 2) Computer aided software enables the processing

of CT images in order to 3) 3D print personalized scaffolds for 4) bone defect

reconstruction. The lower panel illustrates a real large bone defect reconstruction in a

sheep metatarsal bone model.

3.3. 3D printing in bone tissue engineering applications

3D printing prototype models can significantly assist with pre-operative evaluation and

intraoperative procedures, for example for the use of surgical guides in mandibular

reconstruction with osteocutaneous free flaps (Bosc et al., 2017; Dupret-Bories et al.,

2018). These studies showed the advantages of using 3D printed preoperative models

and surgical guides including a reduction in operating time, flap ischemia, morbidity

and associated complications such as infections. Many studies describe the use of 3D

printing scaffolds for bone tissue engineering (Kao et al., 2015; Petrochenko et al.,

2015; Saito et al., 2015; Wang et al., 2015). Various types of ceramics, like

hydroxyapatite (HA), beta-tricalcium phosphate (β-TCP), alpha-tricalcium phosphate

(α-TCP), biphasic calcium phosphates (BCP), bioactive glasses, and more, have been

58
used in recent years for the development of 3D printed scaffolds (Vorndran et al., 2008;

Suwanprateeb et al., 2009; Klammert et al., 2010b), however these materials are often

brittle and do not match the mechanical properties of bone. To obtain similar

mechanical strength to bone, bioceramics can be blended with polymers, such as

cellulose, poly(D,L-lactic acid-co-glycolic acid) or polycaprolactone (PCL), before

being printed (Liao et al., 2011). PCL is a polymer, with FDA approval that is widely

used in 3D printing. It has a low melting temperature (60°C) (Wang et al., 2015)

favorable viscoelasticity, and is biodegradable. Its slow degradation and high stiffness

make PCL one of the preferred polymers for the manufacture of a 3D printing scaffold

for bone tissue engineering (Brunello et al., 2016). The use of computed tomography

to create anatomically accurate scaffolds of calcium phosphate for cranial defects and

alpha-tricalcium phosphate for maxillofacial deformities reconstruction have been

described (Saijo et al., 2009; Klammert et al., 2010a). Direct ink writing (DIW), also

called robocasting, has been one of the most studied and commonly used techniques

for the development of 3D bioceramic scaffolds. DIW is an extrusion-based additive

manufacturing method, in which a liquid-phase ink containing a high volume content

of ceramic powder is dispensed through a nozzle, following a digitally defined pattern

to create a 3D construct in a layer-by-layer manner (Lewis, 2006; Feilden et al., 2016).

The chief advantages of DIW is that it applies to a wide range of bioceramics and it is

possible to control pore size, pore orientation, and lattice design of the printed scaffold.

Moreover, it is a high speed, simple and economic technique (Michna et al., 2005;

Miranda et al., 2006) and has been used to create a hydroxyapatite scaffold for

possible use in maxillofacial reconstruction (Cesarano Iii et al., 2005).

The main advantage of 3D printing is direct control over both the microarchitecture and

microarchitecture with complex anatomical structure. These 3D printed models allow

59
the manufacture of customized scaffolds that mimics the patient's anatomy (Wubneh

et al., 2018). However, there are different challenges to the translation of 3D printing

bioceramics to clinical application. Firstly, 3D printed bioceramics are brittle and not

suitable for load-bearing clinical applications. Secondly, the fabrication of a large-size

scaffold for large bone defect reconstruction is time-consuming and expensive.

Moreover, for producing these 3D printed bioceramics, toxic solvents, and high-

temperatures are used in the printing procedures which may compromise cell viability

́ uez-Lorenzo et al., 2001; Lewis et al., 2006; Trombetta et al., 2017; Wen et al.,
(Rodrıg

2017; Chen et al., 2019). There have been multiple in vivo animal studies conducted

with 3D printed customized scaffolds for bone regeneration (Park et al., 2018; Choi et

al., 2019), however, these techniques are still in a developmental stage for clinical

application and not capable of fabricating large-sized bioceramic scaffolds.

3.4. 3D bioprinting a custom living and vascularized bone graft

Bioprinting is another 3D printing technique that uses cell-laden hydrogels to print

structures that after a period of maturation, will develop complex tissues, such as skin,

cartilage, and bone. Vascularization can be aided by the incorporation of angiogenic

growing factors or endothelial cells into bio-inks (Kolesky et al., 2014; Fahimipour et

al., 2017; Benning et al., 2018). Three major procedures are the most used in

bioprinting: inkjet, extrusion, and laser-assisted bioprinting. For tissue engineering

applications, thermal and piezoelectric inkjet bioprinters are commonly used. In the

piezoelectric inkjet bioprinter system, a piezoelectric crystal is used to create different

potentials which generates pressure that allows the bioink ejection in the form of

droplets. In thermal inkjet bioprinting, the printhead is heated up to 300°C that

generates small air bubbles that produce pressure pulses to eject bioink droplets. The

60
size of droplets depends on multiple factors, such as ink viscosity, the frequency of the

current pulse and the gradient of the temperature (Hock et al., 1996; Hudson et al.,

2000; Cui et al., 2012), and the significant advantages of inkjet bioprinting is its rapid

fabrication (Murphy and Atala, 2014). In extrusion bioprinting, a bioink is dispensed

using pneumatic air pressure or mechanical systems composed of a screw or a piston.

The flow of the bioink is more controlled in the mechanical system due to the action of

the screw. With the pneumatic air, an interrupted filament is ejected, allowing high

precision in the printed construct. Cells are exposed to high mechanical stress during

this procedure, which may affect cell viability (Mandrycky et al., 2016). Extrusion

bioprinting allows printing of different types of inks with different viscosities (Ozbolat

and Hospodiuk, 2016; Paxton et al., 2017). The main disadvantage of this technique

is that the high viscosity of the bioink or cell aggregation can clog the printer tip. Laser

bioprinting consists of the interaction of a pulsed laser source with a ribbon. This ribbon

contains an energy-absorbing layer, and below it, the bioink is located. A collector-

slide receives the droplets of hydrogel created by the dynamic jet faciliated by the

energy deposition that is created by the laser effect in the ribbon. In this procedure

cells are not submitted to a mechanical stress (Gruene et al., 2011; Unger et al., 2011)

and it is a nozzle-free cell printing technique with high resolution. Although 3D

bioprinting brings the potential of producing a customized and vacsularized living bone

transplant, this biofabrication technique has not yet been tested in clinical cases.

Numerous remaining challenges such as obtaining optimal cell numbers, adequate cell

viability and spatial cell differentiation of the 3D construct, as well as reconnection to

the local vasculature are yet to be resolved.

61
4. Conclusion

In this review, the current bone reconstructive options for large skeletal defects such

as autologous, allogeneic, biological and synthetic bone grafts are presented, as well

as the future directions in bone tissue engineering that take advantage of 3D printing.

The current gold standard technique for large bone defect reconstruction is autologous

free flap transplantation that contains the patient’s cells, growth factors, and a

vascularization bed. However, its main disadvantages are donor site morbidity,

laborious microsurgery, and the need to sculpt the construct to the anatomy of the

bone defect. Alternatively, allogeneic bone is also used to reconstruct large bone

defects, but it is less osteogenic than autologous bone and may induce immunogenic

rejection and transfer of disease. 3D printing technologies permit the fabrication of

personalized bone grafts and the improvements in the incorporation of cells, growth

factors, and vasculature may revolutionize bone tissue regeneration.

5. Conflict of Interest

The authors declare that the research was conducted in the absence of any

commercial or financial relationships that could be construed as a potential conflict of

interest.

6. Author Contributions

LV, CK, MAB, wrote the main manuscript text and prepared the figures; AH edited the

manuscript; PL edited the manuscript and prepared the figures. All authors have read

and approved the final version of the manuscript.

62
7. Funding

This work was supported by the European Commission through the H2020 projects

ORTHOUNION “Orthopaedic randomized clinical trial with expanded bone marrow

MSC and bioceramics versus autograft in long bone non-unions” under grant

agreement #733288 and MAXIBONE “Personalised maxillofacial bone regeneration”

under grant agreement #779322.

8. Acknowledgments

Luciano Vidal was financially supported for his PhD thesis by the patient’s charity

‘Ligue Française contre la neurofibromatose’ that is greatly acknowledged.

63
9. References

1) Ahlmann, E.R., Menendez, L.R., Kermani, C., and Gotha, H. (2006).


Survivorship and clinical outcome of modular endoprosthetic reconstruction for
neoplastic disease of the lower limb. J Bone Joint Surg Br 88(6), 790-795. doi:
10.1302/0301-620X.88B6.17519.
2) Albrektsson, T., and Johansson, C. (2001). Osteoinduction, osteoconduction
and osseointegration. Eur Spine J 10 Suppl 2(Suppl 2), 96-101. doi:
10.1007/s005860100282.
3) Athanasiou, V.T., Papachristou, D.J., Panagopoulos, A., Saridis, A., Scopa,
C.D., and Megas, P. (2010). Histological comparison of autograft, allograft-
DBM, xenograft, and synthetic grafts in a trabecular bone defect: an
experimental study in rabbits. Med Sci Monit 16(1), BR24-31.
4) Azi, M.L., Teixeira, A.A.A., Cotias, R.B., Joeris, A., and Kfuri, M. (2019).
Induced-membrane technique in the management of posttraumatic bone
defects. JBJS Essent Surg Tech 9(2), e22. doi: 10.2106/[Link].18.00099.
5) Bakri, K., Stans, A.A., Mardini, S., and Moran, S.L. (2008). Combined massive
allograft and intramedullary vascularized fibula transfer: the capanna technique
for lower-limb reconstruction. Semin Plast Surg 22(3), 234-241. doi: 10.1055/s-
2008-1081406.
6) Bansal, M.R., Bhagat, S.B., and Shukla, D.D. (2009). Bovine cancellous
xenograft in the treatment of tibial plateau fractures in elderly patients. Int
Orthop 33(3), 779-784. doi: 10.1007/s00264-008-0526-y.
7) Benning, L., Gutzweiler, L., Trondle, K., Riba, J., Zengerle, R., Koltay, P., et al.
(2018). Assessment of hydrogels for bioprinting of endothelial cells. J Biomed
Mater Res A 106(4), 935-947. doi: 10.1002/jbm.a.36291.
8) Bertol, L.S., Schabbach, R., and dos Santos, L.A.L. (2016). Dimensional
evaluation of patient-specific 3D printing using calcium phosphate cement for
craniofacial bone reconstruction. J Biomater Appl 31(6), 799-806. doi:
10.1177/0885328216682672.
9) Bosc, R., Hersant, B., Carloni, R., Niddam, J., Bouhassira, J., De Kermadec,
H., et al. (2017). Mandibular reconstruction after cancer: an in-house approach
to manufacturing cutting guides. Int J Oral Maxillofac Surg 46(1), 24-31. doi:
10.1016/[Link].2016.10.004.

64
10) Bostrom, M.P.G., and Seigerman, D.A. (2005). The clinical use of allografts,
demineralized bone matrices, synthetic bone graft substitutes and
osteoinductive growth factors: a survey study. HSS J 1(1), 9-18. doi:
10.1007/s11420-005-0111-5.
11) Brown, W., and Chow, L. (1983). A new calcium-phosphate setting cement. J
Dent Res 62, 672-672.
12) Brown, W.E. (1987). A new calcium phosphate, water-setting cement. Cements
research progress, 351-279.
13) Brunello, G., Sivolella, S., Meneghello, R., Ferroni, L., Gardin, C., Piattelli, A.,
et al. (2016). Powder-based 3D printing for bone tissue engineering. Biotechnol
Adv 34(5), 740-753. doi: 10.1016/[Link].2016.03.009.
14) Brydone, A.S., Meek, D., and Maclaine, S. (2010). Bone grafting, orthopaedic
biomaterials, and the clinical need for bone engineering. Proc Inst Mech Eng H
224(12), 1329-1343. doi: 10.1243/09544119JEIM770.
15) Bucholz, R.W., Carlton, A., and Holmes, R.E. (1987). Hydroxyapatite and
tricalcium phosphate bone graft substitutes. Orthop Clin North Am 18(2), 323-
334.
16) Cao, Y., Vacanti, J.P., Paige, K.T., Upton, J., and Vacanti, C.A. (1997).
Transplantation of chondrocytes utilizing a polymer-cell construct to produce
tissue-engineered cartilage in the shape of a human ear. Plast Reconstr Surg
100(2), 297-302; discussion 303-294. doi: 10.1097/00006534-199708000-
00001.
17) Capanna, R., Bufalini, C., and Campanacci, M. (1993). A new technique for
reconstructions of large metadiaphyseal bone defects. Orthop Traumatol 2(3),
159-177. doi: 10.1007/BF02620523.
18) Careri, S., Vitiello, R., Oliva, M.S., Ziranu, A., Maccauro, G., and Perisano, C.
(2019). Masquelet technique and osteomyelitis: innovations and literature
review. Eur Rev Med Pharmacol Sci 23(2 Suppl), 210-216. doi:
10.26355/eurrev_201904_17495.
19) Cesarano Iii, J., Dellinger, J.G., Saavedra, M.P., Gill, D.D., Jamison, R.D.,
Grosser, B.A., et al. (2005). Customization of load-bearing hydroxyapatite
lattice scaffolds. Int J Appl Ceram Technol 2(3), 212-220. doi: 10.1111/j.1744-
7402.2005.02026.x.

65
20) Chen, Z., Li, Z., Li, J., Liu, C., Lao, C., Fu, Y., et al. (2019). 3D printing of
ceramics: A review. J Eur Ceram Soc 39(4), 661-687. doi:
10.1016/[Link].2018.11.013.
21) Cheng, M.-H., Brey, E.M., Ulusal, B.G., and Wei, F.-C. (2006). Mandible
augmentation for osseointegrated implants using tissue engineering strategies.
Plast Reconstr Surg 118(1). doi: 10.1097/[Link].0000221120.11128.1a.
22) Choi, S., Oh, Y.-I., Park, K.-H., Lee, J.-S., Shim, J.-H., and Kang, B.-J. (2019).
New clinical application of three-dimensional-printed polycaprolactone/β-
tricalcium phosphate scaffold as an alternative to allograft bone for limb-sparing
surgery in a dog with distal radial osteosarcoma. J Vet Med Sci 81(3), 434-439.
doi: 10.1292/jvms.18-0158.
23) Choong, P.F., Sim, F.H., Pritchard, D.J., Rock, M.G., and Chao, E.Y. (1996).
Megaprostheses after resection of distal femoral tumors. A rotating hinge design
in 30 patients followed for 2-7 years. Acta Orthop Scand 67(4), 345-351. doi:
10.3109/17453679609002328.
24) Colin, A., and Boire, J.-Y. (1997). A novel tool for rapid prototyping and
development of simple 3D medical image processing applications on PCs.
Comput Methods Programs Biomed 53(2), 87-92. doi: 10.1016/S0169-
2607(97)01807-5.
25) Cui, X., Boland, T., D'Lima, D.D., and Lotz, M.K. (2012). Thermal inkjet printing
in tissue engineering and regenerative medicine. Recent Pat Drug Deliv Formul
6(2), 149-155. doi: 10.2174/187221112800672949.
26) Daculsi, G., LeGeros, R.Z., Nery, E., Lynch, K., and Kerebel, B. (1989).
Transformation of biphasic calcium phosphate ceramics in vivo: ultrastructural
and physicochemical characterization. J Biomed Mater Res 23(8), 883-894. doi:
10.1002/jbm.820230806.
27) Deckard, C.R. (1989). Method and apparatus for producing parts by selective
sintering. Washington, DC: U.S. Patent and Trademark Office. patent
application U.S. Patent No. 4,863,538.
28) Dimitriou, R., Jones, E., McGonagle, D., and Giannoudis, P.V. (2011). Bone
regeneration: current concepts and future directions. BMC Med 9, 66. doi:
10.1186/1741-7015-9-66.
29) Dupret-Bories, A., Vergez, S., Meresse, T., Brouillet, F., and Bertrand, G.
(2018). Contribution of 3D printing to mandibular reconstruction after cancer.
66
Eur Ann Otorhinolaryngol Head Neck Dis 135(2), 133-136. doi:
10.1016/[Link].2017.09.007.
30) Eggli, P.S., Muller, W., and Schenk, R.K. (1988). Porous hydroxyapatite and
tricalcium phosphate cylinders with two different pore size ranges implanted in
the cancellous bone of rabbits. A comparative histomorphometric and histologic
study of bony ingrowth and implant substitution. Clin Orthop Relat Res (232),
127-138.
31) Elliot, R.R., and Richards, R.H. (2011). Failed operative treatment in two cases
of pseudarthrosis of the clavicle using internal fixation and bovine cancellous
xenograft (Tutobone). J Pediatr Orthop 20(5). doi:
10.1097/BPB.0b013e328346c010.
32) Fahimipour, F., Rasoulianboroujeni, M., Dashtimoghadam, E., Khoshroo, K.,
Tahriri, M., Bastami, F., et al. (2017). 3D printed TCP-based scaffold
incorporating VEGF-loaded PLGA microspheres for craniofacial tissue
engineering. Dent Mater 33(11), 1205-1216. doi: 10.1016/[Link].2017.06.016.
33) Faldini, C., Miscione, M.T., Acri, F., Chehrassan, M., Bonomo, M., and Giannini,
S. (2011). Use of homologous bone graft in the treatment of aseptic forearm
nonunion. Musculoskelet Surg 95(1), 31-35. doi: 10.1007/s12306-011-0117-8.
34) Feilden, E., Blanca, E.G.-T., Giuliani, F., Saiz, E., and Vandeperre, L. (2016).
Robocasting of structural ceramic parts with hydrogel inks. J Eur Ceram Soc
36(10), 2525-2533. doi: 10.1016/[Link].2016.03.001.
35) Fernandez de Grado, G., Keller, L., Idoux-Gillet, Y., Wagner, Q., Musset, A.-M.,
Benkirane-Jessel, N., et al. (2018). Bone substitutes: a review of their
characteristics, clinical use, and perspectives for large bone defects
management. J Tissue Eng 9, 1-18. doi: 10.1177/2041731418776819.
36) Friesenbichler, J., Maurer-Ertl, W., Sadoghi, P., Pirker-Fruehauf, U., Bodo, K.,
and Leithner, A. (2014). Adverse reactions of artificial bone graft substitutes:
lessons learned from using tricalcium phosphate geneX®. Clin Orthop Relat
Res 472(3), 976-982. doi: 10.1007/s11999-013-3305-z.
37) Gerhardt, L.C., and Boccaccini, A.R. (2010). Bioactive glass and glass-ceramic
scaffolds for bone tissue engineering. Materials (Basel) 3(7), 3867-3910. doi:
10.3390/ma3073867.

67
38) Giannoudis, P.V., Einhorn, T.A., Schmidmaier, G., and Marsh, D. (2008). The
diamond concept - open questions. Injury 39, S5-S8. doi: 10.1016/S0020-
1383(08)70010-X.
39) Gjerde, C., Mustafa, K., Hellem, S., Rojewski, M., Gjengedal, H., Yassin, M.A.,
et al. (2018). Cell therapy induced regeneration of severely atrophied
mandibular bone in a clinical trial. Stem Cell Res Ther 9. doi: 10.1186/s13287-
018-0951-9.
40) Gomes, K.U., Carlini, J.L., Biron, C., Rapoport, A., and Dedivitis, R.A. (2008).
Use of allogeneic bone graft in maxillary reconstruction for installation of dental
implants. J Oral Maxillofac Surg 66(11), 2335-2338. doi:
10.1016/[Link].2008.06.006.
41) Gomez-Barrena, E., Rosset, P., Gebhard, F., Hernigou, P., Baldini, N., Rouard,
H., et al. (2019). Feasibility and safety of treating non-unions in tibia, femur and
humerus with autologous, expanded, bone marrow-derived mesenchymal
stromal cells associated with biphasic calcium phosphate biomaterials in a
multicentric, non-comparative trial. Biomaterials 196, 100-108. doi:
10.1016/[Link].2018.03.033.
42) Gomez-Barrena, E., Rosset, P., Muller, I., Giordano, R., Bunu, C., Layrolle, P.,
et al. (2011). Bone regeneration: stem cell therapies and clinical studies in
orthopaedics and traumatology. J Cell Mol Med 15(6), 1266-1286. doi:
10.1111/j.1582-4934.2011.01265.x.
43) Gosheger, G., Gebert, C., Ahrens, H., Streitbuerger, A., Winkelmann, W., and
Hardes, J. (2006). Endoprosthetic reconstruction in 250 patients with sarcoma.
Clin Orthop Relat Res 450, 164-171. doi:
10.1097/[Link].0000223978.36831.39.
44) Gruene, M., Unger, C., Koch, L., Deiwick, A., and Chichkov, B. (2011).
Dispensing pico to nanolitre of a natural hydrogel by laser-assisted bioprinting.
Biomed Eng Online 10(1), 19. doi: 10.1186/1475-925X-10-19.
45) Han, W., Shen, J., Wu, H., Yu, S., Fu, J., and Xie, Z. (2017). Induced membrane
technique: advances in the management of bone defects. Int J Surg 42, 110-
116. doi: 10.1016/[Link].2017.04.064.
46) Hattori, H., Mibe, J., and Yamamoto, K. (2011). Modular megaprosthesis in
metastatic bone disease of the femur. Orthopedics 34(12), e871-876. doi:
10.3928/01477447-20111021-13.
68
47) Heliotis, M., Lavery, K.M., Ripamonti, U., Tsiridis, E., and di Silvio, L. (2006).
Transformation of a prefabricated hydroxyapatite/osteogenic protein-1 implant
into a vascularised pedicled bone flap in the human chest. Int J Oral Maxillofac
Surg 35(3), 265-269. doi: 10.1016/[Link].2005.07.013.
48) Hidalgo, D.A., and Pusic, A.L. (2002). Free-flap mandibular reconstruction: a
10-year follow-up study. Plast Reconstr Surg 110(2), 438-451.
49) Hock, S.W., Johnson, D.A., and Van Veen, M.A. (1996). Print quality
optimization for a color ink jet printer by using a larger nozzle for the black ink
only.
50) Holl, S., Schlomberg, A., Gosheger, G., Dieckmann, R., Streitbuerger, A.,
Schulz, D., et al. (2012). Distal femur and proximal tibia replacement with
megaprosthesis in revision knee arthroplasty: a limb-saving procedure. Knee
Surg Sports Traumatol Arthrosc 20(12), 2513-2518. doi: 10.1007/s00167-012-
1945-2.
51) Hudson, K.R., Cowan, P.B., and Gondek, J.S. (2000). Ink drop volume variance
compensation for inkjet printing.
52) Jawad, M.U., and Brien, E.W. (2014). Proximal femoral reconstruction with a
constrained acetabulum in oncologic patients. Orthopedics 37(2), e187-193.
doi: 10.3928/01477447-20140124-24.
53) Jeys, L., and Grimer, R. (2009). "The long-term risks of infection and amputation
with limb salvage surgery using endoprostheses," in Treatment of Bone and
Soft Tissue Sarcomas, ed. P.-U. Tunn. (Berlin, Heidelberg: Springer Berlin
Heidelberg), 75-84.
54) Jeys, L.M., Grimer, R.J., Carter, S.R., and Tillman, R.M. (2005). Periprosthetic
infection in patients treated for an orthopaedic oncological condition. J Bone
Joint Surg Am 87(4), 842-849. doi: 10.2106/JBJS.C.01222.
55) Ji, K., Wang, Y., Wei, Q., Zhang, K., Jiang, A., Rao, Y., et al. (2018). Application
of 3D printing technology in bone tissue engineering. Bio-des Manuf 1(3), 203-
210. doi: 10.1007/s42242-018-0021-2.
56) Kao, C.T., Lin, C.C., Chen, Y.W., Yeh, C.H., Fang, H.Y., and Shie, M.Y. (2015).
Poly(dopamine) coating of 3D printed poly(lactic acid) scaffolds for bone tissue
engineering. Mater Sci Eng C Mater Biol Appl 56, 165-173. doi:
10.1016/[Link].2015.06.028.

69
57) Karalashvili, L., Chichua, N., Menabde, G., Atskvereli, L., and Grdzelidze, T.
(2017). Decellularized bovine bone graft for zygomatic bone reconstruction.
Med Case Rep 4(1:52). doi: 10.21767/2471-8041.100087.
58) Keating, J.F., and McQueen, M.M. (2001). Substitutes for autologous bone graft
in orthopaedic trauma. J Bone Joint Surg Br 83(1), 3-8. doi: 10.1302/0301-
620x.83b1.11952.
59) Klammert, U., Gbureck, U., Vorndran, E., Rodiger, J., Meyer-Marcotty, P., and
Kubler, A.C. (2010a). 3D powder printed calcium phosphate implants for
reconstruction of cranial and maxillofacial defects. J Craniomaxillofac Surg
38(8), 565-570. doi: 10.1016/[Link].2010.01.009.
60) Klammert, U., Vorndran, E., Reuther, T., Muller, F.A., Zorn, K., and Gbureck, U.
(2010b). Low temperature fabrication of magnesium phosphate cement
scaffolds by 3D powder printing. J Mater Sci Mater Med 21(11), 2947-2953. doi:
10.1007/s10856-010-4148-8.
61) Kokemueller, H., Spalthoff, S., Nolff, M., Tavassol, F., Essig, H., Stuehmer, C.,
et al. (2010). Prefabrication of vascularized bioartificial bone grafts in vivo for
segmental mandibular reconstruction: experimental pilot study in sheep and first
clinical application. Int J Oral Maxillofac Surg 39(4), 379-387. doi:
10.1016/[Link].2010.01.010.
62) Kolesky, D.B., Truby, R.L., Gladman, A.S., Busbee, T.A., Homan, K.A., and
Lewis, J.A. (2014). 3D bioprinting of vascularized, heterogeneous cell-laden
tissue constructs. Adv Mater 26(19), 3124-3130. doi:
10.1002/adma.201305506.
63) Kurien, T., Pearson, R.G., and Scammell, B.E. (2013). Bone graft substitutes
currently available in orthopaedic practice. Bone Joint J 95-B(5), 583-597. doi:
10.1302/0301-620X.95B5.30286.
64) Laurencin, C., Khan, Y., and Veronick, J. (2014). "Bone graft substitutes: past,
present and future," in Bone graft substitutes and bone regenerative
engineering. West Conshohocken, PA: ASTM International), 1-9.
65) Ledford, C.K., Nunley, J.A., 2nd, Viens, N.A., and Lark, R.K. (2013). Bovine
xenograft failures in pediatric foot reconstructive surgery. J Pediatr Orthop
33(4), 458-463. doi: 10.1097/BPO.0b013e318287010d.

70
66) Lee, K.Y., Park, M., Kim, H.M., Lim, Y.J., Chun, H.J., Kim, H., et al. (2006).
Ceramic bioactivity: progresses, challenges and perspectives. Biomed Mater
1(2), R31-R37. doi: 10.1088/1748-6041/1/2/r01.
67) Lewis, J.A. (2006). Direct ink writing of 3D functional materials. Adv Funct Mater
16(17), 2193-2204. doi: 10.1002/adfm.200600434.
68) Lewis, J.A., Smay, J.E., Stuecker, J., and Cesarano, J. (2006). Direct ink writing
of three-dimensional ceramic structures. J Am Ceram Soc 89(12), 3599-3609.
doi: 10.1111/j.1551-2916.2006.01382.x.
69) Liao, H.-T., Chang, K.-H., Jiang, Y., Chen, J.-P., and Lee, M.-Y. (2011).
Fabrication of tissue engineered PCL scaffold by selective laser-sintered
machine for osteogeneisis of adipose-derived stem cells. Virtual Phys Protoyp
6(1), 57-60. doi: 10.1080/17452759.2011.559742.
70) Lodoso-Torrecilla, I., van Gestel, N.A.P., Diaz-Gomez, L., Grosfeld, E.C.,
Laperre, K., Wolke, J.G.C., et al. (2018). Multimodal pore formation in calcium
phosphate cements. J Biomed Mater Res A 106(2), 500-509. doi:
10.1002/jbm.a.36245.
71) Mandrycky, C., Wang, Z., Kim, K., and Kim, D.-H. (2016). 3D bioprinting for
engineering complex tissues. Biotechnol Adv 34(4), 422-434. doi:
10.1016/[Link].2015.12.011.
72) Mankin, H.J., Gebhardt, M.C., Jennings, L.C., Springfield, D.S., and Tomford,
W.W. (1996). Long-term results of allograft replacement in the management of
bone tumors. Clin Orthop Relat Res (324), 86-97. doi: 10.1097/00003086-
199603000-00011.
73) Masquelet, A.C. (2003). Muscle reconstruction in reconstructive surgery: soft
tissue repair and long bone reconstruction. Langenbecks Arch Surg 388(5),
344-346. doi: 10.1007/s00423-003-0379-1.
74) Masquelet, A.C., and Begue, T. (2010). The concept of induced membrane for
reconstruction of long bone defects. Orthop Clin North Am 41(1), 27-37. doi:
10.1016/[Link].2009.07.011.
75) Masquelet, A.C., Fitoussi, F., Begue, T., and Muller, G.P. (2000).
Reconstruction of the long bones by the induced membrane and spongy
autograft. Ann Chir Plast Esthet 45(3), 346-353.

