ISSN-2007-8080

REVISTA MEXICANA DE
FITOPATOLOGÍA
MEXICAN JOURNAL OF PHYTOPATHOLOGY
Fully Bilingual

VOLUMEN 36, NÚMERO 1, Enero 2018

Órgano Internacional de Difusión de la

Sociedad Mexicana de Fitopatología, A.C.
Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology
Sociedad Mexicana de Fitopatología, A. C.

Volumen 36, Número 1, 2018

Fully Bilingual

Editor en Jefe * Editor in Chief

Dr. Gustavo Mora Aguilera, Colegio de Postgraduados.

Editor Técnico * Technical Editor

Tec. Noemi De La Rosa Sánchez, RMF.

Composición Web * Web Composition

M.C. Eduardo Guzmán Hernández, LANREF, Colegio de Postgraduados.

Editoras(es) Adjuntos * Senior Editors

Dra. Sylvia Patricia Fernández Pavía, UMSNH.
Dra. Graciela Dolores Ávila Quezada, UACH.
Dr. Ángel Rebollar Alviter, UACh.
Dra. Irasema del Carmen Vargas Arispuro, CIAD.

Comité Editorial Internacional * International Editorial Advisory Board

Dr. Rodrigo Valverde, LSU, USA.
Dr. Sami Jorge Micheref, Universidad Federal Rural de Pernambuco, Br.
Dr. Miguel Dita Rodríguez, EMBRAPA, Br.
Dr. Vicente Febres, University of Florida, USA.

Editoras(es) Asociados * Associate Editors

Dra. Nadia Landero Valenzuela, UPFIM.
Dr. Luis Pérez Moreno, UGTO.
Dra. Ma. Alejandra Gutiérrez Espinosa, COLPOS.
Dra. Yuridia Mercado Flores, UPP.
Dr. Gabriel Rincón Enríquez, CIATEJ.
Dr. Misael Martínez Bolaños, INIFAP.
Dr. Víctor Manuel Guerrero Prieto, UACH.
MC. Hilda Elizabet Flores Moctezuma, IPN.
Dr. Daniel Leobardo Ochoa Martínez, COLPOS.
Dr. Claudio Rios Velasco, CIAD.
Dr. Hipolito Cortez Madrigal, IPN.
Dr. Remigio Anastacio Guzmán Plazola, COLPOS.

Portada: Malezas asociadas al cultivo de papayo con síntomas de virales de PRSV.

Original: Juan Florencio Gómez Leyva/Pág. 1-15.
Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology

Volumen 36, Número 1, 2018

Fully Bilingual

Artículos Científicos * Scientific Articles

Presence of Papaya ringspot virus (PRSV) in weed associated with Carica papaya in
1
Colima, Mexico * Presencia de Papaya ringspot virus (PRSV) en arvenses asociadas a
Carica papaya en Colima, México.
Bermúdez-Guzmán MJ, Guzmán-González S, Lara-Reyna J, Palmeros-Suárez PA, López-
Muraira IG, Gómez-Leyva JF.

Detection of Sugarcane mosaic virus (SCMV) in Saccharum spp. in Mexico and

16
phylogenetic origin of one isolate from Jalisco * Detección del Sugarcane mosaic virus
(SCMV) en Saccharum spp. en México y origen filogenético de un aislado de Jalisco.
Bermúdez-Guzmán MJ, Delgado-Virgen FJ, Cervantes-Preciado JF, García-Preciado JC,
Farías-Cervantes VS.

Root endophyte bacteria in drought-tolerant and drought-susceptible maize lines * 35
Bacterias endófitas de la raíz en líneas de maíces tolerantes y susceptibles a sequía.
Sánchez-Bautista A, De León-García de Alba C, Aranda-Ocampo S, Zavaleta-Mejía E,
Nava-Díaz C, Goodwin PH, Leyva-Mir SG.

Artículos de Revisión * Review Articles

Wood preservatives and microbial exudates with antagonistic activity against biologi-
56
cal agents * Preservadores maderables y exudados microbianos con actividad antagonista
contra agentes biológicos deletéreos.
García-Ortiz VR, Benítez-Rocha G, Martínez-Pacheco M, Velázquez-Becerra C.

Phosphites as alternative for the management of phytopathological problems * Los

79
fosfitos como alternativa para el manejo de problemas fitopatológicos.
Yáñez-Juárez MG, López-Orona CA, Ayala-Tafoya F, Partida-Ruvalcaba L, Velázquez-
Alcaraz TJ, Medina-López R.

The genus Bacillus as a biological control agent and its implications in the agricultu- 95
ral biosecurity * El género Bacillus como agente de control biológico y sus implicaciones
en la bioseguridad agrícola.
Villarreal-Delgado MF, Villa-Rodríguez ED, Cira-Chávez LA, Estrada-Alvarado MI, Pa-
rra-Cota FI, De los Santos-Villalobos S.
Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology

Volumen 36, Número 1, 2018

Fully Bilingual

Notas Fitopatológicas * Phytopathological notes

Variability and symptoms caused by Iris yellow spot virus in Nicotiana benthamiana 131
* Variabilidad y síntomas causados por Iris yellow spot virus en Nicotiana benthamiana.
Ornelas-Ocampo K, Ochoa-Martínez DL, Aranda-Ocampo S, Ramírez-Rojas S, García-
Ruíz H.

Effect of natural oils against Mycosphaerella fijiensis under in vitro conditions and 141
detection of active plant chemicals * Efecto de aceites naturales contra Mycosphaerella
fijiensis en condiciones in vitro y detección de fitoquímicos activos.
Gutiérrez-Jiménez E, Pedroza-Sandoval A, Martínez-Bolaños L, Samaniego-Gaxiola JA,
García-González F.

Differential gene expression of avocado defense genes in response to avocado sun- 151
blotch viroid infection * Expresión diferencial de genes de defensa en aguacate en res-
puesta a la infección del viroide de la mancha de sol del aguacate.
López-Rivera LA, Ramírez-Ramírez I, González-Hernández VA, Cruz-Huerta N, Téliz-
Ortiz D.

In vitro antifungal activity of garlic essential oil (Allium sativum L.) against Alternaria
162
tenuissima * Actividad antifúngica in vitro del aceite esencial de ajo (Allium sativum L.)
contra Alternaria tenuissima.
Muy-Rangel MD, Osuna-Valle JR, García-Estrada RS, San Martín-Hernández C, Quinta-
na-Obregón EA.

Selection in vitro of mycoparasites with potential for biological control on Coffee Leaf 172
Rust (Hemileia vastatrix) * Selección in vitro de micoparásitos con potencial de control
biológico sobre roya del café (Hemileia vastatrix).
Gómez-De La Cruz I, Pérez-Portilla E, Escamilla-Prado E, Martínez-Bolaños M, Carrión-
Villarnovo GLL, Hernández-Leal TI.

Morphological and molecular identification of Mortierella species associated to rhi-

184
zosphere of apple trees with symptoms of root diseases * Identificación morfológica y
molecular de especies de Mortierella asociados a rizosfera de manzanos con síntomas de
enfermedades radiculares.
Mares-Ponce de León Y, Muñoz-Castellanos LN, Ruiz-Cisneros MF, Pérez-Corral DA,
Ornelas-Paz JJ, Acosta-Muñiz CH, Berlanga-Reyes DI, Rios-Velasco C.
Presence of Papaya ringspot virus (PRSV) in weed associated
with Carica papaya in Colima, Mexico

Presencia de Papaya ringspot virus (PRSV) en arvenses

asociadas a Carica papaya en Colima, México

Manuel de Jesús Bermúdez-Guzmán, INIFAP Campo experimental Tecomán. Km 35 Autopista Colima-

Manzanillo. C.P. 28100, Tecomán, Colima; Salvador Guzmán-González, Universidad de Colima, Km 40
Autopista Colima-Manzanillo, C.P. 28100, Tecomán, Colima; Joel Lara-Reyna, Colegio de Postgraduados,
Campus Campeche. Km. Carretera Haltunchen-Edzna Km. 17.5, C.P. 24450, Sihochac, Champotón, Campe-
che; Paola A. Palmeros-Suárez, CUCBA. Universidad de Guadalajara. Camino Ramón Padilla Sánchez No.
2100 Nextipac, C.P. 45200, Zapopan, Jalisco; Irma G. López-Muraira, Juan Florencio Gómez-Leyva*,
TecNM-Instituto Tecnológico de Tlajomulco. Km 10 Carretera a San Miguel de Cuyutlán, C.P. 45640, Tlajo-
mulco de Zúñiga, Jalisco. *Autor para correspondencia: jfgleyva@[Link].

Recibido: 21 de Junio, 2017. Aceptado: 31 de Agosto, 2017.

Bermúdez-Guzmán MJ, Guzmán-González S, Lara-Rey- Abstract. Papaya ringspot virus (PRSV) is a

na J, Palmeros-Suárez PA, López-Muraira IG, Gómez-Le- Potyvirus of economic importance for papaya
yva JF. 2017. Presence of Papaya ringspot virus (PRSV) crops (Carica papaya L.) whose main symptoms
in weed associated with Carica papaya in Colima, Mexi- are mosaic, chlorosis and deformation in leaves, as
co. Revista Mexicana de Fitopatología 36(1):1-15. well as ring-like characteristic spots on the fruit. In
DOI: 10.18781/[Link].1706-2 Mexico, there is no report on weed species associated
with this crop that act as reservoir of Potyvirus. In
Primera publicación DOI: 17 de Octubre, 2017. the present study, the presence of PRSV in weeds
First DOI publication: October 17, 2017. of commercial papaya plantations was identified in
the state of Colima, Mexico. In a sample of 139
papaya plants and 70 weed samples with symptoms
Resumen. Papaya ringspot virus (PRSV) es un of viral infections, PRSV was detected in 40 and
Potyvirus de importancia económica para el cultivo 50% for Carica papaya and Cucurbita pepo,
de papayo (Carica papaya L.) produciendo sínto- respectively, using DAS-ELISA (Double antibody
mas de mosaico, clorosis y deformación en las ho- sandwich enzyme-linked immunosorbent assays).
jas, así como manchas características en forma de Nucleotide sequence analyses of the 350 base pairs
anillo en el fruto. En México no existen reportes de fragments of the PRbV NIb region generated by
especies de arvenses asociadas a este cultivo que RT-PCR (Reverse Transcription-Polymerase Chain
actúen como reservorio del Potyvirus. En el pre- Reaction) allowed the identification of Potyvirus
sente trabajo, se identificó la presencia de PRSV in 40-90% of the total samples of Abutilon

Publicación en línea, enero 2018 1

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

en arvenses de plantaciones comerciales de papa- abutilastrum and Anoda cristata (Malvaceae), as

yo del estado de Colima, México. En un muestreo well as Solanum rostratum (Solanaceaea), which
de 139 plantas de papayo y 70 arvenses con sin- represents a new report on PRSV reservoir weeds
tomatología de virosis, se detectó a PRSV en un associated with papaya crops in Mexico.
40 y 50% para Carica papaya y Cucurbita pepo
respectivamente mediante DAS-ELISA (Ensayo Key words: weed, alternate hosts, DAS-ELISA,
por inmunoabsorción ligado a enzimas con doble RT-PCR, Potyvirus.
anticuerpo en sándwich), mientras que el análisis
de la secuencia de 350 pares de bases de la región
NIb de PRSV generados por RT-PCR (reacción en Papaya (Carica papaya L.) is a tropical
cadena de la polimerasa con transcriptasa reversa) herbaceous plant native to Mexico and Central
permitió identificar al Potyvirus en un 40 a 90% del America whose fruit is commercially important.
total de muestras de Abutilon abutilastrum y Anoda Ranked fifth among exporters worldwide, Mexico
cristata (Malvaceae), así como Solanum rostratum produces 951,921 tons of papaya. Colima holds
(Solanaceaea), lo que representa un nuevo reporte the second place in papaya domestic production
de arvenses reservorio de PRSV asociadas a plan- with 146,244 ton on an area of nearly 1,800 ha,
taciones de papayo en México. and the first place with 60% of papaya exports.
Papaya cultivation creates around 1,500 direct
Palabras clave: maleza, hospederos alternos, employments and economic benefits ranging from
DAS-ELISA, RT-PCR, Potyvirus. 300 to 400 million pesos a year (SIAP, 2016).
Plague and diseases are important factors
that reduce the quality of papaya fruit for human
El papayo (Carica papaya L.) es una planta her- consumption. Viruses affecting papaya crops cause
bácea tropical nativa de México y Centroamérica, diseases of economic importance worldwide that
cuyo fruto es comercialmente importante. México pose a serious threaten because they reduce fruit
es el quinto exportador de papaya a nivel mundial, production or even cause the total loss of infested
con una producción de 951,921 toneladas. Colima plantations (Navanath et al., 2017). Over 10 viruses
es el segundo estado con mayor producción de pa- affecting papaya have been reported worldwide
paya en el país con146, 244 toneladas, tiene una su- from which the most important are Papaya leaf
perficie de aproximadamente 1,800 ha sembradas, distortion mosaic virus (PLDMV), Papaya lethal
y ocupa el primer lugar con el 60% de las exporta- yellowing virus (PLYV), Papaya mosaic virus
ciones. El cultivo genera alrededor de 1,500 em- (PapMV), Papaya melaira virus (PMeV) and
pleos directos y una derrama económica de entre Papaya ringspot virus (PRSV) (Abreu et al., 2015).
300 y 400 millones de pesos al año (SIAP, 2016). The latter belongs to the family Potyviridae, genus
Las plagas y enfermedades son factores impor- Potyvirus (Fauquet et al., 2005), it is transmitted by
tantes que afectan la calidad del fruto de papaya vector aphids in a non-persistent manner, develops
para el consumo humano. Los virus que infectan symptoms in the form of mosaics, chlorosis, leaf
plantas de papayo han causado enfermedades de distortion and ring-like spots, and is responsible for
importancia económica a nivel mundial, represen- crop losses ranging from 50 to 90%, and from 30 to
tando serios problemas en la reducción de la pro- 40% at postharvest (Hernández-Castro et al., 2004;
ducción de fruta, e incluso, en la destrucción total de Hernández-Castro et al., 2015).

Publicación en línea, enero 2018 2

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

huertos infestados (Navanath et al., 2017). Se han It has been observed that PRSV’s survival greatly
reportado más de 10 virus que afectan este cultivo depends on its capacity to spread from host to host
en todo el mundo, entre estos los más importan- and that weeds in papaya crops can serve as PRSV
tes son Papaya leaf distortion mosaic virus (PLD- reservoirs. Isolates of this virus belong mainly to
MV), Papaya lethal yellowing virus (PLYV), Pa- two different strains known as PRSV-P (papaya)
paya mosaic virus (PapMV), Papaya melaira virus and PRSV-W (watermelon), where the hosts range
(PMeV) y Papaya ringspot virus (PRSV) (Abreu of the P strain is limited to plants of the Caricaceae,
et al., 2015). Este último virus pertenece a la fami- Cucurbitaceae and Chenopodiaceae families,
lia Potyviridae y al género Potyvirus (Fauquet et whereas the isolates of the W strain mainly infect
al., 2005), el cual se transmite por áfidos vectores plants of the Cucurbitaceae and Chenopodiaceae
de manera no persistente y genera síntomas de mo- families (Chin et al., 2007; Tripathi et al., 2008).
saicos, clorosis, distorsión en las hojas y manchas Research has been conducted at international
características en forma de anillo en el fruto, oca- level to identify papaya weeds carrying PRSV. In
sionando pérdidas del 50 al 90% del cultivo y 30 Brazil, a study was conducted to evaluate natural
al 40% en postcosecha (Hernández-Castro et al., infection of cucurbitaceous species inside and
2004; Hernández-Castro et al., 2015). outside of papaya crops infected with PRSV-P using
Se ha observado, que la supervivencia del ELISA and RT-PCR tests (Mansilla et al., 2013).
PRSV depende en gran medida de su capacidad In Florida, the presence of PRSV-W was reported
para dispersarse a nuevos hospederos, donde las ar- in plant species of the family Cucurbitaceae that
venses que se encuentran en los cultivos del papa- damage cucumber, squash, melon and watermelon
yo pueden fungir como reservorios del mismo. Los crops; PRSV-W was also reported as a host of
aislados de este virus pertenecen principalmente a Momordica balsamina, Melothria pendula and
dos cepas diferentes, denominadas como PRSV-P Coccinia grandis (Goyal et al., 2012; Tantiwanich
(papaya) y PRSV-W (watermelon), donde el ran- et al., 2014). In Jamaica, using DAS-ELISA, it
go de hospederos de la cepa P se limita a plantas was found that M. charantia is a host for PRSV-P
de las familias Caricaceae, Cucurbitaceae y Che- (Chin et al., 2007). In addition to reports from other
nopodiaceae, mientras que los aislados de la cepa countries, in Mexico there is not a description of
W infectan principalmente a plantas de las fami- PRSV host weeds associated with papaya crops
lias Cucurbitaceae y Chenopodiaceae (Chin et al., considering that there is about 30% to 100% of
2007; Tripathi et al., 2008). incidence of such virus (Hernández-Castro et al.,
A nivel internacional, se han desarrollado tra- 2015). This research was aimed at determining the
bajos encaminados en identificar maleza del cul- presence of PRSV in some virus-host plant weed
tivo de papayo portadoras de PRSV. En Brasil se species associated with papaya commercial crops
efectuó un estudio para evaluar la infección natural in Colima, Mexico, using serological and molecular
de especies de cucurbitáceas localizadas dentro y techniques.

Publicación en línea, enero 2018 3

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

fuera de cultivos de papayo infectados con PRSV-P MATERIALS AND METHODS

utilizando ELISA y RT-PCR (Mansilla et al., 2013).
En Florida, se reportó la presencia de PRSV-W en Plant material
especies vegetales de la familia Cucurbitaceae,
afectando los cultivos de pepino, calabaza, melón A sampling of papaya plants and weeds was
y sandía; también se detectó como hospedante de conducted in the state of Colima, Mexico, from
maleza, entre las cuales están Momordica balsami- March to September 2014, in three plantations at
na, Melothria pendula y Coccinia grandis (Goyal La Cumbre and Los Asmoles, localities from the
et al., 2012; Tantiwanich et al., 2014). En el país de municipality of Colima, and Camino to Chanchopa
Jamaica se determinó mediante DAS-ELSA que M. from the municipality of Tecomán. Leaves of various
charantia es una maleza hospedante del PRSV-P weed species showing overall viral symptoms (leaf
(Chin et al., 2007). A pesar de la información re- malformation, chlorosis, mosaic and corrugated
portada en otros países, en México no se tiene una leaves) were sampled. Leaves of different papaya
descripción sobre maleza hospedantes del PRSV plants with PRSV characteristic symptoms were
asociada a cultivos de papayo, considerando que also collected at the same plantations. To identify
existe cerca de un 30% hasta 100% de incidencia the gender and species of the collected weeds,
de este virus (Hernández-Castro et al., 2015). El dichotomous keys were used according to Fryxell,
presente trabajo tuvo como objetivo determinar la (1988).
presencia de PRSV, mediante técnicas serológicas
y moleculares, en algunas especies vegetales de Serological detection of PRSV
maleza hospedantes del virus asociadas a planta-
ciones comerciales de papayo en Colima, México. The serological detection of PRSV in all leaf
samples was performed using DAS-ELISA and
the PhatoScreen® (Agdia) kit. The samples were
MATERIALES Y MÉTODOS macerated in an extraction shock-absorber and then
100 µL of raw extract were taken and placed in
Material vegetal ELISA plates along with the positive and negative
controls provided in the kit. The incubations,
El muestreo de plantas de papayo y maleza se the enzyme-substrate conjugate, as well as the
realizaron en el estado de Colima, México, en el corresponding washings were conducted following
periodo de marzo a septiembre del 2014 en tres the manufacturer’s instructions, this is, measuring
plantaciones ubicadas en las localidades de La wells at 405 nm. The absorbance value three times
Cumbre y Los Asmoles del municipio de Colima y higher than that of the absorbance of the negative
Camino a Chanchopa del municipio de Tecomán. Se control was taken as a positive value. Each analysis
muestrearon hojas de varias especies de maleza con was carried out in triplicate. Based on those results,
síntomas virales en general (mal formación de hoja, a descriptive analysis was performed to determine
clorosis, mosaico y hoja corrugada principalmente). the percentage of the samples positive to PRSV.

Publicación en línea, enero 2018 4

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

También se colectaron hojas de diferentes plantas Extraction and purification of RNA

de papayo con síntomas característicos de PRSV
de las mismas plantaciones. Para la identificación To extract PRSV viral RNA, 0.5 g of leaves
de las maleza colectadas a nivel de género y espe- were weighed and powdered with liquid nitrogen.
cie, se utilizaron claves dicotómicas de acuerdo a Fifty mg of powder were immediately dissolved
Fryxell, (1988). in 500 μL de TRIZOL® (LifeTechnologies™).
The mixture was homogenized and incubated for
Detección serológica de PRSV 5 min at room temperature. It was centrifuged at
12,000 rpm for 10 min at 4 °C, and the aqueous
La identificación serológica del PRSV de to- phase was transferred to a new tube adding 100 µL
das las muestras foliares se llevó a cabo mediante of chloroform; the mixture was vigorously agitated
DAS-ELISA, se utilizó el kit PhatoScreen® (Ag- and incubated at room temperature for 3 min.
dia). Las muestras se maceraron en amortiguador The mixture was centrifuged at 12,000 rpm for
de extracción y se tomaron 100 µL del extracto cru- 15 min at 4 °C. To the aqueous phase recovered,
do. Se depositaron en placas de ELISA junto con 250 µL of cold isopropyl alcohol were added,
controles positivo y negativo suministrados en el and then centrifuged at 12,000 rpm for 10 min at
kit. Las incubaciones, el conjugado de la enzima- 4 °C. The tablet obtained in the previous process
sustrato, así como los lavados correspondientes con was washed in 500 µL of 75% ethanol, dried at
las soluciones amortiguadoras se realizaron según room temperature and re-suspended in RNA-
indicaciones del fabricante realizando la lectura de free water treated with diethyl dicarbonate. The
los pozos a 405 nm. Se consideró como un resul- RNA concentration and purity were verified in a
tado positivo el valor de la absorbancia tres veces NanoDrop spectrophotometer with an absorbance
más alto comparado con la absorbancia del testigo ratio of 260 and 280 nm, while the RNA integrity
negativo. Cada análisis se realizó por triplicado. A was verified in 1% agarose gel electrophoresis with
partir de estos datos se realizó un análisis descrip- 10 mM sodium borate buffer stained with ethidium
tivo para determinar los porcentajes de muestras bromide.
positivas a PRSV.
Detection of Potyvirus through reverse
Extracción y purificación de RNA transcription polymerase chain reaction (RT-
PCR)
Para la extracción de RNA viral de PRSV, se
pesaron 0.5 g de hojas y se pulverizaron con nitró- The RNA reverse transcription (RT) was
geno líquido. Se tomaron 50 mg e inmediatamente performed with the kit “GoScript™ Reverse
se adicionaron 500 μL de TRIZOL® (LifeTechno- Transcription System” (Promega A5001.
logies™). La mezcla se homogeneizó y se incubó Madison, WI. USA). The RNA was denatured at
por 5 min a temperatura ambiente. Se centrifugó a 70 °C for 10 min while the RT reaction mixture
12,000 rpm durante 10 min a 4 °C y la fase acuosa was prepared; the mixture contained 2 µL of
se transfirió a un tubo nuevo y se agregaron 100 µL ribonuclease inhibitor (Recombinant RNasin), 8 U
de cloroformo, se agitó vigorosamente y se incu- of AMV reverse transcriptase (0.32 µL), 0.25 µg
bó a temperatura ambiente durante tres min. Esta of random oligonucleotides (0.5 µL) and 5 µL of

Publicación en línea, enero 2018 5

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

mezcla se centrifugó a 12,000 rpm durante 15 min total RNA (5 ng). The mixture was incubated at
a 4 °C. Se recuperó la fase acuosa y se adicionaron room temperature for 10 min and then at 48 °C for
250 µL de alcohol isopropílico frío y se centrifugó 45 min. Immediately afterward it was incubated at
a 12,000 rpm por 10 min a 4 °C. La pastilla obte- 94 °C for 2 min, and finally at 5 °C. The DNAc was
nida se lavó en 500 µL de etanol al 75%; se secó a amplified using PCR and universal oligonucleotides
temperatura ambiente y se resuspendió en agua li- for Potyvirus as described by Zheng et al. (2010).
bre de RNAasa tratada con dietilpirocarbonato. La The last reaction mixture for PCR was prepared
concentración y pureza del RNA se verificó en un in a 25 µL volume containing 17.5 µL of MQ
espectrofotómetro NanoDrop mediante la relación water, 2.5 µL of 10X polymerase buffer, 1 µL
de absorbancias a 260 y 280 nm; mientras que la of MgCl2 50 mM, 0.5 µL of dNTPs 10 mM, 1 µL
integridad del mismo se corroboró mediante elec- of each of the oligonucleotides NIb2F (GTI TGY
troforesis en gel de agarosa al 1% con amortigua- GTI GAY GAY TTY AAY AA) and NIb3R (TCI
dor borato de sodio 10 mM, teñido con bromuro de ACI ACI GTI GAI GGY TGN CC), 0.5 µL of Taq
etidio. DNA polymerase (5U/µL) (Invitrogen) and 1 µL
of DNAc. The reaction mixture was incubated in
Detección de Potyvirus mediante reverso-trans- a thermocycler under the following conditions:
cripción de la reacción en cadena de la polime- denaturation at 95 °C for 3 min, followed by 35
rasa (RT-PCR) denaturation cycles at 95 °C for 45 sec, alignment
at 45 °C for 45 sec, extension at 72 °C for 45 sec,
La reverso transcripción (RT) del RNA se rea- and a final extension at 72 °C for 5 min. When
lizó utilizando el kit “GoScript™ Reverse Trans- the experiment ended, the mixture was kept at
cription System” (Promega A5001. Madison, WI. 4 °C. 12.5 µL of the PCR product was tested by
USA). El RNA fue desnaturalizado a 70 °C durante 1% agarose gel electrophoresis using SB (sodium
10 min mientras se preparó la mezcla de reacción borate, 10 mM) at 100 V. Finally, the amplification
RT que contenía 2 µL de MgCl2 25 mM, 1 µL products were visualized using a transilluminator
de amortiguador RT 10X, 1 µL de dNTPs 10 mM, with UV light.
0.25 µL de inhibidor de ribonucleasa (RNasin re-
combinante), 8 U de transcriptasa reversa AMV Cloning of PCR products
(0.32 µL), oligonucleótidos al azar 0.25 µg (0.5 µL)
y 5 µL de RNA total (5 ng). La mezcla anterior se The PCR products were purified using the “PCR
incubó a temperatura ambiente 10 min y luego a Clean-up” (Lamda Biotech) kit, but those showing
48 °C durante 45 min. Inmediatamente después se more than one amplified band were purified using
incubó a 94 °C durante 2 min y finalmente a 5 °C. agarose gel and the “Rapid Gel Extraction System”
El DNAc fue amplificado por PCR empleando oli- kit (Marligen). Later on, the purified fragments
gonucleótidos universales para Potyvirus descritos were cloned in the commercial vector “pGEM-T
por Zheng et al. (2010). La mezcla final de reac- Easy” (Promega) and inserted into competent
ción para la PCR se realizó en un volumen de E. coli cells JM109 (Promega), according to the
25 µL, la cual consistió de 17.5 µL de agua methodology of Riley et al. (2008).

Publicación en línea, enero 2018 6

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

MQ, 2.5 µL de buffer Taq polimerasa 10X, 1 µL de Secuencing and secuencing analysis
MgCl2 50 mM, 0.5 µL de dNTPs 10 mM, 1 µL de
cada oligonucleótido NIb2F (GTI TGY GTI GAY The extraction of plasmidic DNA was
GAY TTY AAY AA) y NIb3R (TCI ACI ACI GTI performed using the “Pure Link® Quick Plasmid
GAI GGY TGN CC), 0.5 µL de Taq DNA poli- Miniprep” (Invitrogen) kit; the plasmid was then
merasa (5U/µL) (Invitrogen) y 1 µL de DNAc. La sequenced in a ABI PRISM 310 Genetic Analyzer
mezcla de reacción se incubó en un termociclador by the termination method using Big Dye from
con el siguiente programa: desnaturalización de Applied Biosystems. The bioinformatics analysis
95 °C por 3 min; seguido de 35 ciclos de desnatu- was performed using CLC Genomics Workbench
ralización a 95 °C por 45 seg, alineamiento a 45 °C version 4. The similarity of the obtained sequences
por 45 seg, extensión a 72 °C por 45 seg y una ex- was compared with the sequences reported for
tensión final a 72 °C por 5 min; al término, se man- PRSV in the NCBI database using the “Basic Local
tuvo la temperatura a 4 °C. 12.5 µL del producto de Alignment Search Tool” (BLAST) to determine the
PCR se corrieron por electroforesis en gel de agarosa origin of the isolates.
al 1% con buffer SB (borato de sodio, 10 mM) a 100
V. Finalmente, los productos de la amplificación se
tiñeron con bromuro de etidio y se visualizaron en RESULTS AND DISCUSSION
un transiluminador con luz UV.
Identifying weeds and alternative hosts for
Clonación de productos de PCR PRSV

Los productos de PCR fueron purificados em- The genus of the grass-type weed was
pleando el kit “PCR Clean-up” (Lamda Biotech), identified as Eragrostis spp. Another group of
mientras que aquellos que mostraron más de una weeds were identified within the Herissantia
banda amplificada, se purificaron a partir del gel de genus. In this research, all the weed species that
agarosa con el kit “Rapid Gel Extraction System” gave positive for PRSV were identified according
(Marligen). Posteriormente, los fragmentos purifi- to their morphology and the use of descriptors,
cados se clonaron en el vector comercial “pGEM-T according to Fryxell (1988). Papaya plantations
Easy” (Promega), y se introdujeron en células com- showed different phenology and cultural labor
petentes de E. coli JM109 (Promega) de acuerdo a to control weeds (Figure 1). The papaya crops at
la metodología descrita por Riley et al. (2008). La Cumbre and Chanchopa were being harvested
at 13 and 12 months of age, respectively. At La
Secuenciación y análisis de las secuencias Cumbre there were several papaya plantations
that were different ages; the weed samples were
La extracción del DNA plasmídico se realizó collected from a one-month old crop that was at
empelando el kit “Pure Link® Quick Plasmid Mi- the vegetative development stage. Weeds were
niprep” (Invitrogen) y el plásmido fue secuenciado managed adequately at the plantations at La
en un equipo ABI PRISM 310 Genetic Analyzer Cumbre and Chanchopa, while at the Los Asmoles
por el método de terminación con el Big Dye de site there was no weed management; as a result,
Applied Biosystems. El análisis bioinformático a great diversity and quantity of weed species

Publicación en línea, enero 2018 7

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

se realizó con el programa CLC Genomics Wor- sprang up there. This condition represents a
kbench versión 4; y se comparó la similitud de las source of infection for phytopathogens, because
secuencias obtenidas contra las reportadas para when crops are abandoned, or there are no weed
PRSV en la base de datos de NCBI empleando la management practices, mixed viral infections
herramienta “Basic Local Alignment Searh Tool” become increasingly frequent (Bermúdez-Guzmán
(BLAST) para determinar el origen de los aislados. et al., 2016). In some cases, weeds are interspersed
with plants in the form of tramp crops. However, it
is very important to ensure that such weeds are not
RESULTADOS Y DISCUSIÓN virus hosts that attract possible vectors like aphids
that contribute to the rapid spread of the virus
Identificación de maleza y hospederos alternos (Kalleshwaraswamy and Kumar, 2008). Overall,
para PRSV the sampled papaya plants showed mosaic, leaf
deformation, oily stains in the stem and ring-like
La maleza de tipo pasto fue identificada a ni- spots in fruit, all of them characteristic symptoms
vel de género como Eragrosis spp. Otro grupo de of PRSV (Figure 1). The symptoms observed in the
plantas arvenses se identificaron dentro del género field were similar to those reported in papaya plants
Herissantia spp., en este estudio todas las espe- in several states of Mexico, as well as in Hawaii,
cies de maleza que dieron positivo al PRSV fueron Florida, Taiwan and Thailand, to name a few (Noa-
identificadas con base a su morfología y el uso de Carranza et al., 2006; Tripathi et al., 2008).
los descriptores según Fryxell, (1988). Las planta- Martins et al. (2016) recently collected in
ciones de papayo presentaron diferente fenología y Brazil aphid vectors present in 22 weed species
labores culturales en el control de maleza (Figura in papaya plantations, most of them belonging to
1). Los cultivos de papayo de La Cumbre y Chan- the Euphorbiaceae, Commelinaceae, Brassicaceae
chopa se encontraron en plena cosecha de frutos and Malvaceae families. They also identified one
y tenían 13 y 12 meses de edad, respectivamente. Solanaceae species: Solanum americanum. Chin
En la cumbre, se encontraron varias plantaciones et al. (2007) reported that Momordica charantia is
de papayo con diferentes edades; las muestras de a PRSV-P carrier; however, Spadotti et al. (2013),
maleza se colectaron en una plantación del cultivo after evaluating it through mechanical inoculation
en desarrollo vegetativo con un mes de edad. Las and aphid vectors, stated that Momordica charantia
plantaciones de La Cumbre y Chanchopa, presen- is not susceptible to any of the PRSV strains (P
taron un manejo adecuado de la maleza, mientras and W). In this research, we found a M. charantia
que el sitio Los Asmoles no tuvo labores de ma- specimen from Los Asmoles that appeared healthy
nejo en este sentido, por lo que presentó una gran and gave negative DAS-ELISA and RT-PCR test
cantidad y diversidad de especies arvenses. Lo results. However, in the future it would be useful to
anterior representa un foco de infección para los analyze a greater number of samples of this species
fitopatógenos, ya que en cultivos abandonados o to determine if M. charantia can act as a reservoir
con nulo manejo de maleza son más recurrentes las of the virus.
infecciones virales mixtas (Bermúdez-Guzmán et The expression of the multiple viral symptoms
al., 2016). En algunos casos la presencia de maleza in weeds associated with papaya crop in three
es intercalada en el cultivo a manera de cultivos localities in Colima is shown in Figure 2. The weed

Publicación en línea, enero 2018 8

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 1. A) Síntomas de PRSV en plantación de papayo mostrando la abundancia de maleza intercalada, B) Plantación
con control total de maleza, C) Hojas distorsionadas de papaya con síntomas de clorosis y mosaico, D) Frutos con
anillos característicos de PRSV.
Figure 1. A) Symptoms of PRSV in a papaya plantation where there are abundant interspersed weeds; B) Plantation with
full control of weeds; C) Distorted leaves of papaya with chlorosis and mosaic symptoms; D) Fruit with charac-
teristic rings caused by PRSV.

trampa, sin embargo será de gran importancia iden- samples that developed symptoms account for 72%
tificar que estos no sean hospederos de virus y fun- of the total sampling, except for Eragrosis spp. and
cionen como atrayentes de posibles vectores como Herissantia spp. Mosaics were observed in plants
los áfidos que contribuye a la rápida propagación identified as abutilon (Abutilon abutilastrum),
del virus (Kalleshwaraswamy y Kumar, 2008). En spurred anoda (Anoda cristata) and buffalobur
general, las plantas de papayo que se muestrearon, nightshade (Solanum rostratum). The latter species
presentaron síntomas de mosaico y deformación de also developed leaf distortion and chlorosis, the
hojas, manchas aceitosas en tallos y manchas anu- same as summer squash (Cucurbita pepo), whose
lares en frutos, todos ellos característicos del PRSV leaf deformation was quite severe. On the other

Publicación en línea, enero 2018 9

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

(Figura 1). Estos síntomas observados en campo hand, an asymptomatic specimen of Momordica
son similares a los reportados en plantas de papayo charantia was found in Los Asmoles, which has
en varios estados de México y otros países como been reported as host for several viruses; C. pepo,
Hawaii, Florida, Taiwan y Tailandia, entre otros S. rostratum and A. cristata are susceptible to 62, 8
(Noa-Carranza et al., 2006; Tripathi et al., 2008). and 1 viruses, respectively; for the Abutilon genus,
Recientemente, Martins et al. (2016), colec- five viral phytopathogens have been reported (Brunt
taron en Brasil áfidos vectores presentes en 22 et al., 1996. When weeds serve as a reservoir of a
especies arvenses de plantaciones de papayo, la large number of viruses, this often means that the
mayoría pertenecientes a las familias Euphorbia- symptoms observed are the result of the synergic
ceae, Commelinaceae, Brassicaceae y Malvaceae, expression of a mixture of viral infections (Zhang
también se identificó una Solanaceae: Solanum et al., 2001; Hii et al., 2002; Gastélum et al., 2007;
americanum. Chin et al. (2007) reportaron a Mo- Bermúdez-Guzmán et al., 2016).
mordica charantia como portadora de PRSV-P, sin
embargo, Spadotti et al. (2013) determinaron que Detection of PRSV
ésta especie no es susceptible a ninguna de las ce-
pas de PRSV (P y W), tras evaluar su inoculación Data on the detection of PRSV through DAS-
mecánica y mediante áfidos vectores en la especie ELISA and RT-PCR in plants of C. papaya and
antes mencionada. En este estudio se encontró un weeds associated with the crop from three Colima
ejemplar de M. charantia proveniente de Los As- sites are shown in Table 1. From the 130 collected
moles, el cual tuvo una apariencia sana y presentó samples, 57 collected at La Cumbre were analyzed
un resultado negativo a PRSV por DAS-ELISA y using DAS-ELISA and gave positive to PRSV in C.
RT-PCR, sin embargo, resulta conveniente analizar papaya and C. pepo. This result may be explained
en un futuro un mayor número de muestras de esta by the fact that the analyzed samples did not reach
especie para determinar si puede actuar como reser- the minimum viral concentration since, according
vorio del virus. to reports, the DAS-ELISA technique does not
La expresión de la diversidad de síntomas vira- detect virus in plants if its concentration level is less
les en maleza asociada al cultivo del papayo en tres than 0.1 ng of virus per mL (Salazar, 1996). In this
localidades de Colima se muestra en la Figura 2. study, up to 50% of positive samples was reported
Las muestras de maleza que presentaron síntomas by DAS-ELISA, a percentage highly significant
representa un 72.6% del total muestreado, excep- and different from the percentage obtained by
tuando las especies de Eragrosis spp. y Herissantia Hernández de la Cruz et al. (2007), who detected
spp. Se observaron mosaicos en plantas identifica- 2.43% of PVYNTN in potato tubers using the DAS-
das como abutilón (Abutilon abutilastrum), violeta ELISA technique.
de campo (Anoda cristata) y mala mujer (Solanum The BLASTn analysis of the 13 sequences
rostratum). Esta última especie también presentó obtained in the present research that correspond to
distorsión de la hoja y clorosis, al igual que la ca- the NIb region of PRSV allowed for the first time
labacilla (Cucurbita pepo), cuya deformación de the identification of A. abutilastrum, A. cristata
hoja fue muy severa. Por otra parte, se encontró un and S. rostratum as new natural host species
ejemplar asintomático de Momordica charantia en for PRSV. Isolated sequences of C. papaya and
la localidad de Los Asmoles, la cual está reportada C. pepo were also included, but they have been

Publicación en línea, enero 2018 10

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 2. Diversidad de maleza localizada en tres plantaciones de papayo con síntomas virales. A) A. abutilastrum con mo-
saicos en hojas. B) C. pepo con deformación severa de hoja C) S. rostratum con mosaicos y clorosis. D) A. cristata
con mosaicos en hojas. E) Momordica charantia asintomática.
Figure 2. Diverse weeds in three papaya plantations with viral symptoms. A) A. abutilastrum with mosaics in leaves. B) C.
pepo with severe deformation of leaves. C) S. rostratum with mosaics and chlorosis. D) A. cristata with mosaic in
leaves. E) Momordica charantia asymptomatic.

como hospedera de varios virus, mientras que C. extensively reported as hosts for PRSV (Noa-
pepo, S. rostratum y A. cristata son susceptibles a Carranza et al., 2006; Sreenivasulu and Sai-
62, 8 y 1 virus, respectivamente, así como para el Gopal, 2010; Goyal et al., 2012; Mansilla et al.,
género Abutilon se reportan cinco fitopatógenos vi- 2013). Phylogenetics (Figure 3) was useful to
rales (Brunt et al., 1996). Esta condición en que la identify three similar sequence groups. A clear
maleza sirve como reservorio de una gran cantidad grouping is seen according to the plantation zone;
de virus ocasiona frecuentemente que los síntomas for example, it was observed that sample 11 and
observados sean producto de la expresión sinérgica 12 corresponding to C. pepo and A. abutilastrum,
de infecciones virales mixtas (Zhang et al., 2001; respectively, was the same as the one found in C.
Hii et al., 2002; Gastélum et al., 2007; Bermúdez- papaya corresponding to sequences 9 and 8 from
Guzmán et al., 2016). Los Asmoles. This finding clearly confirms that the
weed transmits the same virus to papaya plants.
Detección de PRSV Another major finding was the diverse sequences
identified for the Colima zone which are markedly
La detección de PRSV mediante DAS-ELISA y different from other isolates, even from the one
RT-PCR en plantas de C. papaya y maleza asociada reported for Veracruz (AY231130) with 92%

Publicación en línea, enero 2018 11

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

al cultivo procedentes de tres localidades de Coli- homology. Such diversity of PRSV isolates has
ma son mostrados en el Cuadro 1. De las 139 mues- been observed in regions of China due to the high
tras colectadas se analizaron por DAS-ELISA 57 mutation rate of the virus (Zhao et al., 2016), which
de ellas, provenientes de la localidad de La Cum- makes difficult to implement control strategies. As
bre, y resultaron positivas para PRSV C. papaya expected, other Potyvirus such as: Japanese yam
y C. pepo. Lo anterior puede atribuirse a que las mosaic potyvirus (JYMV), Potato virus Y (PVY),
muestras analizadas no alcanzaron la concentra- Bean yellow mosaic virus (BYMV) and Tobacco
ción mínima viral, ya que está reportado que la téc- vein banding mosaic virus (TVBMV) were located
nica de DAS-ELISA no detecta virus en plantas si farther away in the dendrogram with 70 to 73%
su concentración es menor de 0.1 ng de virus por identity in the sequence.
mL (Salazar, 1996). En el presente estudio se re- 28.15% of papaya plants analyzed in this
portó hasta un 50% de muestras positivas por DAS- research developed viral symptoms but they gave
ELISA; porcentaje significativamente elevado a di- negative to PRSV when tested using RT-PCR. This
ferencia del obtenido por Hernández de la Cruz et may be due to the fact that C. papaya is susceptible
al. (2007) quienes detectaron el 2.43% de PVYNTN to more than eight phytopathogen viruses such as
en tubérculos de papa por DAS-ELISA. Papaya apical necrosis virus (PANV), Papaya
El análisis de BLASTn de 13 secuencias gene- lethal yellowing virus (PLYV), Papaya Mosaic
radas en el presente trabajo correspondientes a la Virus (PMV), Papaya leaf distortion mosaic virus
región NIb de PRSV permitió identificar por pri- (PLDMV), among others (Lastra and Quintero,
mera vez a A. abutilastrum, A. cristata y S. rostra- 1981; Brunt et al., 1996), so it may be that the viral
tum como nuevas especies hospedantes naturales symptom may be caused by some of those viruses.

Cuadro 1. Detección por métodos serológicos y moleculares de PRSV en maleza asociada al cul-
tivo de papayo en tres localidades de Colima, México.
Table 1. Detection of PRSV in weeds associated with papaya crop in three sites in Colima
Mexico, using serological and molecular methods.

        Positivas a PRSV (%)

Muestras
Localidad Especie Familia DAS-ELISA RT-PCR
colectadas

La Cumbre 57 C. papaya Caricaceae 40 40

A. cristata Malvaceae 0 21
C. pepo Cucurbitaceae 50 54
Eragrosis spp. Poaceae 0 0
S. rostratum Solanaceae 0 18
Los Asmoles 35 C. papaya Caricaceae 40 90
A. abutilastrum Malvaceae 0 28
C. pepo Cucurbitaceae 50 80
M. charantia Cucurbitaceae 0 0
S. rostratum Solanaceae 20 33
Chanchopa 47 C. papaya Caricaceae 40 75
C. pepo Cucurbitaceae 0 0
Herissantia spp. Malvaceae 0 0

Publicación en línea, enero 2018 12

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

de PRSV. Además, también se incluyeron secuen- CONCLUSIONS

cias aisladas de C. papaya y C. pepo, aunque estas
ya están ampliamente reportadas como hospederas The DAS-ELISA technique allowed the detection
de PRSV (Noa-Carranza et al., 2006; Sreenivasulu of Papaya ringspot virus (PRSV) in C. papaya and
y Sai-Gopal, 2010; Goyal et al., 2012; Mansilla et any other weed present in papaya crops. However,
al., 2013). La filogenia (Figura 3) permitió iden- the number of positive samples was underestimated
tificar tres grupos de secuencias similares. Se ob- when they were compared using RT-PCR. This
serva una clara agrupación de acuerdo a la zona de technique was useful to identify the presence of
plantación, en las que se observó la muestra 11 y PRSV in weed species associated with papaya
12 correspondiente a C. pepo y A. abutilastrum res- crop, such as A. abutilastrum, A. cristata, C. pepo
pectivamente fue la misma que la encontrada en C. and S. rostratum. PRSV was not detected in M.
papaya correspondiente a la secuencia 9 y 8 perte- charantia. This research reports for the first time
neciente a Los Asmoles. Este hallazgo confirma de that A. abutilastrum and A. cristata, belonging to
manera clara que la maleza aporta el mismo virus a the Malvaceae family, and S. rostratum belonging

JYMV_dnaNlb (NC_000947)
PVY_dna NLB (NC_001616)
PRSV-W Brasil (DQ374153)
PRSV-2 Brasil (DQ374152)
PRSV Hawaii (X67673)
PRSV Hawaii (X67672)
PRSV-P Hawaii (S46722)
PRSV Hawaii (EU126128)
11PRSV C. pepo (Asmoles)
9PRSV C. papaya (Asmoles)
5PRSV S. rostrarum (Cumbre) Asmoles
7PRSV C. papaya (Asmoles)
12PRSV A. abutilastrum (Asmoles)
8PRSV C. papaya (Asmoles)
3PRSV A. cristata (Cumbre)
2 PRSV C. pepo (Cumbre)
1PRSV C. pepo (Cumbre) Cumbre
4PRSV A. cristata (Cumbre)
6PRSV S. rostrarum (Cumbre)
13PRSV C. papaya (Chanchopa) Chanchopa
10PRSV C. pepo (Asmoles)
PRSV México (AY231130)
PRSV-W India (EU475877)
PRSV-W Taiwan (AY027810)
PRSV-W Tailanda (AY010722)

"L-====------------- BYMV_dna Nlb (NC_003492)

TVBMV_dna Nlb (NC_009994)

Figura 3. Filogenia generada a partir de la similitud de secuencias de la región NIb del genoma de Papaya rings-
pot virus (PRSV) de aislados de Colima, México (1-13) comparadas con aislamientos de Brasil, Hawái, India,
Taiwan,Tailandia y otros Potivirus: Japanese yam mosaic potyvirus (JYMV), Potato virus Y (PVY), Bean yellow
mosaic virus (BYMV), Tobacco vein banding mosaic virus (TVBMV).
Figure 3. Phylogeny based on the similarity of the sequences of the NIb region of the Papaya ringspot virus (PRSV) genome
from isolates collected in Colima, Mexico (1-13) and compared with isolates from Brazil, Hawaii, India, Taiwan,
Thailand, and other Potivirus: Japanese yam mosaic potyvirus (JYMV), Potato virus Y (PVY), Bean yellow mosaic
virus (BYMV), Tobacco vein banding mosaic virus (TVBMV).

Publicación en línea, enero 2018 13

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

las plantas de papayo. Otra observación importante to the Solanaceae family, are host weed species for
fue la diversidad en secuencias que se encontraron PRSV.
para la zona de Colima que diferencia claramente
con otros aislados incluso con el reportado para Ve- End of the English version
racruz (AY231130) con un 92% de homología. Esta
diversidad en aislados de PRSV se ha observado
para regiones de China, debido a la alta tasa de mu- la presencia de PRSV en M. charantia. El presente
tación del virus (Zhao et al., 2016), lo que complica trabajo reporta por primera vez a A. abutilastrum y
las estrategias de control para este virus. Como era A. cristata pertenecientes a la familia Malvaceae y
de esperarse, otros Potyvirus como: Japanese yam S. rostratum de la familia Solanaceae como espe-
mosaic potyvirus (JYMV), Potato virus Y (PVY), cies arvenses hospederas de PRSV.
Bean yellow mosaic virus (BYMV), Tobacco vein
banding mosaic virus (TVBMV) fueron los más
alejados en el dendrograma con un porcentaje de LITERATURA CITADA
identidad en la secuencia del 70 al 73%.
Abreu PMV, Antunes TFS, Magaña-Álvarez A, Pérez-Brito D,
El 28.15% plantas de papayo analizadas en este Tapia-Tussell R, Ventura JA, Fernandes AAR and Fernan-
estudio presentaron sintomatología viral, pero re- des PMB. 2015. A current overview of the Papaya meleira
virus, an unusual plant virus. Viruses 7: 1853-1870. http://
sultaron negativas a PRSV mediante RT-PCR. Lo [Link]/10.3390/v7041853
anterior puede deberse a que C. papaya, es sus- Bermúdez-Guzmán MJ, García-Mariscal KP, Orozco-Santos
M, Guzmán-González S, Velázquez-Monreal JJ, García-
ceptible a más de ocho virus fitopatógenos entre Preciado JC, Cervantes-Preciado JF y Álvarez-Cilva
los que destacan Papaya apical necrosis virus M. 2016. Enfermedades ocasionadas por virus en caña
de azúcar en el Occidente de México. Campo Experi-
(PANV), Papaya lethal yellowing virus (PLYV), mental Tecomán, INIFAP. Folleto técnico No. 13. Te-
Papaya Mosaic Virus (PMV), Papaya leaf distor- comán, Col., México. 27p. [Link]
RG.2.2.15748.73605
tion mosaic virus (PLDMV), entre otros (Lastra y Brunt AA, Crabtree K, Dallwitz MJ, Gibbs AJ, Watson L and
Quintero, 1981; Brunt et al., 1996), por lo que muy Zurcher EJ. 1996. Plant Viruses Online: Descriptions and
Lists from the VIDE Database. Version: 16th January
probablemente el síntoma viral presentado, podría co- 1997. Disponible en línea: [Link]
rresponder a la infección por alguno de estos virus. Groups/MES/vide/
Chin M, Ahmad MH and Tennant P. 2007. Momordica cha-
rantia is a weed host reservoir for Papaya ringspot virus
Type P in Jamaica. Plant Disease. 91: 1518. [Link]
org/10.1094/PDIS-91-11-1518A
CONCLUSIONES Fauquet CM, Mayo MA, Maniloff J, Desselbelguer U and Ball
LA. 2005. Virus taxonomy: the eighth report of the Inter-
national Committee on Taxonomy of Viruses. 1st Edition.
La técnica de DAS-ELISA permitió la detección Academic Press Elsevier. Amsterdam, Holanda. 1162p.
del Papaya ringspot virus (PRSV) en C. papaya [Link]
Fryxell, P. A. Malvaceae of Mexico. Syst. Bot. Monogr. 25:
y alguna maleza presente en el cultivo sin embar- 1-522. 1988. Disponible en línea: [Link]
go se subestimo el número de muestras positivas mx/publicaciones/resumeness/FLOBA/Flora%[Link]
Gastélum RB, Magallanes-Tapia MA, Méndez-Lozano J,
al comparar con la técnica de RT-PCR. La técnica Huet H, Trigueros-Salmerón JA y Longoria-Espinosa RM.
molecular de RT-PCR permitió identificar la pre- 2007. Detección del virus mosaico amarillo de la calaba-
za zucchini (ZYMV) y su coinfección con otros virus en
sencia de PRSV en las especies de arvenses aso- cucurbitáceas cultivadas y plantas silvestres en el valle del
ciadas al cultivo de papayo como A. abutilastrum, fuerte, Sinaloa, México. Revista Mexicana de Fitopatolo-
gía. 25:95-101. Disponible en línea: [Link]
A. cristata, C. pepo y S. rostratum. No se detectó org/pdf/612/[Link]

Publicación en línea, enero 2018 14

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Goyal G, Gill HK and McSorley R. 2012. Common weed hosts Noa-Carranza JC, González de León D, Ruiz-Castro BS, Pi-
of insect-transmitted viruses of Florida vegetable crops. ñero D and Silva-Rosales L. 2006. Distribution of Papaya
Disponible en línea: [Link] ringspot virus and Papaya mosaic virus in papaya plants
Hernández–Castro E, Villanueva–Jiménez JA, Mosqueda– (Carica papaya) in Mexico. Plant Disease. 90: 1004-1011.
Vázquez R y Mora–Aguilera JA. 2004. Efecto de la erra- [Link]
dicación de plantas enfermas por el PRSV–P en un siste- Riley SP, Woodman ME and Stevenson B. 2008. Culture of
ma de manejo integrado del papayo (Carica papaya L.) Escherichia coli and related bacteria. Current Protocols
en Veracruz, México. Revista Mexicana de Fitopatología Essential Laboratory Techniques. Wiley. U 4.2.168p.
22: 382–388. Disponible en línea: [Link] [Link]
[Link]?id=61222311 Salazar LF. 1996. Potato viruses and their control. 1st Edition.
Hernández-Castro E, Damian-Nava A, Mora-Aguilera A, International Potato Center (CIP). Lima, Perú. 214p. Dis-
Villanueva-Jimenez JA, Vargas-Álvarez D and Palemón- ponible en línea: [Link]
Alberto F. 2015. Incidence of the Papaya Ringspot Vi- viruses-and-their-control/
rus (PRSV-p) and Management in the State of Guerrero, SIAP 2016. Secretaría de Agricultura, Ganadería, Rural, Pesca
Mexico. Pp:119-127 In: S. Dimitrov Todorov and I. Vi- y Alimentación. Servicio de Información Agroalimentaria
tanova Ivanova (eds.) Tropical Fruits. Chapter 7. Nova y Pesquera. Disponible en línea: [Link]/index
Science Publishers, Inc. [Link] Spadotti DMA, Buriolla JE, Rezende JAM and Souza VC.
RG.2.1.3437.5203 2013. The wild type of Momordica charantia is not infec-
Hernández de la Cruz M, Gómez-Leyva JF, López-Muraira IG, ted by potyviruses that cause disease in papaya and cu-
Dimas-Estrada MS, Andrade-González I y Ireta-Moreno J. curbit crops. Tropical Plant Pathology 38: 447-451. http://
2007. Detección serológica y molecular del virus PVYN [Link]/10.1590/S1982-56762013005000029
y su variante PVYNTN en papa (Solanum tuberosum L.) y Sreenivasulu M and Sai-Gopal DVR. 2010. Development of
hospedantes alternos en Tapalpa, México. Revista Mexi- recombinant coat protein antibody based IC-RT-PCR and
cana de Fitopatología. 25: 167-172. Disponible en línea: comparison of its sensitivity with other immunoassays for
[Link] the detection of Papaya ringspot virus isolates from In-
Hii G, Pennington R, Hartson S, Taylor CD, Lartey R, Wi- dia. The Plant Pathology Journal. 26: 25-31. [Link]
lliams A, Lewis D and Melcher U. 2002. Isolate-specific org/10.5423/PPJ.2010.26.1.025
synergy in disease symptoms between cauliflower mosaic Tantiwanich Y, Baker CA, Turechek WW and Adkins S. 2014.
and turnip vein-clearing viruses. Archives Virology 147: Detection of Papaya ringspot virus type W infecting the
1371-1384. [Link] cucurbit weed Cucumis melo var. dudaim in Florida. Plant
Kalleshwaraswamy CM and Kumar NK. 2008. Transmis- Health Progress 15: 29-30. [Link]
sion efficiency of Papaya ringspot virus by three aphid BR-13-0126
species. Phytopathology. 98: 541-546. Disponible en Tripathi S, Suzuki JY, Ferreira SA and Gonsalves D. 2008.
línea: [Link] Papaya ringspot virus-P: characteristics, pathogenicity,
PHYTO-98-5-0541 sequence variabality and control. Molecular Plant Pa-
Lastra R and Quintero E. 1981. Papaya apical necrosis, new thology. 9: 269-280. [Link]
diseases associated with a Rhabdovirus. Plant Disease 65: 3703.2008.00467.x
439-440. [Link] Zhao H, Zong RJ, Zhang YL, Zhu YJ, Zeng HC, Kong H,
Mansilla PJ, Moreira AG, Mello APOA, Rezende JAM, Ven- McCafferty H, Guo AP, and Peng M. 2016. Geographi-
tura JA, Yuki VA and Levatti FJ. 2013. Importance of cu- cal and Genetic Divergence Among Papaya ringspot vi-
curbits in the epidemiology of Papaya ringspot virus type rus Populations Within Hainan Province, China, Virolo-
P. Plant Pathology 62: 571-577. [Link] gy106:937-944. [Link]
j.1365-3059.2012.02677.x 0111-R
Martins DS, Ventura JA, Paula RCAL, Fornazier, MJ, Rezen- Zhang XS, Holt J and Colvin J. 2001. Synergism between
de, JAM, Culik MP, Ferreira PSF, Peronti ALBG, Car- plant viruses: a mathematical analysis of the epidemiolo-
valho RCZ and Sousa-Silva CR. 2016. Aphid vectors of gical implications. Plant Pathology 50: 732–746. http://
Papaya ringspot virus and their weed host in orchards in [Link]/10.1046/j.1365-3059.2001.00613.x
the major papaya producing and exporting region of Bra- Zheng L, Rodoni BC, Gibbs MJ and Gibbs AJ. 2010. A novel
zil. Crop Protection 90: 191-196. [Link] pair of universal primers for the detection of potyviruses.
cropro.2016.08.030 Plant Pathology. 59: 211-220. [Link]
Navanath MD, Anitha P, Gahukar SJ, Akhare AA. 2017. Biolo- j.1365-3059.2009.02201.x
gical indexing of Papaya ring spot virus (PRSV) in Carica
papaya. International Journal of Agriculture 9: 3728-3730.
Disponible en línea: [Link]
ticles/9_4_7_IJAS.pdf

Publicación en línea, enero 2018 15

 Detection of Sugarcane mosaic virus (SCMV)
in Saccharum spp. in Mexico and phylogenetic
origin of one isolate from Jalisco

Detección del Sugarcane mosaic virus (SCMV) en

Saccharum spp. en México y origen filogenético de un aislado de Jalisco

Manuel de Jesús Bermúdez-Guzmán*, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecua-

rias. Campo Experimental Tecomán, Laboratorio de Biotecnología de Plantas, Km 35 carretera Colima-Manza-
nillo, CP. 28100, Tecomán-Colima; Francisco Javier Delgado-Virgen, Instituto Tecnológico de Colima. Ave-
nida Tecnológico No. 1, CP. 28976, Villa de Álvarez, Colima; Jeovani Francisco Cervantes-Preciado, José
Concepción García-Preciado, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. Cam-
po Experimental Tecomán. Km 35 carretera Colima-Manzanilla, CP. 28100, Tecomán-Colima; Vania Sbeyde
Farías-Cervantes, Instituto Tecnológico de Tlajomulco. Km 10 carretera Tlajomulco-San Miguel Cuyutlán,
CP. 45640, Tlajomulco de Zúñiga, Jalisco. *Autor para correspondencia: [Link]@[Link].

Recibido: 11 de Septiembre, 2017. Aceptado: 16 de Octubre, 2017.

Bermúdez-Guzmán MJ, Delgado-Virgen FJ, Cervantes- Abstract. Sugarcane mosaic virus (SCMV) is
Preciado JF, García-Preciado JC, Farías-Cervantes VS. one of the main viral agents that infect sugarcane
2017. Detection of Sugarcane mosaic virus (SCMV) (Saccharum spp.). SCMV detection in Mexico
in Saccharum spp. in Mexico and phylogenetic origin of has been based on typical symptomatology of the
one isolate from Jalisco. Revista Mexicana de Fitopato- disease, which is not conclusive. Additionally, there
logía 36(1): 16-34. is limited information about their phylogenetic
DOI: 10.18781/[Link].1709-2 origin. The objective of this work was to detect
the presence and distribution of SCMV in the
Primera publicación DOI: 06 de Diciembre, 2017. sugarcane growing areas of the Mexican Pacific
First DOI publication: December 06, 2017. using RT-PCR, and to determine the phylogenetic
origin of one isolate from Jalisco. The results
showed the wide distribution of SCMV in
Resumen. El virus de mosaico de la caña de sugarcane areas of the Mexican Pacific. The virus
azúcar (SCMV) es uno de los principales agentes was found in 33 of the 242 samples analyzed,
virales que infectan a caña de azúcar (Saccharum corresponding to 13.63%. The varieties Mex 69-
spp.). En México la detección del SCMV se ha ba- 290 and CP 72-2086 presented the most severe
sado en sintomatología típica de la enfermedad, por mosaic symptoms. Phylogenetic analysis using
lo que la información no es concluyente, además partial HC-Pro sequences of SCMV isolate from
hay poca información sobre su origen filogenético. Jalisco (JalMex-126) suggests a close relationship

Publicación en línea, enero 2018 16

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

El objetivo del trabajo fue detectar mediante RT- with isolates from India, Australia, China and
PCR la presencia y distribución del SCMV en las Argentina, and thus likely share a common genetic
zonas cañeras de los estados de Colima, Jalisco y origin and have been dispersed to through infected
Nayarit, México y determinar el origen filogenéti- sugarcane germplasm.
co de un aislado de Jalisco. Los resultados obteni-
dos demuestran la amplia distribución del SCMV Key words: sugarcane, virus, RNA, phylogeny.
en la región cañera del Pacífico de México. De las
242 muestras analizadas se detectó al virus en 33
de ellas, lo que corresponde a un 13.63%. Las va- INTRODUCTION
riedades Mex 69-290 y CP 72-2086 fueron las que
presentaron los síntomas de mosaico más severos. Diseases caused by phytopathogens are an
El análisis filogenético con la secuencia parcial important factor for sugarcane production. In
HC-Pro del SCMV aislado de Jalisco (JalMex-126) Mexico, approximately 80% of the diseases
sugiere una estrecha relación con aislados de la In- that affect this crop are fungal in origin, and the
dia, Australia, China y Argentina, por lo que proba- remaining 20% is caused by bacteria, viruses and
blemente compartan un origen genético común y se phytoplasmas (CONADESUCA, 2015). Some
hayan dispersado a través de germoplasma de caña of the first epidemiologies on the sugarcane crop
de azúcar infectado. reported in the world in the beginning of the 20th
Century include those caused by viruses, causing
Palabras clave: caña de azúcar, virus, RNA, filo- large economic losses (Grisham, 2000). The
genia. Sugarcane mosaic virus (SCMV), causal agent of
the mosaic disease, is one of the most economically
important causal agents of the mosaic disease
INTRODUCCIÓN worldwide (Gonçalves et al., 2012). The disease
caused drastic outbreaks in Argentina, Brazil,
Las enfermedades causadas por fitopatógenos Cuba, Puerto Rico, and the United States (Koike
constituyen un factor importante para la producción and Guillaspie, 1989; Yang and Mirkov, 1997).
de caña de azúcar. En México, aproximadamente el This lead to the introduction of interspecific
80% de las enfermedades que afectan este cultivo hybrids of the genus Saccharum (mosaic-tolerant)
son de origen fúngico, el 20% restante es causado imported from Java, in order to control the rapid
por bacterias, virus y fitoplasmas (CONADESU- spread of the disease in noble canes (S. officinarum)
CA, 2015). Entre las primeras epidemiologías so- obtained back then in those countries (Koike and
bre el cultivo de la caña de azúcar reportadas en el Gillaspie, 1989). In susceptible varieties infected
mundo a comienzos del siglo XX están las ocasio- with SCMV, yield losses are estimated in 11-
nadas por virus, causando grandes pérdidas econó- 50% (Singh et al., 2003; Singh et al., 2005). In
micas (Grisham, 2000). El Virus del mosaico de la Mexico, the first report (based on symptoms) of
caña de azúcar (SCMV), agente causal de la enfer- this virus affecting sugarcane was carried out in
medad del mosaico, es uno de los patógenos vira- 1929, in El Potrero, Veracruz. In 1947, over 80%
les de mayor importancia económica a nivel mun- of the areas planted with native sugarcane varieties,
dial (Gonçalves et al., 2012). La enfermedad fue from the Independencia Mill in the municipal area
responsable de drásticas epidemias en Argentina, of Martínez de la Torre, presented the disease

Publicación en línea, enero 2018 17

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Brasil, Cuba, Puerto Rico y Estados Unidos (CONADESUCA, 2015). In that same country,
(Koike y Guillaspie, 1989; Yang y Mirkov, 1997). the first report (based on molecular methods) of
Lo anterior condujo a la introducción de híbridos SCMV affecting maize plants was carried out
interespecíficos del género Saccharum (tolerantes in 2006 (Espejel et al., 2006), although there is
al mosaico) importados de Java, con el fin de con- no quantitative information on the damages this
trolar la rápida propagación de la enfermedad en disease causes in sugarcane plantations in Mexico.
las cañas nobles (S. officinarum) obtenidas en aquel The general symptom caused by SCMV is
entonces en esos países (Koike y Gillaspie, 1989). characterized mostly by the paling of the leaf
En variedades susceptibles infectadas con SCMV blade, which presents normally green colored
las pérdidas en rendimiento se estiman de 11-50% areas, alternated with pale or yellow-green areas;
(Singh et al., 2003; Singh et al., 2005). En Méxi- these areas are a result of the variations in the
co, el primer reporte (basado en sintomatología) de levels of chlorophyll in the leaf (Grisham, 2000;
este virus afectando a caña de azúcar fue realizado CONADESUCA, 2015). The symptoms of this
en 1929, en El Potrero, Veracruz. En 1947 más del disease may also be caused by other viruses and may
80% de las áreas plantadas con variedades de caña be confused with the Sugarcane streak mosaic virus
de azúcar criollas, del Ingenio Independencia en el (SCSMV) or the Sorghum mosaic virus (SrMV),
municipio de Martínez de la Torre, presentaron la which also affect sugarcane plants (Viswanathan et
enfermedad (CONADESUCA, 2015). En ese mis- al., 2008; Xie et al., 2009). Asymptomatic plants
mo país el primer reporte (basado en métodos mo- can also be positive for SCMV (Xu et al., 2008).
leculares) del SCMV afectando plantas de maíz fue In Mexico, reports on the detection of SCMV by
realizado en el año 2006 (Espejel et al., 2006), sin molecular methods are scarce, and have mainly
embargo, no hay información cuantitativa sobre los been based on symptoms (CONADESUCA 2015),
daños que ocasiona esta enfermedad en los cultivos so there is no certainty that the visual damage of
de caña de México. the mosaic truly corresponds to SCMV or any
El síntoma general causado por el SCMV en other virus that presents similar symptoms. Several
caña de azúcar se caracteriza principalmente por reports have standardized protocols to detect
presentar decoloraciones en la lámina foliar, en la SCMV using RT-PCR (Smith and Van de Velde,
cual se observan zonas de color verde normal al- 1994; Xie et al, 2009; Filippone et al., 2010).
ternado con áreas verde pálido o amarillentas; es- Smith and Van de Velde (1994) developed primers
tas decoloraciones son resultado de los niveles de S400-551 and S400-910, which amplified a 359 bp
variación en la concentración de la clorofila en la fragment, which correspond to a partial region that
hoja (Grisham, 2000; CONADESUCA, 2015). Los codifies for the capsid protein (CP) of SCMV. In
síntomas de esta enfermedad también pueden ser another study, Yang and Mirkov (1997) developed
causados por otros virus y pueden confundirse con the primers SCMV-F3/SCMV-R3, which amplify a
el mosaico estriado (SCSMV) o el mosaico del sor- roughly 900 bp band, which corresponds to a region
go (SrMV), los cuales también infectan a caña de that codifies for the CP protein of SCMV. Xie et
azúcar (Viswanathan et al., 2008; Xie et al., 2009). al. (2009) designed the set of oligonucleotides
Además, las plantas asintomáticas también pueden SCMV-F1/SCMV-R1 based on sequences deposited
resultar positivas al SCMV (Xu et al., 2008). En in the NCBI database; these primers amplified a
México, son escasos los reportes sobre la detección 720 bp fragment, which corresponds to a partial
del SCMV por métodos moleculares, y mayorita- region of the HC-Pro protein of SCMV. Recently,

Publicación en línea, enero 2018 18

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

riamente se han basado en síntomas (CONADESU- Filippone et al. (2010) optimized a protocol to
CA 2015), por lo que no hay certeza de que el daño detect SCMV using the oligonucleotides described
visual de mosaico corresponda realmente al SCMV earlier by Yang by Mirkov (1997) and Smith and
o algún otro virus que manifiesta síntomas simila- Van de Velde (1994), respectively.
res. Existen varios reportes que han estandarizado On the other hand, it is important to know
protocolos para la detección del SCMV mediante the origin of SCMV in order to know possible
RT-PCR (Smith y Van de Velde, 1994; Xie et al., entries of this disease into Mexico. In the year
2009; Filippone et al., 2010). Smith y Van de Vel- 2012, a phylogenetic analysis was reported, with
de (1994) desarrollaron los iniciadores S400-551 y 185 SCMV CP sequences from several countries,
S400-910, los cuales amplifican un fragmento de suggesting different phylogeographic origins of
359 pb, correspondiente a una región parcial que two Mexican isolates that this study considered
codifica para la proteína de la cápside (CP) del (Chaves and Ortiz, 2012). On the other hand,
SCMV. En otro estudio, Yang y Mirkov (1997) de- the results produced by Xie et al. (2016) on the
sarrollaron los cebadores SCMV-F3/SCMV-R3, los phylogenetic analysis of 24 SCMV isolates from
cuales amplifican una banda de aproximadamente China and other countries revealed that they could
900 pb, correspondiente a una región que codifica be divided into two groups, which were related to the
para la proteína CP del SCMV. Xie et al. (2009), SCMV host plant species. More recently, results by
diseñaron el juego de oligonucleótidos SCMV-F1/ Moradi et al. (2017) from CP sequences of SCMV
SCMV-R1 basados en secuencias depositadas en la from various countries suggest five divergent
base de datos de NCBI; dichos iniciadores amplifi- evolutionary lineages, where the geographic origin
can un fragmento de 720 pb, correspondiente a una and/or SCMV host plants are partially related.
región parcial de la proteína HC-Pro del SCMV. Due to this, the aim of this study is to detect,
Recientemente, Filippone et al. (2010) optimizaron using RT-PCR, the presence and distribution of
un protocolo para detectar al SCMV utilizando los the SCMV in the sugarcane producing areas of the
oligonucleótidos descritos previamente por Yang y Mexican Pacific, and to establish the phylogenetic
Mirkov (1997) y Smith y Van de Velde (1994), res- origin of one isolate from the state of Jalisco. The
pectivamente. information produced in this work may be used
Por otra parte, resulta importante conocer el by the Sugarcane Reasearch and Development
origen filogenético del SCMV para conocer proba- Center (Centro de Investigación y Desarrollo de la
bles ingresos de esta enfermedad a México. En el Caña de Azúcar, CIDCA), both in its quarantine
año 2012 se reportó un análisis filogenético de 185 station for the exchange of germplasm, and in the
secuencias CP del SCMV provenientes de varios genetic breeding program, in which the selection
países, sugiriendo diferentes orígenes filogeográfi- and elimination of clones susceptible to SCMV are
cos de dos aislados mexicanos que contemplo ese routine procedures.
estudio (Chaves y Ortiz, 2012). Por otra parte, los
resultados de Xie et al. (2016) del análisis filoge-
nético de 24 aislados de SCMV provenientes de MATERIALS AND METHODS
China y diversos países del mundo revelaron que po-
drían dividirse en dos grupos, los cuales fueron aso- Plant material
ciados con la especie vegetal hospedera del SCMV.
Más recientemente, los resultados de Moradi et al. In the year 2014, foliar samples were collected
(2017) a partir de secuencias CP del SCMV de from diverse varieties of sugarcane planted

Publicación en línea, enero 2018 19

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

varios países sugieren cinco linajes evolutivos di- commercially in the states of Colima, Jalisco and
vergentes, donde se relacionan parcialmente el ori- Nayarit (Figure 1). Plants displayed typical mosaic
gen geográfico y/o plantas hospederas del SCMV. symptoms or they were asymptomatic. The samples
Por lo anterior, el objetivo del presente estudio fue taken were wrapped in plastic bags, placed in coolers
detectar mediante RT-PCR la presencia y distribu- with thermal refrigerants and were transferred
ción del SCMV en las zonas cañeras del Pacífico to the Laboratory of Plant Biotechnology from
de México y determinar el origen filogenético de Campo Experimental Tecomán of INIFAP, located
un aislado del estado de Jalisco. La información on km 35 of the Colima-Manzanillo highway, in
generada en este trabajo podrá ser utilizada por el Colima.
Centro de Investigación y Desarrollo de la Caña
de Azúcar (CIDCA), tanto en su estación cuaren- Extraction and quantification of the total RNA
tenaria para el intercambio de germoplasma, como
dentro del programa de mejoramiento genético, en Approximately 200 mg were taken from several
el que la selección y eliminación de clones suscep- parts of the foliar tissue of one same plant. These
tibles al SCMV son procedimientos rutinarios. leaves were pulverized using liquid nitrogen until
a fine powder was formed, which was deposited
in a 1.5 mL tube, and homogenized with 500 μL
MATERIALES Y MÉTODOS of the Tripure reagent (Roche). Manufacturer
recommendations were taken for the extraction
Material vegetal of total RNA. Finally, the RNA obtained was
resuspended in RNase free water (0.01% DEPC)
Durante el año 2014 se colectaron muestras and stored at -70°C. Quantification was carried
foliares de diversas variedades de caña de azúcar out using a NanoDrop (Thermo Scientific)
sembradas comercialmente en los estados de Co- spectrophotometer using 1 μL of the total RNA
lima, Jalisco y Nayarit (Figura 1). Las plantas pre- extracted, and the A260:280 y A260:230, ratio was
sentaron sintomatología típica de mosaico o fueron measured to determine its purity.
asintomáticas. Las muestras se envolvieron en bol-
sas plásticas, fueron colocadas en hieleras con re- Cloning a fragment of SCMV in pGEM-T Easy
frigerantes térmicos y se trasladaron al laboratorio
de biotecnología de plantas del Campo Experimen- In order to have a positive control for the
tal Tecomán del INIFAP ubicado en el km 35 de la detection of the virus, the PCR product of 720 bp,
carretera Colima-Manzanillo en Colima. which corresponds to a sugarcane foliage sample,
obtained in a location of the state of Jalisco, was
Extracción y cuantificación del RNA total purified from agarose gel using the “QIAquick Gel
Extraction” (QIAGEN) kit, following manufacturer
Se tomaron aproximadamente 200 mg de varias instructions. Later, the fragment was cloned using
partes del tejido foliar de una misma planta. Estas the “pGEM-T Easy” (Promega) system, and was
hojas se pulverizaron con nitrógeno líquido hasta transformed into E. coli JM109 cells (Promega),
obtener un polvo fino, el cual fue depositado en un which were previously made competent using
tubo de 1.5 mL y se homogeneizó con 500 μL del CaCl2 according to Riley et al., 2008. A DNA

Publicación en línea, enero 2018 20

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 1. Ubicación geográfica de los sitios de muestreo donde se colectaron hojas de caña de azúcar.
Figure 1. Geographic location of the sampling sites from which sugarcane leaves were collected.

reactivo Tripure (Roche). Se siguieron las reco- fragment insert cloned in the vector was verified by
mendaciones del fabricante para la extracción del purification of plasmid DNA from the recombinant
RNA total. Finalmente, el RNA obtenido fue re- cells and the subsequent digestion reaction with
suspendido en agua libre de RNasa (0.01% DEPC) enzymes EcoR I and Not I.
y almacenado a -70°C. La cuantificación se reali-
zó con un espectrofotómetro NanoDrop (Thermo Analysis of sequences
Scientific) utilizando 1 μL del RNA total extraído y
se midieron las relaciones de A260/280 y A260/230 para The plasmid from the DNA fragment cloned
determinar su pureza. in E. coli was sequenced in a ABI PRISM 310
Genetic Analyzer in both strands with the method
Clonación de un fragmento del SCMV en of termination with Applied Biosystems’ Big Dye.
pGEM-T Easy The editing and assembling of the “forward” and
“reverse” sequences was carried out using the
Con el objetivo de contar con un control po- program CLC Main Workbench 7. Finally, the
sitivo para la detección del virus, el producto de similarity of the sequences obtained was compared
PCR de 720 pb correspondiente a una muestra de with those reported for SCMV in the National
follaje de caña de azúcar, obtenida de una localidad Center for Biotechnology Information (NCBI)

Publicación en línea, enero 2018 21

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

del estado de Jalisco fue purificada a partir del gel database, using the Basic Local Alignment Search
de agarosa con el kit “QIAquick Gel Extraction” Tool (BLAST).
(QIAGEN), según las indicaciones del fabricante.
Posteriormente, el fragmento se clonó con el siste- Detection of SCMV by RT-PCR
ma de “pGEM-T Easy” (Promega) y se transformó
en células de E. coli JM109 (Promega), las cuales The reverse transcription reaction (RT) of
se hicieron competentes previamente con CaCl2 de the total RNA was carried out using the Reverse
acuerdo a Riley et al., 2008. La comprobación del Transcription System (Promega) kit. The RNA was
inserto clonado en el vector se realizó mediante la denaturalized at 70°C for 10 min; the RT reaction
extracción de DNA plasmídico (Engebrecht et al., mixture was carried out in a volume of 20 µL
2001) a las colonias recombinantes y posterior re- containing 5 mM of MgCl2, buffer RT 1 X, 1 mM
acción de digestión con las enzimas EcoR I y Not I. of each dNTP, 1 u/µL of recombinant RNasin®
ribonuclease inhibitor, 15 u/µg of AMV reverse
Análisis de secuencias transcriptase AMV, 0.5 µg of oligonucleotide
mixture by µg of RNA and 5 µL of total RNA (1.5 µg
approximately). This mixture was incubated at
El DNA plasmídico del fragmento clonado en
room temperature for 10 min and then at 42°C for
E. coli fue secuenciado en un secuenciador ABI
45 min. Immediately, it was incubated at 95°C for
PRISM 310 Genetic Analyzer en ambas direccio-
5 min, and finally 0-5°C for 5 min. The resulting
nes por el método de terminación con el Big Dye de
cDNA were used as a mold for the amplification by
Applied Biosystems. La edición y el ensamblado de
PCR with the oligonucleotides described by Xie et
las secuencias “forward” y “reverse” se realizó con
al. (2009). The final volume of the reaction mixture
el programa CLC Main Workbench 7. Finalmente
was 25 µL, containing 12.5 µL of REDTaq®
se comparó la similitud de las secuencias obtenidas
ReadyMixTM (SIGMA-ALDRICH), 1 μM of each
contra las reportadas para SCMV en la base de da- oligonucleotide, 3 µL of cDNA and molecular
tos del “National Center for Biotechnology infor- grade water. The reaction mixture was incubated
mation” (NCBI) empleando la herramienta “Basic in a thermocycler (Labnet) with the following
Local Alignment Searh Tool” (BLAST). program: one cycle of 50°C for 30 min and
94°C for 2 min; 35 cycles of 94°C for 30 sec, 56°C
Detección del SCMV por RT-PCR for 30 sec and 72°C for 1 min, followed by a final
extension at 72°C for 5 min. Electrophoresis was
La reacción de transcripción inversa (RT) del carried out on agarose gel at 1% with TAE buffer 1
RNA total se realizó utilizando el kit “Reverse X and 12.5 µL of the PCR products were used; the
Transcription System” (Promega). El RNA fue samples were run with a voltage of 120 V. Finally,
desnaturalizado a 70 °C durante 10 min; la mezcla the gels were stained with BrEt and observed using
de reacción RT se llevó a cabo en un volumen de a transilluminator with UV light (UVP) for the
20 µL conteniendo 5 mM de MgCl2, amortiguador analysis of results.
RT 1 X, 1 mM de cada dNTP, 1 u/µL de inhibidor
de ribonucleasa RNasin® recombinante, 15 u/µg Phylogenetic analysis
de transcriptasa inversa AMV, 0.5 µg de mezcla de
oligonucleótidos por µg de RNA y 5 µL de RNA to- All bioinformatic analysis were carried out
tal (1.5 µg aproximadamente). La mezcla anterior using CLC Workbench software version 7.0.3.