71
76) Mathieu, L., Bilichtin, E., Durand, M., de l'Escalopier, N., Murison, J.C.,
Collombet, J.M., et al. (2019). Masquelet technique for open tibia fractures in a
military setting. Eur J Trauma Emerg Surg. doi: 10.1007/s00068-019-01217-y.
77) Mazzoli, A. (2013). Selective laser sintering in biomedical engineering. Med Biol
Eng Comput 51(3), 245-256. doi: 10.1007/s11517-012-1001-x.
78) Mercado-Pagan, A.E., Stahl, A.M., Shanjani, Y., and Yang, Y. (2015).
Vascularization in bone tissue engineering constructs. Ann Biomed Eng 43(3),
718-729. doi: 10.1007/s10439-015-1253-3.
79) Mesimaki, K., Lindroos, B., Tornwall, J., Mauno, J., Lindqvist, C., Kontio, R., et
al. (2009). Novel maxillary reconstruction with ectopic bone formation by GMP
adipose stem cells. Int J Oral Maxillofac Surg 38(3), 201-209. doi:
10.1016/[Link].2009.01.001.
80) Michna, S., Wu, W., and Lewis, J.A. (2005). Concentrated hydroxyapatite inks
for direct-write assembly of 3D periodic scaffolds. Biomaterials 26(28), 5632-
5639. doi: s10.1016/[Link].2005.02.040.
81) Miranda, P., Saiz, E., Gryn, K., and Tomsia, A.P. (2006). Sintering and
robocasting of β-tricalcium phosphate scaffolds for orthopaedic applications.
Acta Biomater 2(4), 457-466. doi: 10.1016/[Link].2006.02.004.
82) Mittermayer, F., Krepler, P., Dominkus, M., Schwameis, E., Sluga, M., Heinzl,
H., et al. (2001). Long-term followup of uncemented tumor endoprostheses for
the lower extremity. Clin Orthop Relat Res (388), 167-177. doi:
10.1097/00003086-200107000-00024.
83) Mondschein, R.J., Kanitkar, A., Williams, C.B., Verbridge, S.S., and Long, T.E.
(2017). Polymer structure-property requirements for stereolithographic 3D
printing of soft tissue engineering scaffolds. Biomaterials 140, 170-188. doi:
10.1016/[Link].2017.06.005.
84) Moran, S.L., Bakri, K., Mardini, S., Shin, A.Y., and Bishop, A.T. (2009). The use
of vascularized fibular grafts for the reconstruction of spinal and sacral defects.
Microsurgery 29(5), 393-400. doi: 10.1002/micr.20655.
85) Morelli, I., Drago, L., George, D.A., Gallazzi, E., Scarponi, S., and Romano, C.L.
(2016). Masquelet technique: myth or reality? A systematic review and meta-
analysis. Injury 47 Suppl 6, S68-S76. doi: 10.1016/S0020-1383(16)30842-7.
86) Murphy, S.V., and Atala, A. (2014). 3D bioprinting of tissues and organs. Nat
Biotechnol 32, 773. doi: 10.1038/nbt.2958.
72
87) Muscolo, D.L., Ayerza, M.A., Aponte-Tinao, L., Ranalletta, M., and Abalo, E.
(2004). Intercalary femur and tibia segmental allografts provide an acceptable
alternative in reconstructing tumor resections. Clin Orthop Relat Res 426. doi:
10.1097/[Link].0000141652.93178.10.
88) Ogose, A., Kondo, N., Umezu, H., Hotta, T., Kawashima, H., Tokunaga, K., et
al. (2006). Histological assessment in grafts of highly purified beta-tricalcium
phosphate (OSferion®) in human bones. Biomaterials 27(8), 1542-1549. doi:
10.1016/[Link].2005.08.034.
89) Ogura, K., Sakuraba, M., Miyamoto, S., Fujiwara, T., Chuman, H., and Kawai,
A. (2015). Pelvic ring reconstruction with a double-barreled free vascularized
fibula graft after resection of malignant pelvic bone tumor. Arch Orthop Trauma
Surg 135(5), 619-625. doi: 10.1007/s00402-015-2197-7.
90) Orringer, J.S., Shaw, W.W., Borud, L.J., Freymiller, E.G., Wang, S.A., and
Markowitz, B.L. (1999). Total mandibular and lower lip reconstruction with a
prefabricated osteocutaneous free flap. Plast Reconstr Surg 104(3), 793-797.
doi: 10.1097/00006534-199909030-00028.
91) Oryan, A., Alidadi, S., and Moshiri, A. (2013). Current concerns regarding
healing of bone defects. Hard Tissue 2(2), 13.
92) Oryan, A., Alidadi, S., Moshiri, A., and Maffulli, N. (2014). Bone regenerative
medicine: classic options, novel strategies, and future directions. J Orthop Surg
Res 9(1), 18. doi: 10.1186/1749-799X-9-18.
93) Ozbolat, I.T., and Hospodiuk, M. (2016). Current advances and future
perspectives in extrusion-based bioprinting. Biomaterials 76, 321-343. doi:
10.1016/[Link].2015.10.076.
94) Pala, E., Trovarelli, G., Calabro, T., Angelini, A., Abati, C.N., and Ruggieri, P.
(2015). Survival of modern knee tumor megaprostheses: failures, functional
results, and a comparative statistical analysis. Clin Orthop Relat Res 473(3),
891-899. doi: 10.1007/s11999-014-3699-2.
95) Parikh, S.N. (2002). Bone graft substitutes: past, present, future. J Postgrad
Med 48(2), 142-148.
96) Park, S.A., Lee, H.J., Kim, K.S., Lee, S.J., Lee, J.T., Kim, S.Y., et al. (2018). In
vivo evaluation of 3D-printed polycaprolactone scaffold implantation combined
with beta-TCP powder for alveolar bone augmentation in a beagle defect model.
Materials (Basel) 11(2). doi: 10.3390/ma11020238.
73
97) Patil, S., Auyeung, J., and Gower, A. (2011). Outcome of subtalar fusion using
bovine cancellous bone graft: A retrospective case series. J Foot Ankle Surg
50(4), 388-390. doi: 10.1053/[Link].2011.04.019.
98) Paxton, N., Smolan, W., Böck, T., Melchels, F., Groll, J., and Jungst, T. (2017).
Proposal to assess printability of bioinks for extrusion-based bioprinting and
evaluation of rheological properties governing bioprintability. Biofabrication 9(4),
044107. doi: 10.1088/1758-5090/aa8dd8.
99) Pelissier, P.H., Masquelet, A.C., Bareille, R., Pelissier, S.M., and Amedee, J.
(2004). Induced membranes secrete growth factors including vascular and
osteoinductive factors and could stimulate bone regeneration. J Orthop Res
22(1), 73-79. doi: 10.1016/S0736-0266(03)00165-7.
100) Peng, X., Mao, C., Yu, G.Y., Guo, C.B., Huang, M.X., and Zhang, Y.
(2005). Maxillary reconstruction with the free fibula flap. Plast Reconstr Surg
115(6), 1562-1569. doi: 10.1097/[Link].0000160691.63029.74.
101) Petrochenko, P.E., Torgersen, J., Gruber, P., Hicks, L.A., Zheng, J.,
Kumar, G., et al. (2015). Laser 3D printing with sub-microscale resolution of
porous elastomeric scaffolds for supporting human bone stem cells. Adv
Healthc Mater 4(5), 739-747. doi: 10.1002/adhm.201400442.
102) Putzier, M., Strube, P., Funk, J.F., Gross, C., Monig, H.J., Perka, C., et
al. (2009). Allogenic versus autologous cancellous bone in lumbar segmental
spondylodesis: a randomized prospective study. Eur Spine J 18(5), 687-695.
doi: 10.1007/s00586-008-0875-7.
103) Rizzo, M., and Moran, S.L. (2008). Vascularized bone grafts and their
applications in the treatment of carpal pathology. Semin Plast Surg 22(3), 213-
227. doi: 10.1055/s-2008-1081404.
104) ́ uez-Lorenzo, L.M., Vallet-Regı,́ M., and Ferreira, J.M.F. (2001).
Rodrıg
Colloidal processing of hydroxyapatite. Biomaterials 22(13), 1847-1852. doi:
10.1016/S0142-9612(00)00366-5.
105) Saijo, H., Igawa, K., Kanno, Y., Mori, Y., Kondo, K., Shimizu, K., et al.
(2009). Maxillofacial reconstruction using custom-made artificial bones
fabricated by inkjet printing technology. J Artif Organs 12(3), 200-205. doi:
10.1007/s10047-009-0462-7.
106) Saito, E., Suarez-Gonzalez, D., Murphy, W.L., and Hollister, S.J. (2015).
Biomineral coating increases bone formation by ex vivo BMP-7 gene therapy in
74
rapid prototyped poly(L-lactic acid) (PLLA) and poly(epsilon-caprolactone)
(PCL) porous scaffolds. Adv Healthc Mater 4(4), 621-632. doi:
10.1002/adhm.201400424.
107) Samavedi, S., Whittington, A.R., and Goldstein, A.S. (2013). Calcium
phosphate ceramics in bone tissue engineering: A review of properties and their
influence on cell behavior. Acta Biomater 9(9), 8037-8045. doi:
10.1016/[Link].2013.06.014.
108) Sanan, A., and Haines, S.J. (1997). Repairing holes in the head: a history
of cranioplasty. Neurosurgery 40(3), 588-603. doi: 10.1097/00006123-
199703000-00033.
109) Scaglione, M., Fabbri, L., Dell’Omo, D., Gambini, F., and Guido, G.
(2014). Long bone nonunions treated with autologous concentrated bone
marrow-derived cells combined with dried bone allograft. Musculoskelet Surg
98(2), 101-106. doi: 10.1007/s12306-013-0271-2.
110) Shehadeh, A., Noveau, J., Malawer, M., and Henshaw, R. (2010). Late
complications and survival of endoprosthetic reconstruction after resection of
bone tumors. Clin Orthop Relat Res 468(11), 2885-2895. doi: 10.1007/s11999-
010-1454-x.
111) Shibuya, N., Jupiter, D.C., Clawson, L.D., and La Fontaine, J. (2012).
Incorporation of bovine-based structural bone grafts used in reconstructive foot
surgery. J Foot Ankle Surg 51(1), 30-33. doi: 10.1053/[Link].2011.09.008.
112) Sivakumar, R., Mohideen, M.G., Chidambaram, M., Vinoth, T., Singhi,
P.K., and Somashekar, V. (2016). Management of large bone defects in
diaphyseal fractures by induced membrane formation by Masquelet's
technique. J Orthop Case Rep 6(3), 59-62. doi: 10.13107/jocr.2250-0685.508.
113) Stanovici, J., Le Nail, L.R., Brennan, M.A., Vidal, L., Trichet, V., Rosset,
P., et al. (2016). Bone regeneration strategies with bone marrow stromal cells
in orthopaedic surgery. Curr Res Transl Med 64(2), 83-90. doi:
10.1016/[Link].2016.04.006.
114) Suwanprateeb, J., Sanngam, R., Suvannapruk, W., and
Panyathanmaporn, T. (2009). Mechanical and in vitro performance of apatite-
wollastonite glass ceramic reinforced hydroxyapatite composite fabricated by
3D-printing. J Mater Sci Mater Med 20(6), 1281-1289. doi: 10.1007/s10856-
009-3697-1.
75
115) Tatara, A.M., Wong, M.E., and Mikos, A.G. (2014). In vivo bioreactors for
mandibular reconstruction. J Dent Res 93(12), 1196-1202. doi:
10.1177/0022034514547763.
116) Taylor, G.I. (1982). Reconstruction of the mandible with free composite
iliac bone grafts. Ann Plast Surg 9(5), 361-376. doi: 10.1097/00000637-
198211000-00003.
117) Taylor, G.I. (1983). The current status of free vascularized bone grafts.
Clin Plast Surg 10(1), 185-209.
118) Taylor, G.I. (1985). Composite tissue transfer to the lower limb. Recent
Adv Plast Surg 3, 83-109.
119) Taylor, G.I., Corlett, R.J., and Ashton, M.W. (2016). The evolution of free
vascularized bone transfer: a 40-year experience. Plast Reconstr Surg 137(4),
1292-1305. doi: 10.1097/PRS.0000000000002040.
120) Taylor, G.I., Miller, G.D., and Ham, F.J. (1975). The free vascularized
bone graft. A clinical extension of microvascular techniques. Plast Reconstr
Surg 55(5), 533-544. doi: 10.1097/00006534-197505000-00002.
121) Torres, J., Tamimi, F., Alkhraisat, M., Prados-Frutos, J.C., and Lopez-
Cabarcos, E. (2011). "Bone substitutes," in Implant dentistry - the most
promising discipline of dentistry, ed. I. Turkyilmaz. Intech), 4-105.
122) Trombetta, R., Inzana, J.A., Schwarz, E.M., Kates, S.L., and Awad, H.A.
(2017). 3D printing of calcium phosphate ceramics for bone tissue engineering
and drug delivery. Ann Biomed Eng 45(1), 23-44. doi: 10.1007/s10439-016-
1678-3.
123) Unger, C., Gruene, M., Koch, L., Koch, J., and Chichkov, B.N. (2011).
Time-resolved imaging of hydrogel printing via laser-induced forward transfer.
Appl Phys A 103(2), 271-277. doi: 10.1007/s00339-010-6030-4.
124) Vacanti, J.P., and Langer, R. (1999). Tissue engineering: the design and
fabrication of living replacement devices for surgical reconstruction and
transplantation. Lancet 354, S32-S34. doi: 10.1016/S0140-6736(99)90247-7.
125) Verboket, R., Leiblein, M., Seebach, C., Nau, C., Janko, M., Bellen, M.,
et al. (2018). Autologous cell-based therapy for treatment of large bone defects:
from bench to bedside. Eur J Trauma Emerg Surg 44(5), 649-665. doi:
10.1007/s00068-018-0906-y.

76
126) Vorndran, E., Klarner, M., Klammert, U., Grover, L.M., Patel, S., Barralet,
J.E., et al. (2008). 3D Powder printing of β-tricalcium phosphate ceramics using
different strategies. Adv Eng Mater 10(12), B67-B71. doi:
10.1002/adem.200800179.
127) Wang, M.O., Vorwald, C.E., Dreher, M.L., Mott, E.J., Cheng, M.-H.,
Cinar, A., et al. (2015). Evaluating 3D-printed biomaterials as scaffolds for
vascularized bone tissue engineering. Adv Mater 27(1), 138-144. doi:
10.1002/adma.201403943.
128) Warnke, P.H., Springer, I.N., Wiltfang, J., Acil, Y., Eufinger, H.,
Wehmoller, M., et al. (2004). Growth and transplantation of a custom
vascularised bone graft in a man. Lancet 364(9436), 766-770. doi:
10.1016/S0140-6736(04)16935-3.
129) Wen, Y., Xun, S., Haoye, M., Baichuan, S., Peng, C., Xuejian, L., et al.
(2017). 3D printed porous ceramic scaffolds for bone tissue engineering: a
review. Biomater Sci 5(9), 1690-1698. doi: 10.1039/c7bm00315c.
130) Winder, J., and Bibb, R. (2005). Medical rapid prototyping technologies:
state of the art and current limitations for application in oral and maxillofacial
surgery. J Oral Maxillofac Surg 63(7), 1006-1015. doi:
10.1016/[Link].2005.03.016.
131) Wubneh, A., Tsekoura, E.K., Ayranci, C., and Uludag, H. (2018). Current
state of fabrication technologies and materials for bone tissue engineering. Acta
Biomater 80, 1-30. doi: 10.1016/[Link].2018.09.031.
132) Xu, N., Ye, X., Wei, D., Zhong, J., Chen, Y., Xu, G., et al. (2014). 3D
artificial bones for bone repair prepared by computed tomography-guided fused
deposition modeling for bone repair. ACS Appl Mater Interfaces 6(17), 14952-
14963. doi: 10.1021/am502716t.
133) Yang, X., Lu, Z., Wu, H., Li, W., Zheng, L., and Zhao, J. (2018). Collagen-
alginate as bioink for three-dimensional (3D) cell printing based cartilage tissue
engineering. Mater Sci Eng C 83, 195-201. doi: 10.1016/[Link].2017.09.002.
134) Zimmermann, G., and Moghaddam, A. (2011). Allograft bone matrix
versus synthetic bone graft substitutes. Injury 42 Suppl 2, S16-21. doi:
10.1016/[Link].2011.06.199.

77
CHAPTER II

In situ production of pre-vascularized synthetic bone grafts

for regenerating critical-sized defects in rabbits

Luciano Vidal, MD, 1, §; Meadhbh Á Brennan, PhD, 1,2, §; Stéphanie Krissian, MD, 1,3;

Julien De Lima 1; Alain Hoornaert, DDS, PhD, 1,4; Philippe Rosset, MD, PhD,1,3;

Borhane H Fellah, DVM, PhD, 5; Pierre Layrolle, PhD, 1*

1) Inserm, UMR 1238, PHY-OS, Bone sarcomas and remodeling of calcified

tissues, Faculty of Medicine, University of Nantes, 1 rue Gaston Veil, 44035

Nantes, France.

2) Harvard School of Engineering and Applied Sciences, Harvard University,

Cambridge, MA, USA

3) CHRU Tours, Department of trauma and orthopedic surgery, Hospital

Bretenneau, 2 Boulevard Tonnelé, 37000 Tours, France

4) CHU Nantes, Department of Implantology, Faculty of Dentistry, University of

Nantes, 1 Place Alexis Ricordeau, 44042 Nantes, France

5) ONIRIS, CRIP, Veterinary School, 101 route de Gachet, 44307 Nantes, France

§ These authors contributed equally to this work

* Corresponding author

Prof. Pierre Layrolle, PhD, Director of Research, Inserm, UMR 1238, PHY-OS, Bone

sarcomas and remodeling of calcified tissues, Faculty of Medicine, University of

Nantes, 1 rue Gaston Veil, 44035 Nantes, France, email: [Link]@univ-

[Link]

78
Abstract

Reconstructing large bone defects caused by severe trauma or resection of tumors

remains a challenge for orthopedic and plastic surgeons. Free flaps comprised of a

muscle flap with fibula bone and its vascularized bed can be transplanted to the

reconstruction site to achieve healing. However, this transplantation technique adds

morbidity, and requires extensive microsurgery and sculpting of the bone tissue to

adapt the graft to both the vasculature and the anatomy of the bone defect. The aim of

the current study is to evaluate an alternative approach consisting of the in situ

production of a pre-vascularized synthetic bone graft and its subsequent

transplantation to a critical-sized bone defect. 3D printed chambers containing biphasic

calcium phosphate (BCP) granules, perfused by a local vascular pedicle, with or

without the addition of stromal vascular fraction (SVF), were subcutaneously implanted

into New Zealand White female rabbits. The SVF was prepared extemporaneously

from autologous adipose tissue, while the vascular pedicle was isolated from the

inguinal site. Chambers filled with BCP alone served as controls. After 8 weeks, the

constructs containing a vascular pedicle exhibited abundant neovascularization, with

significant numbers of blood vessels sprouting from the pedicle, which was further

enhanced by the addition of SVF. These pre-vascularized synthetic bone grafts were

then transplanted into 15 mm critical-sized segmental ulnar defects for a further 8

weeks. Micro-CT and decalcified histology revealed that pre-vascularization of

synthetic bone grafts led to significantly enhanced bone regeneration. This pre-clinical

study demonstrates the feasibility and efficacy of in situ production of pre-vascularized

synthetic bone grafts for regenerating large bone defects, and will address an

important clinical need.

79
Keywords:

Bone regeneration; vascularization; biphasic calcium phosphate; 3D printing;

implantable chamber; bone graft transplantation.

80
Introduction

Although minor fractures and small bone defects can heal spontaneously, large and

complex bone defects have limited capacity for regeneration. Reconstructing large

bone defects that are the result of severe trauma or tumor ablation remains a critical

challenge for orthopedic and plastic surgeons. Autologous bone grafting, whereby

bone tissue is harvested from one site and transplanted into the defect site, is currently

the gold standard procedure for regenerating large bone defects. Adequate

vascularization is recognized as being a pivotal factor in ensuring the viability of a bone

graft and the subsequent healing of the defect, indeed there is a statistically significant

positive correlation between vascularization and bone formation [1]. Consequently,

vascularized bone grafts are required for the regeneration of large bone defects. Free

flaps, comprising harvested bone from sources such as the radius or fibula, together

with a vascular supply and soft tissue, can be transplanted into the reconstruction site,

where they are connected to the local vasculature [2]. Vascularized bone transfers

have demonstrated faster healing, higher resistance to resorption and superior

mechanical integrity than non-vascularized bone grafts [3]. However, this

transplantation technique is associated with serious limitations. Firstly, the geometry

of the graft rarely conforms to the shape and size of the bone defect, thereby requiring

bone sculpting to attain an anatomically correct shape. Furthermore, connecting the

vasculature of the graft to the vasculature of the defect site requires extensive

microsurgery. Finally, the quantity of bone and soft tissue available to harvest from the

donor site is limited, and most importantly, harvesting bone and surrounding tissue for

grafting causes extreme pain and morbidity for the patient [4].

A major goal for orthopedic reconstructive surgery is therefore to avoid the need for

the creation of a second surgical bone harvest site by using synthetic biomaterials as

81
an alternative to grafted autologous bone. Synthetic biomaterials alone do not have

the adequate osteoinductive or angiogenic properties for healing large bone defects.

However, osteoprogenitor/stem cells, in particular mesenchymal stem cells derived

from bone marrow (BMSCs), combined with biomaterials, have been successful in

regenerating bone tissue [5–8]. Nevertheless, it is well established that the lack of

vascularization within a synthetic bone construct is the most critical obstacle to healing

large bone defects [9]. Proximity to a vascular network is vital for cell viability, and

sufficient delivery of nutrients and oxygen. Consequently, necrosis is often observed

in the center of large synthetic implants as there is not enough extrinsic vascularization

to produce vessel in-growth from the surrounding host tissue fast enough [10].

The aim of pre-vascularized synthetic constructs is to overcome the challenges of

autologous bone grafting of free flaps and of synthetic biomaterial constructs. In the

tissue engineering context, various efforts have been made to produce a network of

blood vessels in vitro that has the capacity to anastomose after transplantation in vivo

in order to deliver sufficient nutrients to the cells within the scaffold, thus enhancing

their survival and functionality after implantation. The most sophisticated strategies

target the delivery of MSCs together with endothelial cells, and in vitro these constructs

have more advanced osteoblastic and endothelial differentiation compared to groups

containing a single cell type [11]. However, when implanted into bone defects, these

multicellular constructs did not enhance bone regeneration compared with the delivery

of MSCs alone [12,13]. Recent work using 3D bio-printing has led to the creation of a

perfusable vascular network using bio-inks and endothelial cells [14–16]. This

approach seems promising although it is still a long way from clinical applications.

In situ-generated synthetic vascularized constructs have many advantages over the

complex and labor-intensive culture required for in vitro generation of tissue-

82
engineered vascularized constructs. Several teams have suggested prefabricating

synthetic bone substitutes by means of ectopic implantation, making pre-

vascularization possible according to an ‘in vivo bioreactor’ principle before

transplanting it into the defect to be regenerated. To date, various strategies have been

investigated to achieve pre-vascularization. Muscle tissue, which has a rich capillary

network, has been wrapped around scaffolds in the form of an intramuscular pouch to

encourage vessels to sprout from the muscle into the construct. Since this technique

was first reported [17] its use has generated constructs with enhanced vascularization

[18] however, its success was limited in pre-clinical and clinical studies by core

necrosis [18,19]. This technique, along with adipose tissue stem cells and BMP-2, has

nevertheless demonstrated success in large maxillofacial defect reconstruction

Arteriovenous (AV) loops have been used successfully to generate large vascularized

synthetic constructs using fibrin matrix [20], coral scaffolds [21] and ceramics [22] in

ectopic sites in animals. Recently, it was demonstrated that a ceramic construct, pre-

vascularized using an AV loop in an ectopic site, showed superior bone healing

following transplantation into a bone defect, compared to the construct without pre-

vascularization [23]. However, in spite of these favorable outcomes, the applicability of

the AV loop is restricted by the intricate microsurgical skills required for the

construction of the arteriovenous shunt.

An alternative strategy to an AV loop is to provide vascularization by using a vascular

pedicle. In this model, an artery and a vein are inserted centrally within an implantable

chamber containing the biomaterial scaffold. The isolation of a vascular pedicle is

relatively simple and does not require anastomosis of the blood vessels, thereby

circumventing the complicated microsurgery required for an AV loop. An arteriovenous

vascular bundle placed inside a construct with cadaver bovine bone [24] or autologous

83
ovine bone and bone marrow [25], achieved a fully-vascularized construct in ectopic

sites in rats and sheep respectively. Further to this, chambers containing synthetic

ceramic biomaterial with a vascular bundle, and growth factors [26] or BMSCs

implanted ectopically demonstrated abundant microvasculature and tissue engineered

bone [27,28]. Together, these studies demonstrate the utility of a pre-vascularized

construct generated by using a vascular bundle. Appropriate evaluation of the

performances of this type of construct following transplantation into a large bone defect

has not yet been conducted, however.

The objective of this study was to produce a highly-vascularized graft in situ and to

transplant it into a critical-sized defect in rabbits for bone reconstruction. In the current

study, we used biphasic calcium phosphate (BCP) granules as the synthetic

biomaterial, as this material has been shown in pre-clinical [5] and clinical studies

[29,30] to be a suitable scaffold for bone healing. While ligated vascular pedicles can

also achieve pre-vascularization constructs [28], we choose not to ligate the vascular

pedicle due to increased risk of thrombosis. In line with our aim to prefabricate a graft

with abundant microvasculature, we chose to deliver autologous stromal vascular

fraction (SVF) isolated from adipose tissue, together with the vascular bundle, because

SVF contains MSCs and endothelial cells [31] previously shown to stimulate

angiogenesis [32,33]. The principal advantage of delivering SVF instead of expanded

MSCs from adipose tissue is that the preparation the SVF could be performed

extemporaneously in a single surgery, whereas the delivery of AT-MSCs requires in

vitro culture and expansion, plus a second surgery. Chambers containing the BCP

granules and a local vascular pedicle inserted centrally, with or without SVF

supplementation, were implanted subcutaneously into New Zealand White female

rabbits. After 8 weeks, the constructs were characterized by microtomography,

84
immunohistochemistry and histology for vascularization and bone tissue formation. In

a second operative step, the bone construct was transplanted into a mid-diaphyseal

segmental ulna defect. After a further 8 weeks, the animals were euthanized and

samples were analyzed by micro-CT and decalcified histology for bone regeneration.

Materials and Methods

Biomaterials

Implantable chambers, to hold the synthetic biomaterials, SVF, and vascular pedicle,

were designed using computer-aided design software (CAD, Space Claim

Corporation, Concord, Massachusetts, USA). Chambers consisting of hollow cylinders

measuring 15 mm in length and 10 mm in diameter, with a wall thickness of 1 mm,

were designed to contain the BCP granules. A transversal window, measuring 3.5 mm

in width and 15 mm in length, with two openings of 4.5 mm in diameter, was made to

allow the vascular pedicle to pass through the implantable chamber. The drawing was

exported in stereo lithography format (STL) and converted into a readable G-code file

(Cura software). The implantable chambers were printed in 3D using polylactic acid

(PLA) white filament, 3 mm in diameter (Ultimaker 2, Ultimaker B.V, Geldermalsen,

The Netherlands). After 3D printing, the implantable chambers were deburred, cleaned

with 70% ethanol, and air-dried. The sterilization of the chambers was ensured by

immersion for 1 hour in a solution of glutaraldehyde followed by washing in a saline

solution.

The synthetic bone substitute used in this study was macro- and micro-porous biphasic

calcium phosphate (BCP, Biomatlante, Vigneux de Bretagne, France) in the form of

irregular granules measuring 0.5-1 mm in size. These BCP granules were prepared by

mixing calcium-deficient apatite with pore makers, compacting the material, sintering

85
at 1050 °C, crushing and sieving. The BCP granules were composed of 20 %

hydroxyapatite (HA) and 80 % beta tricalcium phosphate (β-TCP) in weight as

analyzed by X-ray diffraction. The BCP granules had an overall porosity of 70 %,

consisting of macropores (>100 m) and micropores (10< m). The BCP granules

were sterilized by gamma irradiation at a dose > 25 kGy.

In order to avoid bone regeneration of the ulna defect from the periosteum of the radius,

a bi-layer membrane of polylactic glycolic acid (PLGA, Tisseos®, Biomedical Tissues,

Nantes, France) was placed between the radius and ulna. This synthetic resorbable

bi-layered membrane was manufactured from medical grade PLGA copolymer

(Purasorb PLG 8531, Corbion Purac BV, Gorinchem, The Netherlands) using a

proprietary process in a clean room [34]. The PLGA membrane, 10 × 20 mm in size,

was packaged in double-sealed pouches and sterilized with gamma irradiation at 25

kGy (Ionisos SA, Dagneux, France).

Study design and ethical approval

The study was carried out on a total of 32 New Zealand White (NZW) rabbits in two

surgical phases, as shown in Figure 1. The experiments were conducted in accordance

with European Directive 2010/60/EU. Ethical approval for this study was obtained from

the local ethics committee (CEEA, Pays de Loire, France) under the authorization

project numbers CEEA.2012.119 and Apafis # 1917. The experiments were carried

out at the Preclinical Investigation Research Center (CRIP) of the National Veterinary

School of Nantes (ONIRIS, Nantes, France) under the supervision of a doctor in

veterinary medicine. NZW adult female rabbits with a body weight of 4.5 kg were

purchased from a professional breeder (Hypharm, Roussay, France). The animals

were housed in individual cages with unlimited water and food. The room was

86
ventilated and air-conditioned to a temperature of 20 ± 1 °C. An artificial day / night

cycle of 12 h was applied. The rabbits were acclimated for at least 10 days prior to

surgery.

Figure 1 : Design of the study. Flow chart of the surgery steps and euthanasia; Design
of the chamber and photograph of the implantable PLA chamber manufactured with
3D printing; Subcutis implantation of the PLA chambers loaded with BCP granules and
autologous SVF with or without a vascular pedicle passing through; At 8 weeks,
harvesting of the content of the subcutis chambers and transplantation in mid-
diaphyseal segmental defects of 15 mm in the ulna of rabbits. At 16 weeks, euthanasia
and micro CT and histology analysis.

In the first surgery, 25 rabbits were operated on. Two chambers containing the BCP

granules and a central vascular pedicle, with or without supplementation with

autologous stromal vascular fraction (SVF), were implanted into inguinal sites. Adipose

tissue was collected and processed for preparation of the SVF during the first surgery.

Chambers containing BCP alone served as controls. Each rabbit received two identical

implants, with groups defined according to the content of the implanted chambers:

synthetic bone filler alone (BCP), BCP with a vascular pedicle (BCP + Pedicle), or BCP

87
supplemented with autologous SVF and a vascular pedicle (BCP + SVF + Pedicle). A

group of 9 rabbits (3/group) was sacrificed after 8 weeks in order to evaluate the

vascularization inside the chambers by injection of a vascular contrast agent.

The second surgery was performed on 19 rabbits. 12 rabbits that had received 2

subcutis chambers containing BCP + Pedicle (n=6) and BCP + SVF + Pedicle (n=6)

for 8 weeks were re-operated on for transplantation of the content of the chambers into

ulnar defects. The rabbits were placed under general anesthesia and the chambers

were explanted from the inguinal subcutis sites. The outer 3D-printed PLA chamber

was removed and the content was transplanted into the ulna defect. The second

chamber was collected and fixed in buffered formaldehyde for histological evaluation.

A further seven rabbits of the same age and body weight were used for creation of

ulnar defects that were left empty (n=3) or filled with BCP granules (n=4). Eight weeks

after the second surgery, the animals were euthanatized. The ulnas were dissected

and immediately fixed in buffered formaldehyde for micro-CT and histology.

Subcutis implantation of chambers in rabbits

The rabbits were placed under general anesthesia by means of an intramuscular

injection of a mixture of xylazine (Rompun® 2%, 0.2 mg / kg, Bayer Pharma, Puteaux,

France) and ketamine (Imalgène 1000®, 20 mg / kg, Mérial, Lyon, France). The

inguinal sites were shaved and disinfected with povidone and sterile gauzes, and

sterile fields were set up to delimit the surgical area. The general anesthesia was

maintained by the intravenous injection of the same mixture through a catheter placed

in the marginal vein of the ear. The rabbit was monitored for body temperature and

heart pulse during the surgery.

The primary surgical steps for inguinal subcutis implantation are shown in Figure 2. A

88
medial cutaneous incision measuring 3-4 cm was made in the inguinal region. Two

identical chambers were implanted into the subcutaneous inguinal sites of each rabbit.

In control samples, BCP was added directly to the chambers (BCP). In the case of pre-

vascularized implants, two pedicles were isolated from the left and right femoral artery

branches respectively. The dissection of the femoral artery was performed in deep

planes in the inguinal site. Once the branch of the femoral artery was identified, delicate

dissection of the pedicle was conducted with careful hemostasis by using an electrical

bistoury. Some BCP particles were put into the chamber, then the vascular pedicle

was placed in the transverse position and the chamber was then completely filled with

BCP granules, taking care not to compress the blood vessel. Hemostasis and the

patency of the vessels upstream and downstream of the chamber were verified. After

smooth dissection of the subcutaneous connective tissue, 5 g of adipose tissue

adjacent to the mammary tissue was harvested and processed for isolation of the SVF.

While harvesting the adipose tissue, hemostasis was ensured by using an electric

scalpel. Preparation of the SVF required less than 1 hour while the rabbit was

maintained under general anesthesia, with the open wound moistened with saline

gauzes. Chambers with a vascular pedicle were filled with BCP granules alone (BCP

+ Pedicle) or BCP granules mixed with SVF (BCP + SVF + Pedicle). All chambers were

fixed to the abdominal muscle with non-absorbable sutures (Prolene®, 2/0, Ethicon).

The surgical site was closed in layers using subcutaneous and cutaneous sutures with

resorbable braided sutures (Polysorb Dec.2®, 2/0 and 3/0, Tyco Healthcare). Post-

operative analgesia was provided by a transdermal patch of Fentanyl (Durogesic®, 15

μg/kg/h) placed on the ear, ensuring continuous release of the active substance for 3

to 5 days. Post-operative s.c. injection of non-steroidal anti-inflammatory drugs

(Meloxicam, Metacam®, Boehringer-Ingelheim, Reims, at a dose of 0.1 to 0.2

89
mg/kg/day) was administered for 5 days. An antibiotic treatment of marbofloxacin (3

mg/kg, s.c. injection, Marbocyl, Vetoquinol, Paris, France) was started the day of

surgery and repeated for 5 days. After surgery, the animals were monitored for signs

of suffering, and the surgical wounds were inspected daily to check for skin healing

and the absence of infections.

Figure 2 : Photographs showing (a) the harvesting of adipose tissue; (b) isolation of
the vascular pedicle from a femoral artery branch; (c) pre-filling of the chamber with
BCP granules; (d) insertion of the vascular pedicle; (e, f) filling and fixation of the
implantable chamber in an inguinal subcutaneous site in rabbits.

90
Extemporaneous preparation and characterization of the stromal vascular

fraction of adipose tissue from rabbits

Autologous adipose tissue (AT), 5 g per rabbit, was harvested in the inguinal-

abdominal region of rabbits during the first surgery. The AT was placed in a sterile 50

ml tube (Falcon, BD). The stromal vascular fraction (SVF) was prepared in aseptic

conditions under a laminar flow cabinet. The AT was washed three times with

phosphate buffered saline (PBS, Gibco) to eliminate red blood cells. Mechanical

digestion was performed to roughly dissociate the AT with scissors and vortexing for 1

to 2 minutes. Enzymatic digestion was performed with 0.075% collagenase A (Roche)

at 37 °C for 45 min with 3 vortex agitations for 1 to 2 min. After digestion, the yellow

viscous solution was filtered through 70 μm (Becton-Dickinson), to remove tissue

debris, and centrifuged at 1600 rpm for 5 min. After removal of the oily supernatant,

the cell pellet corresponding to the SVF was suspended in 1.5 ml of PBS to allow it to

associate with the BCP granules. The SVF was implanted subcutaneously into the

same rabbit as the harvested AT sample to avoid an immune response against

allogeneic cells. Cell counting of the SVF preparation was performed using an

automated cell counter (Nucleocounter® NC-100, Denmark).

In order to demonstrate their multi potency, 1.5 x 10 5 nucleated cells from the SVF of

rabbits were cultured in a 75 cm2 flask in Dulbecco's modified Eagle-based culture

medium (Gibco® DMEM, Life Technologies, Inc. Saint Aubin, France) supplemented

with 10% fetal calf serum (FCS, GE Healthcare, Vélizy-Villacoublay, France) and 1%

penicillin / streptomycin (Gibco) at 37 °C in a humidified atmosphere (5% CO2 / 95 %

of air). The culture medium was refreshed every 2-3 days. After 7 days of culture, the

adherent cells (adipose tissue-derived stromal cells – ATSCs) were approximately 80

% confluent and were detached from the plastic by trypsin/EDTA (Lonza, Belgium) and

91
centrifuged at 1600 rpm for 5 min (Passage 0). After cell counting, the cells were

amplified in a 500 cm2 triple flask at a cell density of 5 × 103 cells/cm2 for 7 days

(passage 1). After detachment and counting, the cells were cultured in 24-well plates

at an initial cell density of 2 × 104 and 5 × 103 cells/cm2 under adipogenic and

osteogenic conditions respectively, with 500 μL of differentiation media (StemPro®

Differentiation kits, Life Technologies, Saint Aubin, France). For chondrocyte

differentiation, 1 x 106 ATSCs were pelleted at 1600 rpm for 5 min and pellets were

cultured under standard chondrogenic conditions (StemPro kits ®Differentiation). The

culture medium was refreshed every 2-3 days. After 21 days of culture, cells were fixed

in 4% paraformaldehyde. Staining with oil red O (M312512, Fisher), Alizarin red

(Sigma) and Alcian blue (Sigma) was performed to highlight, respectively, the

presence of adipocytes, the mineralized matrix produced by osteoblasts, and

glycosaminoglycans produced by chondrocytes.

Transplantation of the pre-vascularized bone grafts into the ulnar defects

Eight weeks after implanting the chambers into the inguinal site, a second surgery was

performed. The rabbits were placed under general anesthesia and prepared for

surgery as previously described. The chambers containing the pre-fabricated synthetic

bone grafts were exposed by smooth dissection. The chambers were removed after

verifying that the permeability of the pedicles was being maintained, and placement of

the vascular ligatures. The vascular permeability was assessed by clamping and

sectioning the distal end of the pedicle, and after unclamping by observation of the

bleeding of the pedicle. As shown in Figure 3, the vascularized synthetic grafts were

gently removed from the PLA breakable chambers and stored in a sterile gauze

moistened with physiological saline for transplantation into the ulna defect. The second

92
construct resected from each rabbit was put in 10% formalin fixative for further analysis

by micro CT and histology.

In the second surgery, the osseous site was prepared to create a critical size

segmental defect at the mid-diaphysis level of the left ulna. One critical-sized defect

site per rabbit was created. The surgical approach was performed caudo-laterally with

respect to the ulna in its middle third, so as to retain the stabilizing function of the

interosseous ligament, thus avoiding the use of a fixation device. As illustrated in

Figure 3, a bone defect measuring 15 mm length was created by medio-diaphyseal

osteotomy using a wireless battery oscillating saw (Acculan 3Ti, Aesculap, Germany).

A physiological saline rinse was performed to remove bone debris. To avoid bone

regeneration of the defect created from the periosteum of the radius, a bi-layer

membrane of polylactic glycolic acid (PLGA, Tisseos®, Biomedical Tissues, Nantes,

France) [34] was interposed between the radius and the BCP granules or the pre-

vascularized synthetic graft. The segmental bone defect was either left empty, filled

with BCP granules moistened with saline, or a vascularized synthetic graft produced

in a subcutaneous site of the same rabbit (BCP + Pedicle or BCP + SVF + pedicle).

The surgical wound was closed in layers using resorbable sutures. As before, the

operated animals were monitored daily to check their locomotion and proper cutaneous

healing of the surgical site. After 8 weeks of implantation, the animals were euthanized

as previously described. The ulna was dissected and immediately fixed in buffered

10% formalin solution and stored at 4°C for micro CT and histology analysis.

Injection of the radio-opaque vascular compound into rabbits

After 8 weeks of subcutaneous implantation, 9 rabbits were sacrificed in order to study

vascularization inside the chambers containing either the BCP, BCP + Pedicle or BCP

93
+ SVF + Pedicle. The animals were placed under general anesthesia as previously

described and received a dose of heparin (50 IU/kg, Heparin Choay® 25000 IU/5 mL,

Sanofi-Aventis) to reduce blood coagulation. The animals were immediately

euthanized by intravenous injection of pentobarbital (1 ml / kg, Dolethal, Vetoquinol).

After euthanasia, a medial skin incision in the abdominal region was performed. The

dissection was performed to expose the abdominal aorta, which was clamped and

ligated proximally with a resorbable suture (Vycril® 3-0 coil, Ethicon, Johnson &

Johnson, France). The aorta was catheterized with a silicone tube of similar diameter

to inject a polymerizable silicone-based vascular contrast product containing lead

(Microfil®, MV-122, Flow Tech Inc., Carver, MA, USA). The silicon tube was pre-filled

with heparinized saline in order to avoid air bubbles, using a peristaltic pump

(MasterflexTM, France). The radio-opaque solution (containing a yellow dye) was

prepared according to the manufacturer’s instructions. It consisted of 45% vol. MV-

122, 50% vol. of the diluent solution and 5% vol. of the curing agent. The vascular

contrast agent was perfused into the carotid artery using a peristaltic pump at a flow

rate of 20 ml/min, corresponding to a physiological pressure of 100–120 mm Hg.

Complete filling of the arteries and capillaries was assessed when the blood vessels

appeared yellow. The vascular contrast agent was left to polymerize at room

temperature for 30 min. The chambers were then dissected and immediately fixed in

buffered 10% formalin solution and stored at 4°C for micro CT and histology analysis.

Micro-computed tomography

Samples which were perfused with the contrast agent to demonstrate vasculature were

characterized by high-resolution X-ray micro-tomography (Skyscan uCT 1076,

Kontich, Belgium) before and after decalcification. The acquisition was carried out at

94
50 kV over 180 ° with axial sections measuring 0.7 mm, giving a resolution of 18 μm /

pixel. 3D reconstruction of the images was carried out using NRecon, Dataviewer,

CTvox and CTan (Bruker, Skyscan) software. Given this spatial resolution, large vessel

diameters as well as fine vasculature down to 50 μm can be observed and measured.

The filling of the chambers with BCP was measured and expressed as material

volume. The vascular volume was determined using the bone volume / total volume

parameter (BV/TV) after decalcification of the samples.

Histology and immunohistochemistry

After fixation, the samples were decalcified in 4.13% ethylenediamine tetra acetic acid

(EDTA)/0.2% paraformaldehyde in phosphate-buffered saline, pH 7.4 for 96 hours at

50°C using automated microwave decalcifying apparatus (KOS Histostation; Milestone

Medical, Kalamazoo, Michigan, USA). The samples were then dehydrated in

ascending series of ethanol baths (80, 95 and 100%) and finally in butanol for

30 minutes in an automated dehydration station (Microm Microtech, Lyon, France).

The samples were then impregnated with liquid paraffin at 56°C (Histowax; Histolab,

Gottenburg, Sweden) and embedded at −16°C. Blocks were cut using a standard

microtome (Leica RM2255; Leica Biosystems, Nanterre, France). Thin histology

sections (3 to 5 μm thick) were made radially for subcutis implants and longitudinally

for ulnar defects. Sections were stained using the Masson trichrome technique in an

automated coloration station (Microm Microtech). This staining combines hematoxylin

for cell nuclei (blue/black), fuchsine for cytoplasm, muscle and erythrocytes (red), and

a light green solution for collagen (green). The stained slices were scanned

(NanoZoomer; Hamamatsu, Photonics, Hamamatsu City, Shizuoka Prefecture, Japan)

and observed with the virtual microscope (NDP view; Hamamatsu). The number of

95
blood vessels per field (objective x10) was determined on histological sections stained

with Masson Trichrome. The number of blood vessels was counted using image

analysis software (ImageJ, National Institute of Health, USA).

Vascularization in the subcutis chambers was also identified with the anti-CD31

antibody which labels endothelial cells. Briefly, heat-mediated antigen retrieval was

performed for 20 hours with Tris-EDTA (pH 9) at 60°C on deparaffinized sections.

Quenching of endogenous peroxidase activity was mediated by 3% hydrogen peroxide

incubation. Nonspecific binding sites were blocked with 5% goat serum, 1% bovine

serum albumin (BSA) in Tris Buffered Saline 1X pH=7.4 Tween 0.05% (T.B.S., ScyTek

Laboratories, Utah, USA). All washing steps were conducted using T.B.S. 1X pH=7.4

Tween 0.05%. Mouse monoclonal antibody to CD31/PECAM-1 (SPM122, M01513,

Bosterbio) at a dilution of 1:25 was used, followed by incubation with a secondary goat

anti-mouse antibody at a dilution of 1:100 (E0433, Dako, Denmark). The target antigen

signal was amplified using streptavidin peroxidase (P0397, Dako, Denmark), revealed

by diaminobenzidine (DAB). All sections were dehydrated and counterstained using

Gill’s hematoxylin and mounted using Pertex mounting medium. Sections were

scanned (NanoZoomer; Hamamatsu, Photonics, Hamamatsu City, Shizuoka, Japan)

and observed using a virtual microscope (NDP view; Hamamatsu). Blood vessels were

counted using ImageJ and presented as the number of blood vessel/mm2.

Statistics

The data were expressed as an average  standard error of the mean. Analysis of the

results of in vivo experiments was performed using the GraphPad Prism 6.0 software

with a one-way ANOVA test. Tukey’s multiple comparisons tests was conducted to

96
assess statistical differences between the distinct groups. The significance threshold

was set at p ≤ 0.05.

Results

Preparation of SVF and multipotency of ATSCs

Approximately 5 g (mean=5.8 ± 1.4 g ; n=6) of adipose tissue was harvested and the

stromal vascular fraction (SVF) was prepared extemporaneously within 1 hour by

mechanical disruption, enzyme digestion and centrifugation. The average number of

nucleated cells in the prepared SVF was 3.57 10 5 ± 1.24 105 cells/ml ; n=6) after re-

suspension in PBS and 1.5ml cell suspension was mixed with BCP granules. The

cellular consituents of SVF from rabbits has been previously well characterized [35].

SVF was cultured in vitro and the constituent plastic adherent cells exhibited the tri-

lineage characteristics of MSCs (supplementary Figure 1). Briefly, in adipogenic

differentiation conditions, lipid droplets were observed after staining with Red Oil. After

osteogenic induction, the cells produced a mineralized collagen matrix, highlighted by

Alizarin red staining. Cell pellets, cultured in the presence of chondrogenic

differentiation factors, showed the production of an extracellular matrix rich in

glycosaminoglycans, as demonstrated by Alcian blue staining.

Characterizing the content of the subcutis implanted chambers

All rabbits survived the surgery without complications. After 8 weeks of subcutaneous

implantation, all implants appeared well-integrated into the surrounding subcutis

tissue, with no evidence of either rejection or necrosis. Vascular patency of the artery

and vein passing through the chamber was observed for all pedicle implants (Figure

3a). The contents of the vascularized pedicle chambers exhibited a cylindrical shape

with a good cohesion between the BCP granules due to abundant fibrosis (Figure 3b).

97
In contrast, the BCP granules implanted without a pedicle appeared loose after

opening the chambers (Supplementary Figure 2).

Figure 3 : Photographs of the surgery steps showing (a) the harvesting of the
implantable chamber with the vascular pedicle passing through after subcutis
implantation for 8 weeks; (b) the content of the chamber; note the cohesion of the BCP
granules due to abundant collagen matrix; (c) the creation of a mid-diaphyseal
segmental defect measuring 15 mm in the ulna; (d) the transplantation of the content
of the chamber into the ulnar defect with a surrounding PLGA membrane to isolate the
radius.

98
Micro-tomography showed that the BCP biomaterial granules had a cylindrical shape

formed by the 3D printed PLGA chamber (Figure 4a-c). As shown in Figure 4g, the

three groups had very comparable dimensions and biomaterial filling percentages.

After injecting the contrast agent and decalcifying the explants, it was possible to

observe the vascular pedicle and new vasculature following 3D reconstruction of the

μCT images. As shown in Figure 4d, the vascularization was negligible inside the

chambers containing the BCP granules without a pedicle and was mainly located in

the surrounding fibrous tissue capsule that had formed around the implantable

chambers. Conversely, abundant vasculature with many small blood vessels was

observed inside chambers containing BCP granules with a vascular pedicle (Figure

4e-f). Both the BCP + Pedicle and BCP + SVF + Pedicle groups exhibited abundant

blood vessel branches that had grown from the main artery (see supplementary video).

Quantification of the micro-CT vascular volume data demonstrated significantly higher

vascular volume in the BCP + Pedicle group (2.33 ± 0.67, n=5) compared to the control

BCP group without a pedicle (0.45 ± 0.19, n=3) (Figure 4h).

99
Figure 4 : 3D micro-CT reconstructions of the contents of 3D-printed PLGA chambers
after subcutis implantation into inguinal sites in rabbits for 8 weeks. (a, b,c) before
decalcification; (d,e,f) after injection of the vascular contrast agent and decalcification;
(a,d) BCP granules; (b,e) BCP + vascular pedicle passing through the chamber; (c,f)
BCP + SVF + Pedicle (scale bar: 1 mm; see supplementary figures with video showing
the vascularization); (g) percentage of material volume in the chambers; (h)
percentage of vascular volume in the chambers after decalcification (mean ± SEM, *
indicates significant difference between groups).

Histological Masson Trichrome images showed that the BCP granules were

encapsulated in a dense collagen matrix for all three implant groups (Figure 5a). The

pediculated implants appeared to be richer in collagen, with stronger fiber

condensation, compared with the control BCP without a pedicle, however, bone tissue

was not observed in any of the three implant groups. At higher magnification, giant

100
nucleated cells were present in contact with the BCP biomaterial, and were more

prevalent in the BCP group without a pedicle. The vascular pedicles were clearly visible

on the histological sections of the BCP + Pedicle and BCP + SVF + Pedicle groups. In

the latter, higher neovascularization with many blood vessels sprouting from the main

vasculature was observed in comparison to the other groups. This observation was

confirmed by the quantification of blood vessels in each group (Figure 5b), whereby

significantly higher vascularization was found in the BCP + SVF + Pedicle group (122.5

± 20.07, n=4) compared to the control BCP group (16.75 ± 9.29, n=4) without a pedicle.

While the number of blood vessels was also higher in the BCP + Pedicle group (55.00

± 10.95, n=5) compared to the control BCP group, this did not reach statistical

significance.

101
Figure 5 : (a) Histology of the content of chambers after subcutis implantation into
inguinal sites in rabbits for 8 weeks (Masson’s Trichrome staining; low magnification
images top row, scale bars: 2.5 mm; scale bars of second row: 250 µm; high
magnification images in rows 3 and 4 scale bars: 25 µm; P: vascular pedicle, *: BCP
granules; black arrows: blood vessels; open arrows: multinucleated giant cells). (b)
Number of blood vessels per field as a function of groups (mean ± SEM; * indicates
statistical differences).

The above results were corroborated by CD31 immunohistochemistry staining of

endothelial cells shown in Figure 6. It is clear that the central vasculature helped to

develop new vascularization, with sprouting of many capillaries visible, while a limited

number of blood vessels were observed in the control BCP group without a pedicle.

As shown in Figure 6b, the number of blood vessels was greater for pedicle groups

(24.20 ± 3.63, n=6, and 26.9 ± 3.44, n=5, for the BCP + Pedicle and BCP + SVF +

Pedicle respectively), compared to the BPC alone group (20.06 ± 3.94, n=3) although

the differences did not reach statistical significance. Taken together, these results

revealed the creation of a vascularized construct through inclusion of a pedicle and,

furthermore, that adding autologous SVF, stimulated angiogenesis.

102
Figure 6 : (a) Immunohistochemistry of CD31 endothelial cells showing vascularization
in the chambers after subcutis implantation into inguinal sites in rabbits for 8 weeks
(CD31 immunohistochemistry hematoxillin staining; low magnification images top row,
scale bars: 1 mm; scale bars of second row: 100 µm; scale bars of third row: 50 µm;
scale bars of fourth row: 25 µm; P: vascular pedicle, *: BCP granules; black arrows:
blood vessels). (b) Number of blood vessels per mm2 as a function of groups (mean ±
SEM; * indicates statistical differences).

Transplantation of pre-vascularized synthetic grafts enhanced bone healing in

ulna defects in rabbits

As shown in Figure 3, a segmental critical-sized defect was created at the mid-

diaphyseal level of the ulna. After 8 weeks in subcutis sites, the pre-vascularized

constructs were transplanted into this defect and isolated from the radius using a PLGA

membrane. Eight weeks after transplantation, the ulnas were characterized by micro-

computed tomography and histology. As shown in Figure 7, the ulna defect that was

left empty exhibited limited bone healing, proving that a critical-sized defect was

created. The ulna defects filled with BCP granules had lower radio-opacity than those

filled with the pre-vascularized grafts. BV/TV measurements revealed higher bone

103
content in the pre-vascularized grafts, BCP + Pedicle (34.53 ± 4.00, n=6) and BCP +

SVF + Pedicle grafts (37.65 ± 1.72, n=6) compared with the BCP group (23.73 ± 3.59,

n=4) and empty defects (4.82 ± 1.49, n=3).

Figure 7 : (a) Micro-CT radiographs and (b) 3D reconstructions of ulnar defects in


rabbits after 8 weeks of healing for the empty defect, defect filled with BCP granules,
defect filled with the transplanted content of the chamber containing the BCP granules
with vascular pedicle or BCP supplemented with SVF and vascular pedicle (scale bars:
10 mm); (c) Percentage of bone volume / total volume in the different groups (mean ±
SEM, * indicates significant difference).

104
As illustrated in Figure 8, histological examination corroborated the micro-computed

tomography results. The empty defects were filled with fibrous vascularized tissue.

Ulna defects filled with BCP granules showed limited bone healing from the edges.

Bone formation was observed within the defects that received the transplanted pre-

vascularized synthetic constructs, however some tissue necrosis was also observed.

In both pre-vascularized constructs, new bone tissue was found in contact with the

BCP biomaterials as evidenced in Figure 8.

Figure 8 : Histology of the ulnar defects in rabbits after 8 weeks of healing for the
empty defect, defect filled with BCP granules, defect filled with the transplanted content
of the chamber containing the BCP granules with vascular pedicle or BCP
supplemented with SVF and vascular pedicle (Masson’s Trichrome staining; low
magnification images scale bars, upper: 1 mm, dashed lines show margins of the mid-
diaphyseal defect of 15 mm; high magnification images scale bars: 250 µm; B: bone,
*: BCP granules).

105
Discussion

Bone is a highly vascularized tissue with bone cells residing within a 100-200 μm

proximity to a blood vessel or capillary in order to ensure adequate supply of vital

oxygen and nutrients. For this reason, when a biomaterial construct is not vascularized

at the time of implantation, ischemia occurs and high cell mortality is observed at the

site. In the current study, implants were constructed by filling 3D-printed implantable

chambers with BCP granules, a ceramic with proven bone-forming capabilities in pre-

clinical and clinical trials [6,30]. The chamber held the granules in place, giving the

construct a compact shape, while also making it easy to position the vascular pedicle.

This pre-clinical study in rabbits demonstrates the feasibility of producing vascularized

synthetic grafts in inguinal subcutaneous sites, and their capacity for bone healing after

transplantation into a critical-sized bone defect.

There have been considerable advances in regenerative approaches aimed at

overcoming the limitations of autologous bone grafting, however lack of adequate

vascularization of synthetic grafts remains a major obstacle for reconstructing large

bone defects. In the current study, we created a vascularized construct in situ by using

an isolated pedicle composed of a peripheral artery and an adjacent vein, which were

easily isolated from the surrounding tissues and passed through the implantable

chamber. This achieved extensive neo vascularization with blood vessels sprouting

from the central vasculature following subcutaneous implantation compared to the

BCP group without a pedicle, as observed by both micro-CT and histology. This finding

is in agreement with previous studies demonstrating the enhancement of

neovascularization by using a vascular pedicle in unison with synthetic biomaterials

[36]. Furthermore, this technique has advantages over previous in situ vascularized

biomaterial constructs made using AV loops as it overcame the laborious stage of

106
microsurgical anastomosis [37]. The delivery of SVF to the pedicle construct, increased

the number of blood vessels as demonstrated by histology, while showing no increased

vascular volume as evaluated by the micro-CT. This could be explained by the different

resolutions of the two measuring techniques: while micro-CT measures vessels as

small as 50 µm, histology can detect vessels as small as 3 µm in diameter. High

resolution CT, such as nano-CT and synchrotron CT equipment, could improve this

resolution but still require the infusion of a vascular contrast agent. Increased number

of new blood vessels by delivery of SVF is in agreement with previous studies [38].

While pre-vascularized constructs were successfully achieved by using our approach,

there was an absence of bone formation in the subcutis constructs following

implantation for 8 weeks. This is in contrast to a recent study which observed bone

formation using SVF in a similar vascular pedicle approach [1], with differences

possibly caused by the much lower cell number used in the current study. However,

the bone induction observed by Epple et al was likely due to another aspect of their

construct since the SVF showed no increase in bone formation compared to other

groups without SVF, or could be due to the longer implantation time of 12 weeks in

contrast to the 8 week period employed here. We have previously observed that

cultured expanded MSCs derived from adipose tissue significantly enhanced

neovascularization in vivo but failed to induce de novo bone in subcutis sites [39], in

agreement with our present results. A comparable study encompassing a vascular

pedicle, albeit just the vein, passing centrally through a 3D printed calcium phosphate

scaffold has recently been reported [40]. Autologous bone marrow was placed in

unison with the biomaterial around the femoral vein of rats in subcutaneous site for 8

weeks. Contrary to our study, newly formed bone tissue was observed in the explants

loaded with bone marrow aspirates [40]. Together, this suggests the superiority of

107
employing bone marrow rather than SVF, whilst still permitting delivery in a single

surgery. While promising, these studies have not assessed the potential of bone

regeneration of critical size bone defects by transplantation of the pre-vascularized

constructs. The current study represents the first evaluation of this type of in situ

vascularized construct in a bone defect. Autologous transplantation of this vascularized

synthetic graft into a rabbit ulna bone defect was possible without tissue morbidity and

furthermore, after 8 weeks, micro-tomographic and histological examination showed

good bone integration of the synthetic pre-vascularized graft and bone defect healing.

Some limitations of the current study include firstly, that since the granules of the BCP

group fell apart upon opening of the chambers, in contrast to the pedicle groups where

firm constructs in the shape of the chambers were formed, this dictated that fresh BCP

granules were used for the BCP control group in the bone defect surgery rather than

those that had been implanted subcutaneously 8 weeks prior, as was the case for the

two pedicle groups. It must also be noted that while our prevascularized construct

approach circumvents issues of autologous bone graft harvesting and tissue

availability, it required two surgeries and an 8 week preparation time for

prevascularization, which is incompatible with severe and urgent trauma. Furthermore,

the creation of the ulna defects was not standardized, which may have contributed to

some non-unions at the extremity of the defects (Figure 7a) which may be overcome

by the use of surgical guides customized to the skeletal anatomy. In addition, the

prevascularized construct was transplanted into the ulna defect without anastomosis

to the local vasculature. The limited size of the rabbit model and the availability of a

suitable local vasculature to connect the transplant prevented us from performing

anastomoses. This may be responsible for the small quantity of necrosis observed

within these constructs after transplantation into the bone defects, nevertheless, new

108
bone tissue was formed and significant defect healing was observed. Finally, we did

not conduct mechanical testing of the bone constructs which would have evaluated the

functional strength of the implants and given a more precise view of the integrity of the

bone tissue that was formed. While calcium phosphate biomaterials, such as the BCP

used in the current study, have proven osteoconductive properties, they have very low

mechanical properties in comparison with those of native bone tissue and it will thus

undoubtedly be necessary to provide them with mechanical reinforcement through the

addition of polymers or by adequate bone formation of high quality subcutaneously

prior to transplantation. An anatomically shaped, mechanically suitable, vascularized

construct has the potential to ensure effective bone healing of large bone defects.

Conclusion

This study has demonstrated the feasibility of in situ fabrication of vascularized

synthetic grafts in an ectopic site using a vascular pedicle passing through the

biomaterial. After inguinal subcutaneous implantation, all the pedicle implants

exhibited excellent vascular permeability, and sprouting of a vascular network. The

addition of SVF further stimulated angiogenesis. The transplantation of the pre-

vascularized synthetic bone grafts into critical-sized ulnar defects led to significantly

higher bone regeneration compared to the transplantation of the BCP biomaterial

without a pedicle. This surgical technique was simple, fast and reproducible, and offers

the possibility to preserve bone stock and overcome the limitations of autologous

grafting.

109
Acknowledgments

This work was financially supported by a grant from the European Commission:

ORTHOUNION (#773288). The patients’ association ‘Ligue Française contre les

neurofibromatoses’ is greatly acknowledged for supporting the PhD thesis of Luciano

Vidal. Meadhbh Brennan is supported by the Marie Skłodowska Curie Individual

Fellowship PARAGEN H2020-MSCA-IF-2015-708711. We appreciate the technical

assistance of Clémence, Thébaud, and Jérôme Amiaud for preparation of the SVF and

for histology, respectively. We also acknowledge the staff of the CRIP platform at the

Veterinary school for the care, anesthesia and post-operative treatment of the animals.

Data availability

The raw/processed data required to reproduce these findings can be accessed by

contacting the authors directly.

110
References

[1] C. Epple, A. Haumer, T. Ismail, A. Lunger, A. Scherberich, D.J. Schaefer, I.

Martin, Prefabrication of a large pedicled bone graft by engineering the germ for de

novo vascularization and osteoinduction, Biomaterials. 192 (2019) 118–127.

doi:10.1016/[Link].2018.11.008.

[2] G. Merlino, M. Borsetti, M. Boltri, Reverse radial artery bone flap reconstruction

of segmental metacarpal losses, J Hand Surg Eur Vol. 32 (2007) 98–101.

doi:10.1016/[Link].2006.08.015.

[3] J.B. Moore, J.M. Mazur, D. Zehr, P.K. Davis, E.G. Zook, A biomechanical

comparison of vascularized and conventional autogenous bone grafts, Plast. Reconstr.

Surg. 73 (1984) 382–386.

[4] J.E. Lipa, C.B. Novak, P.A. Binhammer, Patient-reported donor-site morbidity

following anterolateral thigh free flaps, J Reconstr Microsurg. 21 (2005) 365–370.

doi:10.1055/s-2005-915203.

[5] M.Á. Brennan, A. Renaud, J. Amiaud, M.T. Rojewski, H. Schrezenmeier, D.

Heymann, V. Trichet, P. Layrolle, Pre-clinical studies of bone regeneration with human

bone marrow stromal cells and biphasic calcium phosphate, Stem Cell Res Ther. 5

(2014). doi:10.1186/scrt504.

[6] A.-L. Gamblin, M.A. Brennan, A. Renaud, H. Yagita, F. Lézot, D. Heymann, V.

Trichet, P. Layrolle, Bone tissue formation with human mesenchymal stem cells and

biphasic calcium phosphate ceramics: the local implication of osteoclasts and

macrophages, Biomaterials. 35 (2014) 9660–9667.

doi:10.1016/[Link].2014.08.018.

111
[7] M.H. Mankani, S.A. Kuznetsov, P.G. Robey, Formation of hematopoietic

territories and bone by transplanted human bone marrow stromal cells requires a

critical cell density, Exp. Hematol. 35 (2007) 995–1004.

[8] M.H. Mankani, S.A. Kuznetsov, R.M. Wolfe, G.W. Marshall, P.G. Robey, In vivo

bone formation by human bone marrow stromal cells: reconstruction of the mouse

calvarium and mandible, Stem Cells. 24 (2006) 2140–2149.

doi:10.1634/stemcells.2005-0567.

[9] M.A. Brennan, J.-M. Davaine, P. Layrolle, Pre-vascularization of bone tissue-

engineered constructs, Stem Cell Res Ther. 4 (2013) 96. doi:10.1186/scrt307.

[10] J. Marler, J. Upton, R. Langer, J. Vacanti, Transplantation of cells in matrices

for tissue regeneration, Adv. Drug Deliv. Rev. 33 (1998) 165–182.

[11] N.B. Thébaud, R. Siadous, R. Bareille, M. Remy, R. Daculsi, J. Amédée, L.

Bordenave, Whatever their differentiation status, human progenitor derived - or mature

- endothelial cells induce osteoblastic differentiation of bone marrow stromal cells, J

Tissue Eng Regen Med. 6 (2012) e51-60. doi:10.1002/term.1539.

[12] M. Maisani, D. Pezzoli, O. Chassande, D. Mantovani, Cellularizing hydrogel-

based scaffolds to repair bone tissue: How to create a physiologically relevant micro-

environment?, J Tissue Eng. 8 (2017). doi:10.1177/2041731417712073.

[13] X. Liu, W. Chen, C. Zhang, W. Thein-Han, K. Hu, M.A. Reynolds, C. Bao, P.

Wang, L. Zhao, H.H.K. Xu, Co-Seeding Human Endothelial Cells with Human-Induced

Pluripotent Stem Cell-Derived Mesenchymal Stem Cells on Calcium Phosphate

Scaffold Enhances Osteogenesis and Vascularization in Rats, Tissue Eng Part A. 23

(2017) 546–555. doi:10.1089/[Link].2016.0485.

112
[14] S.V. Murphy, A. Atala, 3D bioprinting of tissues and organs, Nat. Biotechnol. 32

(2014) 773–785. doi:10.1038/nbt.2958.

[15] D.B. Kolesky, K.A. Homan, M.A. Skylar-Scott, J.A. Lewis, Three-dimensional

bioprinting of thick vascularized tissues, Proc Natl Acad Sci U S A. 113 (2016) 3179–

3184. doi:10.1073/pnas.1521342113.

[16] H.-W. Kang, S.J. Lee, I.K. Ko, C. Kengla, J.J. Yoo, A. Atala, A 3D bioprinting

system to produce human-scale tissue constructs with structural integrity, Nat.

Biotechnol. 34 (2016) 312–319. doi:10.1038/nbt.3413.

[17] R.K. Khouri, B. Koudsi, H. Reddi, Tissue transformation into bone in vivo. A

potential practical application, JAMA. 266 (1991) 1953–1955.

[18] A. Kaempfen, A. Todorov, S. Güven, R.D. Largo, C. Jaquiéry, A. Scherberich,

I. Martin, D.J. Schaefer, Engraftment of Prevascularized, Tissue Engineered

Constructs in a Novel Rabbit Segmental Bone Defect Model, Int J Mol Sci. 16 (2015)

12616–12630. doi:10.3390/ijms160612616.

[19] P.H. Warnke, J. Wiltfang, I. Springer, Y. Acil, H. Bolte, M. Kosmahl, P.A.J.

Russo, E. Sherry, U. Lützen, S. Wolfart, H. Terheyden, Man as living bioreactor: fate

of an exogenously prepared customized tissue-engineered mandible, Biomaterials. 27

(2006) 3163–3167. doi:10.1016/[Link].2006.01.050.

[20] J.P. Beier, R.E. Horch, A. Arkudas, E. Polykandriotis, O. Bleiziffer, E. Adamek,

A. Hess, U. Kneser, De novo generation of axially vascularized tissue in a large animal

model, Microsurgery. 29 (2009) 42–51. doi:10.1002/micr.20564.

113
[21] Q. Dong, C. Lin, H. Shang, W. Wu, F. Chen, X. Ji, Y. Liu, J. Zhang, T. Mao,

Modified approach to construct a vascularized coral bone in rabbit using an

arteriovenous loop, J Reconstr Microsurg. 26 (2010) 95–102. doi:10.1055/s-0029-

1243293.

[22] A.M. Boos, J.S. Loew, A. Weigand, G. Deschler, D. Klumpp, A. Arkudas, O.

Bleiziffer, H. Gulle, U. Kneser, R.E. Horch, J.P. Beier, Engineering axially vascularized

bone in the sheep arteriovenous‐loop model, Journal of Tissue Engineering and

Regenerative Medicine. 7 (2013) 654–664. doi:10.1002/term.1457.

[23] A. Arkudas, A. Lipp, G. Buehrer, I. Arnold, D. Dafinova, A. Brandl, J.P. Beier, C.

Körner, S. Lyer, C. Alexiou, U. Kneser, R.E. Horch, Pedicled Transplantation of Axially

Vascularized Bone Constructs in a Critical Size Femoral Defect, Tissue Eng Part A. 24

(2018) 479–492. doi:10.1089/[Link].2017.0110.

[24] E. Polykandriotis, A. Arkudas, R.E. Horch, M. Stürzl, U. Kneser, Autonomously

vascularized cellular constructs in tissue engineering: opening a new perspective for

biomedical science, Journal of Cellular and Molecular Medicine. 11 (2007) 6–20.

doi:10.1111/j.1582-4934.2007.00012.x.

[25] H. Kokemueller, S. Spalthoff, M. Nolff, F. Tavassol, H. Essig, C. Stuehmer, K.-

H. Bormann, M. Rücker, N.-C. Gellrich, Prefabrication of vascularized bioartificial bone

grafts in vivo for segmental mandibular reconstruction: experimental pilot study in

sheep and first clinical application, International Journal of Oral and Maxillofacial

Surgery. 39 (2010) 379–387. doi:10.1016/[Link].2010.01.010.

114
[26] G.E. Holt, J.L. Halpern, C.C. Lynch, C.J. Devin, H.S. Schwartz, Imaging

Analysis of the In vivo Bioreactor: A Preliminary Study, Clin Orthop Relat Res. 466

(2008) 1890–1896. doi:10.1007/s11999-008-0295-3.

[27] D. Han, X. Guan, J. Wang, J. Wei, Q. Li, Rabbit Tibial Periosteum and

Saphenous Arteriovenous Vascular Bundle as an In Vivo Bioreactor to Construct

Vascularized Tissue-Engineered Bone: A Feasibility Study, Artificial Organs. 38 (2014)

167–174. doi:10.1111/aor.12124.

[28] X. Wu, Q. Wang, N. Kang, J. Wu, C. Gu, J. Bi, T. Lv, F. Xie, J. Hu, X. Liu, Y.

Cao, R. Xiao, The effects of different vascular carrier patterns on the angiogenesis and

osteogenesis of BMSC-TCP-based tissue-engineered bone in beagle dogs, J Tissue

Eng Regen Med. 11 (2017) 542–552. doi:10.1002/term.2076.

[29] C. Gjerde, K. Mustafa, S. Hellem, M. Rojewski, H. Gjengedal, M.A. Yassin, X.

Feng, S. Skaale, T. Berge, A. Rosen, X.-Q. Shi, A.B. Ahmed, B.T. Gjertsen, H.

Schrezenmeier, P. Layrolle, Cell therapy induced regeneration of severely atrophied

mandibular bone in a clinical trial, Stem Cell Res Ther. 9 (2018). doi:10.1186/s13287-

018-0951-9.

[30] E. Gómez-Barrena, P. Rosset, F. Gebhard, P. Hernigou, N. Baldini, H. Rouard,

L. Sensebé, R.M. Gonzalo-Daganzo, R. Giordano, N. Padilla-Eguiluz, E. García-Rey,

J. Cordero-Ampuero, J.C. Rubio-Suárez, J. Stanovici, C. Ehrnthaller, M. Huber-Lang,

C.H. Flouzat-Lachaniette, N. Chevallier, D.M. Donati, G. Ciapetti, S. Fleury, M.-N.

Fernandez, J.-R. Cabrera, C. Avendaño-Solá, T. Montemurro, C. Panaitescu, E.

Veronesi, M.T. Rojewski, R. Lotfi, M. Dominici, H. Schrezenmeier, P. Layrolle,

Feasibility and safety of treating non-unions in tibia, femur and humerus with

autologous, expanded, bone marrow-derived mesenchymal stromal cells associated

115
with biphasic calcium phosphate biomaterials in a multicentric, non-comparative trial,

Biomaterials. 196 (2019) 100–108. doi:10.1016/[Link].2018.03.033.

[31] P.A. Zuk, M. Zhu, H. Mizuno, J. Huang, J.W. Futrell, A.J. Katz, P. Benhaim, H.P.

Lorenz, M.H. Hedrick, Multilineage cells from human adipose tissue: implications for

cell-based therapies, Tissue Eng. 7 (2001) 211–228.

doi:10.1089/107632701300062859.

[32] M. Mazo, S. Hernández, J.J. Gavira, G. Abizanda, M. Araña, T. López-Martínez,

C. Moreno, J. Merino, A. Martino-Rodríguez, A. Uixeira, J.A. García de Jalón, J.

Pastrana, D. Martínez-Caro, F. Prósper, Treatment of reperfused ischemia with

adipose-derived stem cells in a preclinical Swine model of myocardial infarction, Cell

Transplant. 21 (2012) 2723–2733. doi:10.3727/096368912X638847.

[33] L. Casteilla, V. Planat-Bénard, B. Cousin, P. Laharrague, P. Bourin, Vascular

and endothelial regeneration, Curr Stem Cell Res Ther. 5 (2010) 141–144.

[34] A. Hoornaert, C. d’Arros, M.-F. Heymann, P. Layrolle, Biocompatibility,

resorption and biofunctionality of a new synthetic biodegradable membrane for guided

bone regeneration, Biomed Mater. 11 (2016) 045012. doi:10.1088/1748-

6041/11/4/045012.

[35] G. Desando, I. Bartolotti, L. Martini, G. Giavaresi, N. Nicoli Aldini, M. Fini, A.

Roffi, F. Perdisa, G. Filardo, E. Kon, B. Grigolo, Regenerative Features of Adipose

Tissue for Osteoarthritis Treatment in a Rabbit Model: Enzymatic Digestion Versus

Mechanical Disruption, Int J Mol Sci. 20 (2019). doi:10.3390/ijms20112636.

[36] P. Yang, X. Huang, J. Shen, C. Wang, X. Dang, H. Mankin, Z. Duan, K. Wang,

Development of a new pre-vascularized tissue-engineered construct using pre-

116
differentiated rADSCs, arteriovenous vascular bundle and porous nano-

hydroxyapatide-polyamide 66 scaffold, BMC Musculoskelet Disord. 14 (2013) 318.

doi:10.1186/1471-2474-14-318.

[37] J.P. Beier, R.E. Horch, A. Hess, A. Arkudas, J. Heinrich, J. Loew, H. Gulle, E.