Publicación en línea, enero 2018 22

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

fue incubada a temperatura ambiente por 10 min y Sequences of the BLAST analysis were selected and
luego a 42°C durante 45 min. Inmediatamente des- downloaded in NCBI with the highest percentages
pués se incubó a 95°C durante 5 min y finalmente of identity with the SCMV sequence, wich named
0-5°C por 5 min. Los cDNA resultantes fueron uti- JalMex-126 (KT334297) and others from the same
lizados como molde para la amplificación por PCR database were used (Table 2). For all samples, PCR
con los oligonucleótidos descritos por Xie et al. in silico were carried out with the primers for SCMV
(2009). El volumen final de la mezcla de reacción described by Xie et al. (2009). In all the sequences
fue de 25 µL, conteniendo 12.5 µL de REDTaq® in which 720 bp fragments were produced, these
ReadyMixTM (SIGMA-ALDRICH), 1 μM de cada were extracted and stored in a local database.
oligonucleótido, 3 µL de cDNA y H2O grado mo- The sequences that did not generate the expected
lecular. La mezcla de reacción se incubó en un ter- fragment were aligned with those generated in the
mociclador (Labnet) con el siguiente programa: un database. The aligned regions of these sequences
ciclo de 50°C por 30 min y 94°C por 2 min; 35 were selected and stored. The region HC-Pro of
ciclos de 94°C por 30 seg, 56°C por 30 seg y 72°C PRSV (NC_001785) was used as an external group.
por 1 min seguido de una extensión final a 72°C por
Multiple alignments of sequences were carried out
5 min. La electroforesis se realizó en gel de aga-
using the MUSCLE algorithm, and the maximum
rosa al 1% con buffer TAE 1 X y fueron cargados
likelihood and Neighbor-joining methods were
12.5 µL de los productos de PCR; las muestras se
used for the construction of the phylogenetic tree.
corrieron con un voltaje de 120 V. Finalmente los
General Time Reversible (GTR) was used as a
geles se tiñeron con BrEt y se visualizaron en un
model of substitution of nucleotides. The bootstrap
transiluminador con luz UV (UVP) para el análisis
analysis was carried out with 1,000 repetitions, and
de los resultados.
finally, the phylogenetic tree was edited using the
software TreeGraph 2.
Análisis filogenético

Todos los análisis bioinformáticos se realizaron

con el software CLC Workbench versión 7.0.3. Se
seleccionaron y descargaron secuencias del análi- RESULTS
sis BLAST en NCBI con los mayores porcentajes
de identidad con la secuencia de SCMV denomi- Symptoms
nada JalMex-126 (KT334297) y se emplearon
otras más de la misma base de datos (Cuadro 2). The symptoms related to the presence of SCMV
Para todas las muestras se realizaron PCR in sili- were found in the foliar samples collected from
co, con los primers para SCMV descritos por Xie sugarcane plants of different varieties in the states
et al. (2009). En todas las secuencias en las que of Colima, Jalisco, and Nayarit, Mexico. Also,
se generaron fragmentos de 720 pb, estos fueron variations were observed in the mosaic patterns
extraídos y almacenados en una base de datos lo- (Figure 2 A). Other samples with mosaics were
cal. Las secuencias que no generaron el fragmen- found to have symptoms, such as white stripes in
to esperado fueron alineadas con las generadas en ribs, lesions from pustules, chlorosis, necrosis and
la base de datos. Se seleccionaron y guardaron las corrugated leaves (Figure 2 B).

Publicación en línea, enero 2018 23

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

regiones alineadas de estas secuencias. Se utilizó Cloning a fragment of SCMV

como grupo externo la región HC-Pro del PRSV
(NC_001785). Se realizaron alineamientos múl- The positive control used to detect the presence
tiples de secuencias con el algoritmo MUSCLE y and distribution of SCMV in three states of the
se empleó el método de máxima verosimilitud y Mexican Pacific was obtained from a sample with
Neighbor-joining para la construcción del árbol fi- severe mosaic symptoms from the state of Jalisco.
logenético. Se utilizó “General Time Reversible” A 720 bp fragment was amplified and cloned; later,
(GTR) como modelo de sustitución de nucleótidos. seven recombinant colonies were obtained and
El análisis bootstrap se realizó con 1,000 réplicas y a restrictive analysis was carried out with EcoR
finalmente el árbol filogenético fue editado con el I and Not I to verify the presence of the cloned
software TreeGraph 2. fragment (Figure 3), which was finally sequenced.
The BLAST analysis of the sequence presented an
identity of up to 95% with other SCMV accessions,
RESULTADOS and was placed in the NCBI database, under
registration number KT334297. The sequence was
Síntomas established as belonging to a partial region of the
HC-Pro gene of SCMV.
Los síntomas relacionados con la presencia del
SCMV se encontraron en las muestras foliares co- Identification and distribution of SCMV in three
lectadas de caña de azúcar de diferentes variedades states of the Mexican Pacific
en los estados de Colima, Jalisco y Nayarit, Méxi-
co; así mismo, se observaron variaciones en los pa- All the products of RT-PCR that underwent
trones de mosaico observados (Figura 2 A). Otras electrophoresis in agarose gel that showed the
muestras con mosaico también fueron detectadas amplification of fragments of 720 bp of SCMV
con algunos síntomas como rayas blancas en ner- with the set of oligonucleotides SCMV-F1/
vaduras, lesiones por pústulas, clorosis, necrosis y SCMV-R1 described by Xie et al. (2009) were
hoja corrugada (Figura 2 B). considered as positive to the virus (Figure 4). A
total of 242 foliar samples of diverse, commercially
Clonación de un fragmento del SCMV planted, symptomatic and asymptomatic sugarcane
varieties, were analyzed for mosaic, as well as
El control positivo utilizado para detectar la pre- other symptoms described earlier.
sencia y distribución del SCMV en tres estados del Table 1 shows the wide distribution presented
Pacífico de México se obtuvo de una muestra con by SCMV in the tropical and subtropical regions of
síntomas severos de mosaico procedente del esta- the Mexican Pacific covered by the present study.
do de Jalisco. Se amplificó y clonó un fragmento In the state of Colima, it was found in the varieties
de 720 pb; posteriormente, fueron obtenidas siete Mex 69-290 and CP 72-2086, among many others
colonias recombinantes y se realizó el análisis res- in the experimental stage. Also, in Jalisco it
trictivo con EcoR I y Not I para comprobar la pre- affected the same two varieties, as well as Atemex
sencia del fragmento clonado (Figura 3), el cual fi- 96-40. Finally, in Nayarit variety Mex 69-290
nalmente fue secuenciado. El análisis BLAST de la was also the most affected. Table 1 shows the 33

Publicación en línea, enero 2018 24

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

A)

B)

Figura 2. A) Diversidad de síntomas de mosaico en hojas de caña de azúcar. B) Diversidad de síntomas (patrón de mosaico,
lesiones por pústulas, clorosis, necrosis, mancha café y hoja corrugada) en hojas de caña de azúcar positivas al
SCMV por RT-PCR.
Figure 2. A) Diversity of the symptoms of mosaic in sugarcane leaves. B) Diversity of symptoms (mosaic pattern, lesions
from pustules, chlorosis, necrosis, brown stain, and corrugated leaf) in sugarcane leaves that tested positive for
SCMV using RT-PCR.

secuencia presentó hasta un 95% de identidad con sugarcane plants that tested positive for SCMV and
otras accesiones de SCMV y fue depositada en la their geographic origin, corresponding to 13.63%
base de datos de NCBI con el registro KT334297. of the total of plants analyzed. The varieties with
Se determinó que la secuencia corresponde a una the most severe viral symptoms and that tested
región parcial del gen HC-Pro del SCMV. positive for SCMV were Mex 69-290, CP 72-2086
and Atemex 96-40. Some samples presented clear
Identificación y distribución del SCMV en tres mosaic symptoms, although they tested negative
estados del Pacífico de México for the presence of the virus by RT-PCR.

Todos los productos de RT-PCR sometidos a Phylogenetic origin

electroforesis en gel de agarosa que mostraron
la amplificación de fragmentos de 720 pb del The phylogenetic analysis with the partial
SCMV con el juego de oligonucleótidos SCMV- sequence HC-Pro of SCMV from Jalisco and
F1/SCMV-R1 descritos por Xie et al. (2009) other similar sequences from other countries is
fueron considerados como positivos al virus (Figu- shown in Figure 5. The formation of two groups is
ra 4). En total se analizaron 242 muestras foliares observed, the first of which includes two sequences
de diversas variedades de caña de azúcar sembradas from Mexico, EU091075 and GU474635,
comercialmente, sintomáticas y asintomáticas para whose percentages of identity with JalMex-126

Publicación en línea, enero 2018 25

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Figura 3. Digestión enzimática con EcoR I y Not I para liberación del inserto de 720 pb del fragmento parcial HC-Pro de
SCMV clonado en el vector pGEM T Easy (Promega). 1-7: DNA plasmídico de colonias de E. coli recombinantes.
M: Marcador de peso molecular 1 Kb plus (Invitrogen).
Figure 3. Enzyme digestion with EcoR I and Not I for the release of the insert of 720 bp of the partial fragment HC-Pro
of SCMV cloned in the vector pGEM T Easy (Promega). 1-7: plasmid DNA of recombinant E. coli colonies. M:
Molecular weight marker 1 Kb plus (Invitrogen).

720 pb

Figura 4. Detección del Sugarcane mosaic virus (SCMV) mediante RT-PCR en muestras de caña de azúcar procedentes de
tres estados del Pacifico mexicano. C-: control negativo (H2O). C+: Control positivo (DNA plasmídico). M: Mar-
cador de peso molecular 100 pb (Invitrogen). Los números corresponden a diferentes muestras analizadas.
Figure 4. Detection of the Sugarcane mosaic virus (SCMV) by RT-PCR in sugarcane samples from three states of the Mexi-
can Pacific. C-: negative control (H2O). C+: Positive control (plasmid DNA). M: Molecular weight marker 100 pb
(Invitrogen). Numbers correspond to different samples analyzed.

mosaico; además de la presencia de otros síntomas (isolate from this study) were 80.39 and 79.28%,
descritos anteriormente. respectively. This group also included another two
En el Cuadro 1 se observa la amplia distribución sequences from China and Germany. In the second
que presenta el SCMV en las regiones tropicales y group is JalMex-126, along with two sequences
subtropicales del Pacífico de México que abarcó el from India, one from Australia, two from China, and
presente estudio. En el estado de Colima se detectó one from Argentina, with which it shares identity
en las variedades Mex 69-290 y CP 72-2086, entre percentages of between 92.5-95.14%, and therefore
otras más en etapa experimental. De igual manera, en the viruses of this group may have a common

Publicación en línea, enero 2018 26

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cuadro 1. Relación de muestras de follaje de caña de azúcar positivas al SCMV mediante RT-PCR en la región cañera del
Pacífico de México.
Table 1. List of sugarcane foliage samples that tested positive for SCMV by RT-PCR in the sugarcane-producing region of
the Mexican Pacific.

No. Muestra Estado Municipio Georeferencia Variedad

1 87 Colima Colima N 19°11’33.0’’ W 103°43’15.4’’ CP 72-2086

2 88 Colima Colima N 19°09’43.6’’ W 103°43’14.0’’ CP 72-2086
3 35 Colima Cuauhtémoc N 19°24’34.14’’ W 103°38’19.79’’ Mex 69-290
4 82 Colima Cuauhtémoc N 19°22’36.61’’ W 103°33’37.49’’ CP 72-2086
5 90 Colima Cuauhtémoc N 19°22’09.12’’ W 103°34’49.81’’ CP 72-2086
6 148 Colima Tecomán N 18°52’36.24” W 103°52’1.49” CP 72-2086
7 336 Colima Tecomán N 18°52’40.12” W 103°51’50.62” CP 72-2086
8 23 Colima Tecomán N 18°56’37.4’’ W 103°46’26.03’’ Mex 69-290
9 33 Colima Tecomán N 18°48’33.23’’ W 103°50’37.89’’ Mex 69-290
10 146 Colima Tecomán N 18°57’57.26’’ W 103°50’22.01’’ Saccharum spp.
11 2 Colima Tecomán N 18°56’06.52’’ W 104°00’03.54’’ Saccharum spp.
12 37 Colima Tecomán N 18°48’32.91’’ W 103°50’33.48’’ Mex 69-290
13 133 Colima Tecomán N 18°52’37.61” W 103°51’57.66” Saccharum spp.
14 387 Colima Tecomán N 18°57’56.03’’ W 103°50’22.02’’ Saccharum spp.
15 350 Jalisco Autlán N 19°45’07.23’’ W 104°19’36.69’’ Mex 69-290
16 342 Jalisco Cuautitlán N 19°26’49.58’’ W 104°24’10.45’’ Saccharum spp.
17 344 Jalisco Cuautitlán N 19°26’54.74’’ W 104°23’40.70’’ Mex 79-431
18 355 Jalisco El Grullo N 19°48’49.81’’ W 104°14’35.95’’ Mex 69-290
19 349 Jalisco El Grullo N 19°47’44.20” W 104°13’38.63” Atemex 96-40
20 413 Jalisco La Huerta N 19°31’07.39’’ W 104°32’11.61’’ Saccharum spp.
21 341 Jalisco La Huerta N 19°31’08.14’’ W 104°32’11.61’’ Saccharum spp.
22 369 Jalisco La Huerta N 19°31’11.23’’ W 104°32’10.97’’ Saccharum spp.
23 340 Jalisco La Huerta N 19°31’05.15’’ W 104°32’06.51’’ Atemex 96-40
24 114 Jalisco Zapotiltic N 19°38’43.00’’ W 103°24’31.01’’ Atemex 96-40
25 120 Jalisco Zapotiltic N 19°38’42.90’’ W 103°24’29.40’’ Atemex 96-40
26 125 Jalisco Zapotiltic N 19°38’24.12’’ W 103°25’03.64’’ CP 72-2086
27 110 Jalisco Zapotiltic N 19°38’27.25’’ W 103°25’04.85’’ CP 72-2086
28 113 Jalisco Zapotiltic N 19°38’42.9’’ W 103°24’29.7’’ Atemex 96-40
29 126 Jalisco Zapotiltic N 19°38’42.68’’ W 103°24’30.04’’ Atemex 96-40
30 123 Jalisco Zapotiltic N 19°38’42.31’’ W 103°24’31.21’’ Atemex 96-40
31 138 Jalisco Zapotiltic N 19°38’42.58’’ W 103°24’31’’ Atemex 96-40
32 186 Nayarit Santa María del Oro N 21°17’56.3’’ W 104°32’14.9’’ Mex 69-290
33 170 Nayarit Xalisco N 21°27’50.1’’ W 104°53’11.4’’ Saccharum spp.

Jalisco se presentó afectando a las mismas dos va- genetic origin. For both groups, the geographic
riedades, además de la Atemex 96-40. Finalmente, origins of the isolates were very diverse. The main
en Nayarit también la variedad Mex 69-290 fue la difference between these two groups formed lies in
más afectada. En el cuadro 1 se muestra la relación the type of virus host. The viral sequences of the
de 33 plantas que resultaron positivas al SCMV y first group had maize plants as hosts, except for the
su origen geográfico, lo que representa un 13.63% isolate from Germany, whose host is unknown. The
del total analizado. Las variedades con síntomas rest of the HC-Pro sequences of SCMV that made

Publicación en línea, enero 2018 27

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

más severos de virosis y que resultaron positivas al up the second group come from diverse hybrids
SCMV fueron Mex 69-290, CP 72-2086 y Atemex and sugarcane species (Table 2).
96-40. Algunas muestras presentaron síntomas cla-
ros de mosaico, sin embargo, resultaron negativas a
la presencia del virus mediante RT-PCR. DISCUSSION

Origen filogenético The variety of symptoms present in the

analyzed samples, combined with mosaic patterns,
El análisis filogenético con la secuencia parcial are possibly due to mixed infections with fungi,
HC-Pro del SCMV de Jalisco y otras secuencias si- since some of the symptoms observed are from
milares de otros países se muestra en la Figura 5. diseases such as brown spot, common rust, pokkah
Se observa la formación de dos grupos, el primero boeng, the causal agents of which are Cercospora
incluye dos secuencias de México, EU091075 y longipes, Puccinia melanocephala and Gibberella
GU474635 cuyos porcentajes de identidad con Jal- fujikuroi, respectively (Raid and Comstock, 2000;
Mex-126 (aislado de este estudio) fueron de 80.39 Saumtally and Sullivan, 2000; Whittle and Irawan,
y 79.28%, respectivamente; en este grupo también 2000). However, molecular tests must be carried
se incluyeron otras dos secuencias procedentes de out to confirm the identity of these causal agents.
China y Alemania. En el segundo grupo se encuen- On the other hand, according to Xie et al. (2009),
tra la secuencia JalMex-126, junto con dos secuen- the mosaic disease is caused by a complex of three
cias de la India, una de Australia, dos de China y viruses: the SCMV, the Sorghum mosaic virus

Grupo 1

Grupo 2

Figura 5. Árbol filogenético basado en el método de Neighbor-joining y máxima verosimilitud utilizando secuencias parcia-
les del fragmento HC-Pro del SCMV. Las ramas con valores de bootstrap menores a 50% fueron colapsadas. Se
utilizó como grupo externo al Papaya ringspot virus (PRSV). En negritas y subrayado se resalta el aislado de este
estudio.
Figure 5. Phylogenetic tree based on the Neighbor-joining and maximum likelihood methods using partial sequences of the
fragment HC-Pro of SCMV. Branches with bootstrap values below 50% were collapsed. The Papaya ringspot virus
(PRSV) was used as an external group. The isolate of this study is highlighted in bold letters and underlined.

Publicación en línea, enero 2018 28

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

una de Argentina, con las que comparte porcentajes (SrMV) and the Sugarcane streak mosaic virus
de identidad de entre 92.5-95.14%, por lo que los (SCSMV), the last two of which have not been
virus de este grupo podrían tener un origen gené- reported as affecting sugarcane in Mexico. The fact
tico común. Para ambos grupos, los orígenes geo- that samples with mosaic characteristics turned
gráficos de los aislados fueron muy diversos; la out negative for the RT-PCR test for SCMV in this
principal diferencia entre estos dos grupos que se study may be due to its symptoms being related
formaron radica en el tipo de hospedero del virus. with the presence of some of the viruses mentioned
Las secuencias virales del primer grupo tuvieron earlier (Grisham, 1994; Xie et al., 2009), or
como hospederos a plantas de maíz, exceptuando those samples with severe mosaics and positive
al aislado de Alemania cuyo hospedero se desco- to SCMV may contain mixed viral infections.
noce. El resto de secuencias de HC-Pro del SCMV Recently, Balarabe et al. (2014) mentioned that the
que formaron el segundo grupo son provenientes Johnsongrass mosaic virus (JGMV) and the Maize
de diversos híbridos y especies de caña de azúcar dwarf mosaic virus (MDMV) cause mosaic disease
(Cuadro 2). in sugarcane in Nigeria. To this day, the presence of
the SrMV has been confirmed in the United States,
China, and Vietnam (Yang and Mirkov, 1997;
DISCUSIÓN Grisham and Pan, 2007; Ha et al., 2008; Zhang
et al., 2016), whereas SCSMV is limited to the
La diversidad de síntomas presentes en las sugarcane producing areas of the Asian continent
muestras analizadas combinados con patrones de (Hall et al., 1998; Hema et al., 1999; Rao et al.,
mosaico, posiblemente se deban a infecciones mix- 2006). However, due to the proximity of Mexico to
tas con hongos, ya que algunos de los síntomas ob- the United States, it is likely that SrMV is infecting
servados corresponden a enfermedades como man- sugarcane plants in our country.
cha café, roya café y pokkah boeng, cuyos agentes The detection of SCMV by RT-PCR in this study
causales son Cercospora longipes, Puccinia confirms its wide distribution in the sugarcane

Cuadro 2. Secuencias parciales del fragmento HC-Pro del SCMV obtenidas de la base de datos de NCBI y utilizadas en este
estudio para el análisis filogenético.
Table 2. Partial sequences of the fragment HC-Pro of SCMV obtained from the NCBI database and used in this study for
the phylogenetic analysis.

No. Nombre del aislado Origen Hospedero Año No. Acceso

1 JalMex-126 México Saccharum spp. (Var. Atemex 96-40) 2015 KT334297

2 Brisbane Australia Saccharum spp. 2005 AJ278405
3 FZ-C1 China Saccharum spp. (Var. Badila) 2014 KR108212
4 CBTCT-Seng India Saccharum sinense 2014 KX266877
5 ARG-915 Argentina Saccharum spp. 2007 JX237863
6 FZ-C2 China Saccharum spp. (Var. Badila) 2014 KR108213
7 CBMungo India Saccharum barberi 2014 KX266876
8 JAL-1 México Zea mays 2010 GU474635
9 SCMV-VER1 México Zea mays 2011 EU091075
10 Seehausen Alemania - 2012 JX185303
11 SCMVgp1 China Zea mays 2015 NC_003398

Publicación en línea, enero 2018 29

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

melanocephala y Gibberella fujikuroi, respectiva- growing areas of the Mexican Pacific region. The
mente (Raid y Comstock, 2000; Saumtally y Su- virus is even present in the European continent,
llivan, 2000; Whittle e Irawan, 2000); sin embar- due to the amount of plant species that can act as
go, se deben realizar las pruebas moleculares para reservoirs for it (Dallwitz, 1980; Dallwitz et al.,
confirmar la identidad de estos agentes causales. 1993; Brunt et al., 1996). In Mexico, varieties
Por otra parte, según Xie et al. (2009) la enferme- Mex 69-290 and CP-72-2086, not only cover 50%
dad del mosaico es ocasionada por un complejo de of the area planted with sugarcane, but have also
tres virus: SCMV, Sorghum mosaic virus (SrMV) been in use for over 30 years, which has led to
y Sugarcane streak mosaic virus (SCSMV), de los the genetic deterioration of the materials, leading,
cuales los últimos dos no se han reportado afec- with time, to susceptibility to several diseases,
tando a caña de azúcar en México. Probablemen- including viral diseases. Also, its vegetative
te las muestras con características de mosaico que reproduction characteristics (seed-stake), as well as
resultaron negativas a la prueba de RT-PCR para the presence of vector aphids Melanaphis sacchari
detectar SCMV en el presente estudio se deba a que and Rophalosiphum maidis (Figueredo et al., 2004)
sus síntomas estén asociados con la presencia de have promoted the dispersion of the virus.
alguno de los virus antes mencionados (Grisham, Several reports have identified the presence
1994; Xie et al., 2009), o incluso aquellas muestras of SCMV in various countries (Smith and Van de
con mosaicos severos y positivas al SCMV con- Velde, 1994; Xie et al, 2009; Filippone et al., 2010;
tengan infecciones virales mixtas. Recientemente Sawazaki et al., 2013). This study was based on
Balarabe et al. (2014) mencionan que también el the work described by Xie et al. (2009) for the
Johnsongrass mosaic virus (JGMV) y el Maize standardization of the method of detection for RT-
dwarf mosaic virus (MDMV) son responsables de PCR. However, despite the molecular diagnosis
la enfermedad del mosaico en caña de azúcar en techniques being more sensitive than serological
Nigeria. Hasta el momento se ha reportado la pre- methods, the latter are less expensive and easier
sencia del SrMV en Estados Unidos, China y Viet- to use when a higher number of samples must be
nam (Yang y Mirkov, 1997; Grisham y Pan, 2007; processed (Gonçalves et al., 2007; Balarabe et
Ha et al., 2008; Zhang et al., 2016), mientras que al., 2014). In Mexico, the SCMV is viewed as the
el SCSMV está limitado para las zonas cañeras del only causal agent of the mosaic disease, although
continente asiático (Hall et al., 1998; Hema et al., there are no solid reports or with scientific validity
1999; Rao et al., 2006). Sin embargo, debido a la to sustain these facts, since information on the
cercanía de Estados Unidos con México sería muy presence of the virus in the country go back to
probable que el SrMV se encuentre infectando a las 1930-1950, and have also been based on the
plantas de caña de azúcar en nuestro país. typical symptoms of the disease (CONADESUCA,
La detección del SCMV por RT-PCR en este es- 2015), which is not conclusive. Studies related
tudio confirma su amplia distribución en las zonas to the SCMV in Mexico have focused on maize
cañeras de la región del Pacífico de México. El vi- (Espejel et al., 2006; Chaves et al., 2011; Chaves
rus incluso está presente en el continente europeo, and Ortiz, 2012). Chaves et al. (2011) obtaine done
donde no se cultiva caña de azúcar, debido a la can- isolate of SCMV in maize in the state of Veracruz
tidad de especies vegetales que pueden servir como and they used the sugarcane varieties CP 72-2086
reservorios del mismo (Dallwitz, 1980; Dallwitz et and MY 44-12 as reference genotypes to inoculate

Publicación en línea, enero 2018 30

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

al., 1993; Brunt et al., 1996). En México, las va- the virus in the leaf of both maize and sugarcane
riedades Mex 69-290 y CP-72-2086, además de re- to determine the movement of SCMV-Ver1. Due
presentar más del 50% del área cultivada con caña to this, the present paper represents the first study
de azúcar, tienen más de 30 años de uso, lo que ha focused on sugarcane to determine the presence and
conllevado al deterioro genético de los materiales distribution of SCMV in the sugarcane producing
que con el tiempo han presentado susceptibilidad a area of the Mexican Pacific. Finally, it is worth
diversas enfermedades, incluidas las virales. Ade- pointing out that in Mexico, there is a need for
más, sus características de multiplicación vegeta- more studies that quantify the damage caused by
tiva (semilla-estaca), así como la presencia de los the sugarcane mosaic disease, since most farmers
áfidos vectores Melanaphis sacchari y Rophalosi- or the agroindustry are unaware of the economic
phum maidis (Figueredo et al., 2004) han favoreci- impact it could have on the crop.
do la dispersión del virus. Regarding the phylogenetic origin of the
Hay varios reportes que han identificado la pre- isolation JalMex-126, results indicate that it could
sencia del SCMV en varios países (Smith y Van de have a common genetic origin with isolations
Velde, 1994; Xie et al, 2009; Filippone et al., 2010; from India, Australia, China and Argentina, which
Sawazaki et al., 2013). El presente estudio se basó suggests deficiencies in the phytosanitary control
en el trabajo descrito por Xie et al. (2009) para la during the exchange of germplasm, which is very
estandarización del método de detección mediante common due to the type of seed-stake reproduction
RT-PCR; sin embargo, a pesar de que las técnicas in sugarcane. However, due to the number of HC-
de diagnóstico molecular tienen mayor sensibili- Pro sequences of SCMV, it is very reduced in
dad que los métodos serológicos, estos últimos son the NCBI data base in comparison with the CP
más económicos y factibles de utilizar cuando se sequences, it was not possible to relate the origin
deben procesar un elevado número de muestras of the Mexican isolation with important sugarcane
(Gonçalves et al., 2007; Balarabe et al., 2014). En producing countries such as Brazil, United States,
México, se atribuye al SCMV como único agente Colombia, and others. In this study we obtained
causal de la enfermedad del mosaico; sin embargo, the formation of two groups based on partial HC-
no existen reportes sólidos o con validez científica Pro sequences of SCMV, and this same tendency
para sostener estos hechos debido a que la infor- was previously reported by Chaves and Ortiz
mación que se tiene sobre la presencia del virus en (2012) and Xie et al. (2016), using CP sequences
el país datan desde los años 1930-1950, además de of SCMV. Similarly, these authors coincide in that
que se han basado en la sintomatología típica de la the formation of these groups is related to the hosts
enfermedad (CONADESUCA, 2015), lo cual no es of SCMV: sugarcane and maize, mainly.
concluyente. En México, los estudios relacionados According to Chaves and Ortiz (2012), Mexican
con el SCMV se han centrado en el cultivo del maíz isolate JAL-1, with access number GU474635 has
(Espejel et al., 2006; Chaves et al., 2011; Chaves a higher phylogenetically proximity to SCMV
y Ortiz, 2012). Chaves et al. (2011) obtuvieron un isolates from Brazil and the United States, while
aislado del SCMV de maíz en el estado de Veracruz CP sequences reported in China and Germany are
y utilizaron las variedades de caña de azúcar CP phylogenetically nearer to the Mexican isolation
72-2086 y MY 44-12 como genotipos de referen- SCMV-VER1, with access number EU091075.
cia para inocular el virus en la lámina foliar tanto In this study, the Mexican isolates mentioned

Publicación en línea, enero 2018 31

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

de maíz como caña para determinar el movimiento above were closely related and they grouped with
del SCMV-Ver1. Por lo anterior, el presente trabajo sequences from China and Germany, composing
representa el primer estudio centrado en caña de group 1. On the other hand, Moradi et al. (2017),
azúcar para detectar la presencia y distribución del also contemplated in their analysis the same two
SCMV en la zona cañera del Pacífico mexicano. Fi- Mexican sequences of SCMV and placed them in
nalmente, cabe destacar que, en México, hacen falta two different groups. Due to the above, there may
estudios que cuantifiquen el daño ocasionado por la be a need to include more HC-Pro sequences of
enfermedad del mosaico en caña de azúcar ya que SCMV into the phlogenetic analysis to observe a
la mayor parte de los productores y la agroindustria similar tendency to those reported by these authors.
desconocen el impacto económico que podrían te-
ner en el cultivo.
Con respecto al origen filogenético del aislado CONCLUSIONS
JalMex-126, los resultados indican que podría te-
ner un origen genético común con aislados de In- The RT-PCR tests carried out on symptomatic
dia, Australia, China y Argentina, lo que sugiere and asymptomatic vegetative sugarcane material
deficiencias en el control fitosanitario durante el helped identify the presence of SCMV in the
intercambio de germoplasma, lo cual es muy co- states of Colima, Jalisco, and Nayarit. This virus
mún por el tipo de reproducción de semilla-estaca is widely distributed in the sugarcane areas of
en caña de azúcar. Sin embargo, debido a que el western Mexico, probably due to the presence of
número de secuencias HC-Pro del SCMV es muy vector aphids and the propagation of potentially
reducido en la base de datos de NCBI a compa- infected stake seed. The phylogenetic analysis
ración del número de secuencias CP, no fue posi- using partial HC-Pro sequences from the SCMV
ble relacionar el origen del aislado mexicano con isolate JalMex-126 helped identify two groups,
países cañeros importantes como Brasil, Estados the first of which had maize plants as host, and
Unidos, Colombia, entre otros. En este estudio se the second, with host plants of different species
obtuvo la formación de dos grupos basados en se- and sugarcane hybrids. Isolate JalMex-126 of this
cuencias parciales HC-Pro de SCMV, esta misma study may probably share common genetic origins
tendencia fue reportada previamente por Chaves y with isolates from India, Australia, China, and
Ortiz (2012) y Xie et al. (2016), utilizando secuen- Argentina.
cias CP de SCMV. De forma similar, estos autores
coinciden que la formación de estos grupos está End of the English version
asociada con los hospederos que tiene el SCMV:
caña de azúcar y maíz, principalmente.
Según Chaves y Ortiz (2012), el aislado mexi- EU091075. En este estudio, los aislados mexicanos
cano JAL-1 con número de acceso GU474635 es fi- antes mencionados estuvieron estrechamente rela-
logenéticamente más cercano a aislados de SCMV cionados y se agruparon con secuencias de China
de Brasil y Estados Unidos, mientras que secuen- y Alemania, conformando el grupo uno. Por otra
cias de la CP del SCMV reportadas en China y Ale- parte, Moradi et al. (2017), también contemplaron
mania son filogenéticamente más cercanas al aisla- en su análisis las mismas dos secuencias mexicanas
do mexicano SCMV-VER1 con número de acceso de SCMV y las colocaron en dos grupos diferentes.

Publicación en línea, enero 2018 32

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Por lo anterior, es probable que haga falta incluir del mosaico de la caña de azúcar (SCMV). Acta Agronó-
mica 61:79-87. Disponible en línea: [Link]
más secuencias HC-Pro del SCMV al análisis filo- [Link]/[Link]/acta_agronomica/article/view/32464
genético para observar una tendencia similar a la CONADESUCA, Comité Nacional para el Desarrollo Susten-
table de la Caña de Azúcar. 2015. Fitopatologías. http://
reportada por estos autores. [Link] (Consulta, junio de 2016).
Dallwitz MJ 1980. A general system for coding taxonomic
descriptions. Taxon 29:41-46. [Link]
www/[Link]
CONCLUSIONES Dallwitz MJ, Paine TA, Zurcher EJ. 1993. User’s Guide to the
DELTA System: a general system for processing taxono-
mic descriptions. [Link]
Las pruebas de RT-PCR realizadas a material Engebrecht J, Brent R, Kaderbhai MA. 2001. Minipreps of
Plasmid DNA. Current Protocols in Molecular Biolo-
vegetativo sintomático y asintomático de caña gy. 15:II:1.6:1.6.1-1.6.10. DOI: 10.1002/0471142727.
de azúcar permitieron identificar la presencia del mb0106s15
Espejel F, Jeffers D, Noa CJC, Ruiz CS, Silva RL. 2006. Coat
SCMV en los estados de Colima, Jalisco y Nayarit. protein gene sequence of a Mexican isolate of Sugarca-
Este virus se encuentra ampliamente distribuido en ne mosaic virus and its infectivity in maize and sugarcane
plants. Archives of Virology 151:409-412. DOI: 10.1007/
las zonas cañeras del Occidente de México, pro- s00705-005-0645-3
bablemente por la presencia de áfidos vectores y Figueredo L, Hernández L, Linares B. 2004. Relación epide-
miológica entre áfidos (Homoptera: Aphididae) y enfer-
la propagación por semilla estaca potencialmente medades virales en el cultivo caña de azúcar en los valles
infectada. El análisis filogenético utilizando se- de los ríos Turbio y Yaracuy, Venezuela. Caña de azúcar
22:5-19.
cuencias parciales HC-Pro del aislado de SCMV Filippone MP, Perera MF, Salgado M, García MG, Vellicce
JalMex-126 permitieron identificar dos grupos, el GR y Castagnaro P. 2010. Diagnóstico molecular de enfer-
medades sistémicas de la caña de azúcar en la Argentina:
primero que tuvo como hospederos a plantas de ajuste metodológico y aplicaciones. Revista industrial y
maíz y el segundo con plantas hospederas de di- agrícola de Tucumán 87:1-11. Disponible en línea: http://
[Link]/[Link]?script=sci_abstract&pid
ferentes especies e híbridos de caña de azúcar. El =S1851-30182010000200001
aislado JalMex-126 de este estudio es probable que Gonçalves MC, Pinto LR, Souza SC and Landell MGA. 2012.
Virus diseases of sugarcane. A constant challenge to su-
comparta un origen genético común con aislados garcane breeding in Brazil. Functional Plant Science and
de India, Australia, China y Argentina. Biotechnology 6:108-116. Disponible en línea: http://
[Link]/Online/GSBOnline/ima-
ges/2012/FPSB_6(SI2)/FPSB_6(SI2)[Link]
Gonçalves MC, Santos AS, Maia IG, Chagas CM and Haraka-
va R. 2007. Characterization of an isolate of Sugarcane
LITERATURA CITADA mosaic virus breaking down resistance of commercial su-
garcane varieties. Fitopatologia Brasileira 32:32-39. http://
Balarabe DD, Adama Y, Azmat KUU, Aisha ZM. 2014. Iden- [Link]/10.1590/S0100-41582007000100004
tification of virus isolates inducing mosaic of sugarcane in Grisham MP and Pan YB. 2007. A genetic shift in the virus
Makarfi local government area of Kaduna state, Nigeria. strains that cause mosaic in Louisiana sugarcane. Plant
African Journal of Biotechnology 13:1351-1357. http:// Disease 91: 453-458. [Link]
[Link]/10.5897/AJB2013.13467 0453
Brunt AA, Crabtree K, Dallwitz MJ, Gibbs AJ, Watson L, Zur- Grisham MP. 1994. Strains of Sorghum mosaic virus causing
cher EJ (eds). 1996. `Plant Viruses Online: Descriptions sugarcane mosaic in Louisiana. Plant Disease 78:729-
and Lists from the VIDE Database. Version: 16th January 732. Disponible en línea: [Link]
1997. Disponible en línea: [Link] tions/PlantDisease/BackIssues/Documents/1994Articles/
Groups/MES/vide/ (Consulta, julio de 2017). PlantDisease78n07_729.pdf
Chaves BG, Espejel F, Alcalá BRI, Hernández VJ, Silva Grisham MP. 2000. Mosaic. Pp 249-254. In: P Rott, RA Bailey,
RS. 2011. Short distance movement of genomic ne- JC Comstock, BJ Croft, AS Saumtally (eds). A Guide to
gative strands in a host and nonhost for Sugarcane mo- Sugarcane Diseases. CIRAD Publications Service. Mon-
saic virus (SCMV). Virology Journal 8:15. [Link] tpellier, France. 339p.
org/10.1186/1743-422X-8-15 Ha C, Revill P, Harding RM, Vu M and Dale JL. 2008. Iden-
Chaves BG, Ortiz RLY. 2012. Evidencia de orígenes filogené- tification and sequence analysis of potyviruses infecting
ticos diferentes de dos aislamientos mexicanos del virus crops in Vietnam. Archives of Virology 153:45-60. http://
[Link]/10.1007/s00705-007-1067-1

Publicación en línea, enero 2018 33

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Hall JS, Adams B, Parsons TJ, French R, Lane LC and Jensen Singh M, Singh A, Upadhyaya PP and Rao GP. 2005. Trans-
SG. 1998. Molecular cloning, sequencing and phyloge- mission studies on an Indian isolate of sugarcane mo-
netic relationships of a new potyvirus: Sugarcane streak saic potyvirus. Sugar Technology 7:32-38. [Link]
mosaic virus and a reevaluation of the classification of org/10.1007/BF02942526
the Potyviridae. Molecular Phylogenetics and Evolution Singh V, Sinha OK and Kumar R. 2003. Progressive decline
10:323-332. [Link] in yield and quality of sugarcane due to sugarcane mosaic
Hema M, Joseph J, Gopinath K, Sreenivasulu P and Savithri virus. Indian Phytopathology 56:500-502.
HS. 1999. Molecular characterization and interviral rela- Smith GR and Van de Velde R. 1994. Detection of Sugarcane
tionships of a flexuous filamentous virus causing mosaic mosaic virus and Fiji disease virus in diseased sugarcane
disease of sugarcane (Saccharum officinarum L.) in India. using the polymerase chain reaction. Plant Disease 78:557-
Archives of Virology 144:479-490. Disponible en línea: 561. Disponible en línea: [Link]
[Link] tions/PlantDisease/BackIssues/Documents/1994Articles/
tion-and-interviral-relationships PlantDisease78n06_557.pdf
Koike H, Guillaspie AG. 1989. Mosaic. Pp 287-288. In: C Ri- Viswanathan R, Balamuralikrishnan M and Karuppaiah R.
caud, BT Egan, AG Gillaspie Jr, CG Hughes (eds). Disea- 2008. Characterization and genetic diversity of Sugarca-
se of sugarcane. Major Disease. Elsevier. Amsterdam, The ne streak mosaic virus causing mosaic in sugarcane. Virus
Netherlands. 387p. Genes 36(3):553-564. DOI:10.1007/s11262-008-0228
Moradi Z, Nazifi E and Mehrvar M. 2017. Occurrence and evo- Whittle PJL and Irawan. 2000. Pokkah boeng. Pp 136-140. In:
lutionary analysis of coat protein gene sequences of Iranian P Rott, RA Bailey, JC Comstock, BJ Croft, AS Saumtally
isolates of Sugarcane mosaic virus. The Plant Pathology (eds). A Guide to Sugarcane Diseases. CIRAD Publica-
Journal 33:296-306. DOI:10.5423/[Link].10.2016.0219 tions Service. Montpellier, France. 339p.
Raid RN, Comstock JC. 2000. Common rust. Pp 85-89. In: P Xie J, Wang M, Xu D, Li R and Zhou G. 2009. Simultaneous
Rott, RA Bailey, JC Comstock, BJ Croft, AS Saumtally detection and identification of four sugarcane viruses by
(eds). A Guide to Sugarcane Diseases. CIRAD Publica- one-step RT-PCR. Journal of virological methods 162:64-
tions Service. Montpellier, France. 339p. 68. Disponible en línea: [Link]
Rao GP, Chatenet M, Girard JG and Rott P. 2006. Distribution simultaneous-detection-and-identification-of-four-sugar-
of sugarcane mosaic and Sugarcane streak mosaic virus in [Link]
India. Sugar Technology 8:79-81. [Link] Xie X, Chen W, Fu Q, Zhang P, An T, Cui A, An D. 2016. Mo-
BF02943747 lecular Variability and Distribution of Sugarcane Mosaic
Riley SP, Woodman ME and Stevenson B. 2008. Culture of Virus in Shanxi, China. PLoS ONE 11: e0151549. https://
Escherichia coli and Related Bacteria. Current Protocols [Link]/10.1371/[Link].0151549
Essential Laboratory Techniques. 00:4.2:4.2.1-4.2.25. Xu DL, Park JW, Mirkov TE and Zhou GH. 2008. Viruses
DOI: 10.1002/9780470089941.et0402s00 causing mosaic disease in sugarcane and their genetic di-
Saumtally AS and Sullivan S. 2000. Brown spot. Pp 77-80. In: versity in southern China. Archives of Virology 153:1031-
P Rott, RA Bailey, JC Comstock, BJ Croft, AS Saumtally 1039. [Link]
(eds). A Guide to Sugarcane Diseases. CIRAD Publica- Yang ZN and Mirkov TE. 1997. Sequence and relationships of
tions Service. Montpellier, France. 339p. sugarcane mosaic and Sorghum mosaic virus strains and
Sawazaki HE, Nogueira SLA, Gonçalves CRNCB, Arruda development of RT-PCR-based RFLPs for strain discri-
VRF and Colombo CA. 2013. Molecular diagnosis optimi- mination. Phytopathology 87(9):932-939. Disponible en
zation of virus, bacteria and fungi in sugarcane. Internatio- línea: [Link]
nal Research Journal of Plant Science 4:76-83. Disponible Zhang YL, Pennerman KK, Wang H and Yin G. 2016. Cha-
en línea: [Link] racterization of a Sorghum mosaic virus (SrMV) isolate in
China. Saudi Journal of Biological Sciences 23:237-242.
[Link]

Publicación en línea, enero 2018 34

 Root endophyte bacteria in drought-tolerant
and drought-susceptible maize lines

Bacterias endófitas de la raíz en líneas de maíces

tolerantes y susceptibles a sequía

Alma Sánchez-Bautista, Carlos De León-García de Alba, Sergio Aranda-Ocampo*, Emma Zavaleta-Me-

jía, Cristian Nava-Díaz, Fitosanidad-Fitopatología, Colegio de Postgraduados. Km. 36.5 Carretera México-
Texcoco. Montecillo, CP. 56230, Texcoco, Estado de México; Paul H. Goodwin, Department of Plant Patholo-
gy, School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, Ontario, N1G 2W1,
Canada; Santos G. Leyva-Mir, Laboratorio de Parasitología Agrícola, Universidad Autónoma Chapingo, Km
38.5 Carretera México-Texcoco, Chapingo, CP. 56230, Texcoco, Estado de México. *Autor para corresponden-
cia: saranda@[Link].