Polykandriotis, O. Bleiziffer, U. Kneser, Axial vascularization of a large volume calcium

phosphate ceramic bone substitute in the sheep AV loop model, J Tissue Eng Regen

Med. 4 (2010) 216–223. doi:10.1002/term.229.

[38] E. Farré-Guasch, N. Bravenboer, M.N. Helder, E.A.J.M. Schulten, C.M. Ten

Bruggenkate, J. Klein-Nulend, Blood Vessel Formation and Bone Regeneration

Potential of the Stromal Vascular Fraction Seeded on a Calcium Phosphate Scaffold

in the Human Maxillary Sinus Floor Elevation Model, Materials (Basel). 11 (2018).

doi:10.3390/ma11010161.

[39] M.A. Brennan, A. Renaud, F. Guilloton, M. Mebarki, V. Trichet, L. Sensebé, F.

Deschaseaux, N. Chevallier, P. Layrolle, Inferior In Vivo Osteogenesis and Superior

Angiogeneis of Human Adipose Tissue: A Comparison with Bone Marrow‐Derived

Stromal Stem Cells Cultured in Xeno‐Free Conditions, Stem Cells Transl Med. 6

(2017) 2160–2172. doi:10.1002/sctm.17-0133.

[40] B. Charbonnier, A. Baradaran, D. Sato, O. Alghamdi, Z. Zhang, Y.-L. Zhang, U.

Gbureck, M. Gilardino, E. Harvey, N. Makhoul, J. Barralet, Material-Induced

Venosome-Supported Bone Tubes, Advanced Science. 0 (n.d.) 1900844.

doi:10.1002/advs.201900844.

117
Supplementary Figures

Supplementary Figure 1 : Characterization of MSC from SVF of rabbits. Tri-lineage

differentiation capacity of MSC without induction of differentiation and with osteogenic

(alizarin red staining), adipogenic (Red Oil staining), and chondrogenic (Alcian blue

staining) differentiation.

118
Supplementary Figure 2 : Photographs of the content of the chamber after subcutis

implantation for 8 weeks ; a) with the vascular pedicle passing through; note the

cohesion of the BCP granules due to abundant collagen matrix ; and b) without the

pedicle ; note the loose BCP granules.

119
CHAPTER III

Regeneration of segmental defects in metatarsus of sheep with

vascularized and customized 3D-printed calcium phosphate

scaffolds

Luciano Vidal 1, Carina Kampleitner 2,§, Stéphanie Krissian 3,§, Oskar Hoffmann 2,

Santiago Raymond 4,5,6, Yassine Maazouz 4,5,6, Maria-Pau Ginebra 4,5,7, Philippe

Rosset 1,3,8, Pierre Layrolle 1,*

1 Inserm, UMR 1238, PHY-OS, Bone sarcomas and remodelling of calcified tissues,
Faculty of Medicine, University of Nantes, Nantes, 44035, France
2 University of Vienna, Department of Pharmacology and Toxicology, Vienna, 1090,
Austria
3 Department of Trauma and Orthopaedic Surgery, University Hospital of Tours,
University of Tours, Tours, 37000, France
4 Universitat Politècnica de Catalunya, Department of Materials Science and
Metallurgical Engineering, Group of Biomaterials, Biomechanics and Tissue
Engineering, Barcelona, 08019, Spain
5 Universitat Politècnica de Catalunya, Barcelona Research Centre for Multiscale
Science and Engineering, Barcelona, 08019, Spain
6 Mimetis Biomaterials, Cerdanyola del Vallès, Barcelona, 08290, Spain
7 Institute for Bioengineering of Catalonia, Barcelona Institute of Science and
Technology, Barcelona, 08036, Spain
8 Platform CIRE, Surgery and Imaging for Research and Education, INRA, Nouzilly,
37380 France

§ These authors contributed equally to this work.

* Corresponding author: [Link]@[Link]

120
ABSTRACT

Although autografts are considered to be the gold standard for reconstruction of large

bone defects resulting from trauma or diseases, donor site morbidity and limited

availability restrict their use. Successful bone repair also depends on sufficient

vascularization. To address this challenge, novel strategies are being drafted to

develop vascularized biomaterial scaffolds. This pilot study aimed to investigate the

feasibility of regenerating large bone defects in sheep using 3D-printed customized

calcium phosphate scaffolds with or without surgical vascularization. Pre-operative

computed tomography scans were performed to visualize the metatarsus and

vasculature and to fabricate customized scaffolds and surgical guides by 3D printing.

Critical-sized segmental defects created in the mid-diaphyseal region of the

metatarsus were either left empty or treated with the 3D scaffold alone or in

combination with an axial vascular pedicle. Bone regeneration was evaluated 1, 2 and

3 months post-implantation. After 3 months, the untreated defect remained non-

bridged while the 3D scaffold guided bone regeneration. The presence of the vascular

pedicle further enhanced bone formation. Histology confirmed bone growth inside the

porous 3D scaffolds with or without vascular pedicle inclusion. Taken together, this

study demonstrated the feasibility of pre-surgical planning and reconstruction of large

bone defects with 3D-printed personalized scaffolds.

KEYWORDS

Bone regeneration, vascularization, 3D printing, customized scaffolds, calcium-

deficient hydroxyapatite, in vivo segmental defect, direct ink writing

121
INTRODUCTION

Bone is a dynamic tissue that possesses the intrinsic capacity to heal within 6-8 weeks

after immobilization of a fracture. However, there are some conditions in which bone

regeneration is delayed, compromised or beyond the physiological healing potential 1,2.

Notably, the successful repair of large bone defects caused by trauma, tumor resection

or disease remains a clinical challenge for orthopedic and plastic surgeons and often

requires additional treatments.

Autologous bone grafting is still considered as the gold standard due to its

osteoconductive, osteoinductive and osteogenic properties. This procedure demands

to harvest the patient`s own bone and subsequently transplant it into the defect site.

Bone can be taken from several areas e.g., iliac crest, fibula or ribs, depending on the

severity and amount needed for reconstruction of the defect. Nevertheless, the amount

of bone is limited and the procedure adds morbidity at the harvesting site. Therefore,

this surgical procedure is often associated with complications such as infection,

hematoma, postoperative pain, muscular and neural damage. Transplantation of

vascularized bone also requires extensive microsurgery to adapt to both the local

vasculature and skeleton3,4. Other procedures for large bone regeneration are the

Masquelet’s induced membrane, the Illizarov’s distraction or advanced therapies with

bone morphogenetic proteins or cultured expanded bone marrow mesenchymal stem

cells. These alternatives have however inherent disadvantages adding morbidity,

surgical procedures, costs and safety concerns5-10.

For several decades, researchers and clinicians have attempted to develop a safe and

potent alternative to autologous bone grafting for the regeneration of large bone

122
defects. Among them, synthetic calcium phosphate biomaterials that resemble the

inorganic phase of bone have proven to be biocompatible and osteoconductive. Most

commercially available calcium phosphate-based bone substitutes are composed of

either hydroxyapatite (HA), β-tricalcium phosphate (β-TCP), or a mixture of both,

termed as biphasic calcium phosphate (BCP). They are made at high sintering

temperatures and are generally used as granules or porous blocks. Although these

bioceramics share some compositional similarities with bone minerals, the

conventional processes employed to manufacture them limit the possibilities to tune

their pore architecture, often lacking interconnections and hindering their osteogenic

potential to support healing of large bone defects11-14.

One fabrication technique that allows controlling the external shape and internal

porosity is three-dimensional (3D) printing. Customized scaffolds and surgical guides

can be produced based on the patient`s anatomy from computed tomography (CT)

scans that are essential for surgical planning, precise resection and accurate bone

reconstruction. Recently, biomimetic calcium phosphate inks have been developed to

manufacture 3D scaffolds consisting of calcium-deficient hydroxyapatite (CDHA) using

a layer-by-layer deposition, also known as 3D-microextrusion. The advantages of this

3D printed biomaterial are the structural and compositional features that closely

resemble the mineral phase of bones as compared to conventional bioceramics, and

the ambient temperatures manufacturing process that offers the possibility to reinforce

the structure with polymers or incorporate drugs. Furthermore, 3D printing allows

accurate control of their interconnected porosity favoring body fluids permeability, cells

invasion, vascularization and bone ingrowth, making these 3D scaffolds promising

therapeutic alternatives to treat large bone defects15-18.

123
Another essential aspect of bone transplantation is vascularization. The development

of a vascular network is crucial for the exchange of nutrients, minerals and soluble

molecules which are important during the repair process and ensure the viability of the

bone graft. Lack of vascularization causes inner tissue necrosis and results in graft

failure, particularly in large bone defects. In this respect, the interconnected porosity of

the 3D scaffold facilitates the formation of new blood vessels throughout the entire

material. Recent studies have attempted to enhance vascularization by either pre-

vascularizing the construct before implantation or by adding angiogenic growth factors

like vascular endothelial growth factor (VEGF) or platelet-derived growth factor (PDGF)

during the grafting procedure. Although these approaches showed promising results,

novel strategies are required to further enable vascularization, in particular for large

bone defects19-22.

This work aims to investigate the feasibility of a one-step surgical skeletal

reconstruction and regeneration of large bone defects in a relevant pre-clinical animal

model. We hypothesize that the application of a 3D-printed CDHA scaffold with pre-

defined shape and interconnected porosity combined with a local and axial vascular

pedicle will result in bone regeneration and improvement of vascularization.

124
RESULTS

Pre-operative computed tomography (CT) for designing customized surgical

guides and 3D scaffolds

One month before surgery, a CT angioscan of the metatarsus of sheep was performed

to visualize the local vasculature and bone (Figure 1a). This 3D reconstruction shows

that 3 main blood vessels were present along the metatarsal bone while the lateral

plantar artery was selected for axial vasculature of the 3D scaffolds. As shown in Figure

1b, a customized surgical guide was designed to assist for the creation of a critical-

sized segmental diaphyseal defect (length: 35 mm) in the metatarsus of sheep, and

for drilling the holes for the osteosynthesis screws to fix the plate that stabilizes the

fracture. This pre-operative CT scan was also used for manufacturing a customized

3D scaffold with interconnected porosity that fitted the defect and a groove to

incorporate the axial vascular pedicle.

125
Figure 1 : Design of the surgical cutting guide for the creation of a segmental mid-
diaphyseal defect with 35 mm length and the customized 3D scaffold for filling this
defect. (a) Preoperative CT scans were taken one month before surgery and three-
dimensionally reconstructed. The image visualizes the metatarsal bone and the local
vasculature. (b) Schematic diagram demonstrating the operating principle of the
surgical guide and the filling of defect with a customized 3D scaffold with a groove for
axial vascularization.

Physicochemical characterization of the 3D-printed calcium phosphate

scaffolds

As shown in Figure 2, the 3D scaffolds were designed with interconnected porosity

and a groove to accommodate the axial vascular pedicle. The 3D scaffolds were then

printed by using a robocasting device with a syringe containing the calcium phosphate

paste coupled to a nozzle. A vascular plug with rounded edges was used for retaining

the axial vascular pedicle inside the 3D scaffold. The porosity had an orthogonal

rectilinear pattern with alternate crisscrossed layers rotated 90º relative to the previous

layer creating an interconnected pore network mesh. The microstructure of the 3D

126
scaffolds, as observed by SEM, consisted of an entangled network of nanosized

needle-like hydroxyapatite crystals.

Figure 2 : Photographs of the fabrication and structure of the 3D-printed customized


calcium phosphate scaffolds. (a-c) Design and printing of a calcium phosphate scaffold
by 3D-microextrusion. (d-i) Optical and scanning electron microscopy (SEM) images
of the 3D-printed scaffolds. Images were taken at different levels of magnification to
visualize the structure and surface of the material.

The physicochemical characteristics of the 3D scaffolds are reported in Table 1. After

setting, the 3D scaffolds were composed of 80.3% of CDHA, 18.7% of β-TCP and no

presence of its alpha polymorph (α-TCP). The main body presented an inter-strand

gap of 703.2 ± 23.9 µm and a filament width of 489.7 ± 9.7 µm in line with the 410 µm-

nozzle used for 3D printing, whereas the scaffolds printed with the 311 µm-nozzle-

setup presented an inter-filament separation of 529.4 ± 25.3 µm and a filament width

of 364.2 ± 11.9 µm. According to the mercury intrusion porosimetry (MIP) analysis, the

127
scaffold presented 81.03% of open porosity of which 59.52% correspond to pores with

entrance sizes larger than 10 µm (macro-pores) and the remaining 21.52%

corresponding to pores with entrance sizes smaller than 10 µm (micro/nano-pores).

The specific surface area of the 3D scaffolds was 22.1 m 2/g in agreement with their

microstructure. The uniaxial compression testing assays resulted in similar values for

both conditions: the scaffolds printed with the 410 µm-nozzle-setup and 311 µm-

nozzle-setup had an ultimate compressive strength of 2.10 ± 0.30 and 2.45 ± 0.53 MPa

respectively.

Table 1 : Physicochemical properties of the 3D scaffolds.

Animal welfare and surgical procedure

All sheep survived the operative intervention without any early or long-term post-

operative complications. Figure 3 demonstrates the surgical procedure using the pre-

designed customized surgical guide and the 3D printed scaffold. The application of the

guides supported the creation of a segmental critical-sized defect of 35 mm at the mid-

diaphyseal level of the metatarsal bone and directed the drilling for the osteosynthesis

plate. This controlled drilling allowed an accurate positioning during the perforation and

avoided damage to the surrounding soft tissues. Besides, they helped to maintain the

reproducibility in all the procedures. The lateral plantar artery (Arteria plantaris
128
lateralis) that was isolated and passed through the 3D-printed scaffold to improve

vascularization (3D scaffold + pedicle group) is shown Figure 3d. Figure 3e indicates

identical anatomical shapes of the customized 3D-printed calcium phosphate scaffolds

made by reverse engineering from CT scans compared to the bone resected at the

day of surgery. The final reconstruction with the axial vascular pedicle passing through

the anatomical 3D scaffold held by the fixation plate and screws is illustrated in Figure

3f.

Figure 3 : Photographs of the surgery steps showing (a) the metatarsal bone, (b) the
surgical guides used to create the bone defect, (c) the creation of a mid-diaphyseal
segmental defect measuring 35 mm in the metatarsal bone, (d) the vascular pedicle
used for the axial vascularization to the 3D-printed scaffold, (e) the customized shape
of the 3D-printed scaffold and (f) the final result with the osteosynthesis plate fixation.

129
In vivo evaluation of 3D-printed calcium phosphate scaffolds

To study the ability of the scaffold to regenerate a large bone defect, the bone repair

was examined by in vivo CT scans over a healing period of 3 months (day 0, 30, 60

and 90). As shown in Figure 4, some bone regeneration occurred from the edges of

the left empty defect on the side opposite to the osteosynthesis plate as early as D30.

It indicated the endogenous healing potential of the mid-diaphyseal defect created in

the metatarsus of sheep. In contrast, the defect filled with the 3D-printed scaffold and

the 3D-printed scaffold combined with the vascular pedicle showed enhanced bone

formation over the 3 months healing period. The scaffolds appeared well-integrated

into the defect and surrounded by newly formed bone tissue. The origin of the bone

regrowth was similar to that of the empty defect group and predominantly started from

the external lateral side, opposite to the osteosynthesis plate. To monitor and control

the durability of the vascular pedicle and vascular patency, angioscans were

conducted by injecting an iodine contrast agent during the CT scan at day 30, 60 and

90. The vascular patency of the vascularized 3D-printed scaffold group was maintained

during the 3 months of the study.

MicroCT scans calculations corroborated that the 3D scaffold before implantation had

a rectangular interconnected porosity with a material volume / total volume (MV/TV) of

34.4 % (n=1) giving a macroporosity of 65.6 % in good agreement with the

macroporosity of 59.5 % measured by MIP (Figure 5 and Table 1). Additionally, ex vivo

high-resolution micro-computed CT (microCT) was performed at the endpoint of the

study (day 90) (Figure 5). The left empty metatarsal defect had limited bone

regeneration with a BV/TV value of 8.7 % (n=1). On the opposite, the metatarsal

130
defects filled with the customized 3D scaffolds and a fortiori in combination with the

vascular pedicle showed a higher bone content with BV+MV/TV value of 48.2 % (n=1)

and 61.7 % (n=1), respectively.

Figure 4 : 3D bone reconstructions of metatarsal defects in sheep. CT scans are


shown post-surgery (D0) and at 30, 60 and 90 days (D30, D60, D90) of healing.
Treatment groups included the empty defect (control), defect filled with the 3D-printed
scaffold (Defect 3D) and defect treated with the 3D-printed scaffold and the axial
vascular pedicle (Defect 3D + P).

131
Figure 5 : (a) MicroCT 3D reconstructions of metatarsal defects in sheep 90 days post-
operation. Images are presented for the scaffold before implantation (3D Scaffold),
empty defect, defect filled with the 3D-printed scaffold (Defect 3D) and the defect filled
with the 3D-printed scaffold associated with a vascular pedicle (Defect 3D + P). (b)
Percentage of bone volume + material volume / total volume (BV+MV/TV) for the
different treatment groups. The percentage of BV+MV/TV was calculated in the area
of interest and compared to the microCT of the 3D scaffold taken before implantation.

132
As illustrated in Figure 6, the histological evaluation corroborated the CT and microCT

findings. The empty defect was mainly filled with fibrous tissue and demonstrated

limited bone tissue formation from the defect edges, whereas metatarsal bone defects

filled with a customized 3D-printed scaffold or the 3D-printed scaffold combined with

the axial vascular pedicle demonstrated bone ingrowth into the 3D structure of the

biomaterial. At higher magnification, bone tissue containing osteocytes was present in

contact with the 3D scaffold material. Osteocytes were more prevalent in the 3D-

printed scaffold in combination with a vascular pedicle indicating the formation of

mature bone tissue on this latter group.

Figure 6 : Representative undecalcified histological thin ground sections of critical-


sized metatarsal defects in sheep were prepared in longitudinal plane and stained with
Levai-Laczko dye 90 days post-surgery. Photomicrographs are presented at three
different magnifications. The black asterisk denotes the host bone (old bone) stained
in light purple, whereas the black arrow demonstrates newly formed bone tissue visible
in dark purple. The white asterisk highlights the 3D scaffold.

133
DISCUSSION

Bone is the second most transplanted tissue after blood transfusion. State of the art in

the reconstruction of large bone defect has shown that vascularization of the

transplanted bone graft is predominant for favorable clinical outcomes. Indeed, bone

cells are located near blood vessels to ensure access to oxygen and to receive the

necessary nutrients to regenerate tissues. It has been shown that with a sufficient

amount of vascularization these bone cells, can differentiate into osteocytes and thus

regenerate bone tissue23-25. However, the current transplantation of vascularized bone

requires extensive microsurgery to reconnect vasculature and to fit the anatomy of a

defect as well as adding morbidity at the harvesting site. Tissue engineering and in

particular customized 3D scaffolds is potentially a promising alternative to autologous

vascularized bone grafting for reconstruction of large skeletal defects26-29.

Nevertheless, vascularization of the tissue-engineered constructs has been reported

as a major limitation in bone regeneration30.

In our work, we present a solution to supply vascularization to the biomaterial scaffold

and to enhance bone regeneration in a clinically relevant animal model. Other

published works proposed different options for improving vascularization. One of the

strategies for improving the vascularization of tissue-engineered bone is the pre-

vascularization of the constructs. Numerous pre-clinical studies have demonstrated

that the combination of mesenchymal stem cells (MSCs) with biphasic calcium

phosphates biomaterials (BCP) can induce bone formation and facilitate the healing of

critical size defects31-34. Some clinical trials have demonstrated the feasibility of

amplifying autologous MSCs in culture from a bone marrow sample and associating

134
them with a BCP biomaterial to regenerate unconsolidated fractures or bone loss in

small defect volumes. However, these tissue engineering techniques do not allow the

regeneration of large bone defects yet because of the absence of a sufficient vascular

network to ensure cell survival and tissue healing35,36. In this context, several teams

have proposed the pre-vascularization of the bone filling material by implantation in an

ectopic site before transplanting it into the defect to be reconstructed. Proof of concept

has been demonstrated at the pre-clinical level by ectopic implantation in the ewe of a

chamber containing the BCP biomaterial and an arteriovenous fistula (vascular loop).

After 6 and 12 weeks of implantation, abundant microvasculature was observed in the

chamber contents37-42. Large defects at the mandibular level have been successfully

reconstructed in a few patients using this technique of transplanting a pre-vascularized

biomaterial from an intramuscular site43,44. In these studies, the pre-vascularization of

the biomaterial appears to dominate for cell survival and bone regeneration. Recently,

Charbonnier et al. published a new arteriovenous bundle technique study enclosing a

vascular pedicle, just the vein, passing centrally through a 3D printed calcium

phosphate scaffold45.

To our knowledge, our contribution is the first work in which, a pre-surgical angioscan

allowed to create a truly personalized biomaterial scaffold that has the same

anatomical shape as the defect to be reconstructed. Moreover with this pre-surgical

angioscan, we were able to study the vasculature in the defect area to be

reconstructed, allowing us to evaluate the possibility to isolate a pedicle composed of

a peripheral artery and an adjacent vein. This pedicle was dissected from the

surrounding tissues and passed through the implantable 3D printed scaffold to provide

with vascularization without adding laborious microsurgery.

135
This pre-clinical study in sheep demonstrates the feasibility of fabricating customized

3D scaffolds and surgical guides based on the patient`s CT scans that are essential

for surgical planning, precise resection and accurate reconstruction. It is important to

emphasize that in our work we proposed and we succeed to do a personalized large

bone defect reconstruction with a 3D printed scaffold associated with a local vascular

pedicle in a one-step surgery. Furthermore, 3D printing did not only allow to control the

shape of the 3D scaffolds for fitting the anatomy of defects but also permitted to design

and produce an interconnected porosity favorable for body fluid permeability,

vasculature and bone ingrowth.

Some limitations of the current study include firstly a little bone tissue regeneration in

the empty defect that has been previously described as a critical size bone defect 38.

We consider that this regenerated bone tissue was developed from the vascularized

membrane that is constituted around the metatarsal bone and in the subcutaneous

tissue. This membrane was not resected in this first study. In a following study, we

have resected this membrane and our empty defect did not regenerate any bone tissue

during the first 3 months (Supplementary figure). Secondly, the 3D scaffolds, even

though they supported bone ingrowth, had insufficient mechanical properties in

comparison with those of native bone tissue. It will be necessary to provide them a

better mechanical reinforcement through for example, the addition of polymers.

Further study in a larger population of animals is needed to assess the clinical efficacy

of this innovative approach.

To conclude, our approach that uses pre-operative medical imaging, 3D printing of

customized surgical guides and 3D scaffolds with a local and axial vascularization

136
constitutes a new and promising synthetic bone substitute option that mimics the

today’s most used autologous technique in the reconstruction of large bone defects,

the fibula flap.

METHODS

Ethical approval

Ethical approval for animal experimentation was obtained from the local ethics

committee (ref. number 9235; CEEA19, Val de Loire, France) and the French Ministry

of Superior Education, Research and Innovation on February 28, 2018, by following

the European Guidelines for Animal Care Directive 2010/63/EU.

Animals

The animal study was performed at the CIRE platform (agreement number: A371754;

INRA, Nouzilly, France) that is fully equipped with an operating theatre, housing and

medical imaging. The Ile de France sheep were supplied from the INRA breeder and

were housed in boxes at the experimental facility. The animals were fed with straw and

received water ad libitum. The animals were acclimated for a minimum of 2 weeks prior

to the first intervention.

137
Pre-operative computed tomography (CT)

One month before surgery, the sheep were placed under general anaesthesia by

intravenous injection of ketamine (20 mg/kg, Kétamidor®, Axience, France) and

xylazine (0.05 mg/kg, Rompun® 2%, Bayer, France). Animals were intubated and put

under gaseous relay with 3% isoflurane (Isoflurin®, Axience, France) carried by 100%

oxygen. The sheep was then placed in the right lateral decubitus position on the CT

scanner table (Dual-source 64-slice spiral Somatom®, Siemens, France) with the left

limb immobilized. Acquisition of the bone metatarsus on the left leg was performed at

300 mAs and 140 kV with a section of 0.6 mm generating 748 DICOM images in

approximately 15 s. To visualize the vasculature, 80 ml of iodine contrast agent (350

mg I/ml; Omnipaque™, GE Healthcare, France) was injected in the jugular vein via a

catheter (5 ml/s). Acquisitions were performed at 80, 120, 140 and 160 s post-injection

of the contrast agent. CT scans were reconstructed and analyzed by using the imaging

software [Link], (Siemens, France).

Design and fabrication of customized surgical guides using 3D printing

The customized surgical guide was designed to assist for the creation of a critical-sized

segmental diaphyseal defect (length: 35 mm) in the metatarsus of sheep, and for

drilling the holes for the osteosynthesis screws to fix the plate that stabilizes the

fracture. Its main objective was to hold precisely the surgical oscillating blade and the

drilling bur. To fabricate the surgical guide, DICOM images from the pre-operative CT

scans of the metatarsi and the titanium osteosynthesis plates (LCP 3.5, 7 holes, L98

mm, Johnson & Johnson Medical) were converted to 3D stereolithography (STL) files

138
using an open-source software (3D Slicer). Thereafter, the surgical guide was planned

in the CAD program (Cinema 4D, Maxon, Germany). A phantom of the 3D scaffold and

the metatarsus were produced in the same manner to examine the anatomical shape

and size of the design (Figure 1). The STL files of the different components

(customized surgical guide, 3D scaffold and metatarsus) were translated into a

printable g-code (3D printing software, Ultimaker Cura 3.0, Ultimaker, The

Netherlands). The customized surgical guide was printed with nylon filament (2.85 ±

0.05 mm, Ultimaker) that sustained autoclave sterilization using a commercial 3D

printer (Ultimaker 3 extended, Ultimaker). The metatarsus and 3D scaffold were printed

with thermoplastic poly-lactic acid (PLA, 2.85 ± 0.10 mm, Ultimaker) in order to control

their precise fitting to anatomy prior to surgery.

3D printing of the customized calcium phosphate scaffolds

The customized 3D calcium phosphate scaffolds (MimetikOss 3D, Mimetis

Biomaterials S.L., Spain) were designed by reverse engineering from CT scans of the

metatarsus of sheep and fabricated by robot casting as previously published15. Briefly,

a calcium-deficient hydroxyapatite self-setting ink was prepared by mixing 35 wt%

aqueous solution of poloxamer 407 (P2443 – Pluronic, F-127, Sigma-Aldrich, Missouri,

USA) and α-tricalcium phosphate (α-TCP, Innotere GmbH, Radebeul, Germany)

powder at a ratio of 0.5 g/g. 3D scaffolds were printed by using a robocasting device

(Heavy Duty Paste Extruder, BCN3D Technologies, Barcelona, Spain) with a syringe

(Optimum® Syringe, Nordson EFD, U.S.A) containing the paste coupled to a tapered

dispensing tip (SmoothFlow Tapered Tips, Nordson EFD) mounted on the machine.

The 3D scaffold consisted of a two-part assembly as displayed in Figure 1. The main

139
body was a cylinder (length: 35 mm, diameter: 15-17 mm) with a central groove of 5

mm in width and 7 mm in depth for passing through the axial vascular pedicle. A

vascular plug (length: 30 mm, height: 8 mm) with rounded edges was used for retaining

the vascular pedicle inside the 3D scaffold. The geometry of the pores had an

orthogonal rectilinear pattern with alternate crisscrossed layers rotated 90º relative to

the previous layer creating an interconnected pore network mesh. Two different

printing setups were defined for the two parts of the assembly: For the main body, we

used a nozzle diameter of 410 µm (410 µm-nozzle-setup, 22 gauge) and for the

vascular plug, a nozzle diameter of 311 µm (311 µm-nozzle-setup, 24 gauge). The

filament width was set to 370 µm and 490 µm respectively. The printing process was

followed by a hydrothermal treatment for hardening as described elsewhere 46.

Subsequently, the samples were packaged in a double sterilization pouch and

sterilized by autoclaving. The physicochemical properties of the customized 3D

scaffolds were characterized using different techniques and are reported in the

supplementary methods.

Critical-sized defects in sheep metatarsus

In this pilot-study, three 3-year old female Ile de France sheep with an average weight

of 65 kg were supplied from the INRA breeder and deprived of food 24 hours before

anaesthesia. The technique used for creating a segmental defect in the metatarsus

was according to a validated and previously described experimental model 47. Briefly,

the animals were anaesthetized and treated with morphine hydrochloride (0.3 mg/kg,

CDM Lavoisier, France) and oxytetracyline (20 mg/kg, Tenaline ® LA, Ceva, France)

for analgesia and antibiotic prophylaxis. During the surgical procedure, general

140
anaesthesia was maintained by orotracheal intubation and inhalation of 3% isoflurane

in oxygen. The heart and breathing rates were continuously monitored. After shaving

and disinfecting the surgical site, a longitudinal incision was made to expose the medial

surface of the left metatarsus. The customized, sterile surgical guide was positioned

on the medial surface of the long bone and a surgical saw was inserted. A segmental

critical-sized defect of 35 mm in length was created under constant saline irrigation to

remove bone debris and prevent overheating. The defect was either left empty, treated

with a customized 3D-printed scaffold alone or in combination with a vascular pedicle

passing through. The metatarsus was stabilized by using a seven-hole dynamic

compression plate (LCP 3.5 L98, Depuy Synthes, Johnson & Johnson Medical,

France) and four head-locking screws (diameter: 3.5 mm, length: 20 mm). The holes

for the osteosynthesis screws were made by drilling them at appropriate positions with

the surgical guide. To close the wound, subcutaneous tissues and skin were sutured

in separate layers with resorbable sutures (Optime® 4/0, Péters Medical, France). The

limb was immobilized using a resin plaster and splint. Post-operative pain was

managed by administration of flunixine (1.5 mg/kg, Finadyne ®, MSD Santé Animale,

France).

Imaging and histological analyses

To follow bone regeneration and vascularization, CT scans were taken at day 0 (post-

operative), 30, 60 and 90 using the same parameters as described for the pre-

operative phase. After completing the CT scans at day 90, metatarsi were harvested

and fixed in 4% formalin (Roti®-Histofix 4%, Carl Roth, France).

141
To receive high-resolution images of the metatarsus at the endpoint of the study,

explants were scanned using an in vivo cone-beam micro-computed tomography

(microCT) scanner (Skyscan 1076, Bruker, Kontich, Belgium) during the fixation

period. Therefore, the X-ray tube was operated at 50 kV and 200 µA. Scans were

recorded with 1° rotation step over 180° and exposure of 400 ms giving a resolution of

18 µm per pixel. The 3D reconstruction was performed using the accompanying

software NRecon (Bruker, Kontich, Belgium). The percentage of bone volume +

material volume over total volume (BV+MV/TV) was calculated in the selected region

of interest corresponding to the diaphyseal defect and compared to the microCT of the

3D scaffold taken before implantation by the Skysan CT Analyzer (CTAn) software.

For histological examination, fixed samples were dehydrated in ascending grades of

ethanol, immersed in xylol (Carl Roth) as intermedium and embedded in methyl

methacrylate (Sigma Aldrich). Undecalcified thin ground sections were prepared in

longitudinal plane using the EXAKT cutting and grinding equipment (EXAKT Advanced

Technologies, Norderstedt, Germany) according to the method established by

Donath48. The sections were reduced to a thickness of 60 µm and stained with Levai-

Laczko dye to differentiate between new bone, old bone and the 3D-printed scaffold49.

For descriptive histological evaluation, the slides were scanned using an Olympus

VS120 virtual slide microscope (Olympus, Tokyo, Japan) with a 20x objective.

Data analysis

All results were expressed as average ± standard deviation and graphed with

GraphPad Prism software (GraphPad Software Inc., La Jolla, CA).

142
REFERENCES

1 Dimitriou, R., Jones, E., McGonagle, D. & Giannoudis, P. V. Bone regeneration:

current concepts and future directions. BMC Med 9, 66, doi:10.1186/1741-7015-9-66

(2011).

2 Kalfas, I. H. Principles of bone healing. Neurosurg Focus 10, E1,

doi:10.3171/foc.2001.10.4.2 (2001).

3 Jakoi, A. M., Iorio, J. A. & Cahill, P. J. Autologous bone graft harvesting: a review

of grafts and surgical techniques. Musculoskelet Surg 99, 171-178,

doi:10.1007/s12306-015-0351-6 (2015).

4 Dimitriou, R., Mataliotakis, G. I., Angoules, A. G., Kanakaris, N. K. &

Giannoudis, P. V. Complications following autologous bone graft harvesting from the

iliac crest and using the RIA: A systematic review. Injury 42, S3-S15,

doi:10.1016/[Link].2011.06.015 (2011).

5 Cecchi, S., Bennet, S. J. & Arora, M. Bone morphogenetic protein-7: Review of

signalling and efficacy in fracture healing. J Orthop Transl 4, 28-34,

doi:10.1016/[Link].2015.08.001 (2016).

6 Friedlaender, G. E. et al. Osteogenic protein-1 (bone morphogenetic protein-7)

in the treatment of tibial nonunions. J Bone Joint Surg Am 83-A Suppl 1, S151-158

(2001).

7 Giannoudis, P. V., Harwood, P. J., Tosounidis, T. & Kanakaris, N. K. Restoration

of long bone defects treated with the induced membrane technique: protocol and

outcomes. Injury 47 Suppl 6, S53-S61, doi:10.1016/S0020-1383(16)30840-3 (2016).

8 Gomez-Barrena, E. et al. Feasibility and safety of treating non-unions in tibia,

femur and humerus with autologous, expanded, bone marrow-derived mesenchymal

143
stromal cells associated with biphasic calcium phosphate biomaterials in a multicentric,

non-comparative trial. Biomaterials 196, 100-108,

doi:10.1016/[Link].2018.03.033 (2019).

9 Gubin, A., Borzunov, D. & Malkova, T. Ilizarov method for bone lengthening and

defect management review of contemporary literature. Bull Hosp Jt Dis (2013) 74, 145-

154 (2016).

10 Verboket, R. et al. Autologous cell-based therapy for treatment of large bone

defects: from bench to bedside. Eur J Trauma Emerg Surg 44, 649-665,

doi:10.1007/s00068-018-0906-y (2018).

11 Albrektsson, T. & Johansson, C. Osteoinduction, osteoconduction and

osseointegration. Eur Spine J 10 Suppl 2, S96-101, doi:10.1007/s005860100282

(2001).

12 de Grado, G. F. et al. Bone substitutes: a review of their characteristics, clinical

use, and perspectives for large bone defects management. J Tissue Eng 9,

doi:10.1177/2041731418776819 (2018).

13 Neto, A. S. & Ferreira, J. M. F. Synthetic and marine-derived porous scaffolds

for bone tissue engineering. Materials 11, doi:10.3390/ma11091702 (2018).

14 Wang, W. & Yeung, K. W. K. Bone grafts and biomaterials substitutes for bone

defect repair: A review. Bioact Mater 2, 224-247, doi:10.1016/[Link].2017.05.007

(2017).

15 Barba, A. et al. Osteogenesis by foamed and 3D-printed nanostructured calcium

phosphate scaffolds: Effect of pore architecture. Acta Biomater 79, 135-147,

doi:10.1016/[Link].2018.09.003 (2018).

144
16 Barba, A. et al. Osteoinduction by foamed and 3D-printed calcium phosphate

scaffolds: effect of nanostructure and pore architecture. ACS Appl Mater Interfaces 9,

41722-41736, doi:10.1021/acsami.7b14175 (2017).

17 Lin, K., Sheikh, R., Romanazzo, S. & Roohani, I. 3D Printing of bioceramic

scaffolds-barriers to the clinical translation: from promise to reality, and future

perspectives. Materials (Basel) 12, doi:10.3390/ma12172660 (2019).

18 Papastavrou, E., Breedon, P. & Fairhurst, D. Low-temperature deposition

modeling of beta-TCP scaffolds with controlled bimodal porosity. Methods Mol Biol

1758, 41-54, doi:10.1007/978-1-4939-7741-3_4 (2018).

19 Fernandez de Grado, G. et al. Bone substitutes: a review of their characteristics,

clinical use, and perspectives for large bone defects management. J Tissue Eng 9, 1-

18, doi:10.1177/2041731418776819 (2018).

20 Griffin, K. S. et al. Evolution of bone grafting: bone grafts and tissue engineering

strategies for vascularized bone regeneration. Clinic Rev Bone Miner Metab 13, 232-

244, doi:10.1007/s12018-015-9194-9 (2015).

21 Mercado-Pagan, A. E., Stahl, A. M., Shanjani, Y. & Yang, Y. Vascularization in

bone tissue engineering constructs. Ann Biomed Eng 43, 718-729,

doi:10.1007/s10439-015-1253-3 (2015).

22 Filipowska, J., Tomaszewski, K. A., Niedzwiedzki, L., Walocha, J. A. &

Niedzwiedzki, T. The role of vasculature in bone development, regeneration and

proper systemic functioning. Angiogenesis 20, 291-302, doi:10.1007/s10456-017-

9541-1 (2017).

23 Bose, S., Roy, M. & Bandyopadhyay, A. Recent advances in bone tissue

engineering scaffolds. Trends Biotechnol 30, 546-554,

doi:10.1016/[Link].2012.07.005 (2012).

145
24 Liu, Y., Lim, J. & Teoh, S. H. Review: development of clinically relevant scaffolds

for vascularised bone tissue engineering. Biotechnol Adv 31, 688-705,

doi:10.1016/[Link].2012.10.003 (2013).

25 O'Keefe, R. J. & Mao, J. Bone tissue engineering and regeneration: from

discovery to the clinic--an overview. Tissue Eng Part B Rev 17, 389-392,

doi:10.1089/[Link].2011.0475 (2011).

26 Hutmacher, D. W., Schantz, J. T., Lam, C. X., Tan, K. C. & Lim, T. C. State of

the art and future directions of scaffold-based bone engineering from a biomaterials

perspective. J Tissue Eng Regen Med 1, 245-260, doi:10.1002/term.24 (2007).

27 Kneser, U., Schaefer, D. J., Polykandriotis, E. & Horch, R. E. Tissue engineering

of bone: the reconstructive surgeon's point of view. J Cell Mol Med 10, 7-19,

doi:10.1111/j.1582-4934.2006.tb00287.x (2006).

28 Rosset, P., Deschaseaux, F. & Layrolle, P. Cell therapy for bone repair. Orthop

Traumatol Surg Res 100, S107-112, doi:10.1016/[Link].2013.11.010 (2014).

29 Tang, D. et al. Biofabrication of bone tissue: approaches, challenges and

translation for bone regeneration. Biomaterials 83, 363-382,

doi:10.1016/[Link].2016.01.024 (2016).

30 Hutmacher, D. W. Scaffolds in tissue engineering bone and cartilage.

Biomaterials 21, 2529-2543, doi:10.1016/s0142-9612(00)00121-6 (2000).

31 Brennan, M. A. et al. Pre-clinical studies of bone regeneration with human bone

marrow stromal cells and biphasic calcium phosphate. Stem Cell Res Ther 5, 114,

doi:10.1186/scrt504 (2014).

32 Corre, P. et al. Direct comparison of current cell-based and cell-free approaches

towards the repair of craniofacial bone defects - A preclinical study. Acta Biomater 26,

306-317, doi:10.1016/[Link].2015.08.013 (2015).

146
33 Gamblin, A. L. et al. Bone tissue formation with human mesenchymal stem cells

and biphasic calcium phosphate ceramics: the local implication of osteoclasts and

macrophages. Biomaterials 35, 9660-9667, doi:10.1016/[Link].2014.08.018

(2014).

34 Mankani, M. H., Kuznetsov, S. A., Wolfe, R. M., Marshall, G. W. & Robey, P. G.

In vivo bone formation by human bone marrow stromal cells: reconstruction of the

mouse calvarium and mandible. Stem Cells 24, 2140-2149,

doi:10.1634/stemcells.2005-0567 (2006).

35 Kanczler, J. M. & Oreffo, R. O. Osteogenesis and angiogenesis: the potential

for engineering bone. Eur Cell Mater 15, 100-114 (2008).

36 Lovett, M., Lee, K., Edwards, A. & Kaplan, D. L. Vascularization strategies for

tissue engineering. Tissue Eng Part B Rev 15, 353-370,

doi:10.1089/[Link].2009.0085 (2009).

37 Beier, J. P. et al. Axial vascularization of a large volume calcium phosphate

ceramic bone substitute in the sheep AV loop model. J Tissue Eng Regen Med 4, 216-

223, doi:10.1002/term.229 (2010).

38 Erol, O. O. & Sira, M. New capillary bed formation with a surgically constructed

arteriovenous fistula. Plast Reconstr Surg 66, 109-115, doi:10.1097/00006534-

198007000-00021 (1980).

39 Kaempfen, A. et al. Engraftment of prevascularized, tissue engineered

constructs in a novel rabbit segmental bone defect model. Int J Mol Sci 16, 12616-

12630, doi:10.3390/ijms160612616 (2015).

40 Kneser, U. et al. Engineering of vascularized transplantable bone tissues:

Induction of axial vascularization in an osteoconductive matrix using an arteriovenous

loop. Tissue Eng 12, 1721-1731, doi:10.1089/ten.2006.12.1721 (2006).

147
41 Kokemueller, H. et al. Prefabrication of vascularized bioartificial bone grafts in

vivo for segmental mandibular reconstruction: experimental pilot study in sheep and

first clinical application. Int J Oral Maxillofac Surg 39, 379-387,

doi:10.1016/[Link].2010.01.010 (2010).

42 Warnke, P. H. et al. Man as living bioreactor: Fate of an exogenously prepared

customized tissue-engineered mandible. Biomaterials 27, 3163-3167,

doi:10.1016/[Link].2006.01.050 (2006).

43 Mesimaki, K. et al. Novel maxillary reconstruction with ectopic bone formation

by GMP adipose stem cells. Int J Oral Maxillofac Surg 38, 201-209,

doi:10.1016/[Link].2009.01.001 (2009).

44 Warnke, P. H. et al. Growth and transplantation of a custom vascularised bone

graft in a man. Lancet 364, 766-770, doi:10.1016/S0140-6736(04)16935-3 (2004).

45 Charbonnier, B. et al. Material-induced venosome-supported bone tubes. Adv

Sci (Weinh) 6, 1900844, doi:10.1002/advs.201900844 (2019).

46 Raymond, S. et al. Accelerated hardening of nanotextured 3D-plotted self-

setting calcium phosphate inks. Acta Biomater 75, 451-462,

doi:10.1016/[Link].2018.05.042 (2018).

47 Petite, H. et al. Tissue-engineered bone regeneration. Nat Biotechnol 18, 959-

963, doi:10.1038/79449 (2000).

48 Donath, K. & Breuner, G. A method for the study of undecalcified bones and

teeth with attached soft tissues. The Sage-Schliff (sawing and grinding) technique. J

Oral Pathol 11, 318-326 (1982).

12of ossifying cartilage and bone tissues embedded in epoxy resin. Mikroskopie 31,

1-4 (1975).

148
General Discussion

The studies presented in this thesis were motivated by the objective to propose

surgical alternatives to the current autologous bone grafting for the reconstruction of

large bone defects.

Chapter I presents the state of the art of the current options for the reconstruction of

large bone defects. One of the conclusions we could get from this chapter is that there

are two significant limitations in the current large bone defects reconstructions. Firstly,

a considerable amount of bone tissue needs to be harvested from the donor area

inducing morbidity, post-surgical complications, extensive and repetitive surgeries and

thus, hampering the quality of life of patients. Secondly, given the critical amount of

bone tissue required, vascularization of the bone graft is a condition sine qua non for

a functional reconstruction. We confirm that although bone autografts have

osteoconductive, osteoinductive and osteogenic properties, they cannot be used as an

isolated surgical technique for this type of reconstruction. The amount of bone is limited

for this type of procedure, and it is a non-vascularized tissue. To circumvent this

difficulty, the Masquelet's technique has proven that pre-vascularization before bone

grafting could regenerate large bone defects, but still requires two surgeries. Thanks

to the neovascularization and the secretion of various growth factors, and the presence

of mesenchymal stem cells in the induced membrane, that contribute to the bone

regeneration of long bone defects. At the same time, instead of using a bone autograft,

one could use synthetic bone substitutes or a combination of autograft and bone

substitutes associated with an induced membrane of Masquelet.

149
Massive bone allografts solve the problem of morbidity and two surgeries but present

significant disadvantages such as safety with possible disease transfer and immune

rejection as well as the lack of vascularization. The Capanna's technique solves this

problem by associating a vascularized bone graft with the allograft. Again,

vascularization of the bone graft appears to be the best surgical option for the

reconstruction of large bone defects. Indeed, the vascularized bone graft has an

adequate amount of bone tissue serving as scaffold and has a vascular pedicle that

allows its vitality to be maintained after reconstruction. However, the significant

disadvantages of this solution are the possible surgical complications and the

associated morbidities. At the same time, although being the best option, it is a surgical

technique that does not allow a personalized reconstruction in the bone defect to be

reconstructed. The surgeon must adapt the bone graft to the shape of the bone defect.

Based on this problematic of the not possible customization, the problem of

vascularization, and with the limited amount of bone tissue, we developed the study

presented as Chapter II in this thesis.

In chapter II, the study aimed to produce a highly-vascularized graft in situ and to

transplant it into a critical-sized defect in rabbits for bone reconstruction. We used

biphasic calcium phosphate (BCP) granules as the synthetic biomaterial. To give the

granules an anatomical shape similar to the bone defect, we developed a 3D printed

PLA chamber, which was filled with the BCP granules. In this study, we observed that

BCP groups without vascularization fell apart upon the opening of the chambers, in

contrast to the pedicle groups where firm constructs in the shape of the chambers were

formed. Moreover, the vascular bundle pedicule generates vascular sprouting

regenerating the vascularization of the synthetic graft. The use of the stroma vascular

fraction of the adipose tissue helped to create vascular capillaries. When constructions

150
were transplanted into the ulna defect, there was a new bone formation, but it was not

complete. Maybe it was due to the limitations that we had in this study. Firstly, the

creation of the ulna defect was not standardized., giving; as a result, some no bone

union with the BCP construct. Secondly, it is a two-step surgery. At the same time, we

did not keep the vascularization after the reconstruction, so our graft can finally behave

like a non-vascularized autograft. Taking into account these limitations, we decided to

develop a customized 3D printed synthetic similar fibula flap (Chapter III). In this study,

to standardize the large bone defects created in the sheep metatarsus, we have

developed the use of surgical guides. The 3D printed scaffolds were designed based

on the CT scan images to give the exact anatomical shape of the bone defect when

doing the reconstruction. To mimic the fibula vascularization, a local pedicle was

dissected and passing it through the 3D printed scaffold. Using these different steps,

we were able to create a customized vascular synthetic bone large defect

reconstruction supplying vascularization to the biomaterial. The limitation of this study

was that 3D scaffolds, even though they supported bone ingrowth, had insufficient

mechanical properties in comparison with those of native bone tissue. This limitation

is a critical clinical requirement which must be resolved. In chapters I and III, we

presented 3D printed constructs as a promise option in clinical application for large

bone defect reconstruction. The most important clinical use of tissue engineering is the

reconstruction of large and critically defects. In these cases, body self-repair is limited.

The main reason why 3D printing complex tissue-engineering constructs have not

done a meaningful translation to clinical use is due to challenges faced when scaling

up to treat the large bone defects. In tissue engineering, 3D printing and 3D bioprinting

have comparable potential and could replace current treatments in the future. This

technology is in a starting period. Multidisciplinary investment in research and

151
development will find the solutions for translation to clinical application to treat large

bone defects.

152
Conclusion

This doctoral thesis gives the current options in large bone defect reconstruction. At

the same time, based on this study, we proposed new possible solutions for treating

large bone defects.

Concerning the current options for large bone defects reconstruction, we can conclude

that given the large amount of bone tissue for this reconstruction:

a) Current techniques generate donor site morbidity, are complex and have their

own limitations.

b) At least two surgical steps are usually needed.

c) Vascularization of the transferred tissue is essential for bone regeneration.

Concerning the study to produce a highly-vascularized graft in situ and to transplant it

into a critical-sized defect in rabbits for bone reconstruction, we conclude that:

a) The use of a 3D printed chamber allowed us to create a BCP anatomical shaped

firm construct.

b) The vascular bundle pedicle generates vascular sprouting regenerating the

vascularization of the synthetic graft.

c) The use of the stroma vascular fraction of the adipose tissue helped to create

vascular capillaries.

Regarding the development of a customized 3D printed synthetic scaffold with a axial

vascular pedicle in segmental defects in sheep, we conclude that:

a) Preoperative CT scan allowed us to create a patient-specific 3D scaffold for the

large bone defect reconstruction.

b) The use of surgical guides allowed us to standardize the large bone defect in

the study and may be useful for surgical resection of tumors.

153
c) We showed the utility of using a local pedicle inserted axially in the 3D scaffold

for producing a one-step surgery reconstruction.

d) 3D scaffolds had insufficient mechanical properties in comparison with those of

native bone tissue and should be improved.

154
Futures Perspectives

Another way in which we could improve the mechanical properties thanks to the

development of 3D printing is developing 3D composite constructs, association

titanium, and bone substitutes.

Different option models could be considered. Customized titanium hollowed prothesis

filled with biomaterials, as described in Chapter II.

We could propose a 3D printed customized titanium coated with hydroxyapatite.

Thanks to the evolution of 3D printing, nowadays, we can design a scaffolding lattice

similar to the cortical and trabecular bone using little quantity of material. With this

approach, we could propose a light 3D printed structure with excellent mechanical

properties. In all the options mentioned before, we will associate a vascular pedicle, as

proposed in all the studies presented in this work.

The work presented in this thesis and the future perspectives will help clinicians and

patients to solve and profit of this new technology which could solve this challenge.

155
REFERENCES

1. Ahlmann, E.R., Menendez, L.R., Kermani, C., and Gotha, H. (2006).


Survivorship and clinical outcome of modular endoprosthetic reconstruction for
neoplastic disease of the lower limb. J Bone Joint Surg Br 88(6), 790-795. doi:
10.1302/0301-620X.88B6.17519.
2. Albrektsson T, Johansson C. Osteoinduction, osteoconduction and
osseointegration. Eur Spine J. 2001 Oct;10(Suppl 2):S96–101.
3. Albrektsson, T. & Johansson, C. Osteoinduction, osteoconduction and
osseointegration. Eur Spine J 10 Suppl 2, S96-101,
doi:10.1007/s005860100282 (2001).
4. Arkudas A, Lipp A, Buehrer G, Arnold I, Dafinova D, Brandl A, et al. Pedicled
Transplantation of Axially Vascularized Bone Constructs in a Critical Size
Femoral Defect. Tissue Eng Part A. 2018 Mar;24(5–6):479–92.
5. Athanasiou, V.T., Papachristou, D.J., Panagopoulos, A., Saridis, A., Scopa,
C.D., and Megas, P. (2010). Histological comparison of autograft, allograft-
DBM, xenograft, and synthetic grafts in a trabecular bone defect: an
experimental study in rabbits. Med Sci Monit 16(1), BR24-31.
6. Azi, M.L., Teixeira, A.A.A., Cotias, R.B., Joeris, A., and Kfuri, M. (2019).
Induced-membrane technique in the management of posttraumatic bone
defects. JBJS Essent Surg Tech 9(2), e22. doi: 10.2106/[Link].18.00099.
7. Bakri K, Stans A, Mardini S, Moran S. Combined Massive Allograft and
Intramedullary Vascularized Fibula Transfer: The Capanna Technique for
Lower-Limb Reconstruction. Seminars in Plastic Surgery. 2008
Aug;22(03):234–41.
8. Bansal, M.R., Bhagat, S.B., and Shukla, D.D. (2009). Bovine cancellous
xenograft in the treatment of tibial plateau fractures in elderly patients. Int
Orthop 33(3), 779-784. doi: 10.1007/s00264-008-0526-y.
9. Barba, A. et al. Osteogenesis by foamed and 3D-printed nanostructured calcium
phosphate scaffolds: Effect of pore architecture. Acta Biomater 79, 135-147,
doi:10.1016/[Link].2018.09.003 (2018).
10. Barba, A. et al. Osteoinduction by foamed and 3D-printed calcium phosphate
scaffolds: effect of nanostructure and pore architecture. ACS Appl Mater
Interfaces 9, 41722-41736, doi:10.1021/acsami.7b14175 (2017).
11. Beier JP, Horch RE, Arkudas A, Polykandriotis E, Bleiziffer O, Adamek E, et al.
De novo generation of axially vascularized tissue in a large animal model.
Microsurgery. 2009 Jan 1;29(1):42–51.

156
12. Beier JP, Horch RE, Hess A, Arkudas A, Heinrich J, Loew J, et al. Axial
vascularization of a large volume calcium phosphate ceramic bone substitute in
the sheep AV loop model. J Tissue Eng Regen Med. 2010 Mar;4(3):216–23.
13. Beier, J. P. et al. Axial vascularization of a large volume calcium phosphate
ceramic bone substitute in the sheep AV loop model. J Tissue Eng Regen Med
4, 216-223, doi:10.1002/term.229 (2010).
14. Bertol, L.S., Schabbach, R., and dos Santos, L.A.L. (2016). Dimensional
evaluation of patient-specific 3D printing using calcium phosphate cement for
craniofacial bone reconstruction. Journal of Biomaterials Applications 31(6),
799-806. doi: 10.1177/0885328216682672.
15. Boos AM, Loew JS, Weigand A, Deschler G, Klumpp D, Arkudas A, et al.
Engineering axially vascularized bone in the sheep arteriovenous‐loop model.
Journal of Tissue Engineering and Regenerative Medicine. 2013 Aug
1;7(8):654–64.
16. Bosc, R., Hersant, B., Carloni, R., Niddam, J., Bouhassira, J., De Kermadec,
H., et al. (2017). Mandibular reconstruction after cancer: an in-house approach
to manufacturing cutting guides. Int J Oral Maxillofac Surg 46(1), 24-31. doi:
10.1016/[Link].2016.10.004.
17. Bose, S., Roy, M. & Bandyopadhyay, A. Recent advances in bone tissue
engineering scaffolds. Trends Biotechnol 30, 546-554,
doi:10.1016/[Link].2012.07.005 (2012).
18. Boskey AL, & Robey PG. (2013). The Composition of Bone. Primer on the
Metabolic Bone Diseases and Disorders of Mineral Metabolism, 49–58.
19. Bostrom, M.P.G., and Seigerman, D.A. (2005). The clinical use of allografts,
demineralized bone matrices, synthetic bone graft substitutes and
osteoinductive growth factors: a survey study. HSS journal : the musculoskeletal
journal of Hospital for Special Surgery 1(1), 9-18. doi: 10.1007/s11420-005-
0111-5.
20. Brandi ML, Collin-Osdoby P (2006) Vascular biology and the skeleton. J Bone
Miner Res 21(2):183–192
21. Brennan MA, Davaine J-M, Layrolle P. Pre-vascularization of bone tissue-
engineered constructs. Stem Cell Res Ther. 2013 Aug 14;4(4):96.
22. Brennan MÁ, Renaud A, Amiaud J, Rojewski MT, Schrezenmeier H, Heymann
D, et al. Pre-clinical studies of bone regeneration with human bone marrow
stromal cells and biphasic calcium phosphate. Stem Cell Res Ther [Internet].
2014 Oct 13 [cited 2019 Feb 25];5(5). Available from:
[Link]
23. Brennan MA, Renaud A, Guilloton F, Mebarki M, Trichet V, Sensebé L, et al.
Inferior In Vivo Osteogenesis and Superior Angiogeneis of Human Adipose

157
Tissue: A Comparison with Bone Marrow‐Derived Stromal Stem Cells Cultured
in Xeno‐Free Conditions. Stem Cells Transl Med. 2017 Oct 19;6(12):2160–72.
24. Brennan, M. A. et al. Pre-clinical studies of bone regeneration with human bone
marrow stromal cells and biphasic calcium phosphate. Stem Cell Res Ther 5,
114, doi:10.1186/scrt504 (2014).
25. Brookes M (1963) Cortical vascularization and growth in foetal tubular bones. J
Anat 97:597–609
26. Brown, W., and Chow, L. (1983). A new calcium-phosphate setting cement. J
Dent Res 62, 672-672.
27. Brown, W.E. (1987). A new calcium phosphate, water-setting cement. Cements
research progress, 351-279.
28. Brunello, G., Sivolella, S., Meneghello, R., Ferroni, L., Gardin, C., Piattelli, A.,
et al. (2016). Powder-based 3D printing for bone tissue engineering.
Biotechnology Advances 34(5), 740-753. doi:
[Link]
29. Brydone AS, Meek D, Maclaine S. Bone grafting, orthopaedic biomaterials, and
the clinical need for bone engineering. Proc Inst Mech Eng H. 2010
Dec;224(12):1329–43.
30. Brydone, A.S., Meek, D., and Maclaine, S. (2010). Bone grafting, orthopaedic
biomaterials, and the clinical need for bone engineering. Proc Inst Mech Eng H
224(12), 1329-1343. doi: 10.1243/09544119JEIM770.
31. Bucholz RW. Nonallograft osteoconductive bone graft substitutes. Clin Orthop
Relat Res. 2002 Feb;(395):44–52.
32. Bucholz, R.W., Carlton, A., and Holmes, R.E. (1987). Hydroxyapatite and
tricalcium phosphate bone graft substitutes. Orthop Clin North Am 18(2), 323-
334.
33. Campanacci DA, Puccini S, Caff G, Beltrami G, Piccioli A, Innocenti M, et al.
Vascularised fibular grafts as a salvage procedure in failed intercalary
reconstructions after bone tumour resection of the femur. Injury. 2014
Feb;45(2):399–404.
34. Cao, Y., Vacanti, J.P., Paige, K.T., Upton, J., and Vacanti, C.A. (1997).
Transplantation of chondrocytes utilizing a polymer-cell construct to produce
tissue-engineered cartilage in the shape of a human ear. Plast Reconstr Surg
100(2), 297-302; discussion 303-294. doi: 10.1097/00006534-199708000-
00001.
35. Capanna, R., Bufalini, C., and Campanacci, M. (1993). A new technique for
reconstructions of large metadiaphyseal bone defects. Orthopedics and
Traumatology 2(3), 159-177. doi: 10.1007/BF02620523.

158
36. Careri, S., Vitiello, R., Oliva, M.S., Ziranu, A., Maccauro, G., and Perisano, C.
(2019). Masquelet technique and osteomyelitis: innovations and literature
review. Eur Rev Med Pharmacol Sci 23(2 Suppl), 210-216. doi:
10.26355/eurrev_201904_17495.
37. Casteilla L, Planat-Bénard V, Cousin B, Laharrague P, Bourin P. Vascular and
endothelial regeneration. Curr Stem Cell Res Ther. 2010 Jun;5(2):141–4.
38. Cecchi, S., Bennet, S. J. & Arora, M. Bone morphogenetic protein-7: Review of
signalling and efficacy in fracture healing. J Orthop Transl 4, 28-34,
doi:10.1016/[Link].2015.08.001 (2016).
39. Cesarano Iii, J., Dellinger, J.G., Saavedra, M.P., Gill, D.D., Jamison, R.D.,
Grosser, B.A., et al. (2005). Customization of load-bearing hydroxyapatite
lattice scaffolds. International Journal of Applied Ceramic Technology 2(3), 212-
220. doi: 10.1111/j.1744-7402.2005.02026.x.
40. Charbonnier B, Baradaran A, Sato D, Alghamdi O, Zhang Z, Zhang Y-L, et al.
Material-Induced Venosome-Supported Bone Tubes. Advanced Science.
0(0):1900844.
41. Charbonnier, B. et al. Material-induced venosome-supported bone tubes. Adv
Sci (Weinh) 6, 1900844, doi:10.1002/advs.201900844 (2019).
42. Chen, Z., Li, Z., Li, J., Liu, C., Lao, C., Fu, Y., et al. (2019). 3D printing of
ceramics: A review. Journal of the European Ceramic Society 39(4), 661-687.
doi: [Link]
43. Cheng, M.-H., Brey, E.M., Ulusal, B.G., and Wei, F.-C. (2006). Mandible
augmentation for osseointegrated implants using tissue engineering strategies.
Plastic and Reconstructive Surgery 118(1).
44. Choi, S., Oh, Y.-I., Park, K.-H., Lee, J.-S., Shim, J.-H., and Kang, B.-J. (2019).
New clinical application of three-dimensional-printed polycaprolactone/β-
tricalcium phosphate scaffold as an alternative to allograft bone for limb-sparing
surgery in a dog with distal radial osteosarcoma. The Journal of veterinary
medical science 81(3), 434-439. doi: 10.1292/jvms.18-0158.
45. Colin, A., and Boire, J.-Y. (1997). A novel tool for rapid prototyping and
development of simple 3D medical image processing applications on PCs.
Computer Methods and Programs in Biomedicine 53(2), 87-92. doi:
[Link]
46. Combes C, Rey C. Amorphous calcium phosphates: Synthesis, properties and
uses in biomaterials. Acta Biomaterialia. 2010 Sep 1;6(9):3362–78.
47. Corre P, Merceron C, Longis J, Khonsari RH, Pilet P, Thi TN, et al. Direct
comparison of current cell-based and cell-free approaches towards the repair
of craniofacial bone defects - A preclinical study. Acta Biomater. 2015
Oct;26:306–17.

159
48. Corre, P. et al. Direct comparison of current cell-based and cell-free approaches
towards the repair of craniofacial bone defects - A preclinical study. Acta
Biomater 26, 306-317, doi:10.1016/[Link].2015.08.013 (2015).
49. Cruess RL, Dumont J. Fracture healing. Can J Surg. 1975 Sep;18(5):403–13.
50. Cui, X., Boland, T., D'Lima, D.D., and Lotz, M.K. (2012). Thermal inkjet printing
in tissue engineering and regenerative medicine. Recent Pat Drug Deliv Formul
6(2), 149-155.
51. Daculsi, G., LeGeros, R.Z., Nery, E., Lynch, K., and Kerebel, B. (1989).
Transformation of biphasic calcium phosphate ceramics in vivo: ultrastructural
and physicochemical characterization. J Biomed Mater Res 23(8), 883-894. doi:
10.1002/jbm.820230806.
52. Dai J, Rabie BM (2007) VEGF: an essential mediator of both angiogenesis and
endochondral ossification. J Dent Res 86(10):937–950
53. de Grado, G. F. et al. Bone substitutes: a review of their characteristics, clinical
use, and perspectives for large bone defects management. J Tissue Eng 9,
doi:10.1177/2041731418776819 (2018).
54. De Long WG, Einhorn TA, Koval K, McKee M, Smith W, Sanders R, et al. Bone
grafts and bone graft substitutes in orthopaedic trauma surgery. A critical
analysis. J Bone Joint Surg Am. 2007 Mar;89(3):649–58.
55. Deckard, C.R. (1989). Method and apparatus for producing parts by selective
sintering. Washington, DC: U.S. Patent and Trademark Office. patent
application U.S. Patent No. 4,863,538.
56. Desando G, Bartolotti I, Martini L, Giavaresi G, Nicoli Aldini N, Fini M, et al.
Regenerative Features of Adipose Tissue for Osteoarthritis Treatment in a
Rabbit Model: Enzymatic Digestion Versus Mechanical Disruption. Int J Mol Sci.
2019 May 29;20(11).
57. Dimitriou, R., Jones, E., McGonagle, D., and Giannoudis, P.V. (2011). Bone
regeneration: current concepts and future directions. BMC Med 9, 66. doi:
10.1186/1741-7015-9-66.
58. Dimitriou, R., Mataliotakis, G. I., Angoules, A. G., Kanakaris, N. K. &
Giannoudis, P. V. Complications following autologous bone graft harvesting
from the iliac crest and using the RIA: A systematic review. Injury 42, S3-S15,
doi:10.1016/[Link].2011.06.015 (2011).
59. Donath, K. & Breuner, G. A method for the study of undecalcified bones and
teeth with attached soft tissues. The Sage-Schliff (sawing and grinding)
technique. J Oral Pathol 11, 318-326 (1982).
60. Dong Q, Lin C, Shang H, Wu W, Chen F, Ji X, et al. Modified approach to
construct a vascularized coral bone in rabbit using an arteriovenous loop. J
Reconstr Microsurg. 2010 Feb;26(2):95–102.

160
61. Dupret-Bories, A., Vergez, S., Meresse, T., Brouillet, F., and Bertrand, G.
(2018). Contribution of 3D printing to mandibular reconstruction after cancer.
Eur Ann Otorhinolaryngol Head Neck Dis 135(2), 133-136. doi:
10.1016/[Link].2017.09.007.
62. Eggli, P.S., Muller, W., and Schenk, R.K. (1988). Porous hydroxyapatite and
tricalcium phosphate cylinders with two different pore size ranges implanted in
the cancellous bone of rabbits. A comparative histomorphometric and histologic
study of bony ingrowth and implant substitution. Clin Orthop Relat Res (232),
127-138.
63. Elliot, R.R., and Richards, R.H. (2011). Failed operative treatment in two cases
of pseudarthrosis of the clavicle using internal fixation and bovine cancellous
xenograft (Tutobone). Journal of Pediatric Orthopaedics B 20(5).
64. Epple C, Haumer A, Ismail T, Lunger A, Scherberich A, Schaefer DJ, et al.
Prefabrication of a large pedicled bone graft by engineering the germ for de
novo vascularization and osteoinduction. Biomaterials. 2019 Feb;192:118–27.
65. Erol, O. O. & Sira, M. New capillary bed formation with a surgically constructed
arteriovenous fistula. Plast Reconstr Surg 66, 109-115, doi:10.1097/00006534-
198007000-00021 (1980).
66. Everts V, Delaissé JM, Korper W, Jansen DC, Tigchelaar-Gutter W, Saftig P, et
al. The bone lining cell: its role in cleaning Howship’s lacunae and initiating bone
formation. J Bone Miner Res. 2002 Jan;17(1):77–90.
67. Faldini, C., Miscione, M.T., Acri, F., Chehrassan, M., Bonomo, M., and Giannini,
S. (2011). Use of homologous bone graft in the treatment of aseptic forearm
nonunion. MUSCULOSKELETAL SURGERY 95(1), 31-35. doi:
10.1007/s12306-011-0117-8.
68. Farré-Guasch E, Bravenboer N, Helder MN, Schulten EAJM, Ten Bruggenkate
CM, Klein-Nulend J. Blood Vessel Formation and Bone Regeneration Potential
of the Stromal Vascular Fraction Seeded on a Calcium Phosphate Scaffold in
the Human Maxillary Sinus Floor Elevation Model. Materials (Basel). 2018 Jan
20;11(1).
69. Feilden, E., Blanca, E.G.-T., Giuliani, F., Saiz, E., and Vandeperre, L. (2016).
Robocasting of structural ceramic parts with hydrogel inks. Journal of the
European Ceramic Society 36(10), 2525-2533. doi:
[Link]
70. Fellah BH, Weiss P, Gauthier O, Rouillon T, Pilet P, Daculsi G, et al. Bone repair
using a new injectable self-crosslinkable bone substitute. J Orthop Res. 2006
Apr;24(4):628–35.
71. Fernandez de Grado, G. et al. Bone substitutes: a review of their characteristics,
clinical use, and perspectives for large bone defects management. J Tissue Eng
9, 1-18, doi:10.1177/2041731418776819 (2018).