Recibido: 10 de Octubre, 2017. Aceptado: 07 de Diciembre, 2017.

Sánchez-Bautista A, De León-García de Alba C, Aran- Abstract. Maize (Zea mays) ranks second as food
da-Ocampo S, Zavaleta-Mejía E, Nava-Díaz C, Good- in the world and drought limits its productivity.
win PH, Leyva-Mir SG. 2017. Root endophyte bacteria Plants harbor endophytic bacteria that influence
in drought-tolerant and drought-susceptible maize lines. health and drought tolerance. The goal of this
Revista Mexicana de Fitopatología 36(1): 35-55. research was to estimate the density and diversity of
DOI: 10.18781/[Link].1710-3 cultivable endophyte bacteria from the root system
of seven homozygous maize drought-tolerant and
Primera publicación DOI: 1 de Enero, 2018. seven drought-susceptible lines in three locations
First DOI publication: January 1, 2018. of Mexico during three crop cycles. The density
and diversity of bacterial populations was assessed
by direct counting on plates and identified by PCR.
Resumen. El maíz (Zea mays) ocupa el segundo The results identified three groups of endophytic
lugar como alimento en el mundo y la sequía limi- bacteria: 1) highly frequent (Bacillus subtilis,
ta su productividad. Las plantas albergan bacterias Bacillus megaterium y Pseudomonas geniculata),
endófitas que influyen en la sanidad y tolerancia a 2) frequent (Bacillus firmus, Pseudomonas
la sequía. El objetivo de esta investigación fue es- hibiscola y Sinorhizobium meliloti) y 3) low
timar la densidad y diversidad de las bacterias en- frequency (Acinetobacter soli, Stenotrophomonas
dófitas cultivables de la raíz en siete líneas homo- maltophila y Burkholderia gladioli. The analysis of
cigóticas de maíces tolerantes y siete susceptibles variance (ANOVA) showed significant differences
a sequía en tres localidades de México durante tres (p≤0.05) in density (Log10 CFU g-1 root) of population
ciclos del cultivo. La densidad y diversidad de las by location, crop cycle, days after sowing and

Publicación en línea, enero 2018 35

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

poblaciones bacterianas se evaluó mediante conteo maize lines. The density of Bacillus subtilis,
directo en placas y se identificaron por PCR. Los Pseudomonas hibiscola at El Batán and Bacillus
resultados identificaron tres grupos de bacterias megaterium, Sinorhizobium meliloti in Tlaltizapán,
endófitas: 1) altamente frecuentes (Bacillus subti- were significantly higher in drought-tolerant maize
lis, Bacillus megaterium y Pseudomonas genicu- lines compared to drought-susceptible lines.
lata), 2) frecuentes (Bacillus firmus, Pseudomo-
nas hibiscola y Sinorhizobium meliloti) y 3) baja Key words: Zea mays; endophytic bacteria;
frecuencia (Acinetobacter soli, Stenotrophomonas bacterial diversity; 16S rADN.
maltophila y Burkholderia gladioli. El análisis de
varianza (ANOVA) mostró diferencias significati-
vas (p≤0,05) en la densidad (Log10 UFC g-1 de raíz) Maize (Zea mays) is currently the second most
de población por localidad, ciclo de cultivo, días important food staple in terms of energy sources,
después de siembra y líneas de maíz. La densidad and provides a protein content of approximately
de Bacillus subtilis, Pseudomonas hibiscola en la 9.2% to human nutrition (FAO, 2016). Mexico
localidad de El Batán y Bacillus megaterium, Si- is in the seventh place in maize production, with
norhizobium meliloti en Tlaltizapán, fueron signifi- approximately 25 million tons a year (FIRA, 2016).
cativamente mayores en las líneas de maíz toleran- Maize productivity is limited by several biotic
tes que en las susceptibles a sequía. stresses (pests and diseases) and abiotic stresses
(drought, nutrient deficiency, salinity and high
Palabras clave: Zea mays; bacterias endofíticas; temperatures) (Grover et al., 2007). Drought is
diversidad bacteriana; 16S rADN. the meteorological term for water scarcity, and is
one of the major environmental stress factors that
affect germination, plant vigor and productivity of
El maíz (Zea mays) es actualmente el segundo agricultural crops (Kamara et al., 2003; Wilkinson
cultivo alimenticio más importante en términos and Davies, 2010). A possible alternative for
de fuentes de energía y un contenido de proteína tackling this problem is to develop knowledge
de aproximadamente 9.2% en la nutrición huma- about plant microorganisms that play an important
na (FAO, 2016). México ocupa el séptimo lugar en role in the expression of abiotic stress resistance
producción del cereal con aproximadamente 25 mi- (Gond et al., 2015).
llones de toneladas al año (FIRA, 2016). La produc- Endophytic microorganisms are bacteria,
tividad de esta gramínea se limita por factores bió- fungi or viruses that live all or part of their lives
ticos por varias plagas y enfermedades y abióticos in plants’ internal tissues without damaging their
como sequía, deficiencia de nutrientes, salinidad y hosts. They establish a symbiotic interaction that
altas temperaturas (Grover et al., 2007). La sequía modulates the health of plants, as well as their
es el término meteorológico para la escasez de agua ability to adapt to different environmental stress
y es uno de los factores ambientales de estrés más factors (Hardoim et al., 2015). Endophytic bacteria
importantes que afectan la germinación, vigor de are a subgroup of the rhizosphere and rhizoplane
la planta y productividad de los cultivos agrícolas bacterial community that colonizes the internal root
(Kamara et al., 2003; Wilkinson y Davies, 2010) tissue of the host plant; this gives them ecological
y una posible alternativa para hacer frente a este advantages over other populations that colonize

Publicación en línea, enero 2018 36

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

problema es la generación de conocimiento sobre epiphytically. Diverse species of Gram-positive

los microorganismos de las plantas que desempe- and Gram-negative endophytic bacteria have been
ñan una función importante en la expresión de re- isolated from different types of tissue from many
sistencia al estrés por factores abióticos (Gond et plant species (Rosenblueth and Martínez-Romero,
al., 2015). 2006).
Los microorganismos endófitos son bacterias, There is evidence of the positive effect of
hongos o virus que habitan, parte o todo su ciclo de endophytic microorganisms through the expression
vida, en el tejido interno de las plantas sin causar of mechanisms such as antagonism, induced
daño a su hospedante y que establecen una interac- systemic resistance (RSI) and acquired systemic
ción simbiótica que modulan la sanidad de la planta resistance (RSA), plant growth promoters and
y su habilidad para adaptarse a diferentes factores induced adaptation response to environmental
de estrés del ambiente (Hardoim et al., 2015). Las stresses (Liu et al., 2013). The relationship
bacterias endófitas representan un subgrupo dentro between the host plant and the endophytic
de la comunidad de bacterias de la rizosfera y rizo- bacterial community reflects a co-evolution in the
plano que colonizan el tejido interno de las raíces colonization process influenced by the genotype,
de la planta hospedante y que le confiere ventajas growth stage, physiological condition and plant
ecológicas sobre otras poblaciones que colonizan tissue, as well as by soil characteristics, agronomic
en forma epífita. Diversas especies de bacterias practices and environmental conditions such as
endófitas Gram positivas y Gram negativas se han temperature, water and nutrient supply (Higgins et
aislado de diferentes tipos de tejido en numerosas al., 2007).
especies de plantas (Rosenblueth y Martínez-Ro- When maize is inoculated with these
mero, 2006). microorganisms, this increases germination, plant
Existen evidencias del efecto positivo que in- height, root and aboveground mass and improves
ducen los microorganismos endófitos mediado por yield (Morales et al., 2011). It has also been shown
la expresión de mecanismos como el antagonismo, that inoculating maize with these bacteria efficiently
resistencia sistémica inducida (RSI) y adquirida promotes drought stress tolerance (Fan et al.,
(RSA), promotores del crecimiento de la planta, 2015) as a result of the increase in root length and
y la inducción de una respuesta de adaptación al biomass, which in turn improves water and nutrient
estrés ambiental (Liu et al., 2013). La relación en- absorption (Naseem and Bano, 2014; Yasmin et al.,
tre la planta hospedante y la comunidad bacteriana 2013). Endophytic bacteria can induce tolerance to
endofítica refleja la coevolución en el proceso de abiotic stresses such as salinity and drought, while
colonización influenciado por el genotipo, etapa de some populations confer tolerance to specific stress
crecimiento, estado fisiológico y tejido de la planta, factors and are responsible for the survival of plants
así como por las características del suelo, prácti- under these particular environmental conditions
cas agronómicas y condiciones ambientales como (Gond et al., 2015; Montañez et al., 2011). Thus, the
la temperatura, agua y el suministro de nutrientes microorganisms that establish positive interactions
(Higgins et al., 2007). with plant roots play a key role in cropping systems
En Maíz, la inoculación de estos microorganis- and have promising biotechnological potential to
mos se relaciona con un incremento en la germi- be used in sustainable agriculture.
nación, altura de la planta, biomasa radical y aérea In Mexico there are no studies on endophytic
que mejora el rendimiento (Morales et al., 2011). bacterial communities in roots of drought

Publicación en línea, enero 2018 37

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Así mismo, se ha demostrado la eficiencia con tolerant or drought susceptible maize lines. Such
la inoculación de estas bacterias en maíz promo- endophytic bacteria could be used to develop
viendo tolerancia al stress por sequía (Fan et al., future biotechnological strategies such as inducers
2015), mediado por el incremento de la longitud y of drought tolerance and other abiotic and biotic
biomasa de la raíz mejorando la absorción de agua factors that limit crop productivity. Therefore, the
y nutrientes (Naseem y Bano, 2014; Yasmin et al., objective of this study was to estimate the density
2013). Las bacterias endófitas pueden inducir to- and diversity of endophytic bacterial populations
lerancia contra enfermedades abióticas como sali- in roots of homozygous (S6) drought tolerant
nidad y sequía, mientras que algunas poblaciones and drought susceptible maize lines previously
confieren tolerancia a factores de estrés específico identified as such under field conditions and sown
y son responsables de la supervivencia de las plan- at three Mexican locations during three crop cycles.
tas bajo esas condiciones particulares del ambiente
(Gond et al., 2015; Montañez et al., 2011). Así, los
microorganismos que establecen una interacción MATERIALS AND METHODS
positiva con las raíces de las plantas desempeñan
un papel clave en sistemas agrícolas con un promi- Sampling site. Seven drought-tolerant homozygous
sorio potencial biotecnológico para su uso en una maize lines (CLQRQ108, CML384, CML445,
agricultura sostenible. CML544, DTMA90, DTMA224, DTMA256) and
En México no existen investigaciones sobre seven drought-susceptible homozygous maize
las comunidades bacterianas endófitas en raíces de lines (CML181, DTMA34, DTMA41, DTMA43,
líneas de maíz tolerantes y susceptibles a sequía. DTMA109, DTMA144, DTMA182) were sown,
Tales bacterias endófitas, potencialmente podrían which were selected because they were inbred due
utilizarse para el desarrollo de futuras estrategias to their uniform response to drought. Each line
biotecnológicas como inductores de tolerancia a was sown with three replications at the experiment
sequía y a otros factores bióticos y abióticos limi- stations of the International Maize and Wheat
tantes en la productividad del cultivo. Por lo ante- Improvement Center (CIMMYT) in Tlaltizapán,
rior, el objetivo de este estudio fue estimar la den- Morelos (18.68 N; 99.11 O), El Batán, Texcoco,
sidad y diversidad de las poblaciones bacterianas Mexico (19.53 N; 98.85 W), and Agua Fría,
cultivables endófitas en la raíz en líneas de maíz Puebla (20.5 N; 97.6 W) during the 2012 summer
homocigóticas (S6) tolerantes y susceptibles a se- crop cycle (V-2012), 2012 winter cycle (I-2012)
quía previamente identificadas con este carácter en and 2013 autumn cycle (V-2013). Samples of the
condiciones de campo y cultivadas en tres localida- internal tissue formed in the apical root area of three
des de México durante tres ciclos del cultivo. plants per line were taken for each location and
crop cycle 25, 52 and 75 days after sowing (dds)
to be analyzed at CIMMYT’s Maize Pathology
MATERIALES Y MÉTODOS Laboratory at El Batán, State of Mexico. The
size of the sample was determined by the method
Sitio de muestreo. Se sembraron siete líneas ho- proposed by Cochran (1982).
mocigóticas de maíz tolerantes (CLQRQ108,
CML384, CML445, CML544, DTMA90, Isolation of endophytic root bacteria. Bacterial
DTMA224, DTMA256) y siete susceptibles a isolates from the internal tissue of maize roots that

Publicación en línea, enero 2018 38

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

sequía (CML181, DTMA34, DTMA41, DTMA43, had been superficially sterilized were defined as
DTMA109, DTMA144, DTMA182), las cuales se endophytic strains. Symptomless maize roots were
seleccionaron por ser líneas endocriadas debido a washed with sterile distilled water and cut in 2-cm
su uniformidad en la respuesta a sequía. Cada línea pieces. 10 g of roots were sterilized superficially
se sembró con tres repeticiones en el Campo Expe- for 5 min in sterile glass jars and washed with 70%
rimental del Centro Internacional de Mejoramiento ethanol for 5 min, 0.53% sodium hypochlorite for
de Maíz y Trigo (CIMMyT) en las localidades de 10 min and then rinsed three times with sterile
Tlaltizapán, Morelos (18.68 N; 99.11 O), El Batán, distilled water. After the last washing with sterile
Texcoco, México (19.53 N; 98.85 O), y Agua Fría, distilled water, 100 µL from each jar were sown in
Puebla (20.5 N; 97.6 O) durante los ciclos de cul- Petri dishes containing NB culture medium (1L):
tivo verano 2012 (V-2012), invierno 2012 (I-2012) 15 g bacteriological agar (BIOXON® Mexico), 5 g
y verano 2013 (V-2013). Se realizaron muestreos peptone (BD DIFCOTM USA), 3 g yeast extract
del tejido interno formado en la zona apical de la (DIBICO® Mexico, NaCl JT BAKER® Mexico) and
raíz en tres plantas de cada línea por localidad y incubated at 28±1oC from 2 to 5 days. The absence
ciclo de siembra a los 25, 52 y 75 días después de of bacterial growth in the culture medium confirmed
la siembra (dds) para su análisis en el Laboratorio that the root surface had been efficiently sterilized.
de Patología de Maíz del CIMMyT, El Batán, Edo. The roots were ground in cold mortars using
México. El tamaño de muestra se determinó por el 20 mL of a sterile buffer solution (50 mM KH2PO4,
método propuesto por Cochran (1982). 150 mM NaCl, pH 7.6). The resulting suspensions
were diluted in series (1:9) from 100 to 10-3; then
Aislamiento de bacterias endófitas de raíces. 100 µL of each dilution and three replications were
Se definieron como cepas endófitas aquellos ais- sown in NB medium and incubated at 28 ºC for
lamientos bacterianos obtenidos del tejido interno 24 h under continuous light. The different bacterial
de las raíces del maíz superficialmente esteriliza- morphotypes were counted and classified according
das. Las raíces de maíz sin síntomas se lavaron con to their color, shape, texture and type of growth.
agua destilada estéril y se cortaron en trozos The bacterial growth was considered representative
de 2 cm. Se esterilizaron superficialmente 10 g de of cultivable endophytic bacteria in maize roots.
raíces en frascos de vidrio estériles con lavados en Bacterial strains were preserved by freezing in NB
serie con etanol 70% durante 5 min; hipoclorito de medium and 20% glycerol for subsequent studies.
sodio 0.53% durante 10 min y tres lavados con agua
destilada estéril. Del último lavado con agua desti- Population density of endophytic bacteria. The
lada estéril, se sembraron 100 µL de cada frasco en population density of bacteria per root tissue was
placas Petri con medio de cultivo NB (1L): Agar estimated by directly counting the colonies on the
Bacteriológico 15 g (BIOXON® México), Peptona plate. The number of bacterial colonies isolated
5 g (BD DIFCOTM EE. UU), Extracto de levadura 3 g from the 14 maize lines was counted using a colony
(DIBICO® México, NaCl JT BAKER® México) y counter (Quebec®, Darkfield Colony Counter). The
se incubaron a 28±1 oC durante 2-5 días. La ausen- bacterial population of root tissue samples was
cia de crecimiento bacteriano en el medio de culti- expressed in terms of colony forming units (UFC
vo confirmó la eficiente esterilización superficial g-1 of root tissue). The resulting data were converted
de las raíces. Estas raíces se molieron en morteros to Log10 UFC g-1 of root and an analysis of variance

Publicación en línea, enero 2018 39

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

fríos con 20 mL de una solución amortiguadora (ANOVA) was performed using a factorial analysis
(50 mM KH2PO4, 150 mM NaCl, pH 7.6) estéril. design to separate the media by DMS (α=0,05)
Las suspensiones obtenidas se diluyeron en serie using the SAS statistical program (Statistical
(1:9) desde 100 hasta 10-3 y se sembraron 100 µL de Analysis System version 9.1.3 SAS Institute, Cary,
cada dilución con tres repeticiones en medio NB NC, USA) according to the crop cycle, location,
incubados a 28 °C durante 24 h con luz continua. days after sowing (dds) and the studied drought-
Se cuantificaron y clasificaron los diferentes mor- tolerant or drought-susceptible maize lines.
fotipos bacterianos con base al color, forma, textu-
ra y tipo de crecimiento. El crecimiento bacteriano Amplification of the 16S rDNA gene and
se consideró representativo de bacterias cultivables identification of endophytic bacteria. Bacterial
endófitas en la raíz de maíz. Las cepas bacterianas DNA was extracted using the protocol described by
se preservaron por congelación en medio NB y gli- Mahuku (2004) with the following modifications:
cerol 20% para estudios posteriores. bacterial cells were obtained by growing them in
NB medium at 28 °C for 48 h. After suspending
Densidad poblacional de bacterias endófitas. La the precipitate in 100 µL of 1X TE, 2 µL of RNAsa
densidad poblacional de bacterias por tejido de raíz were added (1 mg mL-1) and then incubated in
se estimó por conteo directo de colonias en placa. a water bath at 37 °C for 1 h. The DNA quality
El número de colonias bacterianas aisladas de las was verified by electrophoresis in agarose gel.
14 líneas de maíz se cuantificó con un contador de Bacteria were identified by partially amplifying
colonias (Quebec®, Darkfield Colony Counter). La the 16S rADN gene using universal primers 27F
población bacteriana de las muestras de tejido de (5´AGAGTTTGATCMTGGCTCAG-3´) and
raíz se expresó como unidades formadoras de colo- 1492R (5´TACGGHTACCTTGTTACGACTT-3´)
nias (UFC g-1 de raíz). Los datos obtenidos se trans- under the PCR conditions described by Galkiewicz
formaron a Log10 UFC g-1 de raíz y se realizó un aná- and Kellogg (2008). DNA amplification and
lisis de varianza (ANOVA) siguiendo un diseño de sequencing were carried out using Macrogen
análisis factorial de donde se obtuvo la separación (DNA Sequency Service. Korean Biotechnology
de medias por DMS (α=0,05) con el programa es- Company), and the sequences obtained were
tadístico SAS (Statistical Analysis System, versión aligned with sequences kept at the GenBank of
9.1.3 SAS Institute, Cary, NC, [Link]) en función (NCBI) using the BLASTn program ([Link]
del ciclo de cultivo, localidad, días después de la [Link]/BLAST/).
siembra (dds) y líneas de maíz tolerantes/suscepti-
bles a sequía estudiadas.
RESULTS AND DISCUSSION
Amplificación del gen 16S rADN e identificación
de bacterias endófitas. La extracción de ADN de Taxonomic identification of endophytic bacteria.
las bacterias se realizó por el protocolo descrito por Through partial sequencing of the 16S rADN gene,
Mahuku (2004), con las siguientes modificacio- 22 endophytic bacteria species were identified in
nes: las células bacterianas se obtuvieron a partir roots of both groups of maize lines. The greatest
del crecimiento en medio NB a 28 °C durante 48 abundance of bacteria was associated with the
h. Después de suspender el precipitado en 100 µL Proteobacteria phyla followed by Firmicutes and

Publicación en línea, enero 2018 40

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

de 1X TE, se agregaron 2 µL de RNAsa (1 mg Bacteroidetes. Within Firmicutes, 100% of strains

mL-1), y se incubó en baño María a 37 °C durante were identified as Bacillus sp., and within the class
1 h. La calidad del ADN se verificó por electro- Gammaproteobacteria, 33% were identified as
foresis en gel de agarosa. Las bacterias se identi- Pseudomonas sp.
ficaron mediante la amplificación parcial del gen The diversity and richness of bacteria naturally
16S rADN con los iniciadores universales 27F associated with maize roots is wide, and their
(5´AGAGTTTGATCMTGGCTCAG-3´) y 1492R estimation depends on the analytic method used. In
(5´TACGGHTACCTTGTTACGACTT-3´) con this study, a dependent culture approach was used,
las condiciones de PCR descritas por Galkiewicz and the results coincide with previous studies that
y Kellogg (2008). La amplificación y secuencia- found that the Proteobacteria phylum was the most
ción se hizo en Macrogen (DNA Sequency Service. predominant of the endophytic bacterial populations
Korean Biotechnology Company); las secuencias isolated from maize roots, stems and leaves
obtenidas se alinearon con secuencias depositadas (Rosenblueth and Martínez-Romero, 2006). Other
en el GenBank del Centro Nacional de Biotecno- studies of the diversity of endophytic communities
logía de los Estados Unidos (NCBI) utilizando el in maize roots using dependent and independent
programa BLASTn ([Link] culture methods also found that the bacteria most
BLAST/). frequently associated with this crop are Firmicutes
(Bacillus), Gammaproteobacteria (Pseudomonas)
(Pereira et al., 2011) and Burkholderia spp. (Ikeda
RESULTADOS Y DISCUSIÓN et al., 2013). By analyzing these populations
using gas chromatography and fatty acid profiles,
Identificación taxonómica de bacterias endófi- Bacillus pumilus, B. subtilis, Pseudomonas
tas. La secuenciación parcial del gen 16S rADN aeruginosa and P. fluorescens were identified as
permitió identificar 22 especies de bacterias endó- the most predominant species in maize stalks (Rai
fitas en la raíz en ambos grupos de líneas de maíz. et al., 2007), but when using pyrosequencing, the
La mayor abundancia de bacterias se asoció a los Proteobacteria, Bacteroidetes and Actinobacteria
phyla Proteobacteria, seguido de Firmicutes y phyla were identified as being the most abundant in
Bacteroidetes. Dentro de Firmicutes, el 100% de the maize rhizosphere (Li et al., 2014).
las cepas se identificaron como Bacillus sp. y den- Maize research has shown that these populations
tro de la clase Gammaproteobacteria, 33% como could be used as bacterial inoculants for controlling
Pseudomonas sp. drought stress, and suggests that drought tolerance
La diversidad y riqueza de bacterias natural- is induced by the production of phytohormones
mente asociadas a las raíces de maíz es amplia y such as abscisic, gibberellic and indole-3-acetic
la estimación de esta depende del método de aná- acids, cytokinins, enzymes such as ACC deaminase,
lisis. En este estudio se utilizó un enfoque de cul- production of bacterial exopolysaccharides and
tivo dependiente y los resultados coinciden con systemic tolerance induction (Dimkpa et al., 2009;
investigaciones previas que reportaron el phylum Kim et al., 2012; Timmusk et al., 2014; Yang et al.,
Proteobacteria como el más dominante entre las 2009). In other crops, they have been identified as
poblaciones bacterianas endófitas aisladas en raí- tolerance inductors in wheat (Triticum sativum) and
ces, tallos y hojas de maíz (Rosenblueth y Martínez- legumes (Vigna radiata) when they were inoculated

Publicación en línea, enero 2018 41

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Romero, 2006). Así mismo, otros estudios sobre la in seed, for they promoted an increase in the levels
diversidad de las comunidades endófitas de la raíz of regulation of genes related to drought tolerance
en maíz utilizando métodos de cultivo dependiente and the activity of diverse enzymes (Kasim et al.,
e independiente también coinciden en que las bac- 2013; Saravanakumar et al., 2011).
terias más frecuentemente asociadas a este cultivo Based on the frequency of the isolates, three
son Firmicutes (Bacillus), Gammaproteobacteria groups of endophytic bacteria in the roots of
(Pseudomonas) (Pereira et al., 2011) y Burkholde- drought tolerant and drought susceptible maize
ria spp. (Ikeda et al., 2013). El análisis de estas po- stand out in this study: 1) highly frequent (Bacillus
blaciones por cromatografía de gases y perfiles de subtilis, Bacillus megaterium and Pseudomonas
ácidos grasos identificaron a Bacillus pumilus, B. geniculata), isolated during the three crop cycles
subtilis, Pseudomonas aeruginosa y P. fluorescens at the three locations, 2) frequent (Bacillus firmus,
como las especies relativamente más predominan- Pseudomonas hibiscola and Sinorhizobium
tes en el tallo de maíz (Rai et al., 2007), mien- meliloti), isolated during the three crop cycles at two
tras que mediante pyrosecuenciación se identificó locations, and 3) low frequency (Acinetobacter soli,
como los más abundantes en la rizosfera de maíz a Stenotrophomonas maltophila and Burkholderia
los phyla Proteobacteria, Bacteroidetes y Actino- gladioli), isolated only at two locations and not in
bacteria (Li et al., 2014). all crop cycles (Table 1).
Experimentaciones en maíz han mostrado el po- The taxonomic and functional structure of
tencial uso de estas poblaciones como inoculantes bacterial communities in soil is influenced by
bacterianos para el control de estrés por sequía, su- biotic and abiotic factors such as soil physical
giriendo que la inducción de tolerancia a sequía se and chemical characteristics, weather conditions,
debe a la producción de fitohormonas como el áci- plant genotype and interaction with other soil
do abscísico, giberélico, indol-3-acético, citocini- prokaryotes and eukaryotes, a fact that suggests
nas, enzimas como la ACC deaminasa, producción that those interactions are complex. In this study,
de exopolisacáridos bacterianos y la inducción de the structure and large number of isolated bacteria
tolerancia sistémica (Dimkpa et al., 2009; Kim et may be associated with the interaction of several
al., 2012; Timmusk et al., 2014; Yang et al., 2009). factors, including plant genotype, the genetic
En otros cultivos se han señalado como inductores characteristics of bacterium, soil, temperature,
de tolerancia en trigo (Triticum sativum) y legumi- crop cycle and maize plant phenology (Li et al.,
nosas (Vigna radiata) al ser inoculados en semilla 2014; Oliveira et al., 2009) that influence the
y promoviendo el incremento en los niveles de re- colonization and dynamics of the endophytic
gulación de genes relacionados con la tolerancia a bacterial community (Bodenhausen et al., 2013). A
sequía y la actividad de diversas enzimas (Kasim et specific plant-endophyte relationship was revealed
al., 2013; Saravanakumar et al., 2011). by performing bacterial chemotaxis on host plant
Por la frecuencia de los aislamientos, en el pre- exudates as carbon sources that act as signaling
sente estudio se destacan tres grupos de bacterias molecules (Albareda et al., 2006); it also showed
endófitas en la raíz de maíces tolerantes y suscep- that differences in exudate composition and
tibles a sequía: 1) altamente frecuentes (Bacillus patterns depend on the crop variety, development
subtilis, Bacillus megaterium y Pseudomonas ge- stage, exposure of the plant to stress and type of
niculata), aislados durante los tres ciclos de cultivo soil, which influence colonization by bacterial

Publicación en línea, enero 2018 42

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

en las tres localidades, 2) frecuentes (Bacillus fir- communities (Haichar et al., 2008). Studies on
mus, Pseudomonas hibiscola y Sinorhizobium me- maize indicated that root exudates are 65% sugar,
liloti), aislados durante los tres ciclos de cultivo en 33% organic acids and 2% amino acids, and that
dos localidades y 3) baja frecuencia (Acinetobacter changes in the quantity and quality of exudation
soli, Stenotrophomonas maltophila y Burkholderia patterns at different root growth and physiological
gladioli, aisladas solo en dos localidades y no en stages influenced the biomass and the structure
todos los ciclos del cultivo (Cuadro 1). of bacterial communities by increasing nutrient
La estructura taxonómica y funcional de las co- activity and deposition by those microbial
munidades bacterianas en el suelo está influenciada communities and favored plant growth (Baudoin et
por factores bióticos y abióticos como las caracterís- al., 2003). Some maize studies that used a dependent
ticas físicoquímicas del suelo, condiciones climáticas, culture approach have shown dynamic changes

Cuadro 1. Especies de bacterias endófitas identificadas en la raíz de 14 líneas de maíz en tres localidades y durante tres ciclos
del cultivo.
Table 1. Endophyte bacteria species identified in roots of 14 maize lines in three locations during three crop cycles.

Línea Identidad de Localidad/ciclo de cultivo

ID Endófito Clase
T/S Nucleótidos TL AF EB

AF101 Acinetobacter soli Z T, S 96% (KU551890) γ Proteobacteria 1 1

AF105 Agrobacterium tumefaciens T, S 97% (KX518841) α Proteobacteria 1
TL007 Bacillus asahii T, S 95% (KU551893) Firmicutes 1, 2, 3 1
TL008 Bacillus firmus Y T, S 98% (KU551896) Firmicutes 1, 2, 3 1, 2, 3
AF103 Bacillus megaterium x T, S 96% (KC414697) Firmicutes 1, 2, 3 1, 2, 3 1, 2, 3
AF102 Bacillus subtilis x T, S 97% (KU551891) Firmicutes 1, 2, 3 1, 2, 3 1, 2, 3
AF111 Burkholderia cenocepacia T, S 96% (GU433447) β Proteobacteria 1, 2, 3
AF129 Burkholderia gladioli Z S 97% (EU1611873) β Proteobacteria 1, 2 2
AF109 Chryseobacterium indologenes T, S 98% (KU551895) Flavobacteria 1, 2, 3 2
TL032 Enterobacter aerogenes T, S 97% (AM184247) γ Proteobacteria 1 1, 2, 3
BT011 Enterobacter spp. T, S 97% (KX518848) γ Proteobacteria 1
TL012 Flavobacterium johnsoniae T, S 96% (KU551897) Flavobacteria 1
AF116 Klebsiella oxytoca T, S 97% (KU551901) γ Proteobacteria 2
AF128 Klebsiella pneumoniae T, S 96% (KX518847) γ Proteobacteria 1
TL015 Pseduomonas hibiscola Y T, S 97% (KX518846) γ Proteobacteria 1, 2, 3 1, 2, 3
AF112 Pseudomonas chlororaphis T, S 96% (KX518844) γ Proteobacteria 1, 2, 3
AF115 Pseudomonas geniculata x T, S 96% (KU551900) γ Proteobacteria 1, 2, 3 1, 2, 3 1, 2, 3
TL011 Pseudomonas lini T, S 99% (KX518842) γ Proteobacteria 1
AF107 Salmonella bongori T, S 96% (KU551899) γ Proteobacteria 1
AF106 Serratia marcescens T, S 96% (KX518843) γ Proteobacteria 1, 2, 3 1
TL010 Sinorhizobium meliloti Y T, S 98% (KU551892) α Proteobacteria 1, 2, 3 1, 2, 3
TL009 Stenotrophomas maltophilia Z T, S 98% (KU551894) γ Proteobacteria 1, 2, 3 1

T= Línea de maíz tolerante a sequía, S= Línea de maíz susceptible a sequía / T= drought-tolerant maize line, S= drought-susceptible
maize line.
TL= Tlaltizapán, Mor., AF= Agua Fría, Pue., EB= El Batán, Méx. / TL= Tlaltizapán, Mor., AF= Agua Fría, Pue., EB= El Batán,
Mex.
1=Verano 2012; 2=Invierno 2012; 3=Verano 2013 / 1=Autumn 2012; 2=Winter 2012; 3=Summer 2013.
X
Endófitos altamente frecuentes / X Highly frequent endophytes.
Y
Endófitos frecuentes / Y Frequent endophytes.
Z
Endófitos de baja frecuencia / Z Low-frequent endophytes.

Publicación en línea, enero 2018 43

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

genotipo de la planta y la interacción con otros pro- in the bacterial community of the rhizosphere at
cariontes y eucariontes en el suelo, lo cual indica different crop growth stages (Cavaglieri et al.,
que son interacciones complejas. En este estudio, 2009; Nacamulli et al., 1997).
la estructura y abundancia de las bacterias aisladas In this study, specific bacteria were identified
puede asociarse con la interacción de varios facto- such as Burkholderia gladioli, which was isolated
res, incluyendo el genotipo de la planta, las carac- at a low frequency only in susceptible maize lines
terísticas genéticas de la bacteria, el suelo, la tem- at two locations and crop cycles (Table 1).
peratura, ciclo de cultivo y fenología de la planta de Burkholderia gladioli was previously identified
maíz (Li et al., 2014; Oliveira et al., 2009) que in- in roots of a wild maize ancestor (Zea mays ssp.
fluyen en la colonización y dinámica de las comu- parviglumis) and in modern maize genotypes as an
nidades bacterianas endófitas (Bodenhausen et al., endophyte showing antifungal properties (Shehata
2013). Se ha mostrado la relación específica entre et al., 2016). Also, Burkholderia sp. inoculation
planta-endófito mediante una quimiotaxia bacteria- in maize had positive effects on drought tolerance
na hacia exudados de la planta hospedante como (Fan et al., 2015; Naveed et al., 2014).
fuentes de carbono que actúan como moléculas de
señalización (Albareda et al., 2006) y que las dife- Density of endophytic populations in maize lines.
rencias en la composición y patrones de exudación The density of endophytic bacteria in the 14 maize
son dependientes del cultivar, etapa de desarrollo, lines ranged from 1, 6 Log10 UFC g-1 of root. The
exposición a estrés de la planta y tipo de suelo, los ANOVA showed highly significant differences (**=
cuales influencian la colonización por comunida- p≤0,01) in the density of the endophytic population
des bacterianas (Haichar et al., 2008). Estudios en of B. subtilis, B. megaterium, P. hibiscola and S.
maíz indicaron que los exudados de la raíz están meliloti in terms of location, crop cycle, days after
compuestos de 65% de azúcares, 33% de ácidos or- transplanting (dds) and group (drought tolerance/
gánicos y 2% de aminoácidos y que los cambios en susceptibility) of maize lines (Table 2).
cantidad y calidad en estos patrones de exudación By location, the highest population densities
en las diferentes etapas del crecimiento y fisiología recorded at El Batán were those of B. subtilis and
de la raíz, influyó en la biomasa y estructura de las P. hibiscola, while in Tlaltizapán they were B.
comunidades bacterianas incrementando la activi- megaterium and S. melilloti. By crop cycle and
dad y deposición de nutrientes por estas comuni- sampling date, B. megaterium and P. hibiscola
dades microbianas beneficiando el crecimiento de were significantly different (p≤0,05) during the
la planta (Baudoin et al., 2003). Algunas investiga- V-2012 cycle at 52 dds. In this study, a total of
ciones en maíz mediante un enfoque de cultivo de- 22 endophytic bacteria were identified in roots of
pendiente han demostrado cambios dinámicos en la drought tolerant and drought susceptible maize
comunidad bacteriana de la rizosfera en diferentes lines. However, B. subtilis, B. megaterium, P
etapas de crecimiento del cultivo (Cavaglieri et al., hibiscola and S. meliloti population densities were
2009; Nacamulli et al., 1997). significantly higher in drought tolerant maize lines
En este estudio se identificaron bacterias es- than in susceptible lines (Table 2).
pecíficas como Burkholderia gladioli, la cual se The density of bacterial populations is a key
aisló con baja frecuencia únicamente en las líneas element, considered to be the greatest metabolism
susceptibles en dos localidades y ciclos de cultivo regulation mechanism in the interaction with the
(Cuadro 1). biotic and abiotic environment, through which

Publicación en línea, enero 2018 44

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

B. gladioli se ha identificado previamente en it coordinates the expression of specialized

raíces del ancestro silvestre (Zea mays ssp. parvi- genes, depending on cellular density. It has been
glumis) y en genotipos modernos de maíz como un demonstrated that this behavior, known as quorum
endófito con propiedades antifúngicas (Shehata et sensing (QS) in bacteria associated with plants,
al., 2016); así mismo, la inoculación de Burkhol- regulates the expression of genes in the rhizosphere
deria sp. en maíz mostró efectos positivos en la to- to synthesize secondary metabolites, antifungal
lerancia a sequía (Fan et al., 2015; Naveed et al., compounds, antibiotics and extracellular enzymes
2014). involved in biocontrol (Somers et al., 2004;
Whitehead et al., 2001).
Densidad de poblaciones endófitas en líneas de In this study, the total population density of B.
maíz. La densidad de bacterias endófitas en las 14 subtilis in the maize lines sown at El Batán was 3,
líneas de maíz tuvo rangos entre 1, 6 Log10 UFC g-1 4 Log10 UFC g-1 of root, and there was no significant
de raíz. El ANOVA mostró diferencias altamente difference by cycle or days after sowing, but it was
significativas (**= p≤0,01) en la densidad de po- significantly higher in drought-tolerant maize lines
blación endófita de B. subtilis, B. megaterium, P. (Table 2, Figure 1).
hibiscola y S. meliloti en función de la localidad, As an endophyte, B. subtilis is a microorganism
ciclo de cultivo, días después del trasplante (dds) y of great interest in biotechnological applications
grupo (tolerancia/susceptibilidad a sequía) de línea as biocontrol agent for biotic and abiotic stresses
de maíz (Cuadro 2). because of its efficient colonization of plant roots
Por localidad, en El Batán, las mayores densi- which triggers different biocontrol and adaptation
dades de poblaciones se registraron con B. subtilis mechanisms in different environments (Marulanda
y P. hibiscola, mientras que en Tlaltizapán fueron et al., 2006). Additionally, this demonstrates
con B. megaterium y S. melilloti. Por ciclo de cul- its high capacity to produce volatile organic
tivo y fecha de muestreo, B. megaterium y P. hibis- compounds (VOCs) that act as signaling molecules
cola fueron significativamente diferentes (p≤0,05) to trigger a defense response through specific

Cuadro 2. Análisis de varianza y comparación de medias de la densidad de población

(Log10 UFC g-1 de raíz) en las raíces de 14 líneas de maíces tolerantes y suscep-
tibles a sequía.
Table 2. Variance analysis and comparison of means of population density (Log10 UFC g-1
of root) in roots of 14 drought-tolerant maize lines and drought-susceptible maize
lines.

B. subtilis B. megaterium P. hibiscola S. meliloti

Localidad ** ** ** **
Ciclo NS ** ** NS
Días NS ** NS **
Tolerancia ** ** ** **
Tolerante 2.2684 a 3.7374 a 2.9388 a 4.8880 a
Susceptible 1.7410 b 3.3976 b 2.4501 b 4.6389 b

Medias con letras iguales no son estadísticamente diferentes (DMS, 0.05) / Means with the same
letter are not statistically different (DMS, 0.05).
NS= No existen diferencias significativas / NS= There are no significant differences.
**= Diferencias altamente significativas / **= Highly significant differences.

Publicación en línea, enero 2018 45

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

durante el ciclo V-2012 a los 52 dds. En el presente induced systemic resistance (ISR) (Farag et al.,
estudio se identificaron un total de 22 bacterias en- 2013). These VOCs activate hormone production
dófitas en raíces de líneas de maíces tolerantes y paths, including auxins, gibberellins, cytokinins
susceptibles a sequía. Sin embargo, la densidad de and salicylic acid that foster host plant growth
población de B. subtilis, B. megaterium, P hibisco- under stress conditions, mainly by increasing root
la y S. meliloti fueron significativamente mayores biomass, which in turn improves water absorption
en las líneas de maíz tolerantes que en las suscepti- (Zhang et al., 2007). Another study showed that
bles a sequía (Cuadro 2). maize seed inoculated with selected B. subtilis
La densidad de poblaciones en bacterias es un strains provided important benefits as a growth
elemento clave y se considera como el mayor me- promoter and increased nutrient absorption
canismo de regulación del metabolismo en la inte- capacity (Canbolat et al., 2006)In Tlaltizapán, the
racción con el medioambiente biótico y abiótico, population density of B. megaterium in maize lines
a través del cual coordina la expresión de genes was from 3, 5Log10 UFC g-1 of root during the three
especializados dependiente de una densidad celu- cycles and significantly higher (5 Log10 UFC g-1 of
lar. Este comportamiento conocido como Quorum root) in the V-2012 cycle at 52 dds, and in drought
sensing (QS), en bacterias asociadas a plantas se tolerant maize lines (Table 2, Figure 2).
ha demostrado que regula la expresión de genes en Recent studies have shown that B. megaterium
la rizosfera para la síntesis de metabolitos secun- modifies the maize plant response to several abiotic
darios, compuestos antifúngicos, antibióticos y en- stresses, and the importance of the population
zimas extracelulares que están involucrados en el density of some Bacillus species in the drought
biocontrol. (Somers et al., 2004; Whitehead et al., tolerance and water transportation response in
2001). Retama sphaerocarpa, because it promotes root
En este estudio, la densidad total de población growth and water absorption capacity, as well as the
de B. subtilis en las líneas de maíz en la localidad levels of proline and indoleacetic acid (Marulanda
de El Batán fue de 3, 4 Log10 UFC g-1 de raíz, no hubo et al., 2006). In particular, those studies point out
diferencia significativa por ciclo y días después de that the presence of B. megaterium in the host
la siembra, pero fue significativamente mayor en plant increases biomass and water content in the
las líneas de maíz tolerantes a sequía (Cuadro 2, root (Marulanda et al., 2009), a fact that suggests
Figura 1). that these endophytic populations could be used in
Como endófito, B. subtilis es un microorganis- maize plants sown in arid and semi-arid areas. The
mo de gran interés en aplicaciones biotecnológicas biological function of other endophytic Bacillus
como agente de biocontrol de enfermedades bióti- species in maize are related to the plant’s efficient
cas y abióticas, mediada por la eficiente coloniza- defense response against pathogens associated
ción de las raíces de las plantas que desencadenan with the production of antifungal lipopeptides that
diferentes mecanismos de biocontrol y adaptación induces the expression of defense genes (Gond et
a diferentes ambientes (Marulanda et al., 2006); al., 2015).
además, demostrando su alta capacidad de producir At El Batán, the population density of P.
compuestos orgánicos volátiles (VOCs) que actúan hibiscola in maize lines was from 3, 5 Log10 UFC g-1
como moléculas de señalización para disparar of root during the three crop cycles and significantly
una respuesta de defensa mediante la resistencia higher (5 Log10 UFC g-1 of root) in the V-2012 cycle.

Publicación en línea, enero 2018 46

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 1. Población de B. subtilis en 7 líneas de maíz tolerantes y 7 susceptibles a sequía a los 25, 52 y 75 dds en los ciclos de
cultivo Verano 2012, Invierno 2012 y Verano 2013, en tres localidades de México.
Figure 1. B. subtilis population in 7 drought-tolerant maize lines and 7 drought-susceptible maize lines at 25, 52 y 75 dds dur-
ing the 2012 summer crop cycle, 2012 winter crop cycle and 2013 summer crop cycle in three locations of Mexico.

sistémica inducida (ISR) específica (Farag et al., It was not isolated in Agua Fría. There were no
2013). Estos VOCs activan las vías de producción significant differences among the days after sowing
de hormonas incluyendo auxinas, giberelinas, ci- (dds), but the density was significantly higher in
tocininas y ácido salicílico, que promueven el de- drought-tolerant maize lines (Table 2, Figure 3).
sarrollo de la planta hospedante en condiciones de P. hibiscola has not been cited as a maize
estrés, principalmente por el incremento de bioma- endophyte. However, according to the phylogenetic
sa radicular resultando en una mejor absorción de affiliation of the P. hibiscola type ATCC 19867
agua (Zhang et al., 2007). Otro estudio demostró strain based on a comparative analysis of 16S rADN
que la inoculación en semilla de maíz con cepas gene sequences and chemical taxonomy profiles, it
seleccionadas de B. subtilis aportó importantes be- was reclassified as Stenotrophomonas sp. (Anzai
neficios como promotor de crecimiento y mayor et al., 2000). S. maltophilia has been cited as a
capacidad de absorción de nutrientes (Canbolat et maize endophyte (McInroy and Kloepper, 1995)
al., 2006). and reported to act as a biological control agent
En Tlaltizapán, la densidad de población de B. against soil-borne pathogens such as Pythium spp.,
megaterium en las líneas de maíz estuvo entre 3, Fusarium spp. and Rhizoctonia solani. It has also

Publicación en línea, enero 2018 47

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

5Log10 UFC g-1 de raíz en los tres ciclos y fue sig- been reported to produce indoleacetic acid, which
nificativamente mayor (5 Log10 UFC g-1 de raíz) en regulates the development of sprouts and side roots
el ciclo V-2012 a los 52 dds, fue significativamen- in plants (Mehnaz et al., 2010).
te mayor en las líneas de maíz tolerantes a sequía The population density of S. meliloti in drought-
(Cuadro 2, Figura 2). tolerant maize lines in Tlaltizapán was from 4, 6
Investigaciones recientes demostraron que B. Log10
UFC g-1 of root during the three cycles, and
megaterium modifica la respuesta de la planta del significantly higher (6 Log10 UFC g-1 of root) at 52
maíz ante varios estreses abióticos, incluyendo la dds. It was not isolated in Agua Fría. There were
importancia de la densidad poblacional de algunas no significant differences per crop cycle, but it was
especies de Bacillus en la respuesta de tolerancia a significantly higher in drought-tolerant maize lines
sequía y transporte de agua en Retama sphaerocar- (Table 2, Figure 4).
pa, al estimular el crecimiento de la raíz y la capa- S. meliloti is known to be a nitrogen-fixing
cidad de absorción de agua y los niveles de proli- nodular bacterium in plants of the Medicago genus,
na y ácido indol acético (Marulanda et al., 2006). and involved in the drought tolerance and salinity
Particularmente, destacan que la presencia de B. response (Roumiansteva and Muntyan, 2015). In

Figura 2. Población de B. megaterium en 7 líneas de maíz tolerantes y 7 susceptibles a sequía a los 25, 52 y 75 dds en los ciclos
de cultivo Verano 2012, Invierno 2012 y Verano 2013, en tres localidades de México.
Figure 2. B. megaterium population in 7 drought-tolerant maize lines and 7 drought-susceptible maize lines at 25, 52 y 75
dds during the 2012 summer crop cycle, 2012 winter crop cycle and 2013 summer crop cycle in three locations of
Mexico.

Publicación en línea, enero 2018 48

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

megaterium en su planta hospedante aumenta la Mexico, the presence of a great genetic diversity of
biomasa y contenido de agua de la raíz (Marulanda native S. meliloti populations in alfalfa (Medicago
et al., 2009), que sugiere un uso potencial de estas spp.) was reported, and so far, new species have
poblaciones endófitas en plantas de maíz cultivadas been identified in woody legumes of the Leucaena
en zonas áridas y semiáridas. La función biológica (Wang et al., 2002) and Acacia genera (Toledo et
de otras especies de Bacillus endofíticos en maíz se al., 2003). The Sinorhizobium genus was found in
relaciona con una eficiente respuesta de defensa de the maize rhizosphere (Rosenblueth and Martínez-
la planta contra patógenos relacionada con la pro- Romero, 2006), and Rhizobium etli bv. phaseoli as
ducción de lipopéptidos antifúngicos que induce la an endophyte in maize roots in Mexico (Gutiérrez-
expresión de genes de defensa (Gond et al., 2015). Zamora and Martínez-Romero, 2001). However,
En El Batán, la densidad de población de P. hi- there is no information about S. meliloti as an
biscola en líneas de maíz estuvo entre 3, 5 Log10 UFC endophyte in maize roots, so the present study
g-1 de raíz en los tres ciclos y fue significativamente provides reference information about the natural
mayor (5 Log10 UFC g-1 de raíz) en el ciclo V-2012. endophytic colonization of S. meliloti in maize
in Mexico. Alfalfa and maize intercropping is
No se aisló en la localidad de Agua Fría. No hubo
common in the studied locations, so this may
diferencias significativas entre los días después de
explain the endophytic colonization of S. meliloti
la siembra (dds), fue significativamente mayor en
in maize roots. Studies conducted on rice (Oryza
las líneas de maíz tolerantes a sequía (Cuadro 2,
sativa) suggest that S. meliloti may produce a
Figura 3).
lumichrome signaling molecule in the rhizosphere
P. hibiscola no se ha citado como endófito en
of those plants and promote growth by inducing
maíz; sin embargo, la afiliación filogenética de la
better root respiration, stomatal conductance, leaf
cepa tipo ATCC 19867 de P. hibiscola, basados en
transpiration and photosynthetic efficiency (Chi et
el análisis comparativo de secuencias del gen 16S
al., 2010). When it was applied at nanomolecular
rADN y perfiles quimio-taxonómicos, lo reclasi- concentrations, it promoted legume and cereal
fican como Stenotrophomonas sp. (Anzai et al., growth and increased root biomass in the
2000). S. maltophilia se ha citado como endófito legume Lotus japonicus and in tomato (Solanum
en maíz (McInroy y Kloepper, 1995) y se reporta lycopersicum) (Gouws et al., 2012).
su función como agente de control biológico con- The frequency of certain bacteria genera isolated
tra patógenos con origen en el suelo como Pythium from maize roots in this study may be related to
spp., Fusarium spp. y Rhizoctonia solani además the phylogeny of the maize lines. For example,
de la capacidad para producir ácido indol acético among bacteria showing higher frequency and
que en plantas regula el desarrollo de brotes y raí- density in drought-tolerant maize lines, two
ces laterales (Mehnaz et al., 2010). Bacillus species stand out. Bacillus is considered
La densidad de población de S. meliloti en lí- an important endophytic bacterium that has been
neas tolerantes a sequía en Tlaltizapán estuvo entre isolated from both Teozintle (a maize ancestor) and
4, 6 Log10 UFC g-1 de raíz en los tres ciclos y fue sig- modern maize genotypes; it has been shown that
nificativamente mayor (6 Log10 UFC g-1 de raíz) a los the composition of the endophytic bacteria colony
52 dds. No se aisló en la localidad de Agua Fría. No in maize seed varies and that it has been preserved
hubo diferencias significativas por ciclo de cultivo, through the evolution, ethnography and ecology
pero fue significativamente mayor en las líneas de of the maize plant as a host (Johnston-Monje and
maíz tolerantes a sequía (Cuadro 2, Figura 4). Raizada, 2011).

Publicación en línea, enero 2018 49

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Figura 3. Población de P. hibiscola en 7 líneas de maíz tolerantes y 7 susceptibles a sequía a los 25, 52 y 75 dds en los ciclos
de cultivo Verano 2012, Invierno 2012 y Verano 2013, en tres localidades de México.
Figure 3. P. hibiscola population in 7 drought-tolerant maize lines and 7 drought-susceptible maize lines at 25, 52 y 75 dds
during the 2012 summer crop cycle, 2012 winter crop cycle and 2013 summer crop cycle in three locations of
Mexico.

S. meliloti se conoce como una bacteria nodu- In this research, we determined that some
ladora fijadora de nitrógeno en plantas del género factors such as drought tolerance/susceptibility
Medicago, con implicaciones en la respuesta de of the maize lines used, as well as the location,
tolerancia a sequía y salinidad (Roumiansteva y crop cycle and time (days after transplanting)
Muntyan, 2015). En México se determinó la exis- significantly affected the density of cultivable
tencia de una gran diversidad genética de poblacio- endophytic bacteria in the roots of the maize genetic
nes nativas de S. meliloti en alfalfa (Medicago spp.) materials. Rhizobacteria as promoters of growth
y actualmente se han identificado nuevas especies (PGPR), nutrition and plant disease management
en leguminosas leñosas en el género Leucaena have been extensively studied, but their function
(Wang et al., 2002) y Acacia (Toledo et al., 2003). in managing abiotic stresses such as drought has
El género Sinorhizobium se encontró en la rizosfera generated great interest in recent years (Dimpka
de maíz (Rosenblueth y Martínez-Romero, 2006) y et al., 2009; Grover et al., 2010; Kavamura et al.,
a Rhizobium etli bv. phaseoli como endófito en raí- 2013; Yang et al., 2009). The use of endophytic
ces de maíz en México (Gutiérrez-Zamora y Mar- microorganisms may be a viable alternative against
tínez-Romero, 2001); sin embargo, no existe infor- biotic and abiotic stresses. Strains isolated in this
mación sobre S. meliloti como endófito en la raíz study are a microbial resource that is intimately

Publicación en línea, enero 2018 50

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 4. Población de S. meliloti en 7 líneas de maíz tolerantes y 7 susceptibles a sequía a los 25, 52 y 75 dds en los ciclos de
cultivo Verano 2012, Invierno 2012 y Verano 2013, en tres localidades de México.
Figure 4. S. meliloti population in 7 drought-tolerant maize lines and 7 drought-susceptible at 25, 52 y 75 dds during the 2012
summer crop cycle, 2012 winter crop cycle and 2013 summer crop cycle in three locations of Mexico.

de maíz, por lo que el presente estudio aporta in- associated with maize and has the potential to
formación de referencia de la colonización natural be used as a biotechnological tool in agriculture;
endófita de S. meliloti en esta gramínea en México. these strains deserve to be evaluated in the future
En las localidades estudiadas es común el cultivo as microbial inoculants and inductors of drought
intercalado de alfalfa con maíz, que podría explicar stress tolerance, as well as to other biotic and
la colonización endófita de raíces de maíz por S. abiotic factors in regions of Mexico where maize is
meliloti. Estudios en arroz (Oryza sativa) sugieren produced under limiting conditions.
que S. meliloti podría producir la molécula señal
lumicromo en la rizosfera de estas plantas promo-
viendo el crecimiento por inducción de una mejor CONCLUSIONS
respiración de las raíces, conductancia estomática,
transpiración de la hoja y eficiencia fotosintética Cultivable root endophytic bacteria that were
(Chi et al., 2010). Su aplicación en concentracio- most frequently present in the 14 maize lines tested
nes nanomoleculares promovió el crecimiento en belong to the Proteobacteria and Firmicutes phyla.
leguminosas y gramíneas e incrementó la bioma- The highest population density of endophytic
sa de las raíces de la leguminosa Lotus japonicus bacteria was found in drought-tolerant maize

Publicación en línea, enero 2018 51

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

y jitomate (Solanum lycopersicum) (Gouws et al., lines. Bacteria of the Bacillus, Pseudomonas and
2012). Sinorhizobium genera showed the highest frequency
La frecuencia de ciertos géneros de bacterias and population density in drought-tolerant maize
aisladas de la raíz en este estudio podría tener re- lines at the three study locations and crop cycles.
lación con la filogenia de estas líneas de maíz. Por Sinorhizobium meliloti is able to endophytically
ejemplo, entre las bacterias con mayor frecuencia colonize maize roots.
y densidad en líneas tolerantes de maíz destacan
dos especies de Bacillus; Bacillus se considera una Acknowledgments
bacteria endófita importante que se ha aislado tanto
de Teozintle (ancestro del maíz) como de genotipos The authors wish to thank the Colegio de Postgraduados and
de maíces modernos y se demostró que la compo- the Consejo Nacional de Ciencia y Tecnología (CONACyT)
sición de la comunidad bacteriana endófita en se- for funding this research and for the scholarship granted, as
milla de maíz, es variable y conservada a través de well as the International Maize and Wheat Improvement
la evolución, etnografía y ecología de la planta de Center (CIMMYT) for providing the seed for conducting this
maíz como hospedante (Johnston-Monje y Raiza- research.
da, 2011).
En esta investigación se determinó que algunos End of the English version
de los factores: tolerancia/susceptibilidad a sequía
de las líneas de maíz estudiadas, localidad, ciclo de
cultivo, tiempo (días después del trasplante) afec- CONCLUSIONES
taron significativamente la densidad de bacterias
cultivables endófitas en la raíz de estos materiales Las bacterias cultivables endófitas de la raíz
genéticos de maíz. Las rizobacterias como promo- que tuvieron mayor presencia en las 14 líneas de
tores del crecimiento (PGPR), nutrición y manejo maíz probadas pertenecen a los phyla Proteobacte-
de enfermedades en plantas ha sido ampliamente ria y Firmicutes. La mayor densidad de población
estudiado; sin embargo, su función en el manejo de de bacterias endófitas se estimó en líneas de maíz
enfermedades abióticas como el estrés a sequía es tolerantes a sequía. Las bacterias de los géneros
de gran interés en los últimos años (Dimpka et al., Bacillus, Pseudomonas y Sinorhizobium fueron las
2009; Grover et al., 2010; Kavamura et al., 2013; que presentaron mayor frecuencia y densidad de
Yang et al., 2009). El uso de microorganismos población en las líneas de maíz tolerantes a sequía
endófitos puede ser una alternativa viable contra en las tres localidades y ciclos de cultivo estudia-
estreses bióticos y abióticos; las cepas aisladas en dos. Sinorhizobium meliloti es capaz de colonizar
este estudio constituyen un recurso microbiano que endofíticamente la raíz de maíz.
está íntimamente asociados al maíz con potencial
de uso biotecnológico en la agricultura que mere- Agradecimientos
cen ser evaluados en el futuro como inoculantes
microbianos e inductores de tolerancia al estrés hí- Al Colegio de Postgraduados y al Consejo Nacional de

drico y otros factores bióticos y abióticos en regio- Ciencia y Tecnología (CONACyT), por los recursos económi-

nes con condiciones limitantes para la producción cos y beca otorgados. Al Centro Internacional de Mejoramien-

de este cultivo en México. to de Maíz y Trigo (CIMMYT), por la semilla proporcionada

para el desarrollo de esta investigación.

Publicación en línea, enero 2018 52

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

LITERATURA CITADA studies of coral microbial ecology. Applied Environmental

Microbiology 74:7828-7831. Disponible en línea: http://
[Link]/content/74/24/[Link]
Albareda M, Dardanelli MS, Sousa C, Megías M, Temprano Gond SK, Bergen MS, Torres MS, White JF and Kharwar RF.
F and Rodríguez D. 2006 Factors affecting the attachment 2015. Effect of bacterial endophyte on expression of de-
of rhizospheric bacteria to bean and soybean roots. FEMS fense in Indian popcorn against Fusarium moniliforme.
Microbiology Letters 259:67-73. [Link] Symbiosis 66:133-140. [Link]
j.1574-6968.2006.00244.x 015-0348-9
Anzai Y, Kim H, Park JY, Wakabayashi H and Oyaizu H. Gouws LM, Botes E and Wiese AJ, Trenkamp S, Torres-Je-
2000. Phylogenetic affiliation of the pseudomonads based rez I, Tang J, Hills NP, Usadel B, Lloyd RJ, Fernie RA,
on 16S rRNA sequence. International Journal of Systema- Kossmann J and van der Merwe M. 2012. The plant
tic and Evolutionary Microbiology 50:1563-1589. DOI: growth promoting substance, lumichrome, mimics starch,
10.1099/00207713-50-4-1563 and ethylene-associated symbiotic responses in lotus and
Baudoin E, Benizri E and Guckert A., 2003. Impact of arti- tomato roots. Front Plant Science 120:1-20. [Link]
ficial root exudates on the bacterial community structure org/10.3389%2Ffpls.2012.00120
in bulk soil and maize rhizosphere. Soil Biology and Bio- Grover M, Ali SZ, Sandhya V, Rasul A and Venkateswarlu B.
chemistry 35:1183-1192. [Link] 2010. Role of microorganisms in adaptation of agriculture
0717(03)00179-2 crops to abiotic stresses. World Journal of Microbiology
Bodenhausen N, Horton MW and Bergelson J. 2013. Bacterial and Biotechnology 27:1231-1240. [Link]
communities associated with the leaves and the roots of s11274-010-0572-7
Arabidopsis thaliana. PLOS ONE 8:e56329. [Link] Gutiérrez-Zamora ML and Martinez-Romero E. 2001. Natural
org/10.1371/[Link].0056329 endophytic association between Rhizobium etli and mai-
Canbolat M, Bilen S, Çakmakçi R, Sahin F and Aydi A. 2006. ze (Zea mays L.). Journal of Biotechnology 91:117-126.
Effect of plant growth promoting bacteria and soil com- [Link]
paction on barley seeding growth, nutrient uptake, soil Haichar FZ, Marol C, Berge O, Rangel-Castro JI, Prosser JI,
properties and rhizosphere microflora. Biology and Fer- Balesdent J, Heulin T and Achouak W. 2008. Plant host
tility of Soils 42:350-357. [Link] habitat and root exudates shape soil bacterial community
cle/10.1007/s00374-005-0034-9 structure. The ISME Journal 2:1221-1230. Disponible en
Cavaglieri L, Orlando J and Etcheverry M. 2009. Rhizos- línea: [Link]
phere microbial community structure at different maize ISME%20Journal%2012,%201221-1230_1.pdf
plant growth stages and root locations. Microbiological Hardoim PR, Van Overbeek LS, Berg G, Pirttilä AM, Compant
Research 164:391-399. [Link] S, Campisano A, Döring M and Sessitsch A. 2015. The
cres.2007.03.006 hidden world within plants: ecological and evolutionary
Chi F, Yang P, Han F, Jing Y and Shen S. 2010. Proteomic considerations for defining functioning of microbial en-
analysis of rice seedlings infected by Sinorhizobium me- dophytes. Microbiology and Molecular Biology Reviews
liloti 1021. Proteomics 10:1861-1874. [Link] 79:293-320. Disponible en línea: [Link]
[Link]/doi/10.1002/pmic.200900694/full content/79/3/[Link]
Cochran, W. G. Técnicas de muestreo. México: Compañía Edi- Higgins KL, Arnold AE, Miadlikowska J, Sarvate SD and
torial Continental, 1982. 513 p. Lutzoni F. 2007. Phylogenetic relationships, host affinity,
Dimpka C. Weinand T and Asch F. 2009. Plant-rhizobacteria and geographic structure of boreal and arctic endophytes
interactions alleviate abiotic stress conditions. Plant Cell from three major plant lineages. Molecular Phylogenetics
and Environment 32:1682-1694. DOI:  10.1111/j.1365- and Evolution 42:543-555. [Link]
3040.2009.02028.x pev.2006.07.012
Fan X, Hu H, Huang G, Huang F, Li Y and Palta J. 2015. Ikeda CA, Bassani LL, Adamoski D, Stringari D, Cordeiro VK,
Soil inoculation with Burkholderia sp. LD-11 has positi- Glienke C, Steffens MBR, Hungria M and Galli-Terasawa
ve effect on water-use efficiency in inbred lines of maize. LV. 2013. Morphological and genetic characterization of
Plant Soil 390:337-349. [Link] endophytic bacteria isolated from roots of different maize
015-2410-z genotypes. Microbial Ecology 65:154-160. DOI: 10.1007/
Farag MA, Zhang H and Ryu CM. 2013. Dynamic chemical s00248-012-0104-0
communication between plants and bacteria through air- Johnston-Monje D and Raizada MN. 2011. Conservation and
borne signals: induced resistance by bacterial volatiles. diversity of seed associated endophytes in Zea across boun-
Journal of Chemical Ecology 39:1007-1018. [Link] daries of evolution, ethnography and ecology. PLoS ONE
[Link]/article/10.1007/s10886-013-0317-9 6: e20396. [Link]
FAO. 2016. Disponible en línea: [Link] Kasim WA, Osman ME, Omar MN, Abd El-Daim IA, Bejai S
crep/003/x7650s/[Link] (Consulta, marzo 2016) and Meijer J. 2013. Control of drought stress in wheat using
FIRA, Fideicomisos Instituidos en Relación con la Agricultu- plant-growth- promoting bacteria. Journal of Plant Growth
ra. 2016. Disponible en línea: [Link] Regulation 32:122-130. Disponible en línea: [Link]
uploads/attachment/file/61952/Panorama_Agroalimenta- [Link]/article/10.1007/s00344-012-9283-7
rio_Ma_z_2015.pdf (Consulta, febrero 2016) Kamara YA, Menkir A, Badu-Apraku B and Ibikunle O. 2003.
Galkiewicz JP and Kellogg CA. 2008. Cross-Kingdom ampli- The influence of drought stress on growth, yield and yield
fication using Bacteria-specific primers: complications for components of selected maize genotypes. Journal of

Publicación en línea, enero 2018 53

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Agricultural Science 141:43-50. [Link] de Microbiología 43:287-293. Disponible en línea: http://

S0021859603003423 [Link]/pdf/ram/v43n4/[Link]
Kavamura VN, Santos SN, Silva JL, Parma MM, Avila LA, Nacamulli C, Bevivino A, Dalmastri C, Tabacchioni S and
Visconti A, Zucchi TD, Taketani RG, Andreote FD and Chiarini L. 1997. Perturbation of maize rhizosphere mi-
Melo IS. 2013. Screening of Brazilian cacti rhizobacteria croflora following seed bacterization with Burkholderia
for plant growth promotion under drought. Microbiolo- cepacia MCI 7. FEMS Microbiology Ecology. 23:183-
gical Research 168:183-191. [Link] 193. [Link]
micres.2012.12.002 Naseem H and Bano A. 2014. Role of plant growth-promoting
Kim YC, Glick BR., Bashan Y and Ryu CM. 2012. Enhance- rhizobacteria and their exopolysaccharide in drought tole-
ment of plant drought tolerance by microbes. In: Aroca R. rance in maize. Journal of Plant Interactions. 9:689-701.
(eds) Plant responses to drought stress. Springer, Berlin, [Link]
Heidelberg. [Link] Naveed M. Mitter B, Reichenauer TG, Wieczorek K and
0_15 Sessitsch A. 2014. Increased drought stress resilience of
Li X, Rui J, Maoa Y, Yannarell A and Mackie R. 2014. Dyna- maize through endophytic colonization by Burkholderia
mics of the bacterial community structure in the rhizos- phytofirmans PsJN and Enterobacter sp. FD 17. Environ-
phere of a maize cultivar. Soil Biology and Biochemistry mental and Experimental Botany 97:30-39. [Link]
68: 392-401. [Link] org/10.1016/[Link].2013.09.014
Liu Y, Zuo S, Zou YY, Wang JH and Song W. 2013. Inves- Oliveira ALM, Stoels M, Schmid M, Reis VM, Baldani JI and
tigation on diversity and population succession dynamics Hartmann A. 2009. Colonization of sugarcane plantlets
of endophytic bacteria from seeds of maize (Zea mays L., by mixed inoculations with diazotrophic bacteria. Eu-
Nongda108) at different growth stages. Annals of Micro- ropean Journal of Soil Biology 45:106-113. [Link]
biology 63:71-79. Disponible en línea: [Link] org/10.1016/[Link].2008.09.004
[Link]/article/10.1007/s13213-012-0446-3 Pereira P, Ibáñez F, Rosenblueth M, Etcheverry M and Mar-
Mahuku GS. 2004. A simple extraction method suitable for tínez-Romero E. 2011. Analysis of the bacterial diversity
PCR based analysis of plant, fungal and bacterial DNA. associated with the roots of maize (Zea mays L.) through
Plant Molecular Biology Reporter 22:71-81. Disponible en culture-dependent and culture-independent methods.
línea: [Link] International Scholarly Research Network 2011:1-10.
73351?LI=true DOI:10.5402/2011/938546
Marulanda A, Barea JM and Azcón R. 2006. An indigenous Rai R, Prasanta K, Dash BM, Prasanna AS. 2007. Endophytic
drought- tolerant strain of Glomus intraradices associated bacterial flora in the stem tissue of a tropical maize (Zea
with a native bacterium improves water transport and root mays L.) genotype: isolation, identification and enume-
development in Retama sphaerocarpa. Microbial Ecology ration. World Journal Microbiology and Biotechnology
52:670-678. Disponible en línea: [Link] 23:853-858. DOI:10.1007/s11274-006-9309-z
article/10.1007/s00248-006-9078-0 Rosenblueth M and Martinez-Romero E. 2006. Bacterial en-
Marulanda A, Barea JM and Azcón R. 2009. Stimulation of dophytes and their interaction with hosts. Molecular Plant-
plant growth and drought tolerance by native microorga- Microbe Interactions 19:827-837. Disponible en línea:
nisms (AM fungi and bacteria) from dry environments: [Link]
mechanisms related to bacterial effectiveness. Journal of 0827
Plant Growth Regulation 28:115-124. Disponible en línea: Roumiansteva ML and Muntyan VS. 2015. Root nodule bacte-
[Link] ria Sinorhizobium meliloti: Tolerance to salinity and bacte-
9079-6 rial genetic determinants. Microbiology 84:303-318. DOI:
McInroy JA and Kloepper JW. 1995. Survey of indigenous 10.1134/S0026261715030170
bacterial endophytes from cotton and sweet corn. Plant and Saravanakumar D, Kavino M, Raguchander T, Subbian
Soil 173:337-342. Disponible en línea: [Link] P and Samiyappan R. 2011. Plant growth promo-
[Link]/article/10.1007%2FBF00011472?LI=true ting bacteria enhance water stress resistance in green
Mehnaz S, Kowalik T, Reynolds B and Lazarovits G. 2010. gram plants. Acta Physiology Plant 33:203-209. Dis-
Growth promoting effects of corn (Zea mays) bacte- ponible en línea: [Link]
rial isolates under greenhouse and field conditions. Soil pdf/10.1007%[Link]
Biology and Biochemistry 42:1848-1856. [Link] Shehata HR, Lyons EM, Jordan KS and Raizada MN. 2016.
org/10.1016/[Link].2010.07.003 Bacterial endophytes from wild and ancient maize are able
Montañez A, Blanco RA, Barlocco C, Beracochea M and to suppress the fungal pathogen Sclerotinia homoeocarpa.
Sicardi M. 2012. Characterization of cultivable putative Journal of Applied Microbiology 120:756-769. Disponi-
endophytic plant growth promoting bacteria associated ble en línea: [Link]
with maize cultivars (Zea mays L.) and their inoculation jam.13050/epdf
effects in vitro. Applied Soil Ecology 58:21-28. [Link] Somers E, Vanderleyden J and Srinivasan M. 2004. Rhizos-
org/10.1016/[Link].2012.02.009 phere bacterial signalling: A love parade beneath our feet.
Morales Y, Juárez D, Aragón C, Mascarua M, Bustillos M, Critical Reviews in Microbiology: 30:205-240. DOI:
Fuentes L, Martínez R and Muñoz J. 2011. Growth respon- 10.1080/10408410490468786
se of maize plantlets inoculated with Enterobacter spp., Timmusk S, Islam A, Abd El D, Lucian C, Tanilas T and Kan-
as a model for alternative agriculture. Revista Argentina naste A, Behers L, Nevo E, Seisenbaeva G, Stenströ E and

Publicación en línea, enero 2018 54

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Niinemets Ü. 2014. Drought-tolerance of wheat improved línea: [Link]

by rhizosphere bacteria from harsh environments: Enhan- 3040.2009.02052.x/full
ced biomass production and reduced emissions of stress Whitehead AN, Barnard LMA, Slater H, Natalie JL, Simpson
volatiles. PLoS One 9:1-13. [Link] G and Salmond PC .2001. Quorum-sensing in Gram-nega-
[Link].0096086 tive bacteria. FEMS Microbiology Reviews 25:365-404.
Toledo I, Lloret L and Martínez-Romero E. 2003. Sinorhi- [Link]
zobium americanum sp. nov., a new Sinorhizobium spe- Yang J, Kloepper JW and Ryu C. 2009. Rhizosphere bacteria
cies nodulating native Acacia spp. in Mexico. Systema- help plants tolerate abiotic stress. Trends in Plant Science
tic and Applied Microbiology 26:54-64. Disponible en 14:1-4. [Link]
línea: [Link] Yasmin H, Bano A and Samiullah A. 2013. Screening of PGPR
S0723202004701599 isolates from semi-arid region and their implication to alle-
Wang E, Tan ZY, Willems A, Fernández-López M, Rein- viate drought stress. Pakistan Journal Botany 45: 51-58.
hold-Hurek B and Martínez-Romero E. 2002. Sinorhi- Disponible en línea: [Link]
zobium morelense sp. nov., a Leucaena leucocephala- [Link]?eid=2-s2.0-84873424619&origin=inward&txGid
associated bacterium that is highly resistant to multiple =f67ad4b109d3d368731a8b22a1f14cfa
antibiotics. International Journal of Systematic and Evo- Zhang H, Kim MS, Krishnamachari V, Payton P, Sun Y,
lutionary Microbiology 52:1687-1693. [Link] Grimson M, Farag MA, Ryu CM, Allen R, Melo IS and
org/10.1099/00207713-52-5-1687 Pare PW. 2007. Rhizobacterial volatile emissions regula-
Wilkinson S and Davies WJ. 2010. Drought, ozone, ABA and te auxin homeostasis and cell expansion in Arabidopsis.
ethylene: new insights from cell to plant to community. Planta 226:839-851. Disponible línea: [Link]
Plant, Cell & Environment 33:510-525. Disponible en [Link]/content/pdf/10.1007%[Link]

Publicación en línea, enero 2018 55

 Wood preservatives and microbial exudates with
antagonistic activity against
biological agents

Preservadores maderables y exudados microbianos con

actividad antagonista contra agentes biológicos deletéreos

Vanessa Ruby García-Ortiz, Gabriela Benítez-Rocha, *Conservación y Manejo de Recursos Forestales,

Facultad de Ingeniería en Tecnología de la Madera, Universidad Michoacana de San Nicolás de Hidalgo.,
General. Francisco J. Mugica S/N, Ciudad Universitaria, C.P. 58030, Morelia, Michoacán, México; Mauro
Martínez-Pacheco, Instituto de Investigaciones Químico Biológicas. Universidad Michoacana de San Nicolás
de Hidalgo., General Francisco J. Mugica S/N, Ciudad Universitaria, C.P. 58030, Morelia, Michoacán, México;
Crisanto Velázquez-Becerra*. *Autor para correspondencia: cvelazquez@[Link].

Recibido: 20 de Abril, 2017. Aceptado: 30 de Septiembre, 2017.