161
72. Fernandez de Grado, G., Keller, L., Idoux-Gillet, Y., Wagner, Q., Musset, A.-M.,
Benkirane-Jessel, N., et al. (2018). Bone substitutes: a review of their
characteristics, clinical use, and perspectives for large bone defects
management. J Tissue Eng 9, 1-18. doi: 10.1177/2041731418776819.
73. Filipowska J, Tomaszewski KA, Niedźwiedzki Ł, Walocha JA, Niedźwiedzki T.
The role of vasculature in bone development, regeneration and proper systemic
functioning. Angiogenesis. 2017 Aug;20(3):291–302.
74. Forriol F. Growth factors in cartilage and meniscus repair. Injury. 2009 Dec;40
Suppl 3:S12-16.
75. Friedlaender, G. E. et al. Osteogenic protein-1 (bone morphogenetic protein-7)
in the treatment of tibial nonunions. J Bone Joint Surg Am 83-A Suppl 1, S151-
158 (2001).
76. Friesenbichler, J., Maurer-Ertl, W., Sadoghi, P., Pirker-Fruehauf, U., Bodo, K.,
and Leithner, A. (2014). Adverse reactions of artificial bone graft substitutes:
lessons learned from using tricalcium phosphate geneX®. Clinical orthopaedics
and related research 472(3), 976-982. doi: 10.1007/s11999-013-3305-z.
77. Gamblin A-L, Brennan MA, Renaud A, Yagita H, Lézot F, Heymann D, et al.
Bone tissue formation with human mesenchymal stem cells and biphasic
calcium phosphate ceramics: The local implication of osteoclasts and
macrophages. Biomaterials. 2014 Dec 1;35(36):9660–7.
78. Gamblin, A. L. et al. Bone tissue formation with human mesenchymal stem cells
and biphasic calcium phosphate ceramics: the local implication of osteoclasts
and macrophages. Biomaterials 35, 9660-9667,
doi:10.1016/[Link].2014.08.018 (2014).
79. Garrigues GE, Aldridge JM, Friend JK, Urbaniak JR. Free Vascularized Fibular
Grafting for treatment of osteonecrosis of the femoral head secondary to hip
dislocation. Microsurgery. 2009;29(5):342–5.
80. Gerhardt, L.C., and Boccaccini, A.R. (2010). Bioactive glass and glass-ceramic
scaffolds for bone tissue engineering. Materials (Basel) 3(7), 3867-3910. doi:
10.3390/ma3073867.
81. Giannoudis, P. V., Harwood, P. J., Tosounidis, T. & Kanakaris, N. K. Restoration
of long bone defects treated with the induced membrane technique: protocol
and outcomes. Injury 47 Suppl 6, S53-S61, doi:10.1016/S0020-1383(16)30840-
3 (2016).
82. Giannoudis, P.V., Einhorn, T.A., Schmidmaier, G., and Marsh, D. (2008). The
diamond concept &#x2013; open questions. Injury 39, S5-S8. doi:
10.1016/S0020-1383(08)70010-X.
83. Gjerde C, Mustafa K, Hellem S, Rojewski M, Gjengedal H, Yassin MA, et al.
Cell therapy induced regeneration of severely atrophied mandibular bone in a

162
clinical trial. Stem Cell Res Ther [Internet]. 2018 Aug 9 [cited 2019 Feb 25];9.
Available from: [Link]
84. Gomes, K.U., Carlini, J.L., Biron, C., Rapoport, A., and Dedivitis, R.A. (2008).
Use of allogeneic bone graft in maxillary reconstruction for installation of dental
implants. Journal of Oral and Maxillofacial Surgery 66(11), 2335-2338. doi:
10.1016/[Link].2008.06.006.
85. Gómez-Barrena E, Rosset P, Gebhard F, Hernigou P, Baldini N, Rouard H, et
al. Feasibility and safety of treating non-unions in tibia, femur and humerus with
autologous, expanded, bone marrow-derived mesenchymal stromal cells
associated with biphasic calcium phosphate biomaterials in a multicentric, non-
comparative trial. Biomaterials. 2019 Mar 1;196:100–8.
86. Gómez-Barrena E, Rosset P, Müller I, Giordano R, Bunu C, Layrolle P, et al.
Bone regeneration: stem cell therapies and clinical studies in orthopaedics and
traumatology. J Cell Mol Med. 2011 Jun;15(6):1266–86.
87. Gomez-Barrena, E. et al. Feasibility and safety of treating non-unions in tibia,
femur and humerus with autologous, expanded, bone marrow-derived
mesenchymal stromal cells associated with biphasic calcium phosphate
biomaterials in a multicentric, non-comparative trial. Biomaterials 196, 100-108,
doi:10.1016/[Link].2018.03.033 (2019).
88. Gosheger, G., Gebert, C., Ahrens, H., Streitbuerger, A., Winkelmann, W., and
Hardes, J. (2006). Endoprosthetic reconstruction in 250 patients with sarcoma.
Clin Orthop Relat Res 450, 164-171. doi:
10.1097/[Link].0000223978.36831.39.
89. Griffin, K. S. et al. Evolution of bone grafting: bone grafts and tissue engineering
strategies for vascularized bone regeneration. Clinic Rev Bone Miner Metab 13,
232-244, doi:10.1007/s12018-015-9194-9 (2015).
90. Gruene, M., Unger, C., Koch, L., Deiwick, A., and Chichkov, B. (2011).
Dispensing pico to nanolitre of a natural hydrogel by laser-assisted bioprinting.
BioMedical Engineering OnLine 10(1), 19. doi: 10.1186/1475-925X-10-19.
91. Gubin, A., Borzunov, D. & Malkova, T. Ilizarov method for bone lengthening and
defect management review of contemporary literature. Bull Hosp Jt Dis (2013)
74, 145-154 (2016).
92. Hadjidakis DJ, Androulakis II. Bone remodeling. Ann N Y Acad Sci. 2006
Dec;1092:385–96.
93. Han D, Guan X, Wang J, Wei J, Li Q. Rabbit Tibial Periosteum and Saphenous
Arteriovenous Vascular Bundle as an In Vivo Bioreactor to Construct
Vascularized Tissue-Engineered Bone: A Feasibility Study. Artificial Organs.
2014;38(2):167–74.

163
94. Han, W., Shen, J., Wu, H., Yu, S., Fu, J., and Xie, Z. (2017). Induced membrane
technique: advances in the management of bone defects. Int J Surg 42, 110-
116. doi: 10.1016/[Link].2017.04.064.
95. Hankenson KD, Dishowitz M, Gray C, Schenker M (2011).Angiogenesis in bone
regeneration. Injury 42(6):556–561
96. Hattori, H., Mibe, J., and Yamamoto, K. (2011). Modular megaprosthesis in
metastatic bone disease of the femur. Orthopedics 34(12), e871-876. doi:
10.3928/01477447-20111021-13.
97. Heliotis, M., Lavery, K.M., Ripamonti, U., Tsiridis, E., and di Silvio, L. (2006).
Transformation of a prefabricated hydroxyapatite/osteogenic protein-1 implant
into a vascularised pedicled bone flap in the human chest. International Journal
of Oral and Maxillofacial Surgery 35(3), 265-269. doi:
10.1016/[Link].2005.07.013.
98. Henriksen K, Neutzsky-Wulff AV, Bonewald LF, Karsdal MA. Local
communication on and within bone controls bone remodeling. Bone. 2009
Jun;44(6):1026–33.
99. Hidalgo, D.A., and Pusic, A.L. (2002). Free-flap mandibular reconstruction: a
10-year follow-up study. Plast Reconstr Surg 110(2), 438-451.
100. Hock, S.W., Johnson, D.A., and Van Veen, M.A. (1996). Print quality
optimization for a color ink jet printer by using a larger nozzle for the black ink
only.
101. Holl, S., Schlomberg, A., Gosheger, G., Dieckmann, R., Streitbuerger, A.,
Schulz, D., et al. (2012). Distal femur and proximal tibia replacement with
megaprosthesis in revision knee arthroplasty: a limb-saving procedure. Knee
Surg Sports Traumatol Arthrosc 20(12), 2513-2518. doi: 10.1007/s00167-012-
1945-2.
102. Holt GE, Halpern JL, Lynch CC, Devin CJ, Schwartz HS. Imaging
Analysis of the In vivo Bioreactor: A Preliminary Study. Clin Orthop Relat Res.
2008 Aug;466(8):1890–6.
103. Hoornaert A, d’Arros C, Heymann M-F, Layrolle P. Biocompatibility,
resorption and biofunctionality of a new synthetic biodegradable membrane for
guided bone regeneration. Biomed Mater. 2016 10;11(4):045012.
104. Hudson, K.R., Cowan, P.B., and Gondek, J.S. (2000). Ink drop volume
variance compensation for inkjet printing.
105. Hutmacher DW, Schantz JT, Lam CXF, Tan KC, Lim TC. State of the art
and future directions of scaffold-based bone engineering from a biomaterials
perspective. J Tissue Eng Regen Med. 2007 Jul 1;1(4):245–60.
106. Hutmacher, D. W. Scaffolds in tissue engineering bone and cartilage.
Biomaterials 21, 2529-2543, doi:10.1016/s0142-9612(00)00121-6 (2000).

164
107. Hutmacher, D. W., Schantz, J. T., Lam, C. X., Tan, K. C. & Lim, T. C.
State of the art and future directions of scaffold-based bone engineering from a
biomaterials perspective. J Tissue Eng Regen Med 1, 245-260,
doi:10.1002/term.24 (2007).
108. Innocenti M, Abed YY, Beltrami G, Delcroix L, Manfrini M, Capanna R.
Biological reconstruction after resection of bone tumors of the proximal tibia
using allograft shell and intramedullary free vascularized fibular graft: long-term
results. Microsurgery. 2009;29(5):361–72.
109. Jakoi, A. M., Iorio, J. A. & Cahill, P. J. Autologous bone graft harvesting:
a review of grafts and surgical techniques. Musculoskelet Surg 99, 171-178,
doi:10.1007/s12306-015-0351-6 (2015).
110. Jeno, L. & Geza, L. A simple differential staining method for semi-thin
sections of ossifying cartilage and bone tissues embedded in epoxy resin.
Mikroskopie 31, 1-4 (1975).
111. Jeys, L., and Grimer, R. (2009). "The long-term risks of infection and
amputation with limb salvage surgery using endoprostheses," in Treatment of
Bone and Soft Tissue Sarcomas, ed. P.-U. Tunn. (Berlin, Heidelberg: Springer
Berlin Heidelberg), 75-84.
112. Jeys, L.M., Grimer, R.J., Carter, S.R., and Tillman, R.M. (2005).
Periprosthetic infection in patients treated for an orthopaedic oncological
condition. J Bone Joint Surg Am 87(4), 842-849. doi: 10.2106/JBJS.C.01222.
113. Ji, K., Wang, Y., Wei, Q., Zhang, K., Jiang, A., Rao, Y., et al. (2018).
Application of 3D printing technology in bone tissue engineering. Bio-Design
and Manufacturing 1(3), 203-210. doi: 10.1007/s42242-018-0021-2.
114. Kaempfen A, Todorov A, Güven S, Largo RD, Jaquiéry C, Scherberich
A, et al. Engraftment of Prevascularized, Tissue Engineered Constructs in a
Novel Rabbit Segmental Bone Defect Model. Int J Mol Sci. 2015 Jun
4;16(6):12616–30.
115. Kalfas, I. H. Principles of bone healing. Neurosurg Focus 10, E1,
doi:10.3171/foc.2001.10.4.2 (2001).
116. Kanczler JM, Oreffo ROC. Osteogenesis and angiogenesis: the potential
for engineering bone. Eur Cell Mater. 2008;15:100–14.
117. Kang H-W, Lee SJ, Ko IK, Kengla C, Yoo JJ, Atala A. A 3D bioprinting
system to produce human-scale tissue constructs with structural integrity. Nat
Biotechnol. 2016 Mar;34(3):312–9.
118. Kao, C.T., Lin, C.C., Chen, Y.W., Yeh, C.H., Fang, H.Y., and Shie, M.Y.
(2015). Poly(dopamine) coating of 3D printed poly(lactic acid) scaffolds for bone
tissue engineering. Mater Sci Eng C Mater Biol Appl 56, 165-173. doi:
10.1016/[Link].2015.06.028.

165
119. Karalashvili, L., Chichua, N., Menabde, G., Atskvereli, L., and Grdzelidze,
T. (2017). Decellularized bovine bone graft for zygomatic bone reconstruction.
Med Case Rep 4(1:52). doi: 10.21767/2471-8041.100087.
120. Keating, J.F., and McQueen, M.M. (2001). Substitutes for autologous
bone graft in orthopaedic trauma. J Bone Joint Surg Br 83(1), 3-8. doi:
10.1302/0301-620x.83b1.11952.
121. Khouri RK, Koudsi B, Reddi H. Tissue transformation into bone in vivo. A
potential practical application. JAMA. 1991 Oct 9;266(14):1953–5.
122. Klammert, U., Gbureck, U., Vorndran, E., Rodiger, J., Meyer-Marcotty,
P., and Kubler, A.C. (2010a). 3D powder printed calcium phosphate implants
for reconstruction of cranial and maxillofacial defects. J Craniomaxillofac Surg
38(8), 565-570. doi: 10.1016/[Link].2010.01.009.
123. Klammert, U., Vorndran, E., Reuther, T., Muller, F.A., Zorn, K., and
Gbureck, U. (2010b). Low temperature fabrication of magnesium phosphate
cement scaffolds by 3D powder printing. J Mater Sci Mater Med 21(11), 2947-
2953. doi: 10.1007/s10856-010-4148-8.
124. Kneser U, Polykandriotis E, Ohnolz J, Heidner K, Grabinger L, Euler S,
et al. Engineering of vascularized transplantable bone tissues: induction of axial
vascularization in an osteoconductive matrix using an arteriovenous loop.
Tissue Eng. 2006 Jul;12(7):1721–31.
125. Kneser U, Schaefer DJ, Polykandriotis E, Horch RE. Tissue engineering
of bone: the reconstructive surgeon’s point of view. Journal of Cellular and
Molecular Medicine. 2006 Enero;10(1):7–19.
126. Kneser, U. et al. Engineering of vascularized transplantable bone tissues:
Induction of axial vascularization in an osteoconductive matrix using an
arteriovenous loop. Tissue Eng 12, 1721-1731, doi:10.1089/ten.2006.12.1721
(2006).
127. Kneser, U., Schaefer, D. J., Polykandriotis, E. & Horch, R. E. Tissue
engineering of bone: the reconstructive surgeon's point of view. J Cell Mol Med
10, 7-19, doi:10.1111/j.1582-4934.2006.tb00287.x (2006).
128. Kokemueller H, Spalthoff S, Nolff M, Tavassol F, Essig H, Stuehmer C,
et al. Prefabrication of vascularized bioartificial bone grafts in vivo for segmental
mandibular reconstruction: experimental pilot study in sheep and first clinical
application. International Journal of Oral and Maxillofacial Surgery. 2010
Apr;39(4):379–87.
129. Kokemueller, H. et al. Prefabrication of vascularized bioartificial bone
grafts in vivo for segmental mandibular reconstruction: experimental pilot study
in sheep and first clinical application. Int J Oral Maxillofac Surg 39, 379-387,
doi:10.1016/[Link].2010.01.010 (2010).

166
130. Kokemueller, H., Spalthoff, S., Nolff, M., Tavassol, F., Essig, H.,
Stuehmer, C., et al. (2010). Prefabrication of vascularized bioartificial bone
grafts in vivo for segmental mandibular reconstruction: experimental pilot study
in sheep and first clinical application. Int J Oral Maxillofac Surg 39(4), 379-387.
doi: 10.1016/[Link].2010.01.010.
131. Kolesky DB, Homan KA, Skylar-Scott MA, Lewis JA. Three-dimensional
bioprinting of thick vascularized tissues. Proc Natl Acad Sci U S A. 2016 Mar
22;113(12):3179–84.
132. Kurien, T., Pearson, R.G., and Scammell, B.E. (2013). Bone graft
substitutes currently available in orthopaedic practice. The Bone & Joint Journal
95-B(5), 583-597. doi: 10.1302/0301-620X.95B5.30286.
133. Langer R, Vacanti JP. Tissue engineering. Science. 1993 May
14;260(5110):920–6.
134. Laurencin, C., Khan, Y., and Veronick, J. (2014). "Bone graft substitutes:
past, present and future," in Bone graft substitutes and bone regenerative
engineering. West Conshohocken, PA: ASTM International), 1-9.
135. Ledford, C.K., Nunley, J.A., 2nd, Viens, N.A., and Lark, R.K. (2013).
Bovine xenograft failures in pediatric foot reconstructive surgery. J Pediatr
Orthop 33(4), 458-463. doi: 10.1097/BPO.0b013e318287010d.
136. Lee, K.Y., Park, M., Kim, H.M., Lim, Y.J., Chun, H.J., Kim, H., et al.
(2006). Ceramic bioactivity: progresses, challenges and perspectives.
Biomedical Materials 1(2), R31-R37. doi: 10.1088/1748-6041/1/2/r01.
137. Lewis, J.A. (2006). Direct ink writing of 3D functional materials. Advanced
Functional Materials 16(17), 2193-2204. doi: 10.1002/adfm.200600434.
138. Lewis, J.A., Smay, J.E., Stuecker, J., and Cesarano, J. (2006). Direct ink
writing of three-dimensional ceramic structures. Journal of the American
Ceramic Society 89(12), 3599-3609. doi: 10.1111/j.1551-2916.2006.01382.x.
139. Liao, H.-T., Chang, K.-H., Jiang, Y., Chen, J.-P., and Lee, M.-Y. (2011).
Fabrication of tissue engineered PCL scaffold by selective laser-sintered
machine for osteogeneisis of adipose-derived stem cells. Virtual and Physical
Prototyping 6(1), 57-60. doi: 10.1080/17452759.2011.559742.
140. Lin, K., Sheikh, R., Romanazzo, S. & Roohani, I. 3D Printing of
bioceramic scaffolds-barriers to the clinical translation: from promise to reality,
and future perspectives. Materials (Basel) 12, doi:10.3390/ma12172660 (2019).
141. Lipa JE, Novak CB, Binhammer PA. Patient-reported donor-site
morbidity following anterolateral thigh free flaps. J Reconstr Microsurg. 2005
Aug;21(6):365–70.
142. Liu X, Chen W, Zhang C, Thein-Han W, Hu K, Reynolds MA, et al. Co-
Seeding Human Endothelial Cells with Human-Induced Pluripotent Stem Cell-

167
Derived Mesenchymal Stem Cells on Calcium Phosphate Scaffold Enhances
Osteogenesis and Vascularization in Rats. Tissue Eng Part A. 2017 Jun
1;23(11–12):546–55.
143. Liu, Y., Lim, J. & Teoh, S. H. Review: development of clinically relevant
scaffolds for vascularised bone tissue engineering. Biotechnol Adv 31, 688-705,
doi:10.1016/[Link].2012.10.003 (2013).
144. Lodoso-Torrecilla, I., van Gestel, N.A.P., Diaz-Gomez, L., Grosfeld, E.C.,
Laperre, K., Wolke, J.G.C., et al. (2018). Multimodal pore formation in calcium
phosphate cements. J Biomed Mater Res A 106(2), 500-509. doi:
10.1002/jbm.a.36245.
145. Lovett M, Lee K, Edwards A, Kaplan DL. Vascularization Strategies for
Tissue Engineering. Tissue Engineering Part B: Reviews. 2009 Sep;15(3):353–
70.
146. Maisani M, Pezzoli D, Chassande O, Mantovani D. Cellularizing
hydrogel-based scaffolds to repair bone tissue: How to create a physiologically
relevant micro-environment? J Tissue Eng [Internet]. 2017 Jun 8 [cited 2019
Feb 26];8. Available from:
[Link]
147. Mandrycky, C., Wang, Z., Kim, K., and Kim, D.-H. (2016). 3D bioprinting
for engineering complex tissues. Biotechnology Advances 34(4), 422-434. doi:
[Link]
148. Mankani MH, Kuznetsov SA, Robey PG. Formation of hematopoietic
territories and bone by transplanted human bone marrow stromal cells requires
a critical cell density. Exp Hematol. 2007 Jun;35(6):995–1004.
149. Mankani MH, Kuznetsov SA, Wolfe RM, Marshall GW, Robey PG. In vivo
bone formation by human bone marrow stromal cells: reconstruction of the
mouse calvarium and mandible. Stem Cells. 2006 Sep;24(9):2140–9.
150. Mankin, H.J., Gebhardt, M.C., Jennings, L.C., Springfield, D.S., and
Tomford, W.W. (1996). Long-term results of allograft replacement in the
management of bone tumors. Clin Orthop Relat Res (324), 86-97. doi:
10.1097/00003086-199603000-00011.
151. Marler J, Upton J, Langer R, Vacanti J. Transplantation of cells in
matrices for tissue regeneration. Adv Drug Deliv Rev. 1998 03;33(1–2):165–82.
152. Marsh D. Concepts of fracture union, delayed union, and nonunion. Clin
Orthop Relat Res. 1998 Oct;(355 Suppl):S22-30.
153. Masquelet, A.C. (2003). Muscle reconstruction in reconstructive surgery:
soft tissue repair and long bone reconstruction. Langenbecks Arch Surg 388(5),
344-346. doi: 10.1007/s00423-003-0379-1.

168
154. Masquelet, A.C., and Begue, T. (2010). The concept of induced
membrane for reconstruction of long bone defects. Orthopedic Clinics of North
America 41(1), 27-37. doi: [Link]
155. Masquelet, A.C., Fitoussi, F., Begue, T., and Muller, G.P. (2000).
Reconstruction of the long bones by the induced membrane and spongy
autograft. Ann Chir Plast Esthet 45(3), 346-353.
156. Mathieu, L., Bilichtin, E., Durand, M., de l'Escalopier, N., Murison, J.C.,
Collombet, J.M., et al. (2019). Masquelet technique for open tibia fractures in a
military setting. Eur J Trauma Emerg Surg. doi: 10.1007/s00068-019-01217-y.
157. Matsuo K, Irie N. Osteoclast-osteoblast communication. Arch Biochem
Biophys. 2008 May 15;473(2):201–9.
158. Mazo M, Hernández S, Gavira JJ, Abizanda G, Araña M, López-Martínez
T, et al. Treatment of reperfused ischemia with adipose-derived stem cells in a
preclinical Swine model of myocardial infarction. Cell Transplant.
2012;21(12):2723–33.
159. Mazzoli, A. (2013). Selective laser sintering in biomedical engineering.
Med Biol Eng Comput 51(3), 245-256. doi: 10.1007/s11517-012-1001-x.
160. Mercado-Pagan, A. E., Stahl, A. M., Shanjani, Y. & Yang, Y.
Vascularization in bone tissue engineering constructs. Ann Biomed Eng 43,
718-729, doi:10.1007/s10439-015-1253-3 (2015).
161. Mercado-Pagan, A.E., Stahl, A.M., Shanjani, Y., and Yang, Y. (2015).
Vascularization in bone tissue engineering constructs. Ann Biomed Eng 43(3),
718-729. doi: 10.1007/s10439-015-1253-3.
162. Merlino G, Borsetti M, Boltri M. Reverse radial artery bone flap
reconstruction of segmental metacarpal losses. J Hand Surg Eur Vol. 2007
Feb;32(1):98–101.
163. Mesimäki K, Lindroos B, Törnwall J, Mauno J, Lindqvist C, Kontio R, et
al. Novel maxillary reconstruction with ectopic bone formation by GMP adipose
stem cells. Int J Oral Maxillofac Surg. 2009 Mar;38(3):201–9.
164. Mesimaki, K. et al. Novel maxillary reconstruction with ectopic bone
formation by GMP adipose stem cells. Int J Oral Maxillofac Surg 38, 201-209,
doi:10.1016/[Link].2009.01.001 (2009).
165. Michna, S., Wu, W., and Lewis, J.A. (2005). Concentrated hydroxyapatite
inks for direct-write assembly of 3D periodic scaffolds. Biomaterials 26(28),
5632-5639. doi: [Link]
166. Miranda, P., Saiz, E., Gryn, K., and Tomsia, A.P. (2006). Sintering and
robocasting of β-tricalcium phosphate scaffolds for orthopaedic applications.
Acta Biomaterialia 2(4), 457-466. doi:
[Link]

169
167. Mittermayer, F., Krepler, P., Dominkus, M., Schwameis, E., Sluga, M.,
Heinzl, H., et al. (2001). Long-term followup of uncemented tumor
endoprostheses for the lower extremity. Clin Orthop Relat Res (388), 167-177.
doi: 10.1097/00003086-200107000-00024.
168. Mondschein, R.J., Kanitkar, A., Williams, C.B., Verbridge, S.S., and
Long, T.E. (2017). Polymer structure-property requirements for
stereolithographic 3D printing of soft tissue engineering scaffolds. Biomaterials
140, 170-188. doi: [Link]
169. Moore JB, Mazur JM, Zehr D, Davis PK, Zook EG. A biomechanical
comparison of vascularized and conventional autogenous bone grafts. Plast
Reconstr Surg. 1984 Mar;73(3):382–6.
170. Moran, S.L., Bakri, K., Mardini, S., Shin, A.Y., and Bishop, A.T. (2009).
The use of vascularized fibular grafts for the reconstruction of spinal and sacral
defects. Microsurgery 29(5), 393-400. doi: 10.1002/micr.20655.
171. Morelli, I., Drago, L., George, D.A., Gallazzi, E., Scarponi, S., and
Romano, C.L. (2016). Masquelet technique: myth or reality? A systematic
review and meta-analysis. Injury 47 Suppl 6, S68-S76. doi: 10.1016/S0020-
1383(16)30842-7.
172. Murphy, S.V., and Atala, A. (2014). 3D bioprinting of tissues and organs.
Nature Biotechnology 32, 773. doi: 10.1038/nbt.2958.
173. Muscolo, D.L., Ayerza, M.A., Aponte-Tinao, L., Ranalletta, M., and Abalo,
E. (2004). Intercalary femur and tibia segmental allografts provide an
acceptable alternative in reconstructing tumor resections. Clinical Orthopaedics
and Related Research® 426.
174. Myeroff C, Archdeacon M. Autogenous bone graft: donor sites and
techniques. J Bone Joint Surg Am. 2011 Dec 7;93(23):2227–36.
175. Neto AS, Ferreira JMF. Synthetic and Marine-Derived Porous Scaffolds
for Bone Tissue Engineering. Materials (Basel). 2018 Sep 13;11(9).
176. Niedz´wiedzki T, Filipowska J (2015) Bone remodeling in the context of
cellular and systemic regulation: the role of osteocytes and the nervous system.
J Mol Endocrinol 55(2):R23–R36
177. Ogose, A., Kondo, N., Umezu, H., Hotta, T., Kawashima, H., Tokunaga,
K., et al. (2006). Histological assessment in grafts of highly purified beta-
tricalcium phosphate (OSferion®) in human bones. Biomaterials 27(8), 1542-
1549. doi: [Link]
178. Ogura, K., Sakuraba, M., Miyamoto, S., Fujiwara, T., Chuman, H., and
Kawai, A. (2015). Pelvic ring reconstruction with a double-barreled free
vascularized fibula graft after resection of malignant pelvic bone tumor. Arch
Orthop Trauma Surg 135(5), 619-625. doi: 10.1007/s00402-015-2197-7.

170
179. O'Keefe, R. J. & Mao, J. Bone tissue engineering and regeneration: from
discovery to the clinic--an overview. Tissue Eng Part B Rev 17, 389-392,
doi:10.1089/[Link].2011.0475 (2011).
180. Orringer, J.S., Shaw, W.W., Borud, L.J., Freymiller, E.G., Wang, S.A.,
and Markowitz, B.L. (1999). Total mandibular and lower lip reconstruction with
a prefabricated osteocutaneous free flap. Plast Reconstr Surg 104(3), 793-797.
doi: 10.1097/00006534-199909030-00028.
181. Oryan A, Alidadi S, Moshiri A, Maffulli N. Bone regenerative medicine:
classic options, novel strategies, and future directions. J Orthop Surg Res.
2014;9(1):18.
182. Oryan, A., Alidadi, S., and Moshiri, A. (2013). Current concerns regarding
healing of bone defects. Hard Tissue 2(2), 13.
183. Oryan, A., Alidadi, S., Moshiri, A., and Maffulli, N. (2014). Bone
regenerative medicine: classic options, novel strategies, and future directions.
J Orthop Surg Res 9(1), 18. doi: 10.1186/1749-799X-9-18.
184. Ottani V, Raspanti M, Ruggeri A. Collagen structure and functional
implications. Micron. 2001 Apr 1;32(3):251–60.
185. Ozbolat, I.T., and Hospodiuk, M. (2016). Current advances and future
perspectives in extrusion-based bioprinting. Biomaterials 76, 321-343. doi:
[Link]
186. Pala, E., Trovarelli, G., Calabro, T., Angelini, A., Abati, C.N., and
Ruggieri, P. (2015). Survival of modern knee tumor megaprostheses: failures,
functional results, and a comparative statistical analysis. Clin Orthop Relat Res
473(3), 891-899. doi: 10.1007/s11999-014-3699-2.
187. Papastavrou, E., Breedon, P. & Fairhurst, D. Low-temperature deposition
modeling of beta-TCP scaffolds with controlled bimodal porosity. Methods Mol
Biol 1758, 41-54, doi:10.1007/978-1-4939-7741-3_4 (2018).
188. Parikh, S.N. (2002). Bone graft substitutes: past, present, future. J
Postgrad Med 48(2), 142-148.
189. Park, S.A., Lee, H.J., Kim, K.S., Lee, S.J., Lee, J.T., Kim, S.Y., et al.
(2018). In Vivo Evaluation of 3D-Printed Polycaprolactone Scaffold Implantation
Combined with beta-TCP Powder for Alveolar Bone Augmentation in a Beagle
Defect Model. Materials (Basel) 11(2). doi: 10.3390/ma11020238.
190. Patil, S., Auyeung, J., and Gower, A. (2011). Outcome of Subtalar Fusion
Using Bovine Cancellous Bone Graft: A Retrospective Case Series. The Journal
of Foot and Ankle Surgery 50(4), 388-390. doi: 10.1053/[Link].2011.04.019.
191. Paxton, N., Smolan, W., Böck, T., Melchels, F., Groll, J., and Jungst, T.
(2017). Proposal to assess printability of bioinks for extrusion-based bioprinting

171
and evaluation of rheological properties governing bioprintability. Biofabrication
9(4), 044107. doi: 10.1088/1758-5090/aa8dd8.
192. Pelissier, P.H., Masquelet, A.C., Bareille, R., Pelissier, S.M., and
Amedee, J. (2004). Induced membranes secrete growth factors including
vascular and osteoinductive factors and could stimulate bone regeneration.
Journal of Orthopaedic Research 22(1), 73-79. doi: 10.1016/S0736-
0266(03)00165-7.
193. Peng, X., Mao, C., Yu, G.Y., Guo, C.B., Huang, M.X., and Zhang, Y.
(2005). Maxillary reconstruction with the free fibula flap. Plast Reconstr Surg
115(6), 1562-1569. doi: 10.1097/[Link].0000160691.63029.74.
194. Petite, H. et al. Tissue-engineered bone regeneration. Nat Biotechnol 18,
959-963, doi:10.1038/79449 (2000).
195. Petrochenko, P.E., Torgersen, J., Gruber, P., Hicks, L.A., Zheng, J.,
Kumar, G., et al. (2015). Laser 3D printing with sub-microscale resolution of
porous elastomeric scaffolds for supporting human bone stem cells. Adv
Healthc Mater 4(5), 739-747. doi: 10.1002/adhm.201400442.
196. Polykandriotis E, Arkudas A, Horch RE, Stürzl M, Kneser U.
Autonomously vascularized cellular constructs in tissue engineering: opening a
new perspective for biomedical science. Journal of Cellular and Molecular
Medicine. 2007 Jan;11(1):6–20.
197. Putzier, M., Strube, P., Funk, J.F., Gross, C., Monig, H.J., Perka, C., et
al. (2009). Allogenic versus autologous cancellous bone in lumbar segmental
spondylodesis: a randomized prospective study. Eur Spine J 18(5), 687-695.
doi: 10.1007/s00586-008-0875-7.
198. Quarto R, Mastrogiacomo M, Cancedda R, Kutepov SM, Mukhachev V,
Lavroukov A, et al. Repair of Large Bone Defects with the Use of Autologous
Bone Marrow Stromal Cells. New England Journal of Medicine. 2001 Feb
1;344(5):385–6.
199. Raymond, S. et al. Accelerated hardening of nanotextured 3D-plotted
self-setting calcium phosphate inks. Acta Biomater 75, 451-462,
doi:10.1016/[Link].2018.05.042 (2018).
200. Rizzo, M., and Moran, S.L. (2008). Vascularized bone grafts and their
applications in the treatment of carpal pathology. Seminars in plastic surgery
22(3), 213-227. doi: 10.1055/s-2008-1081404.
201. Rodrıǵ uez-Lorenzo, L.M., Vallet-Regı,́ M., and Ferreira, J.M.F. (2001).
Colloidal processing of hydroxyapatite. Biomaterials 22(13), 1847-1852. doi:
[Link]
202. Rosset, P., Deschaseaux, F. & Layrolle, P. Cell therapy for bone repair.
Orthop Traumatol Surg Res 100, S107-112, doi:10.1016/[Link].2013.11.010
(2014).
172
203. Saijo, H., Igawa, K., Kanno, Y., Mori, Y., Kondo, K., Shimizu, K., et al.
(2009). Maxillofacial reconstruction using custom-made artificial bones
fabricated by inkjet printing technology. Journal of Artificial Organs 12(3), 200-
205. doi: 10.1007/s10047-009-0462-7.
204. Saito, E., Suarez-Gonzalez, D., Murphy, W.L., and Hollister, S.J. (2015).
Biomineral coating increases bone formation by ex vivo BMP-7 gene therapy in
rapid prototyped poly(L-lactic acid) (PLLA) and poly(epsilon-caprolactone)
(PCL) porous scaffolds. Adv Healthc Mater 4(4), 621-632. doi:
10.1002/adhm.201400424.
205. Samavedi, S., Whittington, A.R., and Goldstein, A.S. (2013). Calcium
phosphate ceramics in bone tissue engineering: A review of properties and their
influence on cell behavior. Acta Biomaterialia 9(9), 8037-8045. doi:
[Link]
206. Sanan, A., and Haines, S.J. (1997). Repairing holes in the head: a history
of cranioplasty. Neurosurgery 40(3), 588-603. doi: 10.1097/00006123-
199703000-00033.
207. Sawin PD, Traynelis VC, Menezes AH. A comparative analysis of fusion
rates and donor-site morbidity for autogeneic rib and iliac crest bone grafts in
posterior cervical fusions. J Neurosurg. 1998 Feb;88(2):255–65.
208. Scaglione, M., Fabbri, L., Dell’Omo, D., Gambini, F., and Guido, G.
(2014). Long bone nonunions treated with autologous concentrated bone
marrow-derived cells combined with dried bone allograft.
MUSCULOSKELETAL SURGERY 98(2), 101-106. doi: 10.1007/s12306-013-
0271-2.
209. Scherberich A, Di Maggio ND, McNagny KM. A familiar stranger: CD34
expression and putative functions in SVF cells of adipose tissue. World J Stem
Cells. 2013 Jan 26;5(1):1–8.
210. Schmitz JP, Hollinger JO. The critical size defect as an experimental
model for craniomandibulofacial nonunions. Clin Orthop Relat Res. 1986
Apr;(205):299–308.
211. Shehadeh, A., Noveau, J., Malawer, M., and Henshaw, R. (2010). Late
complications and survival of endoprosthetic reconstruction after resection of
bone tumors. Clin Orthop Relat Res 468(11), 2885-2895. doi: 10.1007/s11999-
010-1454-x.
212. Shibuya, N., Jupiter, D.C., Clawson, L.D., and La Fontaine, J. (2012).
Incorporation of bovine-based structural bone grafts used in reconstructive foot
surgery. The Journal of Foot and Ankle Surgery 51(1), 30-33. doi:
10.1053/[Link].2011.09.008.
213. Sivakumar, R., Mohideen, M.G., Chidambaram, M., Vinoth, T., Singhi,
P.K., and Somashekar, V. (2016). Management of large bone defects in