García-Ortiz VR, Benítez-Rocha G, Martínez-Pacheco Abstract. Wood of low durability is susceptible

M, Velázquez-Becerra C. 2017. Wood preservatives and of deterioration by xylophages and its protection
microbial exudates with antagonistic activity against is a technological goal not reached that generates
biological agents. Revista Mexicana de Fitopatología economic and material losses. Alternatives to avoid
36(1): 56-78. the use of toxic preservative conventional and
DOI: 10.18781/[Link].1704-2 contaminating can be established by knowledge
of the bacterial microecosystem in the wood. The
Primera publicación DOI: 10 de Noviembre, 2017. protection of this material is possible to obtain it
First DOI publication: November 10, 2017. with bacteria and its exudates. The purpose of this
research is to highlight that the biodeterioration
of low durability wood is avoidable by means of
Resumen. La madera de baja durabilidad es sus- microbiological strategies relevant for the control
ceptible de deterioro por xilófagos y su protección of xylophages’ fungi. The observation is that
es una meta tecnológica no alcanzada que genera bacteria of the genera Arthrobacter, Bacillus and
pérdidas económicas y materiales. Alternativas Pseudomonas and their exudates are potentially
para evitar el uso de preservadores convencionales protective agents that exhibit different mechanisms
tóxicos y contaminantes se pueden establecer me- of action such as antagonism, parasitism and the
diante el conocimiento del microecosistema bacte- production of exudates containing molecules
riano en la madera. La protección de este material with effect: antimicrobial, chelator (siderophores)
es posible obtenerla con bacterias y sus exudados. that inhibit enzymes or functions and volatile

Publicación en línea, enero 2018 56

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

El propósito de esta investigación es destacar que compounds (dimethylhexadecylamine). Knowledge

el biodeterioro de la madera de baja durabilidad of this microbial ecosystem will facilitate the
es evitable mediante estrategias microbiológicas construction of an alternative to the use of
relevantes para el control de los hongos xilófagos. conventional wood preservatives and constitutes
La observación es que bacterias de los géneros Ar- an area of opportunity. It is evident the absence
throbacter, Bacillus y Pseudomonas y sus exuda- of knowledge of antagonistic bacteria of the
dos potencialmente son agentes de protección que xylophages, the management of the production and
exhiben mecanismos de acción diferentes como, composition of their exudates and their application,
el antagonismo, el parasitismo y la producción de thus manifesting an unexplored field in the
exudados que contienen moléculas con efecto: an- biotechnology of the preservation of wood.
timicrobiano (antibióticos), quelante (sideróforos)
que inhiben enzimas o funciones y compuestos vo- Key words: xylophages’ fungi, lignin, wood,
látiles (dimetilhexadecilamina). El conocimiento preservation, durability.
de este ecosistema microbiano facilitará la cons-
trucción de una alternativa al uso de los preserva-
dores convencionales de madera y constituye un INTRODUCTION
área de oportunidad. Se evidencia la ausencia del
conocimiento de bacterias antagónicas de los xiló- Due to its organic composition, wood is
fagos, el manejo de la producción y composición vulnerable to biological degradation. In general, it
de sus exudados y su aplicación, con lo que se ma- is composed of cellulose in 40-61%, hemicellulose
nifiesta un campo inexplorado en la biotecnología 15-30%, and lignin 17-35%, making it an excellent
de la preservación de la madera. source of carbon to sustain the life cycles of some
organisms. Wood in use is exposed to organisms
Palabras clave: xilófagos, lignocelulósico, made- such as bacteria, algae, fungi, and insects, which
ra, preservación, durabilidad. feed off their macromolecules, causing their
degradation, and therefore, their physical and
mechanical attributes, as well as their performance
INTRODUCCIÓN (Ibáñez, 2012). In the bacterial diversity there is
a great number of genuses with species capable
Por la composición orgánica de la madera es of deteriorating wood by degrading lignin and
susceptible al deterioro biológico. En general, está modifying their structure, such as Flavobacterium,
constituida por celulosa 40-61%, hemicelulosa 15- Xanthomonas, Aeromonas, and Nocardia (Singh
30% y lignina 17-35%, particularidad que la hace et al., 2016). Also, aerobic species of the genuses
una excelente fuente de carbono para sostener el of Pseudomonas of Achromobacter also degrade
ciclo de vida de algunos organismos. La madera en structural polymers, which weaken the primary
uso está expuesta a organismos tales como, bacte- and secondary cell wall, with the alteration of
rias, algas, hongos e insectos, que al nutrirse de sus the crystalline structure of these polymers and
macromoléculas provocan su degradación y con exposes them to promote the development of
ello disminuyen sus atributos físico-mecánicos other deteriorator organisms (Zanni, 2004).
y prestaciones (Ibáñez, 2012). En la diversidad Xylophagous algae are represented mainly by

Publicación en línea, enero 2018 57

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

bacteriana se encuentra un gran número de géneros species of the genuses Clorophyta, Chrysophyta,
cuyas especies son capaces de deteriorar la made- and Cianophyta, which, when deteriorating wood,
ra al degradar la lignina y modificar su estructura, cause it to change color, as well as an increase
tales como; Flavobacterium, Xanthomonas, Aero- in the absorption of solar radiation and water.
monas y Nocardia (Singh et al., 2016). También, However, the deterioration caused by bacteria and
especies aeróbicas de los géneros de Pseudomonas algae is less than the damage produced by fungi
y Achromobacter igualmente degradan polímeros and hylophagous insects, the latter of which are the
estructurales, que debilitan la pared celular prima- main causal agents of biodeterioration (Flower and
ria y secundaria, con la alteración de la estructura Gonzalez-Meler, 2015).
cristalina de estos polímeros y los expone para fa- In the construction and wood-based products
vorecer el desarrollo de otros organismos deteriora- industries, xylophagous fungi are accountable for
dores (Zanni, 2004). Las algas xilófagas, están re- great economic losses (Arbelo and Garbuyo, 2012).
presentadas principalmente por especies de los gé- “Chromogenic” organisms are found in this group
neros Clorophyta, Chrysophyta y Cianophyta que which, when penetrating the woody tissue via the
al deteriorar la madera le provocan un cambio de hyphae, reach the cell cavities, an action that has
color, un incremento en la absorción de radiación the result of a change in color (Moglia et al., 2015).
solar y agua. Sin embargo, el deterioro que realizan Meanwhile, the fungal species that cause “rotting”
las bacterias y algas es menor que el daño produ- are grouped into different categories, such as the
cido por hongos e insectos xilófagos, estos últimos so-called white-rot, brown-rot and soft-rot. Fungi
representan los principales agentes causantes del feed off the components of cell walls obtained by
biodeterioro (Flower y Gonzalez-Meler, 2015). enzymes that degrade the structural prolymers,
En la industria de la construcción y productos thus alter the physical and mechanical properties
basados en madera, los hongos xilófagos son res- of the wood. The depolymerization of cell wall
ponsables de grandes pérdidas económicas (Arbelo macromolecules is carried out with several
y Garbuyo, 2012). Organismos “cromógenos” se hydrolytic enzymes that synthesize it rapidly, e.g.
encuentran en este grupo que, al penetrar el tejido the degradation of crystalline is obtained with
leñoso mediante las hifas, alcanzan las cavidades endo-1,4-ß-glucanases, exo-1,4-ß-glucanases, 1,
celulares, una acción que tiene como resultado un 4-ß-glucosidases and other accessory enzymes
cambio de color (Moglia et al., 2015). Mientras que (Schmidt, 2007).
las especies fúngicas causantes de “pudrición” se Meanwhile, for a complex polymer without three-
agrupan en diferentes categorías, como las nombra- dimensional ordering such as lignin, composed of
das marrón o cúbica, blanca y suave o blanda. Los the concatenation of phenylpropanoic acids and
hongos se nutren de componentes de pared celular alcohols, for its degradation and mineralization,
obtenidos mediante enzimas que degradan los polí- the fungus uses an enzyme complex with activities
meros estructurales y con ello alteran las propieda- of oxidases and peroxidases. The fungal metabolic
des físico-mecánicas de la madera. La despolimeri- pathway to the degradation of this polymer begins
zación de macromoléculas de pared celular la rea- with the action of lignin peroxidase, which break
lizan mediante diversas enzimas hidrolíticas que carbon-carbon bonds or ether bonds within the
la sintetiza aceleradamente, e.g. la degradación complex molecule to produce monomers. Another
de celulosa cristalina se obtiene con endo-1,4- interesting enzymatic complex is the one produced

Publicación en línea, enero 2018 58

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

ß-glucanasas, exo-1,4-ß-glucanasas, 1,4-ß-glucosi- by some xylophagous basidiomycota that cause

dasas y otras enzimas accesorias (Schmidt, 2007). white rot. This complex includes lignin peroxidase,
Mientras que, para un polímero complejo sin manganese peroxidase, a versatile molecule that
ordenamiento tridimensional como la lignina, con- uses hydrogen peroxide as an electron accepter,
formada por la concatenación de ácidos y alcoholes and laccase, which uses molecular oxygen. The
fenilpropílicos, para su degradación y mineraliza- latter enzyme is an oxidase made up of a co-factor
ción el hongo utiliza un complejo enzimático con with four copper atoms, the accepter of electrons
actividades de oxidasas y peroxidasas. La vía meta- is molecular oxygen. Also, laccase degrades non-
bólica fúngica para la degradación de este polímero phenolic substrates, more difficult to oxideze in the
inicia con la acción de la lignina peroxidasa, la cual presence of co-oxidants; 1-hydroxybenzotriazole
lisa enlaces carbono-carbono o enlaces éter dentro (1-HBT), 2,2′-azino-bis-( 3-ethylbenzthiazoline-6-
de la compleja molécula para generar monómeros. sulfonic acid) or violic acid (Subramanian et al.,
Otro complejo enzimático interesante es el que pro- 2014).
ducen algunos basidiomicetos xilófagos que oca- Some of the most important and harmful
sionan la pudrición blanca. Este complejo incluye a xylophagous organisms include basidiomycetes,
la lignina peroxidasa, manganeso peroxidasa, mo- which cause brown or cubid rot (e.g. Serpula
lécula versátil que emplean peróxido de hidrógeno lacrymans, Coniophora puteana, Antrodia
como aceptor de electrones y la lacasa que utiliza al vaillantii, Lentinus lepideus), capable of rapidly
oxígeno molecular. Esta última enzima es una oxi- degrading cellulose, hemicellulose, and of
dasa constituida por un co-factor con cuatro átomos structurally modifying lignin. In white rot, the
de cobre, cuyo aceptor de electrones es el oxígeno basidiomycetes and some ascomycetes feed
molecular. También, la lacasa degrada sustratos no mostly of lignin, although they can decompose
fenólicos más difícilmente oxidables en presencia cellulose. Due to lignin degradation and the large
de co-oxidantes; 1-hidroxibenzotriazol (1-HBT), amount of intact cellulose not used by these
2,2′-azino-bis-(ácido 3-etilbenzotiazolin-6-sulfóni- fungi, wood acquires a pale whit color. Some
co) o ácido violúrico (Subramanian et al., 2014). of the representative fungal species include
Entre los xilófagos más importantes y conside- Trametes versicolor, T. hirsuta and Schizophyllum
rados perniciosos se tienen a los basidiomicetos, commune. Meanwhile, ascomycetes that cause
causantes de la pudrición marrón o cúbica  (e.g. soft rot (Chaetomium globosum, Monodictys
Serpula lacrymans, Coniophora puteana, Antrodia putredinis, Hypocrea muroiana,  Cryphonectria
vaillantii, Lentinus lepideus), capaces de degradar parasitica  and  Fusarium oxysporum), the hyphae
rápidamente la celulosa, hemicelulosa y modificar of which develop in the lumen and the inside of
estructuralmente la lignina. En la pudrición blan- the secondary cell wall, mainly degrade cellulose,
ca, los basidiomicetos y algunos ascomicetos se altering lignin structurally, causing a characteristic
nutren preferentemente de lignina, aunque pueden softening of the lignocellulosic material (Figure 1)
descomponer celulosa. Por la degradación de la (Patel et al., 2013).
lignina y la gran cantidad de celulosa intacta que On the other hand, insects are a relevant and
no utilizan estos hongos, la madera adquiere un diverse group in the animal kingdom, with over one
color “blanquecino”. Entre las especies fúngicas million species described and an amount of up to 30
representativas se encuentra a Trametes versicolor, million species yet to be discovered (Stork et al.,

Publicación en línea, enero 2018 59

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

T. hirsuta y Schizophyllum commune. Mientras 2015). Likewise, they present a broad versatility to
que, los ascomicetos causantes de la pudrición sua- feed and survive. In terms of feeding habits, insects
ve o blanda  (Chaetomium globosum, Monodictys use, e.g. fresh plant tissue, organic animal matter in
putredinis, Hypocrea muroiana,  Cryphonectria decomposition or dead plant matter. Such is the case
parasitica y Fusarium oxysporum), cuyas hifas se of wood, and xylophagous insects carry this with
desarrollan en el lumen e interior de la pared ve- the perforation and formation of galleries in search
getal secundaria, degradan principalmente celulosa for cellulose and starch. This produces physical
alterando estructuralmente la lignina, con lo cual and mechanical damage and chromatic alterations
provocan un ablandamiento característico del ma- in stored wood, process, service, and standing trees
terial lignocelulósico (Figura 1) (Patel et al., 2013). (Table 1) (Zanni, 2008). The insects that stand out in
Por otro lado, los insectos constituyen un rele- this group are coleoptera (beetles or woodworms)
vante y diverso grupo dentro del reino animal, con and lepidoptera (butterflies and moths), as well
aproximadamente más de un millón de especies as isoptera (termites) and hymenoptera (wasps
descritas y una cantidad de hasta 30 millones de and ants). Isoptera and coleoptera are pointed
especies aún por conocer (Stork et al., 2015). Asi- out as producers of considerable damage to
mismo, ellos exhiben una amplia versatilidad para wooden structures and houses (NMX-C-222-1983;
nutrirse y sobrevivir. En relación con el hábito ali- Blackwell and d´Errico 2000). Also, in large
mentario, los insectos utilizan, e.g. tejido vegetal portions of North and Central America, bark

Figura 1. Daño provocado por hongos xilófagos en árbol en pie Ganoderma applanatum (a), en la construcción Antrodia
vaillantii (b), madera aserrada Ceratocystis sp. (c) y madera derribada Pleurotus ostreatus (d).
Figure 1. Damage caused by xylophagous fungi in a standing Ganoderma applanatum tree (a), in the construction Antrodia
vaillantii (b), sawn wood Ceratocystis sp. (c) and felled wood Pleurotus ostreatus (d).

Publicación en línea, enero 2018 60

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

fresco, materia orgánica en descomposición de ori- insects of the genus Dendroctonus (D. frontalis, D.
gen animal o materia muerta vegetal. Tal es el caso mexicanus) are the main pest in pine forests; they
de la madera y los insectos xilófagos, lo hacen me- cause the loss of thousands of trees (FAO, 2007).
diante la perforación y formación de galerías en la The protection of low-durability wood with
búsqueda de celulosa y almidón. Con ello producen chemical preservatives, however practical and
daño físico, mecánico y alteraciones cromáticas cheap, is eco-toxic and requires immediate
en madera almacenada, proceso, servicio y árbo- replacement with eco-friendly preservatives.
les en pie (Cuadro 1) (Zanni, 2008). En este grupo Therefore, the purpose of this work is to establish the
de insectos, destacan los coleópteros (escarabajos bases of protection for wood using microbiological
o carcomas) y lepidópteros (mariposas y polillas), strategies.
al igual que isópteros (termitas) e himenópteros
(avispas y hormigas). Los isópteros y coleópteros Classification of wood according to its resistance
son señalados por producir daños considerables a to xylophagous organisms
estructuras y bienes inmuebles de madera (NMX-
C-222-1983; Blackwell y d´Errico 2000). Tam- Wood can be categorized according to its use
bién, en gran parte del Norte y Centro América and durability (NMX-C-239-1985) and is subject
insectos descortezadores del género Dendroctonus to different levels of risk and to deterioration by
(D. frontalis, D. mexicanus) son la principal plaga xylophagous organisms. The different resistance
en bosques de pino, anualmente miles de árboles present in this material is due to different structural
se pierden por el perjuicio provocado (FAO, 2007). and chemical factors contained in the woody tissue,
La protección de la madera de baja durabili- typical variables of the species, age and development
dad con preservadores químicos, aunque práctica conditions at the time of cutting down. According
y económica es eco-tóxica, requiere su reemplazo to A.S.T.M D-2017-81, the classification of wood

Cuadro 1. Principales insectos xilófagos y las características de los daños que ocasiona en la madera.
Table 1. Main xylophagous insects and the characteristics of the damages they cause on wood.

Ciclo
Orden Familia Especie Madera afectada Autor
biológico

Reticulitermes Todas (celulosa), los insectos forman galerías Ulyshen,

Isoptera Termitidos Variable
lucifugus Rossi separadas por finos tabiques. 2015
Latifoliadas con humedad, producen grandes
Lepidoptera Cossidos Cossus cossus L. orificios separados por tabiques gruesos, 3 años
generando galerías ovales y limpias.
Trozas de resinas húmedas.
Sirex gigas L.
Hymenoptera Sirícidos Coníferas, forman galerías circulares llenas de 3 años
Paururus Juencus L.
aserrín.
Latifoliadas verdes, forman galerías limpias en Berrocal,
Bostríchidos Apate capucina L. 1 año
forma de Y; Galerías larvarias llenas de aserrín. 2007;
Lictus linearis Latifoliadas tropicales, se producen galerías de Agboton et
Coleoptera 1 año al., 2017
Goez diámetro intermedio.
Líctidos
Lictus brunneurs En maderas tropicales se sabe que forman
1 año
Steph. galerías circulares llenas de aserrín.

Publicación en línea, enero 2018 61

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

inmediato con preservadores eco-amigables. Por by its natural durability is shown in Table 2A. This
lo que el propósito de este trabajo es establecer las feature is pondered in years, or in other words, how
bases de la protección de la madera mediante estra- long it is capable of maintaining its mechanical
tegias microbiológicas. properties after making contact with environmental
factors. Later, the Board of the Cartagena
Clasificación de la madera de acuerdo con su re- Agreement (1988) categorized this material into
sistencia a xilófagos five classes, according to the deterioration produced
by xylophagous organisms (Table 2B). However,
La madera puede ser categorizada según el uso y Bobadilla et al., (2005) catalogue its resistance
durabilidad (NMX-C-239-1985) y está sujeta a dis- according to the “Findlay Criterion”, by weight
tintos niveles de riesgo y al deterioro por xilófagos. loss after the attack by fungi (Table 2C) (Findlay,
La diferente resistencia presente en este material se 1951). The latter criterion highlights the importance
debe a diversos factores estructurales y químicos of wood deterioration cause by xylophagous fungi,
contenidos en el tejido leñoso, variables propias de as well as the relevance of their control in which
la especie, edad y condiciones de desarrollo al mo- it is possible to use microbiological methods with
mento de la tala. De acuerdo con A.S.T.M D-2017- this goal.
81, la clasificación de la madera por su durabilidad
natural se observa en el Cuadro 2A. Esta caracterís- Main chemical preservatives used on wood
tica se pondera en años, dicho de otra forma, cuan-
to tiempo es capaz de mantener sus propiedades The chemical wood preservation industry
mecánicas después del contacto con factores am- started in the 19th Century and has had great

Cuadro 2. Criterios y clasificación de la madera con base a su resistencia y durabilidad natural.

Table 2. Criteria and classification of wood based on its natural resistance and durability.

A) Clasificación de la resistencia de la madera por su durabilidad natural (A.S.T.M D-2017-81)

Promedio de pérdida de peso (%) Promedio de peso residual (%) Clasificación y resistencia
0-10 90-100 Altamente resistente
11-24 76-89 Resistente
25-44 56-75 Moderadamente resistente
45 o más 55 o menos Ligeramente resistente/no resistente
B) Clasificación de la durabilidad natural de las maderas en el caso de deterioro producido por hongos xilófagos
Años Durabilidad
Más de 20 Muy durable
15- 20 Durable
15-10 Moderadamente durable
10-5 Poco durable
Menos de 5 No durables
C) Clasificación por resistencia de las maderas de acuerdo con la pérdida de peso
Pérdida de peso (%) Categoría de resistencia
Inferior a 5 Muy resistente
5-10 Resistente
10-20 Moderadamente resistente
20-30 No resistente
Superior a 30 Sin resistencia

Publicación en línea, enero 2018 62

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

bientales. Posteriormente, la Junta del Acuerdo de technological, social, historical and economic
Cartagena (1988) categoriza este material en cinco importance, since humans have tried to protect
clases, acorde al deterioro producido por xilófagos wood from physical and biological deterioration
(Cuadro 2B). Sin embargo, Bobadilla et al., (2005) with different preserving agents. The mixtures of
catalogan su resistencia conforme al “Criterio de mineral salts with organic molecules have been
Findlay”, por pérdida de peso después del ataque extremely efficient; their classification depends
por hongos (Cuadro 2C) (Findlay, 1951). Este últi- on their nature and function (see Table 3). These
mo criterio destaca la importancia del deterioro de salts control fungi and insects in wood in service
la madera causado por hongos xilófagos, así como and that is in touch with the ground. Its use was
la relevancia de su control en donde es posible uti- officialized by the American Wood Protection
lizar métodos microbiológicos con tal fin. Association (AWPA) by norm P5-83, and some time
later, it became official in Mexico (AWPA P5-83).
Principales preservadores químicos utilizados Compounds such as Copper-chromium-arsenical
en madera (CCA) salts are extremely effective preservatives.
Lignocellulosic materials treated with CCA
La industria de la preservación química de la exposed to extreme environment conditions can
madera se desarrolló hasta el comienzo del siglo have a lifespan of decades. A verification carried
XIX debido a que ha sido de gran importancia tec- out by the United States Department of Agriculture
nológica, social, histórica y económica, ya que el (USDA) showed that wooden stakes preserved with
hombre ha intentado protegerla del deterioro físi- CCA restited the attack of diverse xylophagous
co y biológico con diversos agentes preservadores. organisms for over 60 years; the USDA foresees a
Las mezclas de sales minerales con moléculas or- lifespan of these materials five to ten times longer
gánicas han sido extremadamente eficaces, donde than without any preservations.
su clasificación depende de su naturaleza y función The indiscriminate release of these pesticides
(ver el Cuadro 3). Estas sales controlan hongos e in uses of wood has contributed to the alarming
insectos en madera en servicio y que está en con- deterioration of the ecosystem in order to increase
tacto con el suelo. Su uso se oficializó por la agen- the average lifespan of wood products at a
cia estadounidense protectora de madera (AWPA minimum cost. This social and cultural practice is
por sus siglas en inglés) mediante la norma P5-83, now an emerging and multi-factor environmental
tiempo después en México se oficializó (AWPA problem with a complex solution. However, in
P5-83). Compuestos como las sales de Cobre- the 20th Century, some control measurements
cromo-arsenicales (CCA) son preservadores extre- were set in motion for the release of pesticides in
madamente efectivos. Materiales lignocelulósicos developed countries which were then copied and
tratados con CCA expuestos a condiciones ambien- adapted in developing countries. One of them
tales extremas pueden mantener una vida útil por was the Food Quality Protection Act emitted
décadas. Una comprobación realizada por el De- by the U.S. government in 1966, and which
partamento de Agricultura de los Estados Unidos included a proposal to drastically restrict the use
de Norteamérica (USDA). Donde se demostró que of conventional pesticides. At the same time, the
estacas de madera preservada con CCA, resistieron definition of pesticide proposed by the World
al ataque de diversos organismos xilófagos por más Health Organization (WHO) was modified, and

Publicación en línea, enero 2018 63

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Cuadro 3. Principales sustancias utilizadas en la industria de la preservación de madera.

Table 3. Main substances used in the wood preservation industry.

Criterio Tipo Sustancia Autor

De acuerdo con el Pudrición 1-Cromo, Cobre y Arsénico (CCA)/CrO3 65.5, AWPA P5-83
tipo de daño CuO 18.1, Ar2O5 16.4
2-Cobre, Azoles orgánicos (CA)
3-Cobres, Azoles orgánicos y Boro (CAB)
4-Cobre y Amonios Cuaternarios (ACQ)
5- Boro
Mancha azul 6-Quinolinolato de cobre/C18H12CuN2O2 Lebow et al., 2015
7-Tribromofenato de sodio/C6H3Br3 NaO
8-Carbendazimas/ C9H9N3O2 NMX-C-222-1983
Retardantes de fuego 9-Tetraborato de sodio/Na2B4O7. 10H2O 10-Ácido bórico/
H3BO311-Sulfatos y fosfatos amónicos
Protectores contra luz 12-Pinturas con pigmentos metálicos Veronovski et al., 2013;
ultravioleta y calor Auffan et al., 2014
De acuerdo con su Oleosos 13-Creosota Singh y Singh, 2014;
naturaleza química Oleosolubles 14-Pentaclorofenol (PCF)/C6HCl5O Freeman et al., 2003
15-Naftenatos
16-Pentaclorofenato de sodio/C6Cl5NaO
17-Oxido tributil estañoso/C24H54OSn2
18-Quinolinolato de cobre/ C18H12CuN2O2
Hidrosolubles 19-Sales múltiples
20-Arsénico-cobre-amoniacales (ACA)/As2
50,20 %, Cu 49,80 %
21-Cobre-cromo-arsenicales (CCA)/As2O5-5H2O 56 %,
SO4Cu-2H2O 33 %, C2O7K2 11 %
22-Cobre-cromo-boro (CCB)/CuO, Cr2O3, H3BO3
23-Compuestos de boro
Otras sales 24-Cromo-Zinc-Cloro (CZC)/CrO3 20 %, Cl2Zn 80 %
25-Flúor-Cromo-Arsénico-Fenol

de 60 años, la USDA predice una vida útil para es- included biopesticides, such as dissuasive agents
tos materiales de cinco a diez veces mayor que sin with a confounding effect, inhibitor of oviposition,
preservar. anti-feeding and repellent, as well as biological
La liberación ambiental indiscriminada de estos control agents (Konradsen et al., 2003). With
plaguicidas de uso en la madera ha coadyuvado al these measures adopted and adjusted for Mexican
alarmante deterioro del ecosistema. Con la finali- Legislation, a new academic, biotechnological and
dad de aumentar la vida media de productos made- commercial opportunity opens up for the design
rables a un mínimo costo económico. Una práctica of preservatives of microbiological origin for their
sociocultural que ahora es un problema ambiental use on low-durability wood. The control of the
emergente y multifactorial cuya solución es com- biodeterioration of lignocellulosic materials with
pleja. Sin embargo, en el siglo XX algunas medi- preservatives based on the lifestyle and microbial
das de control para la liberación de plaguicidas se strategies of ecological invasion is a non-toxic
pusieron en marcha en países desarrollados, que alternative.

Publicación en línea, enero 2018 64

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

tiempo después fueron copiadas y adaptadas en Natural compounds with wood preserving
los países subdesarrollados. Una de ellas fue Food potential
Quality Protection Act emitida por el gobierno es-
tadounidense en 1996. En ella, se propuso restrin- Nowadays, protection methods with natural
gir drásticamente el uso de insecticidas convencio- components are the technological alternative to
nales. Paralelamente, la definición de plaguicida replace the conventional and harmful preservatives
propuesta por la Organización Mundial de la Salud for low-durability wood. The use of this eco-
(OMS) se modificó e incluyó a los bioplaguicidas friendly technology is slow and scarcely popular,
tales como los agentes disuasivos con efecto con- due to the practicity and effectiveness at a low cost
fusor, inhibidor de la oviposición, anti-alimentario of conventional preservatives.
y repelente, así como a los agentes de control bio- Among the alternative preservation methods,
lógico (Konradsen et al., 2003). Con estas medidas there are technological flaws that must be overcome,
adoptadas y adecuadas en la legislación mexicana, and that are the challenge to be faced, solved rapidly
una nueva oportunidad académica, biotecnológica due to the alarming environmental deterioration
y comercial se propicia para el diseño de preserva- and the change in attitude of the government.
dores de origen microbiano para su aplicación en Some of these methods include the differences
madera de baja durabilidad. El control del biodete- obtained under controlled conditions (laboratory)
rioro de materiales lignocelulósicos mediante pre- and the yield in the field, hardships in efficiency
servadores basados en el estilo de vida y estrategias related to exposure, environmental conditions, and
microbianas de invasión ecológica es una alterna- legislation conflicts worldwide (Singh and Singh,
tiva no tóxica. 2012). However, different natural compounds have
justified their efficiency as wood preservatives.
Compuestos de origen natural con potencial Historically, plant extracts were the molecular
preservador de madera basis for the chemical synthesis of pyrethroids
nicotinoids. Another successful example of
Hoy en día, métodos de protección con com- insecticides are derived from the Azadirachta indica
ponentes naturales son la alternativa tecnológica (neem) or Enterolobium cyclocarpum (guanacaste)
para sustituir a los convencionales y nocivos pre- trees, such as their essential oils or compounds
servadores de la madera de baja durabilidad. La contained in the heartwood, such as azadiracthin
aplicación de esta tecnología eco amigable es lenta (Martinez et al., 2012; Raya-González et al., 2013).
y escasamente popular, debido a la practicidad y Likewise, microbial agents of biological control
efectividad a bajo costo económico de los preser- of known use and efficiency, and that compose a
vadores convencionales. paradigm in the control of pests, such as Bacillus
Dentro de los métodos alternativos en la preser- thuringensis, encourages to know the style and the
vación se exhiben debilidades tecnológicas que se life cycle of bacteria and other microorganism so as
tienen que superar y que son el reto que enfrentar, to use them in the preservation of wood. Likewise,
resolver con rapidez, debido al alarmante deterioro new or novel synthetic molecules and natural
ambiental y al cambio de actitud gubernamental. products with biological activity such as pest
Entre ellas se incluyen a, las diferencias obteni- controllers are surfacing, as a partial solution for
das en condiciones controladas (laboratorio) y el the control of deleterious organisms that damage

Publicación en línea, enero 2018 65

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

rendimiento en campo, las dificultades en eficacia wood (Damian et al., 2010; González-Laredo et al.,
relacionada con la exposición, condiciones am- 2015; Ramírez-López et al., 2016).
bientales y conflictos en legislación a nivel mun- The plant synthesizes secondary metabolites
dial (Singh y Singh, 2012). Sin embargo, compues- in the bark, fruit, leaf, wood, seed, or root. Its
tos naturales diferentes, han justificado su eficacia presence will become evident according to its
como persevantes de la madera. Históricamente, los surroundings, its circadian rhythm and life cycles,
extractos de plantas fueron la base molecular para where its plant function is varied, including plant
la síntesis química de los piretroides y nicotinoides. defense, and in this chemical arsenal of the plant,
Otro ejemplo exitoso de insecticidas son los deri- several bioactive compounds, inhibitors of the
vados de los árboles Azadiracta indica (neem) o growth of pathogens, have been described. In this
de Enterolobium cyclocarpum (parota), tales como regard, extracts in Cinnamomun zeylanicum Ness.
sus aceites esenciales o componentes contenidos leaves contain components that are efficient to fight
en el duramen como la azadiractina (Martinez et some xylophagous fungi and termites (Cheng et
al., 2012; Raya-González et al., 2013). Asimismo, al., 2006; Tascioglu et al., 2013). Singh and Singh
agentes microbianos de control biológico de cono- (2012) recently reported that leaf substances in
cido uso, eficacia y que conforman un paradigma Elaeocarpus dentatus display antifungal activities
en el control de plagas, tal como Bacillus thurin- (brown rot), like Citrus x limon, Rosmarinus
gensis, motiva a conocer el estilo y ciclo de vida de officinalis, Thymus vulgaris, Cinnamomum
bacterias y otros microrganismos con la finalidad zeylanicum Ness. Syzygium aromaticum essential
de usarlos en la preservación de la madera. De igual oils, are efficient to control growth in xylophagous
forma, nuevas o novedosas moléculas sintéticas y fungi that produce mold; the most typical are species
productos naturales con actividad biológica como of the genuses Penicillium, Trichoderma, Fusarium
controladores de plagas están surgiendo como una and Aspergillus (Yang and Clausen, 2007; Matan
solución parcial para el control de organismos de- and Matan, 2008) (Table 4). Other studies reported
letéreos que dañan la madera (Damian et al., 2010; by Kartal et al., (2009) show a comparison of
González-Laredo et al., 2015; Ramírez-López et formulations based on cinnamaldehyde, cinnamic
al., 2016). acid, cassia oils, and wood tar, which inhibited
La planta sintetiza metabolitos secundarios en growth in Tyromyces palustris and Trametes
la corteza, fruto, hoja, madera, semilla o raíz. Su versicolor, as well as providing resistance against
presencia se evidenciará de acuerdo con su entor- the underground termite Coptotermes formosanus.
no, a sus ciclos circadianos y de vida, donde su Authors such as Stirling  et al.,  (2007) pointed
función vegetal es variada, entre las que destaca la out that Cedrela odorata L. compounds present a
defensa vegetal y en este arsenal químico vegetal biocidal action, due to tujaplicin,  β-tujaplicinol,
se han descrito compuestos bioactivos inhibidores and plictic acid, toxic in Coniophora puteana,
del crecimiento de patógenos. Al respecto, extrac- Postia placenta and Trametes versicolor, with
tos en hoja de Cinnamomun zeylanicum Ness. con- metal chelating characteristics,. Plictic acid and
tiene componentes que son eficaces para combatir ácido plicático and  β-tujaplicinol simultaneously
algunos hongos y termitas xilófagas (Cheng et al., showed and interesting antioxdiant activity.
2006; Tascioglu et al., 2013). Recientemente Singh Tascioglu  et al. (2012) reported that both bark
y Singh (2012) reportaron que sustancias de hojas (Acacia mollissima)  and heartwood (Schinopsis

Publicación en línea, enero 2018 66

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

en Elaeocarpus dentatus presentan actividad anti- lorentzii) samples displayed antifungal activity
fúngica (pudrición parda), de igual forma, aceites due to the large content of condensed tannins.
esenciales de Citrus x limon, Rosmarinus offici- Likewise, flavonoids presented an activity of
nalis, Thymus vulgaris, Cinnamomun zeylanicum growth inhibition of the fungi Coniophora puteana,
Ness. y Syzygium aromaticum, son eficaces para Irpex lacteus, Pleurotus ostreatus and T. versicolor
el control de crecimiento en hongos xilófagos pro- (Carrillo-Parra  et al., 2011; Nascimento  et al.,
ductores de moho, los más típicos son especies del 2013). The plants present a varied profile of
género Penicillium, Trichoderma, Fusarium y As- secondary metabolites, that suppress the growth
pergillus (Yang y Clausen, 2007; Matan y Matan, of a wide variety of microorganisms. However,
2008) (Cuadro 4). En otros estudios reportados por our interest is placed in the search for new plant
Kartal et al., (2009), muestran una comparación components for the control of pathogens and
de formulaciones a base de cinamaldehído, ácido their importance in the control of deteriorant
cinámico, aceites de cassia y alquitrán de madera, microorganisms is discriminated. Therefore, the
los cuales inhibieron el crecimiento en Tyromyces relevance of plant components in the protection
palustris y Trametes versicolor, además de pro- of low-durability wood is a priority and calls for
porcionar resistencia contra la termita subterránea immediate attention.
Coptotermes formosanus. Autores como Stirling et
al.,  (2007) señalaron que compuestos de Cedrela Bacterial activity antagonistic to xylophagous
odorata L. presentan acción biocida, debida a tuja- fungi
plicina, β-tujaplicinol y ácido plicático, tóxicos en
Coniophora puteana, Postia placenta y Trametes Apart from components identified as having
versicolor, con características quelantes de metales, wood preservation capabilities from plants, such as
simultáneamente el ácido plicático y β-tujaplicinol, essential oils, waxes, saps and extractives, there is a
mostraron una interesante actividad antioxidante. proposal to use microorganisms or their exudates as
Tascioglu et al. (2012) reportaron que extractos de agents with antagonistic activity in the protection
corteza (Acacia mollissima) y duramen (Schinopsis of wood against biological deterioration.
lorentzii), mostraron actividad antifúngica debido Out of the group of fungi that produce exudates,
al gran contenido de taninos condensados, de igual the species of the genus Trichoderma stand out,
forma, los flavonoides exhibieron una actividad in- which suppress the growth of plant pathogens by
hibitoria del crecimiento de los hongos Coniopho- microparasitism processes and/or the production
ra puteana, Irpex lacteus, Pleurotus ostreatus y T. of antifungal toxins (Widmer, 2014). Also, a
versicolor (Carrillo-Parra  et al., 2011; Nascimen- wide group of bacteria are able to antagonize
to et al., 2013). Se evidencia que las plantas presen- the development of some fungi using various
tan un variado perfil de metabolitos secundarios, action mechanisms. This group includes plant
que reprimen el crecimiento de una vasta varie- growth-promoting rhizobacteria (PGPRs), which,
dad de microorganismos. Sin embargo, el interés by producing siderophores (Saha et al., 2016),
se enfoca en la búsqueda de nuevos componentes antibiotics (Tariq et al., 2017) or by competition for
vegetales para el control de patógenos y se discri- colonization spaces in roots and the production of
mina su importancia en el control de microorganis- organic compounds (COVs), generate an excellent
mos deterioradores. Por tanto, la relevancia de and a distinctive antimicrobial effect (Table 5).

Publicación en línea, enero 2018 67

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Cuadro 4. Principales hongos causantes pudrición blanca y parda en madera (Guillén et al., 2005; Schwarze, 2007; Singh y Singh, 2014).
Table 4. Main fungi responsible for white rot and brown rot in wood (Guillén et al., 2005; Schwarze, 2007; Singh y Singh, 2014).

Especie Tipo de
Madera afectada Características del hongo Infección
fúngica pudrición

Xylaria Blanca Latifoliadas, Carpóforo anamorfo bifurcado y Se desarrolla sobre materia vegetal
hypoxylon  (esponjosa) recientemente apeada o filamentoso, de himenio inserto en la en descomposición, debido a la
apilada. superficie externa del ascoma (negro), degradación de lignina produce
ausente de pie, sabor u olor. podredumbre blanca.
Eutypa flavovirens  Blanca Latifoliadas tanto en pie Tiene pseudostromas, peritecios con Ascomicetos que desarrollan
  (fibroso como recién apeadas. paredes oscuras, ascas cilíndricas, fructificaciones sobre la madera,
veteado) diatripáceos en forma alargada con se ablanda, vetea, con cavidades;
ascosporas. pierde peso: hifas de 0.5 a 5 µ, de q
las menores, azuladas. Parte superior
de los cuerpos fructíferos con pelos
característicos.
Stereum hirsutum Blanca Latifoliadas tanto en Los cuerpos de fructificación son Saprofita de madera muerta o
Willd pie como recientemente costrosos, en visera, ondulados, grises viva, produciendo podredumbre
  apeadas. en la parte superior y amarillenta en la blanca, basidiomicete responsable
parte inferior. de la pudrición blanca de la madera,
presenta fuerte actividad ligninolítica
lacasa y manganeso peroxidasa.
Schizophyllum Blanca De coníferas y Cuerpos de fructificación Presenta actividad lacasa, manganeso
commune Fr. latifoliadas con alta encespelados, blancos de 3 cm y peroxidasa y las lignino peroxidasa.
humedad (Roble, Haya cubiertos de pelillos finos. Laminillas Inespecífico de hospedero, se reporta
y Pino). de los cuerpos de fructificación con creciendo sobre madera muerta o
borde partido a lo largo de toda su árboles en pie. Considerado una
longitud. plaga causando daños a los árboles
de plantaciones forestales, parques y
jardines.
Polysticus Blanca Latifoliadas y algunas La madera se decolora y las manchas En considerado un hongo agresivo para
versicolor Fr. (fibrosa) coníferas. se extienden: Hifas de 0,5 a 5 µ; la madera, degradándola rápidamente,
cuerpo fructífero con tubos en la parasitando árboles en pie. La
parte inferior Sensible a los taninos. infección se extiende de arriba y abajo
Cuerpos de fructificación coloreados del tronco desde el punto de inicio,
superiormente de forma concéntrica. recorriendo hacia fuera en las ramas
e incluso en las raíces. En los árboles
vivos el hongo produce esporóforos
en gran abundancia, pero rara vez se
produce fructificación en la madera.
Chaetomium Parda y blanca De coníferas y Hongo con fuerte presencia en suelo Ataca a la madera que queda
globosum Kunze latifoliadas con altos y plantas, se caracteriza por degradar superficialmente blanda y al secar se
grados de humedad. la pulpa craft, Esta especie forma un resquebraja. Resiste a la anaerobiosis;
micelio escaso y delgado, pero con los daños dependen de la densidad
numerosos ascocarpos verde oliva, de la madera y la presencia de sales.
que se distribuyen uniformemente Produce cavidades en la subcapa S2 de
sobre la superficie de la colonia. la pared celular.
Serpula lacrymans Parda seca Coníferas y latifoliadas La madera se decolora, ablanda y
Organismo causante de severos
Wulf. (cúbica) con distintos grados de agrieta: micelio externo de blanco
daños a la madera, con la capacidad
humedad. pasa a rojo, coloreado quinoide; hifas
de generar pudrición en bajas
de 2,5 a 4 µ. Micelio incoloro muy
condiciones de humedad. S. lacrymans
ramificado, hifas de 1,8 µ. Cuerpos de
es considerado como el destructor
fructificación con basidiosporas que
más perjudicial de materiales de
colorean de rojo-oro viejo. Cordones
construcción de madera en interiores
miceliares, los rizomorfos para
en regiones templadas.
transporte de agua, de 5,8 µ.

Publicación en línea, enero 2018 68

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Continúa Cuadro 4.
Continued Table 4.

Lenzites abietina Parda húmeda Coníferas Cuerpos de fructificación coloreados, Organismo con alta presencia en
Bull. hifas de 4 µ. Cistidios de gran tamaño. construcciones y todo tipo de objetos
manufacturados con madera, degradan
la celulosa y lignina en menor medida.
En sitios en donde se almacena la
madera, este hongo produce pérdida de
peso en este material lignocelulósico.
Lentinus lepideus Parda húmeda Coníferas Se distingue por presentar un La madera se colorea, amarillenta,
sombrero convexo de 12 cm y pie obscurece. Micelio blanco pasa a
de 7cm Cutícula de blanco a crema, marrón purpura; hifas de 1-2,5 µ.
escamosa. Láminas adnatas y Resistente a las creosotas, a
decurrentes, espaciadas. Saprofito de altas temperaturas, a los medios
troncos, tocones, muebles, madera anaeróbicos. Sin luz origina
vieja de ferrocarril y postes. fructificación.

los componentes vegetales en la protección de la COVs are organic molecules with a molecular
madera de baja durabilidad se establece como una mass of <300 Da and their main characteristic is a
prioridad de atención inmediata. high vapor pressure that facilitates its volatilization
(Zou et al., 2007). Some have anti-fungal potential
Actividad bacteriana antagónica de hongos xi- and can act at a distance by diffusion in the air
lofagos e.g. la rhizobacteria Arthrobacter agilis UMCV2,
in an in vitro system, limited the growth of the fungi
Además de componentes identificados con ca- Botrytis cinerea  and of the oomycete Phytophthora
pacidad preservante de madera, procedentes de cinnamomi, due to the production of amine
plantas como aceites esenciales, ceras, resinas y dimethylhexadecylamine (Velázquez-Becerra et al.,
extractivos, se propone la opción de utilizar a los 2013). Likewise, with this experimental approach,
microorganismos o sus exudados como agentes con Orozco-Mosqueda et al., (2015) characterized the anti-
actividad antagónica en la protección de la madera fungal activity of diverse amines with antagonistic
contra el deterioro biológico. Del grupo de hon- action on four strains of the xylophagous fungi
gos productores de exudados destacan las especies Hypocrea  sp. (UMTM3) and  Fusarium  sp.
fúngicas del género Trichoderma, que reprimen (UMTM13) obtained by fungal scrutiny in wood
el crecimiento de fitopatógenos mediante proce- in decomposition, the origin of which was a
sos de micoparasitismo y/o producción de toxinas pine-oak forest. The vitro test showed that the
antifúngicas (Widmer, 2014). También, un amplio amines evaluated presented an inhibiting effect
grupo de bacterias son capaces de antagonizar el on the growth of the UMTM fungal isolations, in
desarrollo de algunos hongos mediante variados which dimethylhexadecylamine stood out. Due
mecanismos de acción. En este grupo se encuen- to its fungal deadliness, it is a potentially useful
tran las rizobacterias promotoras del crecimiento biomolecule in the preventive treatment of wood
vegetal (PGPRs), que por medio de la producción against the attack of xylophagous fungi and blue
de sideróforos (Saha et al., 2016), antibióticos (Ta- stain fungus. Included in the main bacterial genuses
riq et al., 2017) o competencia por espacios de identified as producers of COVs is Pseudomonas,

Publicación en línea, enero 2018 69

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

colonización en raíces y producción de compuestos since Pseudomonas spp. synthesize hydrocyanic

orgánicos volátiles (COVs), generan un excelente y acid (HCN), a growth inhibitor in lignocellulosic
distintivo efecto antimicrobiano (Cuadro 5). pathogens. This metabolite is produced from glycine
Los COVs son moléculas orgánicas con masa in essentially microaerophyllic conditions, where
molecular de <300 Da, se caracterizan por tener the HCN synthetases codified by the genes hcnABC
una alta presión de vapor que facilita su volatili- are crucial for the competition of P. fluorescens (Haas
zación (Zou et al., 2007). Algunos tienen potencial and Défago, 2005). Other bacterial species of this
antifúngico y pueden actuar a distancia a través genus that produce fungicides are P. chlororaphis
de su difusión por el aire e.g. la rizobacteria Ar- (cyclohexanol), P. corrugata (2-ethyl-1-hexanol),
throbacter agilis UMCV2, en un sistema in vitro P. aurantiaca (nonanal, benzothiazole and dimethyl
limitó el crecimiento del hongo Botrytis cinerea y sulfate). The compound 2,4-Di-tert-butylphenol

Cuadro 5. Clasificación de las PGPRs de acuerdo con el antagonismo con fitopatógenos.