173
diaphyseal fractures by induced membrane formation by Masquelet's
technique. J Orthop Case Rep 6(3), 59-62. doi: 10.13107/jocr.2250-0685.508.
214. Stanovici, J., Le Nail, L.R., Brennan, M.A., Vidal, L., Trichet, V., Rosset,
P., et al. (2016). Bone regeneration strategies with bone marrow stromal cells
in orthopaedic surgery. Curr Res Transl Med 64(2), 83-90. doi:
10.1016/[Link].2016.04.006.
215. Suwanprateeb, J., Sanngam, R., Suvannapruk, W., and
Panyathanmaporn, T. (2009). Mechanical and in vitro performance of apatite-
wollastonite glass ceramic reinforced hydroxyapatite composite fabricated by
3D-printing. J Mater Sci Mater Med 20(6), 1281-1289. doi: 10.1007/s10856-
009-3697-1.
216. Tang D, Tare RS, Yang L-Y, Williams DF, Ou K-L, Oreffo ROC.
Biofabrication of bone tissue: approaches, challenges and translation for bone
regeneration. Biomaterials. 2016 Mar;83:363–82.
217. Tang, D. et al. Biofabrication of bone tissue: approaches, challenges and
translation for bone regeneration. Biomaterials 83, 363-382,
doi:10.1016/[Link].2016.01.024 (2016).
218. Tatara, A.M., Wong, M.E., and Mikos, A.G. (2014). In vivo bioreactors for
mandibular reconstruction. Journal of dental research 93(12), 1196-1202. doi:
10.1177/0022034514547763.
219. Taylor, G.I. (1982). Reconstruction of the mandible with free composite
iliac bone grafts. Ann Plast Surg 9(5), 361-376. doi: 10.1097/00000637-
198211000-00003.
220. Taylor, G.I. (1983). The current status of free vascularized bone grafts.
Clin Plast Surg 10(1), 185-209.
221. Taylor, G.I. (1985). Composite tissue transfer to the lower limb. Recent
Adv Plast Surg 3, 83-109.
222. Taylor, G.I., Corlett, R.J., and Ashton, M.W. (2016). The evolution of free
vascularized bone transfer: a 40-year experience. Plast Reconstr Surg 137(4),
1292-1305. doi: 10.1097/PRS.0000000000002040.
223. Taylor, G.I., Miller, G.D., and Ham, F.J. (1975). The free vascularized
bone graft. A clinical extension of microvascular techniques. Plast Reconstr
Surg 55(5), 533-544. doi: 10.1097/00006534-197505000-00002.
224. Thébaud NB, Siadous R, Bareille R, Remy M, Daculsi R, Amédée J, et
al. Whatever their differentiation status, human progenitor derived - or mature -
endothelial cells induce osteoblastic differentiation of bone marrow stromal
cells. J Tissue Eng Regen Med. 2012 Nov;6(10):e51-60.
225. Thompson TJ, Owens PD, Wilson DJ (1989) Intramembranous
osteogenesis and angiogenesis in the chick embryo. J Anat 166:55–65

174
226. Tomlinson RE, Silva MJ (2013) Skeletal blood flow in bonerepair and
maintenance. Bone Res 1(4):311–322
227. Torres, J., Tamimi, F., Alkhraisat, M., Prados-Frutos, J.C., and Lopez-
Cabarcos, E. (2011). "Bone substitutes," in Implant dentistry - the most
promising discipline of dentistry, ed. I. Turkyilmaz. Intech), 4-105.
228. Trombetta, R., Inzana, J.A., Schwarz, E.M., Kates, S.L., and Awad, H.A.
(2017). 3D printing of calcium phosphate ceramics for bone tissue engineering
and drug delivery. Ann Biomed Eng 45(1), 23-44. doi: 10.1007/s10439-016-
1678-3.
229. Unger, C., Gruene, M., Koch, L., Koch, J., and Chichkov, B.N. (2011).
Time-resolved imaging of hydrogel printing via laser-induced forward transfer.
Applied Physics A 103(2), 271-277. doi: 10.1007/s00339-010-6030-4.
230. Vacanti, J.P., and Langer, R. (1999). Tissue engineering: the design and
fabrication of living replacement devices for surgical reconstruction and
transplantation. The Lancet 354, S32-S34. doi: 10.1016/S0140-
6736(99)90247-7.
231. Verboket, R. et al. Autologous cell-based therapy for treatment of large
bone defects: from bench to bedside. Eur J Trauma Emerg Surg 44, 649-665,
doi:10.1007/s00068-018-0906-y (2018).
232. Verboket, R., Leiblein, M., Seebach, C., Nau, C., Janko, M., Bellen, M.,
et al. (2018). Autologous cell-based therapy for treatment of large bone defects:
from bench to bedside. Eur J Trauma Emerg Surg 44(5), 649-665. doi:
10.1007/s00068-018-0906-y.
233. Vorndran, E., Klarner, M., Klammert, U., Grover, L.M., Patel, S., Barralet,
J.E., et al. (2008). 3D Powder printing of β-tricalcium phosphate ceramics using
different strategies. Advanced Engineering Materials 10(12), B67-B71. doi:
10.1002/adem.200800179.
234. Wang, M.O., Vorwald, C.E., Dreher, M.L., Mott, E.J., Cheng, M.-H.,
Cinar, A., et al. (2015). Evaluating 3D-printed biomaterials as scaffolds for
vascularized bone tissue engineering. Advanced Materials 27(1), 138-144. doi:
10.1002/adma.201403943.
235. Wang, W. & Yeung, K. W. K. Bone grafts and biomaterials substitutes for
bone defect repair: A review. Bioact Mater 2, 224-247,
doi:10.1016/[Link].2017.05.007 (2017).
236. Warnke PH, Springer ING, Wiltfang J, Acil Y, Eufinger H, Wehmöller M,
et al. Growth and transplantation of a custom vascularised bone graft in a man.
Lancet. 2004 Sep 28;364(9436):766–70.
237. Warnke PH, Wiltfang J, Springer I, Acil Y, Bolte H, Kosmahl M, et al. Man
as living bioreactor: fate of an exogenously prepared customized tissue-
engineered mandible. Biomaterials. 2006 Jun;27(17):3163–7.
175
238. Warnke, P. H. et al. Growth and transplantation of a custom vascularised
bone graft in a man. Lancet 364, 766-770, doi:10.1016/S0140-6736(04)16935-
3 (2004).
239. Warnke, P. H. et al. Man as living bioreactor: Fate of an exogenously
prepared customized tissue-engineered mandible. Biomaterials 27, 3163-3167,
doi:10.1016/[Link].2006.01.050 (2006).
240. Warnke, P.H., Springer, I.N., Wiltfang, J., Acil, Y., Eufinger, H.,
Wehmoller, M., et al. (2004). Growth and transplantation of a custom
vascularised bone graft in a man. Lancet 364(9436), 766-770. doi:
10.1016/S0140-6736(04)16935-3.
241. Wen, Y., Xun, S., Haoye, M., Baichuan, S., Peng, C., Xuejian, L., et al.
(2017). 3D printed porous ceramic scaffolds for bone tissue engineering: a
review. Biomater Sci 5(9), 1690-1698. doi: 10.1039/c7bm00315c.
242. Winder, J., and Bibb, R. (2005). Medical rapid prototyping technologies:
state of the art and current limitations for application in oral and maxillofacial
surgery. J Oral Maxillofac Surg 63(7), 1006-1015. doi:
10.1016/[Link].2005.03.016.
243. Wu X, Wang Q, Kang N, Wu J, Gu C, Bi J, et al. The effects of different
vascular carrier patterns on the angiogenesis and osteogenesis of BMSC-TCP-
based tissue-engineered bone in beagle dogs. J Tissue Eng Regen Med.
2017;11(2):542–52.
244. Wubneh, A., Tsekoura, E.K., Ayranci, C., and Uludag, H. (2018). Current
state of fabrication technologies and materials for bone tissue engineering. Acta
Biomater 80, 1-30. doi: 10.1016/[Link].2018.09.031.
245. Xu, N., Ye, X., Wei, D., Zhong, J., Chen, Y., Xu, G., et al. (2014). 3D
artificial bones for bone repair prepared by computed tomography-guided fused
deposition modeling for bone repair. ACS Applied Materials & Interfaces 6(17),
14952-14963. doi: 10.1021/am502716t.
246. Yang P, Huang X, Shen J, Wang C, Dang X, Mankin H, et al.
Development of a new pre-vascularized tissue-engineered construct using pre-
differentiated rADSCs, arteriovenous vascular bundle and porous nano-
hydroxyapatide-polyamide 66 scaffold. BMC Musculoskelet Disord. 2013 Nov
8;14:318.
247. Yang, X., Lu, Z., Wu, H., Li, W., Zheng, L., and Zhao, J. (2018). Collagen-
alginate as bioink for three-dimensional (3D) cell printing based cartilage tissue
engineering. Materials Science and Engineering: C 83, 195-201. doi:
[Link]
248. Zimmermann, G., and Moghaddam, A. (2011). Allograft bone matrix
versus synthetic bone graft substitutes. Injury 42 Suppl 2, S16-21. doi:
10.1016/[Link].2011.06.199.

176
249. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, et al.
Multilineage cells from human adipose tissue: implications for cell-based
therapies. Tissue Eng. 2001 Apr;7(2):211–28.

177
ANNEXE

178
International Journal of
Molecular Sciences

Article
Epinephrine Infiltration of Adipose Tissue Impacts
MCF7 Breast Cancer Cells and Total Lipid Content
Pierre Avril 1,† , Luciano Vidal 1,† , Sophie Barille-Nion 2 , Louis-Romée Le Nail 1 ,
Françoise Redini 1 , Pierre Layrolle 1 , Michelle Pinault 3 , Stéphane Chevalier 3 , Pierre Perrot 1,4, *
and Valérie Trichet 1
1 INSERM, Université de Nantes, UMR1238, Phy-Os, Sarcomes osseux et remodelage des tissus calcifiés,
F-44035 Nantes, France; [Link].44@[Link] (P.A.); [Link]@[Link] (L.V.);
lrlenail@[Link] (L.-R.L.N.); [Link]@[Link] (F.R.); [Link]@[Link] (P.L.);
[Link]@[Link] (V.T.)
2 CRCINA, INSERM, Université d’Angers, Université de Nantes, F-44035 Nantes, France;
[Link]@[Link]
3 INSERM Université de Tours, UMR1069, Nutrition, Croissance et Cancer, F-37032 Tours, France;
[Link]@[Link] (M.P.); [Link]@[Link] (S.C.)
4 CHU de Nantes, Service de Chirurgie Plastique et des Brûlés, F-44035 Nantes, France
* Correspondence: [Link]@[Link]; Tel.: +33-2-40-08-73-02
† These authors contributed equally to this work.

Received: 6 October 2019; Accepted: 4 November 2019; Published: 11 November 2019 

Abstract: Background: Considering the positive or negative potential effects of adipocytes, depending
on their lipid composition, on breast tumor progression, it is important to evaluate whether adipose
tissue (AT) harvesting procedures, including epinephrine infiltration, may influence breast cancer
progression. Methods: Culture medium conditioned with epinephrine-infiltrated adipose tissue was
tested on human Michigan Cancer Foundation-7 (MCF7) breast cancer cells, cultured in monolayer
or in oncospheres. Lipid composition was evaluated depending on epinephrine-infiltration for
five patients. Epinephrine-infiltrated adipose tissue (EI-AT) or corresponding conditioned medium
(EI-CM) were injected into orthotopic breast carcinoma induced in athymic mouse. Results: EI-CM
significantly increased the proliferation rate of MCF7 cells Moreover EI-CM induced an output of
the quiescent state of MCF7 cells, but it could be either an activator or inhibitor of the epithelial
mesenchymal transition as indicated by gene expression changes. EI-CM presented a significantly
higher lipid total weight compared with the conditioned medium obtained from non-infiltrated-AT of
paired-patients. In vivo, neither the EI-CM or EI-AT injection significantly promoted MCF7-induced
tumor growth. Conclusions: Even though conditioned media are widely used to mimic the secretome
of cells or tissues, they may produce different effects on tumor progression, which may explain some
of the discrepancy observed between in vitro, preclinical and clinical data using AT samples.

Keywords: adipose tissue; breast cancer; epinephrine; breast reconstruction

1. Introduction
Adipose tissue (AT) is a biologically active tissue, which releases soluble growth factors (vascular
endothelium growth factor, insulin growth factor) inducing tissue revascularization, but also produces
hormones (leptin, adiponectin), cytokines (interleukin 6) and insoluble fatty acids, which all interact
through complex networks within a tumor microenvironment. Different in vitro and pre-clinical studies
have demonstrated that AT including mature adipocytes and stem cells, promotes the proliferation,
invasion and survival of breast cancer cells through different secreted factors [1–5].

Int. J. Mol. Sci. 2019, 20, 5626; doi:10.3390/ijms20225626 [Link]/journal/ijms


Int. J. Mol. Sci. 2019, 20, 5626 2 of 15

In contrast specific lipids content in peritumoral AT of breast cancer patients were correlated
with therapeutic benefits. Decreased levels of two polyunsaturated n-3 fatty acids (n-3 PUFA),
docosahexaenoic and eicosapentaenoice acids (DHA 22:6n-3 and EPA 20:5n-3), in peritumoral AT of
women were associated with aggressive multifocal tumors compared to unifocal ones. Moreover it
was shown that DHA and EPA decreased resistance of experimental mammary tumors to taxanes,
anthracyclines or radio-therapy. These preclinical results are supported by the improved outcome
of chemotherapy on metastatic breast cancer that was observed in a phase II clinical study including
dietary supplementation with n-3 PUFA [6–11].
In addition, AT transfer does not increase the risk of recurrence of breast cancer as recently
suggested by large retrospective clinical studies [12–14]. However one retrospective study observed
that patients presenting either ductal or lobular intraepithelial neoplasia, had an increased risk of local
events in the group who had undergone lipofilling [15]. The method to harvest AT is one of the most
important steps governing the success of AT transplantation. Different methods have been described
in the literature studying the variables (fat harvesting technique, infiltration solution, donor site, fat
processing, etc.) that influence adipocyte survival and the AT engraftment [16–19]. However, the breast
cancer recurrence risk related to the AT harvesting method has not yet been investigated. To harvest
fat tissue, some surgical teams use for fat harvesting, an infiltration solution that contains epinephrine,
to induce vasoconstriction [20], but it is worth noting that epinephrine may enhance lipolysis in AT [21].
In our study, the ephinephrine-lactated Ringer’s infiltrated solution adipose tissue conditioned
medium (EI-CM) was tested on proliferative and quiescent human Michigan Cancer Foundation-7
(MCF7) breast cancer cells. The lipid composition of conditioned media of non-infiltrated or epinephrine
infiltrated-AT from five donors was investigated. EI-CM and epinephrine-infiltrated adipose tissue
(EI-AT) were injected into orthotopic induced breast carcinoma in athymic mouse.

2. Results

2.1. MCF7 Cell Proliferation was Enhanced by Epinephrine-Infiltrated Adipose Tissue Conditioned Medium
Proliferation of MCF7 breast carcinoma cells was analyzed in adherent culture conditions by
measuring mitochondrial activity (WST-1 assay) and cell viability was controlled by cell counting with
trypan blue staining. As cancer cells lost their adherence to plastic when whole epinephrine-infiltrated
adipose tissue (EI-AT) was used, EI-AT was replaced by EI-CM to complement cell culture medium
in order to mimic secreted factors by EI-AT. Before being treated, cells were cultured overnight
(16 h) in a standard medium without fetal bovine serum (FBS) in order to observe a synchronized
response to growth factor stimulation. FBS supplementation (10%) enhanced MCF7 mitochondrial
activity up to 240% compared to that without FBS (Figure 1a). Similarly supplementation with 50%
epinephrine-infiltrated adipose tissue conditioned medium (EI-CM) and 50% MEM α medium (0%
FBS) from three different donors enhanced MCF7 mitochondrial activity from 150 to 200% (Figure 1a).
The increases of mitochondrial activity were correlated with an increase in cell number by trypan bleu
counting. Moreover, independent experiments performed with 50% or 25% of EI-CM of patients n◦ 1 to
3 showed similar increases of MCF7 cell proliferation. The inhibition of the ERK1/2 signaling pathway
using 5 µM UO126 induced a 30% decrease of the MCF7 proliferation with EI-CM, whereas it did not
change the MCF7 proliferation with 10% FBS (Figure 1b). These results indicate that EI-CM increases
MCF7 cell proliferation at least partially through the ERK1/2 signaling pathway.
Cell distribution in each cell-cycle phases was observed by flow cytometry after DNA staining
with propidium iodide. During culture without FBS, at least half of the MCF7 cells were in G0 /G1
phase (54% in Figure 1c, top panel). FBS treatment decreased the proportion of cells in G0 /G1 phase
by half and increased the proportion of cells preparing their mitosis and those replicating their DNA
(Figure 1c, middle panel). When MCF7 cells were treated with 25% EI-CM (Figure 1c, low panel),
the proportion of cells in G0 /G1 phase was also reduced by half compared to 0% FBS culture condition.
With 25% EI-CM, a higher increase in cells in G2 /M phase was observed compared to 10% FBS (plus
Int. J. Mol. Sci. 2019, 20, 5626 3 of 15

Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 3 of 16

20% versus plus 11%) whereas the increase of cell proportion in S phase was weaker than with 10%
20% versus plus 11%) whereas the increase of cell proportion in S phase was weaker than with 10%
FBS (plus 4% versus plus 15%). These results indicate that EI-CM complementation induced cell-cycle
FBS (plus 4% versus plus 15%). These results indicate that EI-CM complementation induced cell-cycle
activation in MCF7 cells allowing cells to reach the G2 /M phase faster than FBS complementation.
activation in MCF7 cells allowing cells to reach the G2/M phase faster than FBS complementation.

MichiganCancer
[Link]
Figure CancerFoundation-7
Foundation-7(MCF7)
(MCF7)cellcellgrowth
growthwith
withELR
ELRsolution-infiltrated
solution-infiltratedadipose
adipose
tissue conditioned medium (EI-CM). MCF7 cells were cultured during 24 h in a medium
tissue conditioned medium (EI-CM). MCF7 cells were cultured during 24 h in a medium without any without any
growthfactor
growth factor(0%
(0% FBS)
FBS) or or supplemented
supplemented with
with fetal
fetal bovine
bovine serum
serum (10%(10%
FBS)FBS) or EI-CM
or EI-CM (25 to(25 to and
50%) 50%)
and MEM with 0%FBS. (a) Histogram shows the mitochondrial activity of MCF7 cells,
MEM with 0%FBS. (a) Histogram shows the mitochondrial activity of MCF7 cells, measured by WST- measured by
WST-1 assay. EI-CM were derived from 3 different donors (n◦ 1 to n◦ 3). Results are the means of
1 assay. EI-CM were derived from 3 different donors (n°1 to n°3). Results are the means of 3 wells and
3 wells and are presented as a percentage of 0% FBS value with standard deviations. Statistically
are presented as a percentage of 0% FBS value with standard deviations. Statistically significant
significant differences are indicated in comparison with 0% FBS (***: p < 0.0001). Each patient EI-CM
differences are indicated in comparison with 0% FBS (***: p < 0.0001). Each patient EI-CM was tested
was tested in 3 independent experiments. (b) Mitochondrial activity of MCF7 cells measured by WST-1
in 3 independent experiments. (b) Mitochondrial activity of MCF7 cells measured by WST-1 assay.
assay. Cells were cultured for 24 h with or without 5 or 10 µM of ERK inhibitor UO126. Results are
Cells were cultured for 24 h with or without 5 or 10 µM of ERK inhibitor UO126. Results are the means
the means of 3 wells and are presented as a percentage of condition without UO126 with standard
of 3 wells and are presented as a percentage of condition without UO126 with standard deviations.
deviations. Statistically significant differences are indicated in comparison with 0 UO126 (*: p < 0.05;
Statistically significant differences are indicated in comparison with 0 UO126 (*: p < 0.05; ***: p <
***: p < 0.0001). Two independent experiments were performed. (c) Histograms show the distribution
0.0001). Two independent experiments were performed. (c) Histograms show the distribution of
of MCF7 cells in cell-cycle phases following DNA detection by flow cytometry. Because only 2–3% of
MCF7 cells in cell-cycle phases following DNA detection by flow cytometry. Because only 2–3% of
cells were identified in the subG phase, only the proportion of cells in the G /G , S and G2 /M phases
cells were identified in the subG0 0phase, only the proportion of cells in the G00/G1,1 S and G2/M phases
are indicated.
are indicated.
Int. J. Mol. Sci. 2019, 20, 5626 4 of 15

2.2. MCF7 Cell Quiescence was Increased by Sphereoid Culture and Reduced by Epinephrine-Infiltrated
Adipose Tissue Conditioned Medium
Cell culture under anchorage-independent conditions induces carcinoma cells to form spheres
and to undergo epithelial mesenchymal transition (EMT) which may correlate with a more invading
phenotype such as carcinoma stem cells [22,23]. From MCF7 spheres, messenger ribonucleic nucleic
acids (mRNAs) were isolated for relative gene expression analysis after three days in culture. Five genes
MYC, CD44, TWIST1, TWIST2 and SNAI1 (official symbols and full gene names presented in Table 1)
which are activated in breast carcinoma stem cells and during EMT exhibited a higher expression
in MCF7 cells cultured as spheroids (3-D) compared to that in MCF7 cells cultured in monolayer
(2-D) (Figure 2a). In accordance with EMT, E-cadherin gene (CDH1) expression was lower in MCF7
spheroids than in monolayers. EI-CM treatment of 3-D cultured MCF7 cells increased expression of
MYC and TWIST2 while it decreased that of CD44 and SNAI1, suggesting that the effect of EI-CM on
EMT in MCF7 cells could be either as an activator or inhibitor of the EMT.
Tumor recurrence can be explained by the persistence of cancer cells in a quiescent/non-dividing
stage that enables them to escape to chemotherapy agents during treatment, whereas microenvironment
changes may later activate a cellular switch towards cell division. Quiescent cells corresponding to
cells in G0 phase do not express the Ki-67 protein which is strictly associated with dividing cells in
the G1 , S, G2 or M phases [24]. Under anchorage-independent conditions (3-D), 26.9% of MCF7 cells
were in G0 phase (Figure 2b, left panel). In 3-D culture conditions, 10% FBS complementation did
not change cell distribution (Figure 2b, middle panel). In contrast, EI-CM complementation of 3-D
cultured MCF7 cells induced a decrease of cell proportion in G0 phase (13.9%; Figure 2b, right panel).
Immunohistochemistry (IHC) targeting the Ki-67 protein was performed on spheroids formed
by MCF7 cells cultured under anchorage-independent conditions (Figure 2c). Consistent with flow
cytometry, 25% EI-CM treatment induced an increase of the Ki-67 positive cell proportion (+25%;
Figure 2d left panel). Despite cell cycle activation by EI-CM, sphere number and volume (Figure 2d,
right panel) were not significantly different between 1% FBS and 25% EI-CM complementation.
Altogether, this indicates that EI-CM enabled G0 to G1 phase transition of MCF7 cells.

Table 1. List of genes analyzed by real time RT-PCR: Genes are presented with official gene symbols
and corresponding full name. Forward and reverse primer sequences used to perform the analyses
are indicated.

Official Symbol Official Full Name Reverse Primer


HPTR1 Hypoxanthine PhosphoRibosyl Transferase 1 CGAGCAAGACGTTCAGTCCT
CD44 Cluster of Differentiation 44 CGGCAGGTTATATTCAAATCG
TWIST1 Twist-related protein 1 TGCAGAGGTGTGAGGATGGTGC
TWIST2 Twist-related protein 2 AGAAGGTCTGGCAATGGCAGCA
SNAI1 Snail family transcriptional repressor 1 CAGCAGGTGGGCCTGGTCGTA
CDH1 Cadherin 1 CCAGCGGCCCCTTCACAGTC
MYC Myelocytomatosis viral oncogene homolog GATCCAGACTCTGACCTTTTGC
Int.
[Link].
[Link].
Sci.2019,
2019,20,
20,x5626
FOR PEER REVIEW 5 5ofof16
15

Figure 2. Quiescence of MCF7 cells with ELR solution-infiltrated adipose tissue conditioned medium
Figure
(EI-CM).2. Quiescence
(a) Relativeof MCF7 cells
expression with
fold ELR solution-infiltrated
changes are presented for mRNA adiposeoftissue
MCF7 conditioned
cells cultured medium
either
(EI-CM). (a) Relative
in monolayer (2-D) orexpression
in sphere fold changes are conditions,
(non-anchorage presented for 3-D)mRNA
duringof 3MCF7 cellstreated
days and cultured 48either
h in a
in monolayer
medium (2-D) or inwith
supplemented sphere1 or(non-anchorage
10% FBS or withconditions,
25% EI-CM. 3-D) during 3change
Expression days and treated
of those 48 h inhas
5 genes a
medium supplemented with 1 or 10% FBS or with 25% EI-CM. Expression change
been correlated to epithelial mesenchymal transition leading to invading phenotype of carcinoma cells. of those 5 genes
has
Fullbeen
genecorrelated
names andtosymbols
epithelial aremesenchymal
indicated in Table transition leading
1. Means of 3to invading
samples arephenotype
presented with of carcinoma
standard
cells. Full gene
deviations. names and
Significant symbolsare
differences arenotindicated
indicated inasTable 1. Means ofwas
this experiment 3 samples are presented
not repeated. (b) Dot with
plots
standard
show thedeviations.
distributionSignificant
in cell cycledifferences
phases (Gare 0 , Gnot
1 indicated
and S/G 2 /M)as this experiment
following DNA was
and not
Ki-67 repeated.
detection (b)
in
Dot
MCF7plots
cellsshow the distribution
cultured in cellBecause
in spheres (3-D). cycle phases
only 2–3%(G0, of
G1cells
and were
S/G2/M) following
identified DNA
in subG 0 and
phase, Ki-67
only
detection in MCF7
the proportion cells in
of cells cultured
G0 , G1 ,inand S/G2 /M
spheres (3-D). Because
phases only 2–3%(c)
are indicated. ofRepresentative
cells were identifiedimages in of
subG
IHC 0

phase, only
detection of the
Ki-67proportion
on MCF7 of cells in
spheres G0, Magnification
(3-D). G1, and S/G2/M phases are(d)
is indicated. indicated.
Histograms (c) Representative
show the Ki-67
images of IHC
index (left detection
panel) and theofmeanKi-67diameter
on MCF7 spheres
(right (3-D).
panel) Magnification
of MCF7 spheres. isIn indicated. (d) Histograms
the left panel, percentages
show the Ki-67onindex
were counted (left panel) regions
6 representative and the formean eachdiameter
treatment (right
afterpanel) of MCF7 by
Ki-67 detection spheres.
IHC. In Inthe
theright
left
panel,
panel, percentages
mean diameter werewascounted on 6on
calculated representative regionsfor
90 different spheres foreach
eachcondition.
treatmentStatistically
after Ki-67 significant
detection
by IHC. In the
differences areright panel,inmean
indicated diameter
comparison was1%
with calculated
FBS (**: pon < 90 different
0.001). Three spheres for each
independent condition.
experiments
Statistically
were [Link] differences are indicated in comparison with 1% FBS (**: p < 0.001). Three
independent experiments were performed.
Int. J. Mol. Sci. 2019, 20, 5626 6 of 15

2.3. Epinephrine Infiltration Changed Lipid Content and Proliferative Effect of Adipose Tissue
Conditioned Medium
For patients n◦ 4 to 10, two AT samples were successively collected: a first one without epinephrine
infiltration and a second one following infiltration with the epinephrine-lactated Ringer’s solution (ELR)
and were used to obtain, respectively, NI-CM and EI-CM. As previously observed with EI-CM from
patients n◦ 1 to 3, the CM obtained from EI-AT samples had an increased proliferative effect on MCF7
cells, whereas their counterpart CM obtained with non-infiltrated AT did not (Figure 3a, left panel).
As shown in Figure 3a (right panel), the ELR by itself had no effect on MCF7 cell proliferation. Because
epinephrine infiltration may modify the metabolite composition of the AT samples through lipolysis
enhanced by beta-adrenergic receptor activation, the comparison of lipid contents between NI-CM and
EI-CM was performed to identify potential molecular mediators leading to EI-CM pro-proliferative
effects. We compared the fatty acid content of AT-CM samples that were obtained from 5 donor sites
either non-injected (NI) or ephinephrine-lactated Ringer’s infiltrated (EI). EI-CM showed a higher
total lipid content compared to NI-CM of the corresponding donors (Figure 3b). This result suggested
that EI-CM and NI-CM may present a different lipid content; however, the percentages of saturated,
mono-unsaturated or polyunsaturated fatty acids (PUFAs n-3 and n-6) were similar (Figure 3c) and
there were no statistically significant differences in individual fatty acid between EI-CM and NI-CM
samples which were derived from 5 donor sites either infiltrated or non-infiltrated with ELR.

2.4. Injection of Epinephrine-Infiltrated Adipose Tissue or Corresponding Conditioned Medium into MCF7
Tumor in Mice
We were able to compare EI-AT and EI-CM injection in a preclinical model of breast carcinoma.
Orthotopic breast carcinoma were induced in athymic mice by intraductal injection of MCF7 cells and
a single injection of either PBS, EI-CM or EI-AT was performed at the tumor site after 90 days when
tumors were detectable (>70 mm3 ).
PBS-treated group (Figure 4b, top panel) showed a slow tumor development, reaching a mean
volume of 200 mm3 at day 160. Human Ki-67 protein detection confirmed the presence of tumor cells
in mammary ducts (Figure 4a, top panel) as well as in surrounding adipose and connective structures
(Figure 4a, middle panel). These observations may indicate that the tumor first grew within mammary
ducts before invading the rest of mammary fat pad, as a ductal carcinoma in situ that would have
turned invasive.
Two of six tumors in the EI-CM-injected group showed faster development compared to tumors of
the PBS-injected group (Figure 4b, top and middle panels, respectively); however differences between
the tumor volume means of these two groups were not significant at day 160. Tumor growth was more
similar between PBS-and EI-AT-injected groups (Figure 4b, top and low panels, respectively) than
between PBS- and EI-CM-injected groups. However the percentages of Ki-67 positive cells ranging
from 18 to 26% were not significantly different between EI-AT-, EI-CM- and PBS-treated groups as
determined after human Ki-67 protein immunohistochemical staining on tumor samples (Figure 4a).
These results indicate that EI-CM may have slightly (but not significantly) promoted MCF7 tumor
growth while corresponding whole EI-AT may not have modified breast tumor growth.
Int.
Int. J.
J. Mol. Sci. 2019,
Mol. Sci. 20, x5626
2019, 20, FOR PEER REVIEW 77 of 15
16

Figure 3. MCF7 cell growth and lipid composition depending on ELR solution infiltration of harvested
adipose
Figure 3. tissue.
MCF7(a)cell Histogram
growth shows the mitochondrial
and lipid activity of MCF7
composition depending on ELR cells measured
solution after 24 of
infiltration h.
For the left panel, cells were cultured in medium without FBS (0% FBS) or
harvested adipose tissue. (a) Histogram shows the mitochondrial activity of MCF7 cells measured supplemented with 10%
FBS
afteror24with
h. For50%theEI-CM and cells
left panel, 50% were
MEMcultured
α with 0%FBS.
in mediumAT samples
without were obtained
FBS (0% FBS) orfrom 2 different
supplemented
donors ◦
(n FBS ◦
4 andornwith
5) and were initially
with 10% 50% EI-CM and not-infiltrated
50% MEM α with (NI) or infiltrated
0%FBS. with ELR
AT samples (EI).obtained
were For rightfrompanel,
2
cells were cultured in a medium without FBS (0% FBS) or supplemented with 10%
different donors (n°4 and n°5) and were initially not-infiltrated (NI) or infiltrated with ELR (EI). For FBS, PBS or ELR,
representing
right panel, cells1 to were
50% of the total
cultured involume.
a medium < 0.05; FBS
*: pwithout ***: p(0%< 0.0001.
FBS) or(b) Histogram shows
supplemented the total
with 10% FBS,
lipid amount detected in conditioned medium from infiltrated with ELR (EI-CM) or
PBS or ELR, representing 1 to 50% of the total volume. *: p < 0.05; ***: p < 0.0001. (b) Histogram shows not-infiltrated AT
(NI-CM) for 5 patients (n ◦ 6 to n◦ 10) who are represented by a distinct geometric forms. Lipid amount is
the total lipid amount detected in conditioned medium from infiltrated with ELR (EI-CM) or not-
indicated
infiltratedinAT standard
(NI-CM) culture medium (n°6
for 5 patients without FBS who
to n°10) (MEM are **: p = 0.0045
α).represented by paired t-test.
a distinct (c) Histogram
geometric forms.
shows
Lipid amount is indicated in standard culture medium without FBS (MEM α). **: p = 0.0045with
the weight % of fatty acids derived from 5 donors either infiltrated or non-infiltrated ELR.
paired t-
Saturated, mono-unsaturated or polyunsaturated fatty acids (SFA, MUFA or PUFA)
test. (c) Histogram shows the weight % of fatty acids derived from 5 donors either infiltrated or non- were measured in
a conditioned medium of epinephrine lactated Ringer’s solution-infiltrated or non-infiltrated adipose
infiltrated with ELR. Saturated, mono-unsaturated or polyunsaturated fatty acids (SFA, MUFA or
tissue (EI-CM or NI-CM).
PUFA) were measured in a conditioned medium of epinephrine lactated Ringer’s solution-infiltrated
or non-infiltrated adipose tissue (EI-CM or NI-CM).
respectively) than between PBS- and EI-CM-injected groups. However the percentages of Ki-67
positive cells ranging from 18 to 26% were not significantly different between EI-AT-, EI-CM- and
PBS-treated groups as determined after human Ki-67 protein immunohistochemical staining on
tumor samples (Figure 4a). These results indicate that EI-CM may have slightly (but not significantly)
promoted MCF7
Int. J. Mol. Sci. tumor
2019, 20, 5626 growth while corresponding whole EI-AT may not have modified breast
8 of 15
tumor growth.

Figure
Figure 4.
4. Single
Singleinjection
injectionofofeither EI-AT
either or or
EI-AT EI-CM
EI-CMin in
MCF7 tumor
MCF7 induced
tumor in athymic
induced mouse.
in athymic (a)
mouse.
Immunohistochemical
(a) Immunohistochemical staining
stainingof of
human
humanKi-67 protein
Ki-67 ininMCF7
protein MCF7tumors
tumorsinjected
injectedwith
withPBS,
PBS,EI-CM
EI-CM or
or
EI-AT. Observation of mammary duct (top panel) and mammary fat pad (middle panel). (b) Evolution
of tumor volume is reported for each group of mice (n = 6); the mean tumor volume is represented by
a red line. The arrows indicate time of the intra-tumor injection of either PBS (top panel), or EI-CM
(middle panel group) or EI-AT (low panel). At days 145 and 160, no significant difference between
groups was detected by unpaired nonparametric method.

3. Discussion
AT transplantation has become an increasingly common technique in aesthetic breast augmentation,
in non-oncological and in oncological breast reconstruction [25]. Low complication rates, readily
available donor sites with low donor-site morbidity and an aesthetic benefit are some of the advantages
of the AT transfer. Although AT transplantation has proven effective in breast reconstruction, safety
concerns have been raised regarding its use in patients with a history of breast cancer [26–28]. At present,
large cohort retrospective studies or systematic literature reviews and meta-analyses suggest that
AT transplantation is safe with no increase of cancer recurrence risk for breast cancer patients after
treatments [29–33]. However AT harvesting procedures have been poorly described in these clinical
studies, whereas the lack of standardized protocols for harvesting may explain unpredictable clinical
outcomes with AT engraftment [34–36].
Ephinephrine-lactated Ringer’s solution is often used to infiltrate AT before harvesting, in order
to reduce bleeding, but it may modify the metabolite composition, especially cholesterol and fatty
acids, of AT samples since catecholamines induce lipolysis in adipocytes [37–39]. Interestingly,
Int. J. Mol. Sci. 2019, 20, 5626 9 of 15

polyunsaturated n-3 fatty acids in peritumoral AT of breast cancer patients may have beneficial effects
on the disease progression.
In this study, we sought to understand how soluble factors secreted by EI-AT may influence the
proliferation and quiescent state of breast cancer cells. EI-AT secreted factors that were collected in the
conditioned culture medium induced a significant increase in the proliferation rate (150% to 200%)
of MCF7 breast cancer cells, while non-infiltrated AT soluble factors did not. EI-AT secreted factors
increased MCF7 cell proliferation at least partially through the extracellular-regulated kinase (ERK)
1/2 signaling pathway. In a previous study using similar EI-CM samples, multi cytokine assay has
identified interleukin 6 (IL-6) and leptin as molecular candidates to induce increase of osteosarcoma
cell proliferation; however neither IL-6 nor leptin have been able to mimic the pro-proliferative effects
of EI-CM. By in vitro and preclinical studies, Danilo C. et al. have shown that cholesteryl ester via
its cellular receptor (scavenger receptor class B type I, SR-BI) increase breast cancer cell proliferation
through the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) pathway but not through
the mitogen-activated protein kinase (MAPK)/ERK1/2 pathway [40]. Despite the important role of
ERK1/2 in the proliferation of breast cancer cells in vitro, activation of ERK1/2 was not associated with
enhanced proliferation and invasion of 148 clinical mammary carcinomas [41].
During clinical procedures, EI-AT transplantation is never performed in a tumor site with
proliferative cancer cells. Plastic surgery is performed following a cancer-free period and at worst,
the primary tumor site may contain quiescent/dormant cancer cells. The quiescent state of breast cancer
cells in vitro was induced by culture under anchorage-independent conditions, using methylcellulose
in the culture medium. We observed that EI-CM induced an output of the quiescent state of MCF7
cells when maintained in non-adherent spheres: 14% of cells in G0 phase with EI-CM compared to 27%
or 24% in 1% and 10% FBS supplementation, respectively. Such 3-D culture conditions induced a slight
change from epithelial towards mesenchymal phenotypes of MCF7 cells, as suggested by MYC, CD44,
TWIST1/2 and SNAI1 expression increase associated with a decrease of CDH1 expression. We observed
that EI-CM did not enhance such potential EMT in MCF7 cells. In this study, we did not test EI-CM effect
on the migration of breast cancer cells and we did not use primary breast cancer stem cells which are
of high interest in the progression, treatment resistance and recurrence. Originally, Charvet H.J. et al.
have used one breast cancer cell line derived from one out of 10 patient specimens, and not a purchased
banked cell line. Charvet H.J. et al. showed a 10-fold migration increase of primary breast cancer cells
when cocultured with adipose-derived stem cells isolated from the same patient.
To conduct in vitro assays, an AT-conditioned medium (AT-CM) is usually used in the literature,
instead of the whole AT sample itself which would be injected into a patient. AT-CM contains AT
secreted and soluble factors including growth factors, cytokines and free fatty acids, but no adipocytes
or adipose-derived stem cells. Dirat B. et al. have demonstrated that adipocytes obtained from breast
AT during tumorectomy, exhibit a loss of lipid content, an expression increase of proinflammatory
cytokines and the ability to increase invasive capacities of breast cancer cell lines.
Conditioned media derived from epinephrine-infiltrated AT showed a pro-proliferative effect
on breast cancer cells and significantly higher lipid contents compared to non-infiltrated AT of
corresponding patients. However, the percentages of saturated, mono-unsaturated or polyunsaturated
fatty acids were similar in EI- or NI-CM. Recently, Wang Y.Y. et al. showed that free fatty acids released
from adipocytes were incorporated into breast cancer cells as triglycerides in lipid droplets and that
saturated fatty acids but not unsaturated ones were increased in cocultured cells [42]. Additionally,
they demonstrated that lipolysis in adipocytes was induced by tumor cell secretions, but was not
induced by catecholamines. In our study, only patients with a standard body mass index ranging from
20 to 22 were included. Because obesity is clearly related to a higher risk of cancer [43], including
breast cancer risk, it would be of interest to compare the total lipid contents of EI-CM derived from
obese and lean patients.
Epinephrine-infiltrated adipose tissue-conditioned medium (EI-CM) and whole
epinephrine-infiltrated adipose tissue (EI-AT) of the same patient were compared following
Int. J. Mol. Sci. 2019, 20, 5626 10 of 15

a single injection within breast carcinomas induced in athymic mice by intraductal injection of MCF7
cells. Interestingly, carcinoma growth was slow in this preclinical model; tumors were visible only
90 days after MCF7 cell injection, despite implantation of pellet delivering 17β-estradiol, and tumor
volumes were less than 400 mm3 two weeks after EI-AT or EI-CM single injections. A single injection
of EI-CM may have slightly but not significantly increased MCF7 tumor growth compared to a single
PBS injection. The untranslation of the EI-CM cellular effects to in vivo effects may be due to reversed
or transient effects that have not been tested in our in vitro study, or due to neutralization through
molecular interactions with physiological liquids. In contrast, corresponding whole EI-AT injection
did not modify breast tumor growth, in agreement with clinical studies which show that AT transfer
did not increase tumor recurrence and then, may have no effect on quiescent tumor cells.
MCF-7 cell line which is a luminal A subtype of breast cancer expressing estrogen and progesterone
receptors, is not the more aggressive and invasive model. It will be of high interest to test a model
with a higher metastatic potential such as the MDA-MB-231 cell line, a basal subtype of triple negative
breast cancer. We observed that EI-CM of patients n◦ 1 to 3 induced 50% increase in the proliferation
rate of MDA-MB-231 cells in culture (data not shown), but we did not investigate further this cell line
as we were not able to establish an adequate in vivo model using it. A low tumor incidence (50%) with
high variability of tumor size was obtained using MDA-MB-231 cell injection in nude mice.
In conclusion, epinephrine-infiltration of AT induces secretion of factors including lipids. This may
contribute to the pro-proliferative effect and output of the quiescent state that were observed
in vitro on MCF7 breast cancer cells. Moreover, such epinephrine-induced secreted factors seem
to increase the in vivo growth of MCF7-induced tumor in mice. However, a single injection of whole
epinephrine-infiltrated AT did not increase the slow progression of MCF7-induced tumor in mice,
revealing a discrepancy between the effects of AT-secreted soluble factors in the conditioned medium
and the whole AT sample which would be injected into a patient. The proportion of polyunsaturated
fatty acids was not modified by the epinephrine infiltration, despite the significant increase in secreted
lipids by EI-AT. The results of the EI-AT presented here do not call into question the safety of AT
transplantation, however it would be of interest to compare cancer recurrences in breast cancer patients
following the transplantation of AT harvested with or without epinephrine infiltration.

4. Materials and Methods

4.1. Adipose Tissue (AT)


AT samples: Human adipose tissue (AT) was obtained from abdominal liposuction during
plastic surgery at the University Hospital of Nantes. Donors (patients n◦ 1 to 10) with no significant
medical history gave informed consent for the use of surplus AT sample for anonymized unlinked
research, as validated by the “Comité de Protection des Personnes des Pays de la Loire” and by the
“Ministère de la Recherche” (Art. L. 1245-2 of the French public health code, Law no. 2004-800 of 6
August 2004, Official Journal of 7 August 2004) with declaration to the “Commission Nationale de
l’Informatique et des Libertés”. Ten AT samples were collected using a 12-gauge, 12-hole cannula
(Khouri Harvester) connected to a 10 mL Luer-Lock syringe after infiltration with 0.1% epinephrine
lactated Ringer’s solution as performed in our department to reduce bleeding. All patients had a
body mass index ranging from 20 to 22. For five patients, we obtained both epinephrine infiltrated
(EI) and non-infiltrated (NI) samples. Samples were centrifuged at 3000 rpm with a 9.5 cm radius
fixed angle rotor for 1 min (Medilite™, Thermo Fisher Scientific, Illkirch, France) at room temperature.
After centrifugation, the samples were separated into 3 layers: the upper one composed of oil, the
middle one composed of the adipose tissue and the bottom one with blood and infiltration solution.
Only middle layers corresponding to AT samples were collected.
AT-Conditioned Medium (AT-CM): AT samples were placed in cell culture inserts (pore size 3 µm;
Becton Dickinson, Le Pont de Claix, France) with Minimum Essential Medium alpha (Gibco® MEM α;
Life technologies, St Aubin, France) with nucleosides and 1 g/L D-Glucose (MEM) under serum-free
Int. J. Mol. Sci. 2019, 20, 5626 11 of 15

conditions. After 24 h, inserts with AT were removed and AT-CM was collected and frozen at minus
20 ◦ C.

4.2. Culture Conditions


MCF7 cells were initially derived from a human breast adenocarcinoma ATCC number HTB-22,
(ATCC, Manassas, VA, USA). They are a luminal subtype and express estrogen, progesterone and
glucocorticoid receptors. MEM α medium was supplemented with 10% fetal bovine serum (FBS)
and used to culture cells at 37 ◦ C in a humidified atmosphere (5% CO2 /95% air). For culture
under anchorage-independent conditions, 1 mL MEM α medium was supplemented with 1.05% of
methylcellulose (R&D Systems, Lille, France) and 1% FBS, and was seeded with 1 × 105 cells into a
well of 24-well plate for 3 days. Then 0.5 mL MEM α medium supplemented with 1% or 10% FBS or
with 25% EI-CM were added for 2 days. Complete FBS starving (0%) was avoided in 3-D culture to
maintain a low proportion (<5%) of cells in subG0 phase.

4.3. Cell Viability


Three thousand cells per well were cultured into 96-well plates with medium supplemented with
FBS, CM or chemical inhibitor of ERK1/2 phosphorylation, UO126 (R&D Systems). After 24 h, WST-1
reagent (Roche Diagnostics, Meylan, France) was added to each well for 2 h at 37 ◦ C. Then absorbance
was read at 450 nm.

4.4. Cell Cycle Analysis


MCF7 cells were obtained and analyzed as previously described [44]. Briefly, DNA was stained in
ethanol-fixed cells with propidium iodide (50 µg/mL; Sigma-Aldrich, Lyon, France) and Ki-67 protein
was eventually detected using a FITC-coupled mouse anti-human Ki-67 antibody (Becton-Dickinson,
Le pont de Claix, France). Cell fluorescence was measured by flow cytometry (Cytomics FC500;
Beckman Coulter, Villepinte, France). Cell-cycle distribution was analyzed for 20,000 events using
MultiCycle AV Software, Windows version (Phoenix Flow System, San Diego, CA, USA) to obtain
histograms of cell repartition in each cell-cycle phase and CXP Analysis software version 2.2 (Beckman
Coulter, Villepinte, France) to obtain dot-plots of DNA/Ki-67 double-staining.

4.5. Reverse Transcription and Quantitative PCR


Gene expression was observed as previously described [45], after RNA extraction (NucleoSpin
RNA II; Machery-Nagel, Düren, Germany), reverse transcription with ThermoScript RT (Invitrogen
Life Technologies, Villebon sur Yvette, France) and cDNA amplification using the IQ SYBR Green
Supermix (Bio-Rad, Marne la Coquette, France). For quantitative analysis, the iCycler iQ Real-time PCR
Detection system (Bio-Rad), was used to calculate relative fold change of gene expression, following the
delta delta Ct method [46]. The HPRT1 reference gene was used for normalization. Primer sequences
with corresponding gene symbol and name are indicated in Table 1.

4.6. Breast Carcinoma Model


Eight-week-old female athymic mice (NMRI nu/nu) were obtained from Elevages Janvier
(Le Genest St Isle, France). They were housed under pathogen-free conditions at the Experimental
Therapy Unit (Faculty of Medicine, Nantes, France). The experimental protocol was approved by the
regional committee on animal ethics ([Link].06) and the Minister of Agriculture (Authorisation
number: 9634) and was conducted following the guidelines “Charte nationale portant sur l’éthique de
l’expérimentation animale” of the French ethical committee. The mice were anaesthetized by inhalation
of an isoflurane-air mix (2% for induction and 0.5% for maintenance, 1 L/min) before injection with
2 × 106 MCF7 cells in 30 µL of Matrigel (R&D Systems) diluted in phosphate buffered saline (PBS
50%) into the 4th left mammary duct. At the time of cell injection, a pellet delivering 17β-estradiol
Int. J. Mol. Sci. 2019, 20, 5626 12 of 15

(Innovative Research of America, Sarasota, FL, USA) was subcutaneously implanted between the neck
and the left shoulder. Formula (l2 xL)/2, where l and L represent the smallest and largest diameter
respectively, was used to calculate the tumor volume [47].

4.7. Histology Analysis


Tumor samples were fixed in 4% buffered paraformaldehyde (PFA) for 48 h, while sphere samples
were fixed in 4% PFA for 15. Three µm-thick sections of tumors or spheres embedded in paraffin were
dewaxed, rehydrated and then treated with 3% H2 O2 for 15 min at room temperature. Human Ki-67
immunohistochemistry detection was then performed with a mouse monoclonal anti-human Ki-67
(MIB-1 clone; Dako, Les Ulis, France) and revealed with a biotinylated goat anti-mouse Immunoglobulin
G secondary antibody and Streptavidin-Horse Radish Peroxydase complexes (Dako) that were observed
following an incubation with 3,30 -Diaminobenzidine (DAB, Dako). Nuclei were counterstained with a
Gill-Haematoxylin solution. ImageJ software (NIH, Bethesda, MD, USA) was used to calculate the
proportion of Ki-67-positive cells, from counting >15,000 nuclei in 6 sections of each tumor sample or
>5000 nuclei in 6 sections of each sphere sample.

4.8. Lipid Analysis


Fatty acid composition analysis using gas chromatography: AT-CM were frozen in liquid nitrogen
before total lipid extraction according to the FOLCH method with chloroform-methanol 2:1 (v/v).
Extracts from AT-CM were washed with saline and separated into two phases. The chloroform
phase transferred to a new tube was evaporated. Lipid extracts were resuspended with 200 µl of
chloroform-methanol 2:1 (v/v). Triglycerids (TG) were separated on silica gel TLC plates (LK5, 20*20;
Merck St Quentin, Yvelines, France) for thin layer chromatography. After spot scraping, TG were
collected and treated as fatty acids methyl esters (FAME) for gas chromatography analysis.
Derivatization of fatty acids was performed with 14% boron trifluoride (in methanol),
which resulted in the formation of methyl esters. The derivatization mixture was incubated and shaken
for 30 min at 100 ◦ C. Finally, FAME were extracted twice with hexane and then evaporated to dryness.
Batch samples were analzsed with a gas chromatograph (GC-2010plus; Shimadzu Scientific instruments,
Noisiel, France) through a capillary column (SGE BPX70 GC Capillary Columns; Chromoptic SAS,
Courtaboeuf, France). A hydrogen carrier gas was maintained at 120 kPa. Oven temperature was set
to 60 ◦ C to 220 ◦ C and flame ionization detector temperature at 280 ◦ C for fatty acid detection. FAME
identification was done by comparing relative retention times of samples to those obtained for pure
standard mixtures (Supelco 37 fatty acid methyl Ester mix; Sigma Aldrich). The relative amount of each
fatty acid (saturated, mono-unsaturated or polyunsaturated fatty acid) was quantified by integrating
the baseline peak divided by the peak area corresponding to all fatty acids, using the GC solutions
software (Shimadzu Scientific instruments, Noisiel, France).

4.9. Statistical Analysis


Microsoft Excel software (Redmond, WA, USA) was used. In vitro experiments results
were analyzed following the analysis of variance t-test. In vivo experimentation results were
analyzed with the unpaired nonparametric method and Dunn’s multiple comparisons following
the Kruskal-Wallis test.

Author Contributions: Conceptualization, S.B.-N., P.P. and V.T.; methodology, P.A. and M.P.; validation, L.-R.L.N.,
P.P. and V.T.; formal analysis, P.A. and V.T.; writing—original draft preparation, L.V., S.C. and V.T.; writing—review
and editing, L.-R.L.N., V.T. and P.P.; project administration, V.T.; funding acquisition, F.R., P.L. and V.T.
Funding: This work was partly supported by INSERM, the University of Nantes and Cancéropole Grand Ouest
(AOE2016).
Acknowledgments: The authors wish to thank Brennan M for the manuscript revision, Guiho R and Bitteau K for
their help with in vivo experiments and Charrier C for the histology experiments.
Int. J. Mol. Sci. 2019, 20, 5626 13 of 15

Conflicts of Interest: The authors declare no conflicts of interest. The funders had no role in the design of the
study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to
publish the results.

References
1. Wolfson, B.; Eades, G.; Zhou, Q. Adipocyte activation of cancer stem cell signaling in breast cancer. World J.
Biol. Chem. 2015, 6, 39–47. [CrossRef]
2. D’Esposito, V.; Liguoro, D.; Ambrosio, M.R.; Collina, F.; Cantile, M.; Spinelli, R.; Raciti, G.A.; Miele, C.;
Valentino, R.; Campiglia, P.; et al. Adipose microenvironment promotes triple negative breast cancer cell
invasiveness and dissemination by producing CCL5. Oncotarget 2016, 7, 24495–24509.
3. Nieman, K.M.; Romero, I.L.; Van Houten, B.; Lengyel, E. Adipose tissue and adipocytes supports
tumorigenesis and metastasis. Biochim. Biophys. Acta 2013, 1831, 1533–1541. [CrossRef]
4. Iyengar, P.; Combs, T.P.; Shah, S.J.; Gouon-Evans, V.; Pollard, J.W.; Albanese, C.; Flanagan, L.; Tenniswood, M.P.;
Guha, C.; Lisanti, M.P.; et al. Adipocyte-secreted factors synergistically promote mammary tumorigenesis
through induction of anti-apoptotic transcriptional programs and proto-oncogene stabilization. Oncogene
2003, 22, 6408–6423. [CrossRef]
5. Dirat, B.; Bochet, L.; Dabek, M.; Daviaud, D.; Dauvillier, S.; Majed, B.; Wang, Y.Y.; Meulle, B.; Salles, B.;
Gonidec, S.L.; et al. Cancer-associated adipocytes exhibit an activated phenotype and contribute to breast
cancer invasion. Cancer Res. 2011, 71, 2455–2465. [CrossRef] [PubMed]
6. Kornfeld, S.; Goupille, C.; Vibet, S.; Chevalier, S.; Pinet, A.; Lebeau, J.; Tranquart, F.; Bougnoux, P.; Martel, E.;
Maurin, A.; et al. Reducing endothelial NOS activation and interstitial fluid pressure with n-3 PUFA offset
tumor chemoresistance. Carcinogenesis 2012, 33, 260–267. [CrossRef]
7. Ouldamer, L.; Goupille, C.; Vildé, A.; Arbion, F.; Body, G.; Chevalier, S.; Cottier, J.P.; Bougnoux, P. N-3
Polyunsaturated Fatty Acids of Marine Origin and Multifocality in Human Breast Cancer. PLoS ONE 2016,
11, e0147148. [CrossRef]
8. Chauvin, L.; Goupille, C.; Blanc, C.; Pinault, M.; Domingo, I.; Guimaraes, C.; Bougnoux, P.; Chevalier, S.;
Maheo, K. Long chain n-3 polyunsaturated fatty acids increase the efficacy of docetaxel in mammary cancer
cells by downregulating Akt and PKCε/δ-induced ERK pathways. Biochim. Biophys. Acta 2016, 1861, 380–390.
[CrossRef] [PubMed]
9. Biondo, P.D.; Brindley, D.N.; Sawyer, M.B.; Field, C.J. The potential for treatment with dietary long-chain
polyunsaturated n-3 fatty acids during chemotherapy. J. Nutr. Biochem. 2008, 19, 787–796. [CrossRef]
10. Calviello, G.; Serini, S.; Piccioni, E.; Pessina, G. Antineoplastic effects of n-3 polyunsaturated fatty acids in
combination with drugs and radiotherapy: Preventive and therapeutic strategies. Nutr. Cancer 2009, 61,
287–301. [CrossRef]
11. Bougnoux, P.; Hajjaji, N.; Maheo, K.; Couet, C.; Chevalier, S. Fatty acids and breast cancer: Sensitization to
treatments and prevention of metastatic re-growth. Prog. Lipid. Res. 2010, 49, 76–86. [CrossRef]
12. Kronowitz, S.J.; Mandujano, C.C.; Liu, J.; Kuerer, H.M.; Smith, B.; Garvey, P.; Jagsi, R.; Hsu, L.; Hanson, S.;
Valero, V. Lipofilling of the breast does not increase the risk of recurrence of breast cancer: A matched
controlled study. Plast. Reconstr. Surg. 2016, 137, 385–393. [CrossRef]
13. Charvet, H.J.; Orbay, H.; Wong, M.S.; Sahar, D.E. The oncologic safety of breast fat grafting and contradictions
between basic science and clinical studies: A systematic review of the recent literature. Ann. Plast. Surg.
2015, 75, 471–479. [CrossRef]
14. Gentile, P.; Casella, D.; Palma, E.; Calabrese, C. Engineered fat graft enhanced with adipose-derived stromal
vascular fraction cells for regenerative medicine: Clinical, histological and instrumental evaluation in breast
reconstruction. J. Clin. Med. 2019, 8, 504. [CrossRef]
15. Petit, J.Y.; Rietjens, M.; Botteri, E.; Rotmensz, N.; Bertolini, F.; Curigliano, G.; Rey, P.; Garusi, F.; De Lorenzi, S.;
Martella, S.; et al. Evaluation of fat grafting safety in patients with intraepithelial neoplasia: A matched-cohort
study. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2013, 24, 1479–1484. [CrossRef]
16. Geissler, P.J.; Davis, K.; Roostaeian, J.; Unger, J.; Huang, J.; Rohrich, R.J. Improving fat transfer viability:
The role of aging, body mass index, and harvest site. Plast. Reconstr. Surg. 2014, 134, 227–232. [CrossRef]
Int. J. Mol. Sci. 2019, 20, 5626 14 of 15

17. Gentile, P.; De Angelis, B.; Di Pietro, V.; Amorosi, V.; Scioli, M.G.; Orlandi, A.; Cervelli, V. Gentle Is Better:
The original “Gentle Technique” for fat placement in breast lipofilling. J. Cutan. Aesthet. Surg. 2018, 11,
120–126. [CrossRef] [PubMed]
18. Gentile, P.; Orlandi, A.; Scioli, M.G.; Di Pasquali, C.; Bocchini, I.; Curcio, C.B.; Floris, M.; Fiaschetti, V.;
Floris, R.; Cervell, V. A comparative translational study: The combined use of enhanced stromal vascular
fraction and platelet-rich plasma improves fat grafting maintenance in breast reconstruction. Stem Cells
Transl. Med. 2012, 1, 341–351. [CrossRef]
19. Gentile, P.; Scioli, M.G.; Orlandi, A.; Cervelli, V. Breast reconstruction with enhanced stromal vascular
fraction fat grafting: What is the best method? Plast. Reconstr. Surg. Glob. Open 2015, 3, e406. [CrossRef]
20. Hamza, A.; Lohsiriwat, V.; Rietjens, M. Lipofilling in breast cancer surgery. Gland Surg. 2013, 2, 7–14.
[PubMed]
21. Large, V.; Hellström, L.; Reynisdottir, S.; Lönnqvist, F.; Eriksson, P.; Lannfelt, L.; Arner, P. Human beta-2
adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2
adrenoceptor function. J. Clin. Investig. 1997, 100, 3005–3013. [CrossRef] [PubMed]
22. Girard, Y.K.; Wang, C.; Ravi, S.; Howell, M.C.; Mallela, J.; Alibrahim, M.; Green, R.; Hellemann, G.;
Mohapatra, S.S.; Mohapatra, S. A 3D fibrous scaffold inducing tumoroids: A platform for anticancer drug
development. PLoS ONE 2013, 8, e75345. [CrossRef]
23. Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of
tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [CrossRef]
24. Cuylen, S.; Blaukopf, C.; Politi, A.Z.; Müller-Reichert, T.; Neumann, B.; Poser, I.; Ellenberg, J.; Hyman, A.A.;
Gerlich, D.W. Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Nature 2016, 535, 308–312.
[CrossRef]
25. Niddam, J.; Vidal, L.; Hersant, B.; Meningaud, J.P. Primary Fat Grafting to the Pectoralis Muscle during
Latissimus Dorsi Breast Reconstruction. Plast. Reconstr. Surg. Glob. Open 2016, 4, 1059. [CrossRef]
26. Lohsiriwat, V.; Curigliano, G.; Rietjens, M.; Goldhirsch, A.; Petit, J.Y. Autologous fat transplantation in
patients with breast cancer: «silencing» or “fueling” cancer recurrence? Breast Edinb. Scotl. 2011, 20, 351–357.
[CrossRef] [PubMed]
27. Charvet, H.J.; Orbay, H.; Harrison, L.; Devi, K.; Sahar, D.E. In vitro effects of adipose-derived stem cells on
breast cancer cells harvested from the same patient. Ann. Plast. Surg. 2016, 76, S241–S245. [CrossRef]
28. Fraser, J.K.; Hedrick, M.H.; Cohen, S.R. Oncologic risks of autologous fat grafting to the breast. Aesthet. Surg.
J. 2011, 31, 68–75. [CrossRef]
29. Silva-Vergara, C.; Fontdevila, J.; Weshahy, O.; Yuste, M.; Descarrega, J.; Grande, L. Breast cancer recurrence is
not increased with lipofilling reconstruction: A case-controlled study. Ann. Plast. Surg. 2017, 79, 243–248.
[CrossRef] [PubMed]
30. Largo, R.D.; Tchang, L.A.H.; Mele, V.; Scherberich, A.; Harder, Y.; Wettstein, R.; Schaefer, D. Efficacy, safety
and complications of autologous fat grafting to healthy breast tissue: A systematic review. J. Plast. Reconstr.
Aesthetic Surg. 2014, 67, 437–448. [CrossRef]
31. Cohen, O.; Lam, G.; Karp, N.; Choi, M. Determining the oncologic safety of autologous fat grafting as a
reconstructive modality: An institutional review of breast cancer recurrence rates and surgical outcomes.
Plast. Reconstr. Surg. 2017, 140, 382e–392e. [CrossRef]
32. Wazir, U.; El Hage Chehade, H.; Headon, H.; Oteifa, M.; Kasem, A.; Mokbel, K. Oncological safety of
lipofilling in patients with breast cancer: A meta-analysis and update on clinical practice. Anticancer Res.
2016, 36, 4521–4528. [CrossRef]
33. Gigli, S.; Amabile, M.I.; Pastena, F.D.; De Luca, A.; Gulia, C.; Manganaro, L.; Monti, M.; Ballesio, L. Lipofilling
outcomes mimicking breast cancer recurrence: Case report and update of the literature. Anticancer. Res. 2017,
37, 5395–5398.
34. Suszynski, T.M.; Sieber, D.A.; Van Beek, A.L.; Cunningham, B.L. Characterization of adipose tissue for
autologous fat grafting. Aesthet. Surg. J. 2015, 35, 194–203. [CrossRef]
35. Spear, S.L.; Coles, C.N.; Leung, B.K.; Gitlin, M.; Parekh, M.; Macarios, D. The safety, effectiveness, and
efficiency of autologous fat grafting in breast surgery. Plast. Reconstr. Surg. Glob. Open 2016, 4, e827.
[CrossRef]
36. Waked, K.; Colle, J.; Doornaert, M.; Cocquyt, V.; Blondeel, P. Systematic review: The oncological safety of
adipose fat transfer after breast cancer surgery. Breast Edinb. Scotl. 2017, 31, 128–136. [CrossRef]
Int. J. Mol. Sci. 2019, 20, 5626 15 of 15

37. Lafontan, M.; Berlan, M. Fat cell adrenergic receptors and the control of white and brown fat cell function.
J. Lipid Res. 1993, 34, 1057–1091.
38. Bougnères, P.; Stunff, C.L.; Pecqueur, C.; Pinglier, E.; Adnot, P.; Ricquier, D. In vivo resistance of lipolysis to
epinephrine. A new feature of childhood onset obesity. J. Clin. Investig. 1997, 99, 2568–2573. [CrossRef]
39. Jocken, J.W.E.; Blaak, E.E. Catecholamine-induced lipolysis in adipose tissue and skeletal muscle in obesity.
Physiol. Behav. 2008, 94, 219–230. [CrossRef]
40. Danilo, C.; Gutierrez-Pajares, J.L.; Mainieri, M.A.; Mercier, I.; Lisanti, M.P.; Frank, P.G. Scavenger receptor
class B type I regulates cellular cholesterol metabolism and cell signaling associated with breast cancer
development. Breast Cancer Res. 2013, 15, R87. [CrossRef]
41. Milde-Langosch, K.; Bamberger, A.M.; Rieck, G.; Grund, D.; Hemminger, G.; Müller, V.; Longing, T. Expression
and prognostic relevance of activated extracellular-regulated kinases (ERK1/2) in breast cancer. Br. J. Cancer
2005, 92, 2206–2215. [CrossRef]
42. Wang, Y.Y.; Attané, C.; Milhas, D.; Dirat, B.; Dauvillier, S.; Guerard, A.; Gilhodes, G.; Lazar, I.; Alet, N.;
Laurent, V.; et al. Mammary adipocytes stimulate breast cancer invasion through metabolic remodeling of
tumor cells. JCI. Insight. 2017, 2, e87489. [CrossRef]
43. Basen-Engquist, K.; Chang, M. Obesity and cancer risk: Recent review and evidence. Curr. Oncol. Rep. 2011,
13, 71–76. [CrossRef]
44. Chipoy, C.; Brounais, B.; Trichet, V.; Battaglia, S.; Berreur, M.; Oliver, L.; Juin, P.; Redini, F.; Heymann, D.;
Blanchard, F. Sensitization of osteosarcoma cells to apoptosis by oncostatin M depends on STAT5 and p53.
Oncogene 2007, 26, 6653–6664. [CrossRef]
45. Avril, P.; Le Nail, L.R.; Brennan, M.Á.; Rosset, P.; De Pinieux, G.; Layrolle, P.; Layrolle, P.; Heymann, D.;
Trichet, V.; Perrot, P. Mesenchymal stem cells increase proliferation but do not change quiescent state of
osteosarcoma cells: Potential implications according to the tumor resection status. J. Bone Oncol. 2015, 5,
5–14. [CrossRef]
46. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [CrossRef]
47. Gernapudi, R.; Yao, Y.; Zhang, Y.; Wolfson, B.; Roy, S.; Duru, N.; Eades, G.; Yang, P.; Zhou, Q. Targeting
exosomes from preadipocytes inhibits preadipocyte to cancer stem cell signaling in early-stage breast cancer.
Breast Cancer Res. Treat. 2015, 150, 685–695. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license ([Link]
Titre : Apport de l’impression 3D et de la vascularisation dans la régénération de grands défauts
osseux

Mots clés : Chirurgie reconstructive - Ingénierie tissulaire - Impression 3D – Grands défauts osseux

Résumé : La reconstruction de grands défauts osseux de taille critique chez le lapin. Cette étude
osseux d’origine traumatique ou tumorale animale démontre l’intérêt de la vascularisation
constitue un défi pour les orthopédistes et les dans la régénération osseuse mais nécessite
chirurgiens plasticiens. Cette thèse est divisée en deux chirurgies.
trois chapitres. Le troisième chapitre vise à étudier la faisabilité
Le premier chapitre décrit les différentes options de régénérer de grands défauts osseux en une
chirurgicales actuelles et propose de nouvelles seule étape chirurgicale en utilisant des
technologies telles que l’impression 3D dans la biomatériaux en phosphate de calcium
régénération de grands défauts osseux. La personnalisés et imprimés en 3D, avec ou sans
technique de référence en matière de vascularisation. Cette dernière étude démontre la
reconstruction osseuse est la greffe autologue à faisabilité de la planification pré-chirurgicale et de
lambeau libre qui contient les cellules du patient, la reconstruction de grands défauts osseux avec
ses facteurs de croissance et un apport vasculaire des biomatériaux anatomiques et l’apport d'une
mais induit une morbidité importante au site de vascularisation axiale dans la régénération
prélèvement. osseuse.
Le deuxième chapitre évalue une approche En conclusion, ce travail permet de proposer une
expérimentale consistant à produire in situ un nouvelle approche en médecine régénérative,
greffon osseux synthétique pré-vascularisé et à le personnalisée et vascularisée, pour la
greffer dans un second temps dans un défaut reconstruction de grands défauts osseux.

Title : Large bone defects reconstruction by using 3D printing and vascularization

Keywords : Reconstructive Surgery -Tissue Engineering - 3D Printing - Large Bone Defect

Abstract : Large bone defect reconstruction vascularization of synthetic bone grafts for
constitutes a challenge for orthopedists and regenerating large bone defects but still required
plastic surgeons. This thesis is divided into three two surgeries.
chapters. The first chapter gives a review of the The third chapter aimed to investigate the
current surgical options and future technologies feasibility of regenerating large bone defects in
such as 3D printing for regeneration of large one surgical step by using 3D-printed customized
bone defects. The gold standard technique for calcium phosphate scaffolds with or without
bone reconstruction is autologous free flap vascularization. This pre-clinical study
transplantation that contains patient’s own cells, demonstrated the benefits of pre-surgical planning
growth factors and a vascularization bed but for reconstruction of large bone defects with 3D-
induces morbidity. The second chapter evaluates printed personalized scaffolds and axial
an experimental approach consisting of the in vascularization.
situ production of a pre-vascularized synthetic In conclusion, this works enables to propose a new
bone graft and its subsequent transplantation to approach in regenerative medicine with
a critical-sized bone defect in rabbits. This animal customized and vascularized for large bone defect
study demonstrated the benefit of pre- reconstruction.

Vous aimerez peut-être aussi