Table 5. Clasificación de las PGPRs depending on the antagonism with phytopathogens.

Microrganismo Compuesto Efecto inducido en

PGPRs Autor
antagónico sintetizado plantas y fitopatógenos
Gutiérrez-
Bacillus pumilus y Bacillus Giberelinas Elongación del tallo de aliso (Alnus
Mañero et al.,
licheniformis. GA1, GA2, GA3 y GA4 glutinosa [L.] Gaertn.).
2001
Ácido indol acético, Son eficientes en la promoción del
Pseudomonas fluorescens y Sivasakthi et
Directo sideróforos y ácido crecimiento vegetal en cultivos de
Burkholderia cepacia al., 2014
salicílico importancia económica.
Hormonas vegetales, Ácido Promueve el crecimiento vegetal de
Azotobacter, Pseudomona indol acético, amoniaco, la planta e inhibición de fitopatógenos
Ahmad et al.,
fluorecens, Mesorhizobium, cianuro de hidrogeno, como Aspergillus, Fusarium
2008
Bacillus. sideroforos, solubilización oxysporum, F. solani y Rhizoctonia
de fosfatos botaticola.
Inhibe el crecimiento de Fusarium sp.,
interactuando con las moléculas de
Ariza y
colesterol, interrumpe la membrana
Sánchez,
Bacillus subtilis. Iturina A citoplasmática fúngica, crea canales
2012; Liu et
transmembranales, que permiten la
al., 2015
liberación de iones vitales como el
K+
Inhibición de fitopatógenos como
Curvularia sp. y Pyricularia grisea.
Metabolitos secundarios Tejera et al.,
Bacillus sp. Genera un efecto de biocontrol a
con actividad anti fúngica 2012
través de la acción de las proteínas
Indirecto Cry1Ab y Cry1Ac.
Promueve el crecimiento vegetal de
la plata e inhibición de fitopatógenos
como Macrophomina phaseolina,
Ácido indol acético,
Fusarium oxysporum, F. solani,
sideróforos, fitasa.
Sclerotinia sclerotiorum, Rhizoctonia
Ácidos orgánicos, ACC
y Colletotricum sp., por medio de Kumar et al.,
Bacillus sp. desaminasa, cianógenos,
enzimas mucolíticas como quitinasa, 2012
enzimas líticas, oxalato
β(1,3)-glucanasa y β(1,4)-glucanasa
oxidasa, fuentes de fosfatos
que degradan los componentes de la
orgánicos, potasio y zinc.
pared celular de hongos, la quitina,
Β(1,3)-glucano y enlaces glucosídicos
son lisados.

Publicación en línea, enero 2018 70

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

del oomiceto Phytophthora cinnamomi, debido a is produced by Lysobacter enzymogenes ISE13,

la producción de la amina dimetilhexadecilamina used in the suprression of the life cycle of the
(Velázquez-Becerra et al., 2013). Asimismo, con fungus Colletotrichum acutatum and the oomycete
este enfoque experimental Orozco-Mosqueda et Phytophthora capsici, since they inhibit mycelial
al., (2015) caracterizaron la actividad antifúngica growth, sporulation and the germination of spores
de diversas aminas con acción antagónica sobre and zoospores, as well as limiting the formation
cuatro cepas de los hongos xilófagos Hypocrea sp. of the appressorium of C. acutatum (Pedraza,
(UMTM3) y  Fusarium  sp. (UMTM13) obtenidos 2015). Also, an important number of strains of
mediante un escrutinio fúngico en madera en des- the genus Paenibacillus can act as antagonists to
composición cuyo origen fue un bosque de pino- pathogenic fungi, such as P. ehimensis KWN38,
encino. El ensayo in vitro evidenció que las aminas which synthesizes butanol, which produces an
evaluadas mostraron un efecto inhibitorio sobre el inhibition (>50 %) in the development of hyphae of
crecimiento de los aislados fúngicos UMTM, don- the fungi Rhizoctonia solani, Fusarium oxysporum
de destacó la dimetilhexadecilamina. Por su letali- and of the oomycete Phytophthora capsici (Naing
dad fúngica es una biomolécula potencialmente útil et al., 2014). The bacteria Paenibacillus polymyxa
en el tratamiento preventivo de la madera contra el presents volatile components such as 1-Octen-3-ol,
ataque de hongos xilófagos y de la mancha azul. benzothiazole, citronellol and 1,3-dichloropropene,
Dentro de los principales géneros bacterianos iden- which severely inhibit mycelial growth and affect
tificados como interesantes productores de COVs the spreading of fungal pathogens, and they
es Pseudomonas. Ya que Pseudomonas spp. sin- show an interesting insecticidal and herbicidal
tetizan ácido cianhídrico (HCN), un inhibidor del activity (Zhao et al., 2011). Likewise, the effect of
crecimiento de patógenos lignocelulósicos. Este Streptomyces platensis COVs on plant pathogenic
metabolito se produce a partir de glicina en con- fungi was reported in a study that identified
diciones esencialmente microaerofílicas, donde las antifungal compounds such as 2-phenylethanol and
sintetasas de HCN codificadas por los genes hcnA- a derivative of felandren, substances responsible for
BC son fundamentales para la competencia de P. the suppression of mycelial growth in Rhizoctonia
fluorescens (Haas y Défago, 2005). Otras especies solani, Sclerotinia sclerotiorum and Botrytis cinerea
bacterianas de este género que producen antifún- (Wan et al., 2008). Also strains of Bacillus subtilis
gicos son: P. chlororaphis (ciclohexanol), P. co- produce COVs that significantly limit mycelial
rrugata (2-etil-1-hexanol), P. aurantiaca (nonanal, growth, pigment production (inhibition of 43 to
benzotiazol y trisulfuro de dimetilo). El compuesto 93 % respectively) and control the germination of
2,4-Di-ter-burtilfenol lo produce Lysobacter en- Sclerotinia sclerotiorum with alkynes, alcohols,
zymogenes ISE13, utilizado en la represión del ci- esters, ketones, amines, phenols and heterocyclic
clo de vida del hongo Colletotrichum acutatum y compounds (Liu et al., 2008). Microbial
del oomiceto Phytophthora capsici, ya que inhiben technologies based on sustainable principles that
el crecimiento micelial, la esporulación y la germi- use agents with minimum environmental effects
nación de esporas y zoosporas, así como también are the alternative and a perspective for the
limitar la formación del apresorio de C. acutatum preservation of wood resources and its derivative.

Publicación en línea, enero 2018 71

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

(Pedraza, 2015). También, un importante número Bacterial strategies for the control of fungi that
de cepas del género Paenibacillus pueden actuar deteriorate wood
como antagonistas de hongos fitopatógenos, por
ejemplo, P. ehimensis KWN38 sintetiza butanol, el Bacteria present diverse mechanisms
cual genera una inhibición (>50 %) en el desarrollo through which they can inhibit the growth og
de hifas de los hongos Rhizoctonia solani, Fusa- microorganisms that cause the deterioration of
rium oxysporum y del oomiceto Phytophthora cap- wood and other forestry products (Zavattieri et
sici (Naing et al., 2014). La bacteria Paenibacillus al., 2016; Cely et al., 2016). Some of the bioactive
polymyxa presenta componentes volátiles como metabolites may supress fungal germination,
1-Octen-3-ol, benzotiazol, citronelol y 1,3-di- spreading, or affect other activities of fungal
cloropropeno, los cuales inhiben severamente el development, such as invasive activity, the survival
crecimiento micelial y afectan la propagación de of fungal propagules embedded in clefts or the
patógenos fúngicos, adicionalmente muestran una surface of wood to avoid their spreading (Figure 2).
interesante actividad insecticida y herbicida (Zhao Most of these bacterial bioactives are catalogued in
et al., 2011). Asimismo, el efecto de COVs de the group of antibiotics that inhibit the syntheses of
Streptomyces platensis sobre hongos fitopatógenos the cell wall and of proteins, or alter the structure
se reportó. En dicho estudio se identificaron com- of the microbial membrane system, or cause the
puestos antifúngicos como 2-feniletanol y un deri- degradation of the genetic material of the target
vado del felandreno, sustancias responsables de la microorganism (Maksimov et al., 2011). Some
supresión del crecimiento micelial en Rhizoctonia species of the genus Bacillus produce insecticidal
solani, Sclerotinia sclerotiorum y Botrytis cinerea antibiotics and proteins e.g. B. subtilis produce
(Wan et al., 2008). También, cepas de Bacillus sub- antibiotics, yet considered PGPRs, since they
tilis producen COVs que limitan significativamente promote plant growth and a biological control over
el crecimiento micelial, producción de pigmentos some soil pathogens. B. thuringensis produces
(inhibición de 43 a 93 % respectivamente) y con- proteins that affect the development of insects, and
trolan la germinación de Sclerotinia sclerotiorum, is therefore used as an insecticide. Both bacilli are
por medio de alquinos, alcoholes, ésteres, cetonas, an unexplored source of bioactives for the control
aminas, fenoles y compuestos heterocíclicos (Liu of wood-decaying fungi.
et al., 2008). Tecnologías microbianas fundamenta- Fungi require microelements for their
das en principios sustentables que emplean agentes development, and this need is vital, since these
de mínima afectación ambiental son la alternativa y minerals can act as the farmaceutical target or
a la vez una perspectiva para la preservación de del objective and make them unavailable to the
recurso maderable y derivado. fungus and allow its control. The molecular
chelating of ions avoids their availability and
Estrategias bacterianas para el control de hon- therefore the assimilation by the fungus, therefore
gos que deterioran la madera its development. This fungal control strategy
can be carried out with the siderophores, that are
Las bacterias exhiben diversos mecanismos a compounds with low molecular weight, produced
través de los cuales pueden inhibir el desarrollo and secreted by plant roots and some bacteria, e.g.
de microorganismos causantes del deterioro de la siderophores capture elements such as iron (Fe+3)

Publicación en línea, enero 2018 72

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

madera y otros productos forestales (Zavattieri et (Saha et al., 2016). The best siderophore-producing
al., 2016; Cely et al., 2016). Alguno de los metabo- bacteria are found in the bacterial category of
litos bioactivos bacterianos puede suprimir la ger- PGPRs. Although siderophores are interesting,
minación, propagación o afectar otras actividades for the purpose of this investigation, it is shown
del desarrollo fúngico, tales como la actividad in- as a recurring topic for its use in the protection of
vasora, la supervivencia de los propágulos fúngicos wood. The bacterial ability to produce siderophores
anidados en hendiduras o superficie de la madera calls to attention for the chelating of iron, since
para evitar su dispersión (Figura 2). La mayoría when it forms a siderophore Fe3 + complex, and
de estos bioactivos bacterianos están catalogados confining it in the bacterial cytosol with a specific
en el grupo de antibióticos que inhiben la síntesis receptor located in the bacterial membrane causes
de pared celular y la síntesis de proteínas o alterar this micronurtient to become unavailable for
la estructura del sistema membranal microbiano o microorganisms that lack the specific assimilation
provocar la degradación del material genético del system and acknowledgement of such a complex
microorganismo diana (Maksimov et al., 2011). (Radzki et al., 2013; Tariq et al., 2017). In this
Algunas especies del género Bacillus producen way, when using all or most of the soluble iron
antibióticos y proteínas insecticidas e.g. B. sub- un the wood, fungal growth is suppressed, as
tilis producen antibióticos, aunque consideradas well as in other microorganisms, as occurs in the
PGPRs debido a que ejercen efecto promotor del rhizosphere (Bolívar-Anillo et al., 2016; Kumar
crecimiento vegetal y un control biológico sobre et al., 2017). The ability of siderophores to act

Figura 2. Modelo de inhibición de Trametes versicolor por la secreción de metabolitos de Bacillus sp. (a) el crecimiento del
aislado bacteriano de Bacillus sp, (b) ejemplo del desarrollo del hongo fitopatógeno T. versicolor y (c) grado de
inhibición de los metabolitos bacterianos sobre el crecimiento del fitopatógeno al estar en desarrollo simultáneo
bajo condiciones in vitro a siete días de tiempo.
Figure 2. Trametes versicolor inhibition model for the secretion of Bacillus sp. metabolites (a) ths growth of the Bacillus sp
bacterial isolation, (b) example of the development of the phytopathogenic fungus T. versicolor and (c) degree of
inhibition of the bacterial metabolites on the growth of the phytopathogen when in simultaneous development
under in vitro conditions after seven days.

Publicación en línea, enero 2018 73

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

algunos patógenos del suelo. B. thuringensis pro- as suppressors of wood deteriorating fungi is
duce proteínas que afectan el desarrollo de insectos unknown and its deleterious action may depend
por lo que se usa como insecticida. Ambos bacilos on chemical, physical and biological factors, as in
son una fuente de bioactivos inexplorada para el the Rhizoshpere (Saha et al., 2016). However this
control de hongos deterioradores de la madera. is one of the challenges to overcome and that may
Los hongos requieren de microelementos para be important in the preservation of this material.
su desarrollo y esta necesidad es de vital impor- Another unexplored field in wood preservation and
tancia. En donde, estos minerales pueden actuar in the control of its biodeterioration are the lytic
como el blanco o diana farmacológica al tornarlos enzymes of polymers from fungal cell walls. These
no disponibles para el hongo y permitir su control. enzymes are produced by diverse microorganisms,
El secuestro molecular de iones evita su disponi- including PGPRs, in which there have been
bilidad y por tanto la asimilación por el hongo y descriptions of glucanases, proteases and chitinases.
con ello se afecta su desarrollo. Esta estrategia de These act with the degradation of the polymers that
control fúngico se puede realizar mediante los si- make up the fungal cell wall of wood deteriorators,
deróforos, que son compuestos de bajo peso mole- as described that takes place in pathogenic fungi
cular producidos y secretados por raíces vegetales (El-Tarabily and Sivasithamparam, 2006). Some
y algunas bacterias, e.g. los sideróforos capturan of the main PGPRs that produce these enzymes
elementos como el hierro (Fe+3) (Saha et al., 2016). are Bacillus altitudinis and B. amyloliquefaciens
Las mejores bacterias productoras de siderófo- (Sunar et al., 2013; Tariq et al., 2017). As a natural
ros se encuentran en la categoría bacteriana de las renewable but definitely finite resource, wood is of
PGPRs. Aunque, los sideróforos son interesantes, great economic importance worldwide. A challenge
por el propósito de este trabajo se muestra como un in its preservation is to have strategies based on
tema recurrente para su aplicación en la protección the microbial exudates to avoid the use of toxic
de la madera. La capacidad bacteriana de producir substances in its control.
sideróforos llama la atención para el secuestro del
hierro ya que al formar un complejo Fe3 + sideró-
foro, e internarlo al citosol bacteriano mediante un CONCLUSIONS
receptor específico localizado en la membrana bac-
teriana, ocasiona que este micronutriente no esté Bacterial metabolites such as
disponible para microorganismos que carezcan del dimethylhexadecylamine, 2,4-Di-tert-butylphenol
sistema de asimilación específico y reconocimiento or of an antibiotic nature are potentially an
de dicho complejo (Radzki et al., 2013; Tariq et al., alternative to conventional preservatives of
2017). De tal manera que al utilizar la totalidad o low durability wood. But there is still a lack
mayoría del hierro soluble en la madera se suprime of knowledge in terms of production, use and
el crecimiento fúngico y de otros microorganismos, doses of the microbial exudates. Therefore, the
tal como ocurre en la rizósfera (Bolívar-Anillo et challenge is to attain high yields and reliability
al., 2016; Kumar et al., 2017). La capacidad de los of these secondary metabolites comparable to the
sideróforos para actuar como supresores de hon- conventional preservatives using biotechnology
gos deterioradores de la madera se desconoce y es strategies that include microbiological components

Publicación en línea, enero 2018 74

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

posible que su acción deletérea dependa de facto- Acknowledgements

res químicos, físicos y biológicos como ocurre en
la rizósfera (Saha et al., 2016). Sin embargo, este The authors wish to thank the UMSNH for
es uno de los retos a superar y que puede ser im- funding this investigation.
portante en la preservación de este material. Otro
campo inexplorado en la preservación de la madera End of the English version
y en el control de su biodeterioro son las enzimas
líticas de polímeros de pared celular fúngica. En-
zimas que diversos microorganismos las producen
entre los que se encuentran las PGPRs, en quienes Agradecimientos
se han descrito las glucanasas, proteasas y quitina-
sas. Estas actúan mediante la degradación de los Los autores agradecen a la UMSNH por el financiamiento
polímeros que componen la pared celular fúngica a esta investigación.
de los deterioradores de la madera, al igual como
se describió que ocurre en hongos fitopatógenos LITERATURA CITADA
(El-Tarabily y Sivasithamparam, 2006). Entre las
principales PGPRs productoras de estas enzimas
Agboton C, Onzo A, Korie S, Tamò M and Vidal S. 2017.
destacan Bacillus altitudinis y B. amyloliquefa- Spatial and temporal infestation rates of Apate terebrans
ciens (Sunar et al., 2013; Tariq et al., 2017). Como (Coleoptera: Bostrichidae) in cashew orchards in Benin,
West Africa. African Entomology 25(1):24-36. [Link]
recurso natural renovable pero definitivamente org/10.4001/003.025.0024
agotable, la madera es de importancia económica Ahmad F, Ahmad I and Khan MS. 2008. Screening of free-
living rhizospheric bacteria for their multiple plant growth
a nivel mundial. Un reto en el área de su preserva- promoting activities.  Microbiological Research  163:173-
ción es tener estrategias basadas en los exudados 181. [Link]
Arbelo A y Garbuyo E. 2012. Patologías en la construcción en
microbianos para evitar el uso de sustancias tóxicas madera. Estudio de caso: vivienda Punta Colorada. Dis-
en su manejo. ponible en línea: [Link]
tream/123456789/1884/5/[Link]
Ariza Y y Sánchez L. 2012. Determinación de metabolitos
secundarios a partir de Bacillus subtilis efecto biocontro-
lador sobre Fusarium sp. Nova 10:149-155. Disponible
CONCLUSIONES en línea:  [Link] [Link]/[Link]?script=sci_
arttext&pid=S1794-24702012000200002&lng=en&tlng=
es
Metabolitos bacterianos como la dimetilhexa- A.S.T.M D-2017-81. American Society for Testing and Mate-
decilamina, 2,4-Di-ter-butilfenol o de naturaleza rials. (ASTM). 1994. D-2017-81: Standard Method of Ac-
celerated Laboratory Natural Decay Resistance for Woods.
antibiótica potencialmente son una alternativa a los Annual Book of ASTM Standard, Philadelphia, v. 410, p.
preservadores convencionales de la madera de baja 324-328. Disponible en línea: [Link]
dard/[Link]
durabilidad. Pero aún, un desconocimiento existe Auffan M, Masion A, Labille J, Diot MA, Liu W, Olivi L,
en cuanto a la producción, modo de empleo y dosi- Proux O, Ziarelli F, Chaurand P, Geantetf C, Bottero JY
and Rose J. 2014. Long-term aging of a CeO2 based nano-
ficación de los exudados microbianos. Por lo tanto, composite used for wood protection. Environmental Pollu-
el reto es alcanzar rendimientos y confiabilidad de tion 188:1-7. [Link]
AWPA P5-83 1983. American Wood-Preserver´s Association
estos metabolitos secundarios comparable con los (AWPA). 1983. P5-83. Standard for waterborne preserva-
preservadores convencionales mediante estrategias tives. In: American Wood Preservers’ Association AWPA.
Pp. 1-4
biotecnológicas que incluyen componentes micro- Berrocal JA. 2007. Clasificación de daños producidos por
biológicos. agentes de biodeterioro en la madera.  Revista Forestal

Publicación en línea, enero 2018 75

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Mesoamericana Kurú 4:54-62. Disponible en línea: http:// González-Laredo RF, Rosales-Castro M, Rocha-Guzmán NE,
[Link]/[Link]/kuru/article/view/500/427 Gallegos-Infante JA, Moreno-Jiménez MR y Karchesy
Bobadilla EA, Pereyra O, Silva F y Stehr AM. 2005. Durabi- JJ. 2015. Wood preservation using natural products. Ma-
lidad natural de la madera de dos especies aptas para la dera y Bosques 21:63-76. [Link]
industria de la construcción. Floresta 35:419-428. http:// myb.2015.210427
[Link]/ 10.5380/rf.v35i3.5192 Guillén F, Martínez MJ, Gutiérrez A and Del Rio JC. 2005.
Bolívar-Anillo HJ, Contreras-Zentella ML y Teherán-Sierra Biodegradation of lignocellulosics: microbial, chemical,
LG. 2016. Burkholderia tropica una bacteria con gran and enzymatic aspects of the fungal attack of lignin.  In-
potencial para su uso en la agricultura.  TIP 19:102-108. ternational Microbiology 8:195-204. Disponible en línea:
[Link] [Link]
Carrillo-Parra A, Hapla F, Mai C y Garza-Ocañas F. 2011. Du- Gutiérrez-Mañero FJ, Ramos-Solano B, Probanza A, Mehoua-
rabilidad de la madera de Prosopis laevigata y efecto de chi J, Tadeo F and Talon M. 2001. The plant-growth-pro-
sus extractos en hongos que degradan la madera. Madera moting rhizobacteria Bacillus pumilus and Bacillus liche-
y bosques 17:7-21. Disponible en línea: [Link] niformis produce high amounts of physiologically active
[Link]/[Link]?script=sci_arttext&pid=S140504 gibberellins.  Physiologia Plantarum  111:206-211. http://
712011000100001&lng=es&tlng=en [Link]/10.1034/j.1399-3054.2001.1110211.x
Cely MV, Siviero MA, Emiliano J, Spago FR, Freitas VF, Ba- Haas D and Défago G. 2005. Biological control of soil-borne
razetti AR, Goya ET, de Souza Lamberti, G, dos Santos pathogens by fluorescent pseudomonads. Nature Reviews
IM, De Oliveira AG and Andrade G. 2016. Inoculation of Microbiology 3:307-319. [Link]
Schizolobium parahyba with Mycorrhizal Fungi and Plant cro1129
Growth-Promoting Rhizobacteria Increases Wood Yield Ibáñez OC, Mantero C, Rabinovich M, Cecchetto G y Cer-
under Field Conditions. Frontiers in Plant Science 7:1-13. deiras P. 2012. Deterioro y preservación de madera. Re-
[Link] vista Digital Universitaria 13(5):1-15 Disponible en línea:
Cheng SS, Liu JY, Hsui YR and Chang ST. 2006. Chemical po- [Link]
lymorphism and antifungal activity of essential oils from html
leaves of different provenances of indigenous cinnamon Kartal SN, Yoshimura T and Imamura Y. 2009. Modification
(Cinnamomum osmophloeum). Bioresource Technology of wood with Si compounds to limit boron leaching from
97:306-312. [Link] [Link].2005. treated wood and to increase termite and decay resistance.
02.030 International Biodeterioration and Biodegradation 63:187-
Damian BLM, Martinez MRE, Salgado GR y Martinez PMM. 190. [Link]
2010. In vitro antioomycete activity of Artemisia ludovi- Konradsen F, van der Hoek W, Cole DC, Hutchinson G, Dais-
ciana extracts against Phytophthora. Boletín Latinoame- ley H, Singh S and Eddleston M. 2003. Reducing acute
ricano y del Caribe de Plantas Medicinales y Aromáticas poisoning in developing countries-options for restricting
9:136-142. ISSN:0717-7917. Disponible en linea: http:// the availability of pesticides. Toxicology 192(2):249-261.
[Link]/html/856/85612475009/ [Link]
El-Tarabily KA and Sivasithamparam K. 2006. Non-strep- Kumar H, Dubey RC and Maheshwari DK. 2017. Seed-coating
tomycete actinomycetes as biocontrol agents of soil-borne fenugreek with Burkholderia rhizobacteria enhances yield
fungal plant pathogens and as plant growth promoters. Soil in field trials and can combat Fusarium wilt. Rhizosphere
Biology and Biochemistry  38:1505-1520. [Link] 3:92-99. [Link]
org/10.1016/[Link].2005.12.017 Kumar P, Dubey RC and Maheshwari DK. 2012. Bacillus
FAO 2007. Food and Agriculture Organization of the United strains isolated from rhizosphere showed plant growth
Nations. State of the world’s forests. Rome, Italy: FAO promoting and antagonistic activity against phytopa-
Forestry Department. thogens.  Microbiological Research  167:493-499. http://
Findlay WPK. 1951. The value of laboratory test on wood [Link]/10.1016/[Link].2012.05.002
preservatives. [S.l.]: Convention British Wood Preserving Lebow S, Arango R, Woodward B, Lebow P and Ohno K.
Association. 2015. Efficacy of alternatives to zinc naphthenate for dip
Flower CE and Gonzalez-Meler MA. 2015. Responses of treatment of wood packaging materials. International Bio-
temperate forest productivity to insect and pathogen dis- deterioration and Biodegradation 104:371-376. [Link]
turbances. Annual Review of Plant Biology 66:547-569. org/10.1016/[Link].2015.07.006
Disponible en línea: [Link] Liu C, Sheng J, Chen L, Zheng Y, Lee DYW, Yang Y, Xu M
pdf/10.1146/annurev-arplant-043014-115540 and Shen L. 2015. Biocontrol activity of Bacillus subti-
Freeman MH, Shupe TF, Vlosky RP and Barnes HM. 2003. lis isolated from Agaricus bisporus mushroom compost
Past, present, and future of the wood preservation indus- against pathogenic fungi. Journal of Agricultural and Food
try: wood is a renewable natural resource that typically is Chemistry 63(26):6009-6018. [Link]
preservative treated to ensure structural integrity in many jafc.5b02218
exterior applications. Forest Products Journal 53(10):8-16. Liu W, Mu W, Zhu B and Liu F. 2008. Antifungal activities
Disponible en línea: [Link] and components of VOCs produced by Bacillus subtilis
ALE%7CA110822270&sid=googleScholar&v=2.1&it=r G8. Current Research on Bacteriology 1:28-34. Dispo-
&linkaccess=fulltext&issn=00157473&p=AONE&sw=w nible en línea: [Link]
&authCount=1&u=umsnh1&selfRedirect=true crb/2008/[Link]

Publicación en línea, enero 2018 76

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Maksimov IV, Abizgil’Dina RR and Pusenkova LI. 2011. Plant provide iron to iron-starved tomato plants in hydropo-
growth promoting rhizobacteria as alternative to chemical nics culture. Antonie Van Leeuwenhoek 104(3):321-330.
crop protectors from pathogens (review). Applied Bio- [Link]
chemistry and Microbiology 47:333-345. [Link] Ramírez-López CB, García-Sánchez E, Martínez-Muñoz RE,
org/10.1134/S0003683811040090 Del Río RE y Martínez-Pacheco MM. 2016. Chemical
Manual del grupo andino para la preservación de maderas. composition of the essential oil from Ageratina jocote-
1988. Ed. Proyecto subregional de promoción industrial pecana and its repellent effect on drywood termite Inci-
de la madera para construcción de la Junta del Acuerdo de sitermes marginipennis. Boletín Latinoamericano y del
Cartagena L. Caribe de Plantas Medicinales y Aromáticas. 15(1):53-
Martinez PMM, del Rio RE, Flores GA, Martínez MRE, Ron 60. Disponible en línea: [Link]
Echeverria OA and Raya GD. 2012. Enterolobium cyclo- oa?id=85643330005
carpum (Jacq.) Griseb: The biotechnological profile of Raya-González D, Martínez-Muñoz RE, Ron-Echeverría
a tropical tree. Boletín Latinoamericano y del Caribe de OA, Flores-García A, Macías-Rodríguez LI and Martí-
Plantas Medicinales y Aromáticas 11:385-399. Disponible nez-Pacheco MM. 2013. Dissuasive effect of an extract
en línea: [Link] aqueous from Enterolobium cyclocarpum (Jacq) Gri-
pdf seb on the drywood termite Incisitermes marginipennis
Matan N and Matan N. 2008. Antifungal activities of anise oil, (Isoptera:Kalotermitidae) (Latreille). EJFA 25:524-530.
lime oil, and tangerine oil against molds on rubberwood [Link]
(Hevea brasiliensis). International Biodeterioration and Saha M, Sarkar S, Sarkar B, Sharma B K, Bhattacharjee S and
Biodegradation 62:75-78. [Link] Tribedi P. 2016. Microbial siderophores and their potential
ibiod.2007.07.014 applications: a review. Environmental Science and Pollu-
Moglia JG, Amórtegui IC y Giménez AM. 2015. Ocurrencia tion Research 23(5):3984-3999. [Link]
de la mancha roja en el leño de Aspidosperma quebracho- s11356-015-4294-0
blanco. Revista de Ciencias Forestales 23:1-2. Disponible Schmidt O. 2007. Indoor wood-decay basidiomycetes: dama-
en línea: [Link] ge, causal fungi, physiology, identification and characte-
pdf rization, prevention and control. Mycological Progress
Naing KW, Anees M, Kim SJ, Nam Y, Kim YC and Kim KY. 6:261-279. [Link]
2014. Characterization of antifungal activity of Paenibaci- Schwarze FWMR. 2007. Wood decay under the microsco-
llus ehimensis KWN38 against soilborne phytopathogenic pe. Fungal Biology Reviews 21(4):133-170. [Link]
fungi belonging to various taxonomic groups. Annals of org/10.1016/[Link].2007.09.001
Microbiolog 64:55-63. [Link] Singh AP and Singh T. 2014. Biotechnological applica-
013-06. tions of wood-rotting fungi: A review. Biomass and
Nascimento MS, Santana ALBD, Maranhão CA, Oliveira LS Bioenergy 62:198-206. [Link]
and Bieber L. 2013. Phenolic extractives and natural re- bioe.2013.12.013
sistance of wood. Pp:349-370. In Biodegradation-Life of Singh AP, Kim YS and Singh T. 2016. Bacterial degradation of
Science. [Link] wood. Secondary Xylem Biology: Origins, Functions, and
NMX-C-222-1983. Norma Mexicana. “Industria de la Cons- Applications 9:169-190. [Link]
trucción-Vivienda de Madera Prevención de Ataque por 12-802185-9.00009-7
Termitas-Especificaciones”. Singh T and Singh AP. 2012. A review on natural products as
NMX-C-239-1985. Norma Mexicana para la “Calificación y wood protectant. Wood Science and Technology 46:851-
clasificación de la madera de pino para uso estructural”. 870. [Link]
Orozco-Mosqueda M, Valencia-Cantero E, López-Albarrán Sivasakthi S, Usharani G and Saranraj P. 2014. Biocontrol
P, Martínez-Pacheco M y Velázquez-Becerra C. 2015. La potentiality of plant growth promoting bacteria (PGPR)-
bacteria Arthrobacter agilis UMCV2 y diversas aminas Pseudomonas fluorescens and Bacillus subtilis: A review.
inhiben el crecimiento in vitro de hongos destructores de African Journal of Agricultural Research 9(16):1265-
madera. Revista Argentina de Microbiología 47:219-228. 1277. [Link]
[Link] Stirling R, Daniels CR, Clark JE and Morris PI. 2007. Methods
Patel N, Oudemans PV, Hillman BI and Kobayashi DY. 2013. for determining the role of extractives in the natural dura-
Use of the tetrazolium salt MTT to measure cell viability bility of western red cedar. International Research Group
effects of the bacterial antagonist Lysobacter enzymoge- on Wood Protection. Doc No. IRG-WP 07e20356.
nes on the filamentous fungus Cryphonectria parasitica. Stork NE, McBroom J, Gely C and Hamilton AJ. 2015. New
Antonie Van Leeuwenhoek 103(6):1271-1280.  [Link] approaches narrow global species estimates for beetles,
org/10.1007/s10482-013-9907-3 insects, and terrestrial arthropods. Proceedings of the Na-
Pedraza RO. 2015. Siderophores production by Azospirillum: tional Academy of Sciences 112(24):7519-7523. http://
biological importance, assessing methods and biocon- [Link]/10.1073/pnas.1502408112
trol activity. In Handbook for Azospirillum. Pp. 251-262. Subramanian J, Ramesh T and Kalaiselvam M. 2014. Fungal
Springer International Publishing. 514p. [Link] laccases-properties and applications: a review. Interna-
org/10.1007/978-3-319-06542-7_14 tional Journal of Pharmaceutical and Biological Archive
Radzki W, Mañero FG, Algar E, García JL, García-Villaraco 5(2):8-16. Disponible en línea: [Link]
A and Solano BR. 2013. Bacterial siderophores efficiently ba/[Link]/ijpba/article/viewFile/1237/881

Publicación en línea, enero 2018 77

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Sunar K, Dey P, Chakraborty U and Chakraborty B. 2013. Veronovski N, Verhovšek D and Godnjavec J. 2013. The in-
Biocontrol efficacy and plant growth promoting activity fluence of surface-treated nano-TiO2 (rutile) incorporation
of Bacillus altitudinis isolated from Darjeeling hills, India. in water-based acrylic coatings on wood protection. Wood
Journal of Basic Microbiology 55:91-104. [Link] science and technology 47(2):317-328. [Link]
org/10.1002/jobm.201300227 org/10.1007/s00226-012-0498-3
Tariq M, Noman M, Ahmed T, Hameed A, Manzoor N and Wan M, Li G, Zhang J, Jiang D and Huang HC. 2008. Effect of
Zafar M. 2017. Antagonistic features displayed by Plant volatile substances of Streptomycesplatensis F-1 on con-
Growth Promoting Rhizobacteria (PGPR): A Review. Jo- trol of plant fungal diseases. Biological Control 46:552-
urnal of Plant Science and Phytopathology 1:38-43. Dis- 559. [Link]
ponible en línea: [Link] Widmer TL. 2014. Screening Trichoderma species for biologi-
[Link] cal control activity against Phytophthora ramorum in soil.
Tascioglu C, Yalcin M, de Troya T y Sivrikaya H. 2012. Ter- Biological Control 79:43-48. [Link]
miticidal properties of some wood and bark extracts used control.2014.08.003
as wood preservatives. BioResources 7:2960-2969. Dispo- Yang VW and Clausen CA. 2007. Antifungal effect of es-
nible en línea: [Link] sential oils on southern yellow pine.  International Bio-
article/view/BioRes_07_3_2960_Tascioglu_YTS_Termi- deterioration and Biodegradation 59:302-306. [Link]
ticidal_Wood_Bark_Extracts org/10.1016/[Link].2006.09.004
Tascioglu C, Yalcin M, Sen S and Akcay C. 2013. Antifungal Zanni E. 2004. Patología de madera. Degradación y Rehabili-
properties of some plant extracts used as wood preserva- tación de Estructuras de Madera. Primera Edición. Edito-
tives. International Biodeterioration and Biodegradation rial Brujas. Córdoba, Argentina. 244p.
85:23-28. [Link] Zanni E. 2008. Patología de la construcción y restauro de obras
Tejera B, Heydrich M y Rojas MM. 2012. Antagonismo de de arquitectura. Primera Edición. Editorial Brujas. Córdo-
Bacillus spp. frente a hongos fitopatógenos del cultivo ba, Argentina. 300p.
del arroz (Oryza sativa L.). Revista de Protección Vegetal Zavattieri MA, Ragonezi C and Klimaszewska K. 2016. Ad-
27:117-122. Disponible en línea: [Link] ventitious rooting of conifers: influence of biological
php?script=sci_arttext&pid=S1010-27522012000200008 factors. Trees 30(4):1021-1032. [Link]
Ulyshen MD. 2015. Insect-mediated nitrogen dynamics in s00468-016-1412-7
decomposing wood. Ecological Entomology 40:97-112. Zhao LJ, Yang XN, Li XY, Wei MU and Feng LIU. 2011. An-
[Link] tifungal, insecticidal and herbicidal properties of volatile
Velázquez-Becerra C, Macías-Rodríguez LI, López-Bucio J, components from Paenibacillus polymyxa strain BMP-11.
Flores-Cortez I, Santoyo G, Hernández-Soberano C and Agricultural Sciences in China 10:728-736. [Link]
Valencia-Cantero E. 2013. The rhizobacterium Arthrobac- org/10.1016/S1671-2927(11)60056-4
ter agilis produces dimethylhexadecylamine, a compound Zou CS, Mo MH, Gu YQ, Zhou JP and Zhang KQ. 2007. Pos-
that inhibits growth of phytopathogenic fungi in vitro. sible contributions of volatile-producing bacteria to soil
Protoplasma 25:1251-1262. [Link] fungistasis. Soil Biology and Biochemistry 39:2371-2379.
s00709-013-0506-y [Link]

Publicación en línea, enero 2018 78

 Phosphites as alternative for the management
of phytopathological problems

Los fosfitos como alternativa para el manejo de problemas fitopatológicos

Moisés Gilberto Yáñez-Juárez, Carlos Alfonso López-Orona, Felipe Ayala-Tafoya*, Leopoldo Partida-
Ruvalcaba, Teresa de Jesús Velázquez-Alcaraz y Raymundo Medina-López, Facultad de Agronomía, Uni-
versidad Autónoma de Sinaloa. Carretera Culiacán-Eldorado Km 17.5, Aparatado Postal 25, CP. 80000, Culia-
cán, Sinaloa, México. *Autor para correspondencia: tafoya@[Link].

Recibido: 31 de Octubre, 2017. Aceptado: 22 de Diciembre, 2017.

Yáñez-Juárez MG, López-Orona CA, Ayala-Tafoya F, Abstract. Phosphites are compounds derived
Partida-Ruvalcaba L, Velázquez-Alcaraz TJ, Medina- from phosphorous acid used as an alternative for
López R. 2017. Phosphites as alternative for the mana-
gement of phytopathological problems. Revista Mexica- the control of phytoparasitic organisms and their
na de Fitopatología 36(1): 79-94. effectiveness has been tested against protozoa,
DOI: 10.18781/[Link].1710-7 oomycetes, fungi, bacteria and nematodes;
however, compared to conventional synthesized
Primera publicación DOI: 01 de Enero, 2018.
First DOI publication: January 01, 2018. fungicides, phosphites are generally less effective
at reducing damage by phytopathogens. The
phosphite ion is easily transported in the plants
Resumen. Los fosfitos son compuestos deriva- via xylem and phloem, so it has been used in
dos del ácido fosforoso empleados como alternati- foliar application, drench of plant root and neck,
va para el control de organismos fitoparásitos y su injection trunk, through drip irrigation mixed in the
eficacia se ha probado contra protozoarios, oomy- nutrient solution in hydroponics, seed treatment,
cetes, hongos, bacterias y nematodos; sin embargo, aerial application in low volume, or as treatment
en comparación con los fungicidas convencionales in immersion of seeds and fruits. The mechanisms
sintetizados, generalmente son menos eficaces para of action involved in the prophylactic effects of
disminuir el daño por fitopatógenos. El ion fosfito phosphites are diverse and include the stimulation
es fácilmente transportado en las plantas vía xilema of biochemical and structural defense mechanisms
y floema, por lo que se ha utilizado en aplicación in plants and direct action that restricts the growth,
foliar, baño a la raíz y cuello de la planta, inyección development and reproduction of phytopathogenic
al tronco, a través de riego por goteo mezclado en organisms.
la solución nutritiva en hidroponía, tratamiento a
semilla, aplicación aérea en bajo volumen o como Key words: potassium phosphite, biostimulant,
tratamiento en inmersión de semillas y frutos. Los control of phytopathogens.

Publicación en línea, enero 2018 79

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

mecanismos de acción involucrados en los efectos The irrational use of synthetic pesticides in
profilácticos de los fosfitos son diversos e incluyen agriculture increases problems of environmental
la estimulación de los mecanismos de defensa bio- pollution and public health, and decreases
química y estructural en las plantas, además de la biodiversity in the agroecosystems as well as
acción directa que restringe el crecimiento, desa- the development of resistant-phytopathogenic
rrollo y reproducción de los organismos fitopató- organisms. Furthermore, the current agricultural
genos. marketing requires products that are safe for
consumers and created using low environmental
Palabras clave: fosfito de potasio, bioestimulante, impact processes. Thus, disease control based on
control de fitopatógenos. the use of inorganic salts, which aside from being
effective in managing crop diseases have minimum
adverse consequences, becomes relevant. To this
El uso irracional en la agricultura de pesticidas regard, Deliopoulos et al. (2010) reported that 34
sintetizados, incrementa los problemas de contami- different salts have been used for such purpose, and
nación ambiental, salud pública, disminución de la suggested that phosphite salts stand out because of
biodiversidad en los agroecosistemas y desarrollo their use frequency and control effectiveness.
de organismos fitopatógenos con resistencia, ade- Phosphites are oxyanions derived from
más, la comercialización agrícola actual demanda phosphorous acid (H3PO3-) regularly combined
productos inocuos para los consumidores, prove- with non-metal cations, such as potassium, sodium,
nientes de procesos con bajo impacto ambiental. calcium or ammonia. The terms “phosphite” and
Así, adquiere relevancia el control de enfermeda- “phosphonate” are commonly used in the literature
des basado en el empleo de sales inorgánicas, que to refer to salts derived from phosphorous acid, the
además de ser eficaces para el manejo de enfer- same as “hydrogen phosphates”, “orthophosphites”,
medades en los cultivos muestren mínimas conse- “phosphonic acid compounds” and “phosphorous
cuencias adversas. Al respecto, Deliopoulos et al. acid compounds” (Deliopoulos et al., 2010).
(2010) reportan que se han utilizado 34 diferentes The chemical difference between phosphate
sales con esa finalidad, además indican que las sa- (H2PO4-) and phosphite (H2PO3-) is an oxygen atom
les de fosfito destacan por su frecuencia de utiliza- that is replaced by another of hydrogen (Figure
ción y eficacia en el control. 1). When oxygen is replaced, there is a profound
Los fosfitos son oxianiones derivados del ácido difference in the way phosphates and phosphites
fosforoso (H3PO3-), que regularmente se combinan behave in living organisms (McDonald et al.,
con cationes no metales como potasio, sodio, cal- 2001; Achary et al., 2017). Due to their structural
cio o amonio. Los términos “fosfito” y “fosfana- similarity, phosphites are thought to be akin to
to” son comúnmente utilizados en la literatura para phosphates. However, the use of phosphites as
referirse a las sales derivadas del ácido fosforoso, fungicides and biostimulants to control plant
al igual que “hidrogenofosfanatos”, “ortofosfitos”, pathogens is widely accepted, but their use as a
“compuestos del ácido fosfónico” o “compuestos phosphorus source in plant nutrition is currently
del ácido fosforoso” (Deliopoulos et al., 2010). debated (Borza et al., 2014; Gómez-Merino
La diferencia química entre fosfato (H2PO4-) y and Trejo-Téllez, 2015; Alexandersson et al.,
fosfito (H2PO3-) es un átomo de oxígeno el cual es 2016; Manna et al., 2016). Such difference gives

Publicación en línea, enero 2018 80

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

sustituido por otro de hidrógeno (Figura 1). La sus- phosphites a greater mobility in soil and plant
titución del oxígeno da lugar a profundas diferen- tissues, as well as a greater capacity to penetrate
cias en la manera en que los fosfatos y fosfitos se through leaves, stems and roots (Tkaczyk et al.,
comportan en los organismos vivos (McDonald et 2016).
al., 2001; Achary et al., 2017). Debido a su simili- The use of phosphites in agriculture has been
tud estructural, los fosfitos son considerados como studied mainly because of their action to control
análogos de los fosfatos, sin embargo, el uso de los phytoparasite organisms or as a nutrition source for
fosfitos como fungicidas y bioestimulantes para el cultivated plants (Gómez-Merino and Trejo-Téllez,
control de patógenos de plantas es ampliamente 2015; Alexandersson et al., 2016). The latter may
aceptado, pero su utilización como fuente de fós- occur only if phosphites are applied to soil and come
foro en la nutrición de plantas es actualmente de- into contact with bacteria that have the capacity
batida (Borza et al., 2014; Gómez-Merino y Trejo- to oxidize them to phosphates (McDonald et al.,
Téllez, 2015; Alexandersson et al., 2016; Manna et 2001; Manna et al., 2016). However, since this is a
al., 2016). Además, esa diferencia da a los fosfitos very slow process that can take up to four months,
una mayor movilidad en el suelo y en los tejidos it becomes impractical in agriculture (McDonald et
de las plantas, así como una mayor capacidad para al., 2001; Lovatt and Mikkelsen, 2006).
penetrar a través de hojas, tallos y raíces (Tkaczyk In early 1930, researchers concluded that
et al., 2016). phosphites were not an efficient nutrition source
El uso de los fosfitos en la agricultura, se ha in- for plants. However, 40 years later, phosphites
vestigado principalmente por su acción en el con- returned to the agrochemicals market as an
trol de organismos fitoparásitos o como fuente de alternative for controlling plant diseases, when the
nutrición en plantas cultivadas (Gómez-Merino y French company Rhône-Poulenc offered the active
Trejo-Téllez, 2015; Alexandersson et al., 2016). ingredient fosetyl-aluminum to control mildews and
Esto último puede ocurrir únicamente si los fosfitos diseases caused the Phytophthora genus (Tkaczyk
se aplican al suelo y entran en contacto con bacte- et al., 2016; Achary et al., 2017). Phosphites, as an
rias que tienen la capacidad de oxidarlos a fosfatos alternative for controlling phytoparasite organisms,
(McDonald et al., 2001; Manna et al., 2016). No have been extensively studied and proven to be
obstante, este proceso es muy lento, y puede tomar effective against protozoa, oomycetes, fungi,
hasta cuatro meses para completarse, lo que resul- bacteria and phytoparasite nematodes (Table 1), as
ta impráctico para la agricultura (McDonald et al., well as biostimulators (Gómez-Merino and Trejo-
2001; Lovatt y Mikkelsen, 2006). Téllez, 2015) that reduce damages caused by weeds
(Manna et al., 2016; Achary et al., 2017) and UV-B
O O radiation (Oyarburo et al., 2015).

P P
APPLICATION METHODS
HO O- H O-
OH OH
The phosphite ion is easily transported in plants
A: (H2PO4-) B: (H2PO3-)
via xylem and phloem (McDonald et al., 2001;
Figura 1. Estructura del grupo fosfato (A) y fosfito (B). Tkaczyk et al., 2016), so it has been used in foliar
Figure 1. Structure of the phosphate (A) and phosphite (B) applications (Rebollar-Alviter et al., 2010; Silva et
group.

Publicación en línea, enero 2018 81

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Fue a principios de 1930 cuando se concluyó al., 2011; Pagani et al., 2014; Yáñez et al., 2014;
que los fosfitos no eran fuente eficiente de fosforo Liljeroth et al., 2016; Borza et al., 2017), drench of
para la nutrición de las plantas y 40 años después, plants root and neck (Oka et al., 2007; Akinsanmi
regresó al mercado de los agroquímicos como al- and Dreth, 2013), trunk injection (Bock et al.,
ternativa para el manejo de enfermedades, cuando 2012; Akinsanmi and Drenth, 2013: Aćimović
la compañía Francesa Rhône-Poulenc ofreció el et al., 2015; Aćimović et al., 2016) through
ingrediente activo fosetil-aluminio para el control drip irrigation mixed in a nutrient solution in
de mildius y enfermedades causadas por el género hydroponics (Förster et al., 1998), seed treatments
Phytophthora (Tkaczyk et al., 2016; Achary et al., (Abbasi and Lazarovits 2006; Lobato et al., 2008),
2017). Los fosfitos, como alternativa para el con- low-volume aerial applications (Hardy et al., 2001)
trol de organismos fitoparásitos, han sido estudia- or as a treatment in seed and fruits immersion
dos ampliamente y su eficacia se ha probado contra (Anderson et al., 2012; Cerioni et al., 2013, Borin
protozoarios, oomycetes, hongos, bacterias y ne- et al., 2017).
matodos fitoparásitos (Cuadro 1); adicionalmente,
se ha comprobado su eficacia como bioestimulador EFFECTIVENESS
(Gómez-Merino y Trejo-Téllez, 2015), para dis-
minuir los daños por malezas (Manna et al., 2016; The levels of effectiveness of phosphites to
Achary et al., 2017) y radiación UV-B (Oyarburo control phytoparasite organisms vary depending
et al., 2015). on the ion bonded to phosphite, application
method, pathogen organism and host plant (Table
MÉTODOS DE APLICACIÓN 2; Figure 2). For example, mandarin orange fruits
immersed in solutions containing calcium and
El ion fosfito es fácilmente transportado en potassium phosphites contributed to reduce 50%
las plantas vía xilema y floema (McDonald et al., of fruits infected with citrus green mold caused by
2001; Tkaczyk et al., 2016), por lo que se ha uti- Penicillium digitatum (Cerioni et al., 2013); also,
lizado en aplicación foliar (Rebollar-Alviter et soja plants treated with potassium phosphite showed
al., 2010; Silva et al., 2011; Pagani et al., 2014; up to 50% less damage by Peronospora manshurica
Yáñez et al., 2014; Liljeroth et al., 2016; Borza than non-treated plants (Silva et al., 2011). Abbasi
et al., 2017), baño a la raíz y cuello de la planta and Lazarovits (2006) reported 80% less cucumber
(Oka et al., 2007; Akinsanmi y Dreth, 2013), in- plants infected by Pythium spp. when seeds were
yección al tronco (Bock et al., 2012; Akinsanmi y treated by immersion in solutions containing
Drenth, 2013: Aćimović et al., 2015; Aćimović et copper phosphite. Ogoshi et al. (2013) obtained a
al., 2016), a través de riego por goteo mezclado en 62.5% decrease in the severity of Colletotrichum
la solución nutritiva en hidroponía (Förster et al., gloeosporioides in coffee plants treated with
1998), tratamiento a semilla (Abbasi y Lazarovits potassium phosphite. In another experiment, 93%
2006; Lobato et al., 2008), aplicación aérea en bajo of papaya plants treated with potassium phosphite
volumen (Hardy et al., 2001) o como tratamiento survived the attack of Phytophthora palmivora, but
en inmersión de semillas y frutos (Anderson et al., only 24% of non-treated plants survived (Vawdrey
2012; Cerioni et al., 2013, Borin et al., 2017). and Westerhuis, 2007).

Publicación en línea, enero 2018 82

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cuadro 1. Organismos fitoparásitos controlados con fosfitos.

Table 1. Control of phytoparasite organisms using phosphites.

Organismo fitoparásito Planta hospedante Fosfito Referencia

Protozoarios
Plasmodiophora brassicae Brassica rapa Potasio Kammerich et al., 2014
Oomycetes
Peronospora destructor Allium cepa Potasio Monsalve et al., 2012
P. manshurica Glicine max Potasio Silva et al., 2011
P. parasitica Brassica oleracea Potasio Becót et al., 2000
Phytophthora cinnamomi Macadamia spp. Potasio Akinsanmi y Dreth, 2013
P. cinnamomi Ananas comosus Potasio Anderson et al., 2012
Phytophthora infestans Solanum tuberosum Aluminio Kromann et al., 2012
P. infestans S. tuberosum Calcio Lobato et al., 2008
P. infestans S. tuberosum Potasio Borza et al., 2017
P. infestans S. tuberosum Potasio Kromann et al., 2012
P. infestans S. tuberosum Potasio Liljeroth et al., 2016
P. nicotianae Nicotiana tabacum Potasio Smillie et al., 1989
P. palmivora Carica papaya Potasio Smillie et al., 1989
Plasmopara viticola Vitis vinifera Potasio Pinto et al., 2012
Pseudoperonospora cubensis Cucumis melo Potasio Méndez et al., 2010
Pythium aphanidermatum C. sativus Cobre Abbasi y Lazarovits, 2006
P. irregulare C. sativus Cobre Abbasi y Lazarovits, 2006
P. ultimum C. sativus Cobre Abbasi y Lazarovits, 2006
P. ultimum C. sativus Potasio Mofidnakhaei et al., 2016
Hongos
Alternaria alternata Malus domestica Potasio Reuveni et al., 2003
Cercospora coffeicola Coffea arabica Potasio Costa et al., 2014
Cochliobolus miyabeanus Oryza sativa Potasio Nascimento et al., 2016
Colletotrichum gloeosporioides C. arabica Potasio Ogoshi et al., 2013
C. gloeosporioides Fragaria vesca Potasio MacKenzie et al., 2009
C. gloeosporioides Malus domestica Potasio Araujo et al., 2010
Fusarium solani Solanum tuberosum Calcio Lobato et al., 2008
F. solani S. tuberosum Potasio Lobato et al., 2008
Fusicladium effusum Carya illinoinensis Potasio Bock et al., 2012
Hemileia vastatrix Coffea arabica Potasio Costa et al., 2014
Oidium sp. Cucumis sativus Potasio Yáñez et al., 2012
Oidium sp. C. sativus Potasio Yáñez et al., 2014
Penicillium digitatum Citrus limon Potasio Cerioni et al., 2013
P. italicum C. limon Potasio Cerioni et al., 2013
P. expansum Malus domestica Potasio Amiri y Bompeix, 2011
P. expansum Malus domestica Potasio Lai et al., 2017
Rhizoctonia solani Solanum tuberosum Calcio Lobato et al., 2008
R. solani S. tuberosum Potasio Lobato et al., 2008
Venturia inaequalis S. tuberosum Potasio Percival et al., 2009
V. pirina Pyrus communis Potasio Percival et al., 2009
Bacterias
Erwinia carotovora Solanum tuberosum Potasio Lobato et al., 2011
E. amylovora Pyrus malus Potasio Aćimović et al., 2015
Pseudomonas syringae pv. actinidiae Actinidia deliciosa Aluminio Monchiero et al., 2015
Nematodos
Helicotylenchus spp. Musa paradisiaca Potasio Quintero-Vargas y Castaño-Zapata, 2012
Heterodera avenae Avena sativa Potasio Oka et al., 2007
Meloidogyne marylandi Triticum aestivum Potasio Oka et al., 2007
Meloidogyne spp. M. paradisiaca Potasio Quintero-Vargas y Castaño-Zapata, 2012
Pratylenchus bracyurus Glycine max Potasio Dias-Areira et al., 2012
Pratylenchus bracyurus Zea mays Potasio Dias-Areira et al., 2012
P. bracyurus Zea mays Manganeso Puerari et al., 20015
Radopholus similis M. paradisiaca Potasio Quintero-Vargas y Castaño-Zapata, 2012

Publicación en línea, enero 2018 83

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

EFICACIA Cuadro 2. Sensibilidad a fosfitos de patógenos en papa (To-

mado de Lobato et al., 2010).
Table 2. Pathogen sensitivity to phosphites in potato (Tak-
Los niveles de eficacia de los fosfitos en el con- en from Lobato et al., 2010).
trol de organismos fitoparásitos varían dependien- Fosfito de Fosfito de Fosfito de
do de: ión unido al fosfito, método de aplicación, calcio potasio cobre
organismo patógeno y planta hospedante (Cuadro
Patógeno mg mL-1
2; Figura 2); por ejemplo, la inmersión de frutos
Phytophthora infestans 0.09x
0.15 <0.04
de mandarina en soluciones elaboradas con fosfi- Rhizoctonia solani 1.87 >3.56 1.04
to de calcio y potasio, sirvió para disminuir 50% Fusarium solani 1.29 >3.56 0.68
de frutos dañados por moho verde de los cítricos, Streptomyces scabies 0.83 1.99 0.22

originado por Penicillium digitatum (Cerioni et al., x

Concentración del compuesto para inhibir el 50% de su cre-
cimiento / xCompound concentration to inhibit 50% growth.
2013); también, plantas de soya tratadas con fos-
fito de potasio mostraron hasta 50% menos daño
por Peronospora manshurica en comparación con Compared with conventional synthetic
las plantas sin tratar (Silva et al., 2011). Abbasi fungicides, phosphites are usually less effective to
y Lazarovits (2006) reportan 80% menos plantas reduce damages caused by phytopathogens. Méndez
de pepino infectadas por Pythium spp. cuando las et al. (2010) were able to reduce the damage caused
semillas fueron tratadas por inmersión en solucio- by Pseudoperonospora cubensis in melon plants
nes con fosfito de cobre. Ogoshi et al. (2013) ob- treated with chlorothalonil and mancozeb, but not
tuvieron disminución de 62.5% en la severidad de in those that were treated with potassium phosphite
Colletotrichum gloeosporioides en plantas de café (Figure 3). Aćimović et al. (2016) were also able
tratadas con fosfito de potasio. También, 93% de to significantly reduce the incidence of Erwinia

Figura 2. Incidencia y severidad de Pseudoperonospora cubensis (A y A´) y Sphaerotheca fuliginea (B y B´) en plantas de
pepino cultivadas en invernadero.
Figure 2. Incidence and severity of Pseudoperonospora cubensis (A and A´) and Sphaerotheca fuliginea (B and B´) in cucum-
ber plants cultivated in the greenhouse.

Publicación en línea, enero 2018 84

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

las plantas de papaya tratadas con fosfito de potasio amylovora using streptomycin sulfate, compared
sobrevivieron al ataque de Phytophthora palmivo- with the incidence of the pathogen when they used
ra, en contraste con el 24% de sobrevivencia de las potassium phosphite (Figure 4); the compounds
plantas sin tratar (Vawdrey y Westerhuis, 2007). were injected into apple tree trunks. Meyer and
En comparación con los fungicidas convencio- Hausbeck (2013) reported a significant decrease
nales sintetizados, los fosfitos generalmente son in the incidence of death squash plants infected by
menos eficaces para disminuir el daño por los pa- Phytophthora capsici when they were treated with
tógenos que atacan plantas, al respecto Méndez et fluopicolide, mandipropamid or dimethomorph
al. (2010) consiguieron que plantas de melón trata- fungicides, compared with the incidence of plants
das con clorotalonil y mancozeb, mostraran menor treated with potassium phosphite. In general, the
daño por Pseudoperonospora cubensis que aqué- reports on the effectiveness of phosphites and
llas que recibieron tratamiento con fosfito de pota- conventional fungicides in controlling phytoparasite
sio (Figura 3). También, Aćimović et al. (2016) lo- organisms suggest that phosphites are less effective
graron incidencia de Erwinia amylovora significa- and could not replace fungicides at all, but that
tivamente inferior con sulfato de estreptomicina, en if they are included as part of an integrated pest
comparación con la incidencia obtenida con fosfito management program they could help reduce the
de potasio, cuando esos compuestos se inyectaron use of fungicides as well as the probability that
al tallo de árboles de manzana (Figura 4). Meyer y the organisms develop resistance (Liljeroth et
Hausbeck (2013) reportaron disminución significa- al., 2016). Méndez et al. (2010) reported similar
tiva en la incidencia de plantas de calabaza muertas effectiveness against Pseudoperonospora cubensis
in squash plants by alternately using chlorothalonil/
600
534.9 b
500 100
90
400 80
68.5
ABCPE

306.3 a 70
300
Incidencia (%)

215.7 a 60 52.5
200 50 47.3
43.5
40
100 30
20
0
Clorotalonil/ Fosfito de Clorotalonil/ 10
Mancozeb potasio Mancozeb + 0
Fosfito de Agua Fosfito de Acibenzolar Sulfato de
potasio potasio S metil estreptomicina

Figura 3. Promedio del área bajo la curva del progreso de Figura 4. Control de Erwinia amylovora después de dos
la enfermedad (ABCPE) obtenido con el trata- aplicaciones de inductor de resistencia o antibió-
miento para el combate de Pseudoperonospora tico, al tronco de árboles de manzana (Elabora-
cubensis en plantas de pepino (Elaboración de ción de los autores con datos de Aćimović et al.,
los autores con datos de Méndez et al., 2010). 2016).
Figure 3. Average area under the progress curve (ABCPE) Figure 4. Control of Erwinia amylovora after two appli-
from a treatment against Pseudoperonospora cations of a resistance inducer or antibiotics to
cubensis in cucumber plants (Developed by the trunks of apple trees (Developed by the authors
authors with data from Méndez et al., 2010). with data from Aćimović et al., 2016).

Publicación en línea, enero 2018 85

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

por Phytophthora capsici, cuando fueron tratadas mancozeb and potassium phosphite compared
con los fungicidas fluopicolide, mandipropamid o with the effectiveness when using only fungicides
dimethomorph, en comparación con la incidencia (Figure 3). Liljeroth et al. (2016) also reported that
registrada en las plantas tratadas con fosfito de po- the protection against Phytophthora infestans in
tasio. En general, los reportes comparativos de la potato was similar using fluazinam, cyazofamid,
eficacia en el control entre los fosfitos y los fun- mandipropamid, metalaxyl + fluazinam or
gicidas convencionales, indican que los primeros fluopicolide + propamocarb at 100% of the
son menos eficaces y que no los podrían sustituir recommended dose, or at 50% of the dose mixed
por completo, pero su integración como parte de un with potassium phosphite.
programa de manejo integrado puede permitir dis-
minuir el uso de fungicidas y reducir la posibilidad ACTION MODE
de generar resistencia por los organismos (Liljeroth
et al., 2016). Al respecto, Méndez et al. (2010) de- The action mechanisms involved in the
terminaron eficacia similar en el combate de Pseu- prophylactic effects of phosphites include direct
doperonospora cubensis en plantas de calabaza con and indirect action. It has been stated that when the
clorotalonil/mancozeb y fosfito de potasio aplica- phosphite ion come into contact with phytopathogen
dos de manera alternada, comparada con la eficacia organisms, it affects their growth and reproduction,
registrada cuando se utilizó únicamente los fungi- because it influences the expression of genes that
cidas (Figura 3). También, Liljeroth et al. (2016) encode the synthesis of essential compounds in
reportaron que la protección contra Phytophthora their cell structure and physiology (direct action).
infestans en papa, fue semejante cuando los fun- When the phosphite ion enters the plant tissue
gicidas fluazinam, cyazofamida, mandipropamida, cells (indirect action) activates biochemical
metalaxyl + fluazinam o fluopicolide + propamo- (production of: polysaccharides, proteins related
carb, se usaron al 100% de la dosis recomendada o to pathogenesis, phytoalexins, etc.) and structural
al 50% de la dosis en mezcla con fosfito de potasio. defense (such as callose deposition) mechanisms
that restrict pathogens penetration and survival in
MODO DE ACCIÓN the plant (Figure 5).

Los mecanismos de acción involucrados en los Direct action

efectos profilácticos de los fosfitos incluyen acción
directa e indirecta. Se ha determinado que el ion The addition of phosphites to the medium
fosfito al entrar en contacto con los organismos culture reduced mycelium growth, as well as the
fitopatógenos, afecta su crecimiento y reproduc- number of spore-generating structures and of
ción al influir en la expresión de genes que codi- produced and germinated spores (Figure 6). Thus,
fican la síntesis de compuestos indispensables en with this practice, we observed a growth decrease
la estructura y fisiología celular (acción directa). of Alternaria alternata (Reuveni et al., 2003),
Además, al entrar a las células del tejido vegetal Colletotrichum gloeosporioides (Araujo et al.,
(acción indirecta) activa los mecanismos bioquí- 2010), Fusarium culmorum and F. graminearum
micos (producción de: polisacáridos, proteínas re- (Hofgaard et al., 2010), Mycosphaerella fijiensis
lacionadas con la patogénesis, fitoalexinas, etc.) y (Mogollón and Castaño, 2012), Penicillium

Publicación en línea, enero 2018 86

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

estructurales de defensa (como la deposición de ca- digitatum (Cerioni et al., 2013), Phytophthora
losa) que restringen la penetración y supervivencia cinnamomi (Wilkinson et al., 2001; Won et
de los patógenos en la planta (Figura 5). al., 2009; King et al., 2010), P. cinnamomi, P.
palmivora and P. nicotianae (Smillie et al., 1989),
Acción directa P. infestans (Bórza et al., 2014), P. plurivora (Dalio
et al., 2014) and Pythium aphanidermatum, P.
Los fosfitos adicionados al medio de cultivo ultimum, P. irregulare, P. myriotylum, P. torulosum,
para organismos fitopatógenos, originaron que dis- P. volutum and P. graminicola (Cook et al., 2009).
minuyera el crecimiento del micelio, el número de The decrease level in the microorganisms’ growth
estructuras generadoras de esporas, la cantidad de as a consequence of the phosphite ion is determined
esporas producidas y su germinación (Figura 6). by the organism tested, amount of phosphite added
Así, mediante esa práctica se reportó disminución to the culture medium, type of ion bonded to
en el crecimiento de Alternaria alternata (Reuve- phosphite and pH produced by the culture medium
ni et al., 2003), Colletotrichum gloeosporioides (Lobato et al., 2010).
(Araujo et al., 2010), Fusarium culmorum y F. gra- The susceptibility of the microorganisms to
minearum (Hofgaard et al., 2010), Mycosphaerella the phosphite ion was demonstrated by Wong et

Figura 5. Modo de acción de los fosfitos, representación esquemática (Elaboración de los autores con datos de: Daniel y
Guest, 2006; Jackson et al., 2000; King et al., 2010; Eshraghi et al., 2011; Olivieri et al., 2012; Cerioni et al., 2013;
Dalio et al., 2014).
Figure 5. Action mode of phosphites, schematic representation (developed by the authors using data from Daniel and
Guest, 2006; Jackson et al., 2000; King et al., 2010; Eshraghi et al., 2011; Olivieri et al., 2012; Cerioni et al., 2013;
Dalio et al., 2014).

Publicación en línea, enero 2018 87

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

A A’

B B’

Figura 6. Crecimiento de Pythium aphanidermatum en medio de cultivo Papa-Dextrosa-Agar (izquierda) y agua destilada
(derecha). A y A´ sin fosfito de potasio; B y B´ con fosfito de potasio.
Figure 6. Pythium aphanidermatum in Potato Dextrose Agar (PDA) culture medium (left) and distilled water (right). A and
A´ without potassium phosphite; B and B´ with potassium phosphite.

fijiensis (Mogollón y Castaño, 2012), Penicillium al. (2009), who determined the negative effect of
digitatum (Cerioni et al., 2013), Phytophthora cin- phosphite and the positive effect of phosphate on
namomi (Wilkinson et al., 2001; Won et al., 2009; Phythopthora cinnamomic growth, when grown in
King et al., 2010), P. cinnamomi, P. palmivora y P. a culture medium enriched with salts containing
nicotianae (Smillie et al., 1989), P. infestans (Bór- each ion individually.
za et al., 2014), P. plurivora (Dalio et al., 2014) As for interspecific susceptibility, Hofgaard et
y Pythium aphanidermatum, P. ultimum, P. irregu- al. (2010) were able to reduce Fusarium culmorum,
lare, P. myriotylum, P. torulosum, P. volutum y P. F. graminearum and Microdochium majus
graminicola (Cook et al., 2009). El grado de dis- mycelium growth by 60, 80 and 90%, respectively,
minución en el crecimiento de los microorganis- using 10 μl ml-1 of potassium phosphite. To inhibit
mos como consecuencia del ion fosfito, está deter- Phytophthora infestans in vitro growth, Lobato et
minado por el organismo ensayado, la cantidad de al. (2010) used a lower dose, followed by the dose
fosfito agregado al medio de cultivo, el tipo de ion used to inhibit Streptomyces scabies, Rhizoctonia
unido al fosfito y el pH que se origine en el medio solani and Fusarium solani growth.
de cultivo (Lobato et al., 2010). The intraspecific susceptibility was studied by
La susceptibilidad de los microorganismos al Wilkinson et al. (2001), who determined that from
ion fosfito fue comprobada por Wong et al. (2009), 21 Phytophthora cinnamomi isolates collected

Publicación en línea, enero 2018 88

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

quienes determinaron el efecto negativo de fosfi- in western Australia, 9% were susceptible, 82%
to y el positivo de fosfato sobre el crecimiento de intermediate susceptible and 9% tolerant. Smillie
Phythopthora cinnamomi, cuando creció en me- et al. (1989) showed Phytophthora cinnamomi,
dio de cultivo enriquecido con sales que contenían P. palmivora and P. nicotiana susceptibility to
cada ion de manera individual. potassium phosphite, and explained that as the
En relación a la susceptibilidad interespecífica, concentration of phosphite increased in the culture
Hofgaard et al. (2010) obtuvieron disminuciones medium, the weight of the biomass produced
de 60, 80 y 90% en el crecimiento del micelio de by Phytophthora species decreased. Cook et
Fusarium culmorum, F. graminearum y Microdo- al. (2009) also evaluated the concentration of
chium majus, respectivamente, con 10 μl ml-1 de phosphite and mefenoxan fungicide needed to
fosfito de potasio. Lobato et al. (2010) determina- inhibit 50% mycelium growth of eight Pythium
ron que para inhibir el crecimiento in vitro, la dosis aphanidermatum isolates, and reported that all the
menor se empleó para Phytophthora infestans, se- isolates were susceptible to both compounds, but
guida de la usada para inhibir a Streptomyces sca- that the concentrations of phosphite were higher
bies, Rhizoctonia solani y Fusarium solani. than those of the fungicide.
La susceptibilidad intraespecífica fue estudiada On the other hand, the phosphate ion reduced
por Wilkinson et al. (2001), quienes determinaron pH in the culture medium at acidity levels that
que de 21 aislamientos de Phytophthora cinnamomi were associated with Phytophthora infestans,
colectados en el oeste de Australia, 9% resultaron Rhizoctonia solani, Fusarium solani and
susceptibles a fosfito de potasio, 82% mostraron Streptomyces scabies low growth (Lobato et al.,
susceptibilidad intermedia y 9% fueron tolerantes. 2010). Araujo et al. (2010) reported a larger decrease
Smillie et al. (1989) determinaron la susceptibili- in the diameter of Colletotrichum gloeosporioides
dad de Phytophthora cinnamomi, P. palmivora y colonies as well as in the growth speed index using
P. nicotiana a fosfito de potasio, explicando ade- formulations containing potassium phosphite,
más que a medida que la concentración de fosfito which reduced pH in the medium culture.
se incrementó en el medio de cultivo, disminuyó Also, potassium phosphite affected Alternaria
el peso de la biomasa producida por las tres espe- alternata (Reuveni et al., 2003), Colletotrichum
cies de Phytophthora. También Cook et al. (2009) gloeosporioides (Ogoshi et al., 2013), Penicillium
evaluaron la concentración necesaria de fosfito y digitatum (Cerioni et al., 2013), P. expansum (Amiri
el fungicida mefenoxan, para inhibir el 50% del and Bompeix, 2011) and Peronospora parasitica
crecimiento del micelio de ocho aislamientos de (Becót et al., 2000) spore germination, as well as
Pythium aphanidermatum, y reportaron que todos Fusarium oxysporum f sp. cubense (Davis and
los aislamientos fueron susceptibles a los dos com- Grant, 1996), Mycosphaerella fijiensis (Mogollón
puestos, pero que las concentraciones de fosfito uti- y Castaño, 2012), Peronospora sparsa (Hukkanen
lizadas fueron mayores que las del fungicida. et al., 2008), Phytophthora plurivora (Dalio et al.,
Por otro lado, el ion fosfito disminuyó el pH en 2014) and P. cinnamomi (Wong et al., 2009) spore
el medio de cultivo a niveles de acidez que se rela- production.
cionaron con menor crecimiento de Phytophthora The effect of phosphites added to a medium
infestans, Rhizoctonia solani, Fusarium solani y culture was explained by King et al. (2010), who
Streptomyces scabies (Lobato et al., 2010). Araujo et reported changes induced by potassium phosphite

Publicación en línea, enero 2018 89

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

al. (2010) reportaron mayor diminución del diáme- in the expression of the genes that encode protein
tro de las colonias y el índice de velocidad de cre- synthesis and builds Phytophthora cinnamomi cells
cimiento de Colletotrichum gloeosporioides, con and cytoskeleton, which caused hyphae distortion
formulaciones de fosfito de potasio que originaron and cell wall lysis.
mayor disminución del pH en el medio de cultivo.
Además, fosfito de potasio afectó la germinación Indirect action
de esporas de Alternaria alternata (Reuveni et al.,
2003), Colletotrichum gloeosporioides (Ogoshi et The indirect action of the phosphite ion includes
al., 2013), Penicillium digitatum (Cerioni et al., stimulation of structural and biochemical defense
2013), P. expansum (Amiri y Bompeix, 2011) y Pe- mechanisms in plants. Pilbeam et al. (2011)
ronospora parasitica (Becót et al., 2000); así como described lignin and suberine deposition around
la producción de esporas de Fusarium oxysporum f tissue damaged by Phytophthora cinnamomi in
sp. cubense (Davis y Grant, 1996), Mycosphaerella eucalyptus plants treated with potassium phosphite,
fijiensis (Mogollón y Castaño, 2012), Peronospora which limited the pathogen’s development. Olivieri
sparsa (Hukkanen et al., 2008), Phytophthora plu- et al. (2012) reported an increased pectin content
rivora (Dalio et al., 2014) y P. cinnamomi (Wong in periderm and cortex tissue and tubers from
et al., 2009). potato plants treated with potassium phosphite,
El efecto de los fosfitos agregados al medio de a feature that improves resistance to different
cultivo fue explicado por King et al. (2010), quie- pathogens. Jackson et al. (2000) reported that the
nes reportaron modificación inducida por fosfito de development of lesions caused by P. cinnamomi
potasio en la expresión de genes que codifican la was highly restricted when they applied a
síntesis de proteínas que constituyen la pared y el high concentration of phosphite in Eucalyptus
citoesqueleto de las células de Phytophthora cinna- marginata tissue, and that the reduced number of
momi, lo que originó distorsión de hifas y lisis de lesions was associated with a significant increase of
pared celular. defense enzymes (4-coumarate coenzyme A ligase
(4CL) and cinnamyl-alcohol dehydrogenase)
Acción indirecta and soluble phenols. Daniel and Guest (2006)
demonstrated that when Arabidopsis thaliana
La acción indirecta del ión fosfito incluye la es- plantlets were treated with potassium phosphite
timulación de los mecanismos de defensa estructu- and inoculated with Phytophthora palmivora
ral y bioquímica en las plantas; así, Pilbeam et al. zoospores, the infected cells showed increased
(2011) describieron deposición de lignina y sube- cytoplasmic activity, development of cytoplasmic
rina alrededor del tejido dañado por Phytophtho- aggregates, release of hydrogen peroxide, located
ra cinnamomi en plantas de eucalipto tratadas con cell death, and enhanced phenolic compounds
fosfito de potasio, efecto que limitó el desarrollo accumulation. Eshraghi et al. (2011) also reported
del patógeno. También Olivieri et al. (2012) re- that when Arabidopsis thaliana plantlets were
firieron aumento en el contenido de pectina en el treated with potassium phosphite and inoculated
tejido de la peridermis y la corteza, en tubérculos with Phytophthora cinnamomi, the infected cells
procedentes de plantas de papa tratadas con fosfito increased their production of calose and hydrogen
de potasio, condición que mejora la resistencia a peroxide.

Publicación en línea, enero 2018 90

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

diversos patógenos. Jackson et al. (2000) reporta- CONCLUSIONS

ron que el desarrollo de lesiones por P. cinnamomi
fue altamente restringido, cuando la concentración Phosphites are effective compounds to
de fosfito en el tejido de Eucalyptus marginata fue control protozoa, oomycetes, fungi, bacteria and
alta y la disminución en el desarrollo de lesiones phytoparasite nematodes, but compared with
se asoció con un aumento significativo de las en- synthetic conventional fungicides, they tend to be
zimas de defensa (4-coumarato coenzima A ligasa less effective. The effectiveness level of phosphites
y deshidrogenasa de alcohol cinnamyl) y de feno- to solve phytopathological problems is associated
les solubles. Daniel y Guest (2006) demostraron with the problem organism, the host plant and the
que en plántulas de Arabidopsis thaliana, tratadas ion bonded to phosphite. Because of its efficient
con fosfito de potasio e inoculadas con zoosporas translocation in plant tissue, they can be applied
de Phytophthora palmivora, las células infectadas to canopy, stems, roots or fruits. The action
aumentaron la actividad citoplasmática, el desarro- mechanisms involved in the prophylactic effects of
llo de agregados citoplasmáticos, la liberación de phosphites are diverse and include the stimulation
peróxido de hidrógeno, muerte celular localizada of biochemical and structural defense mechanisms
y mejoraron la acumulación de compuestos fenóli- in plants, besides the direct action that limits
cos. Eshraghi et al. (2011) también reportaron que phytoparasite organisms’ growth, development
en plántulas de Arabidopsis thaliana, tratadas con and reproduction. Integrating phosphites as part
fosfito de potasio e inoculadas con Phytophthora of a phytopathological problems management
cinnamomi, la producción de calosa y de peróxido program allows to reduce the number of fungicide
de hidrógeno se incrementó en las células infectadas. applications as well as the probability that the
organisms develop resistance.

CONCLUSIONES End of the English version

Los fosfitos son compuestos eficaces para el

control de protozoarios, oomycetes, hongos, bac-
terias y nematodos fitoparásitos, sin embargo, en
comparación con los fungicidas convencionales desarrollo y reproducción de los organismos fitopa-
sintetizados suelen ser menos eficaces. Los niveles rásitos. La integración de los fosfitos como parte de
de eficacia de los fosfitos para resolver problemas un programa de manejo de problemas fitopatoló-
fitopatológicos están en relación con: organismo gicos permite disminuir el número de aplicaciones
problema, planta hospedante e ion unido al fosfito. de fungicidas y reducir la posibilidad de generar
Por su eficiente translocación en tejido vegetal, se resistencia por los organismos fitoparásitos.
pueden suministrar al follaje, tallos, raíces o fru-
tos. Los mecanismos de acción involucrados en los
efectos profilácticos de los fosfitos son diversos e LITERATURA CITADA
incluyen la estimulación de los mecanismos de de- Abbasi PA and Lazarovits G. 2006. Seed treatment with phos-
phonate (AG3) suppresses Pythium damping-off of cu-
fensa bioquímica y estructural en las plantas, ade- cumber seedlings. Plant Disease 90:459-464. [Link]
más de la acción directa que restringe el crecimiento, org/10.1094/PD-90-0459

Publicación en línea, enero 2018 91

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Achary VMM, Ram B, Manna M, Datta D, Bhatt A, Reddy M Borza T, Schofield A, Sakthivel G, Bergese J, Gao X, Rand J
and Agrawal PR. 2017. Phosphite: a novel P fertilizer for and Wang-Pruski G. 2014. Ion chromatography analysis of
weed management and pathogen control. Plant Biotechno- phosphite uptake and translocation by potato plants: dose-
logy Journal 1-16. [Link] dependent uptake and inhibition of Phytophthora infes-
Aćimović SG, Zeng Q, McGhee GC, Sundin GW and Wise JC. tans development. Crop Protection 56:74-81. [Link]
2015. Control of fire blight (Erwinia amylovora) on apple org/10.1016/[Link].2013.10.024
trees with trunk-injected plant resistance inducers and Cerioni L, Rapisarda VA, Doctor J, Fikkert S, Ruiz T, Fassel
antibiotics and assessment of induction of pathogenesis- R and Smilanick JL. 2013. Use of phosphite salts in la-
related protein genes. Front. Plant Science 6:1-6. https:// boratory and semicommercial tests to control citrus pos-
[Link]/10.3389/fpls.2015.00016 tharvest decay. Plant Disease 97:201-212. [Link]
Aćimović SG, VanWoerkom AH, Garavaglia T, Vandervoort org/10.1094/PDIS-03-12-0299-RE
C, Sundin GW and Wise JC. 2016. Seasonal and cross- Cook PJ, Landschoot PJ and Schlossberg MJ. 2009. Inhibi-
seasonal timing of fungicide trunk injections in apple tion of Pythium spp. and suppression of Pythium blight
trees to optimize management of apple scab. Plant Disea- of turfgrasses with phosphonate fungicides. Plant Disease
se 100:1606-1616. [Link] 93:809-814. [Link]
1061-RE Costa BHG, De Resende MLV, Ribeiro PM, Mathioni SM, Pa-
Akinsanmi OA and Drenth A. 2013. Phosphite and metalaxyl dua MS and Da Silva MBJ. 2014. Suppression of rust and
rejuvenate macadamia trees in decline caused by Phyto- brown eye spot diseases on coffee by phosphites and by-
phthora cinnamomi. Crop Protection 53:29-36. [Link] products of coffee and citrus industries. Journal of Phyto-
org/10.1016/[Link].2013.06.007 pathology 162:635-642. [Link]
Alexandersson E, Mulugeta T, Lankinen Å, Liljeroth E and Dalio RJD, Fleischmann F, Humez M and Osswald W. 2014.
Andreasson E. 2016. Plant resistance inducers against Phosphite protects Fagus sylvatica seedlings towards
pathogens in Solanaceae species-from molecular me- Phytophthora plurivora via local toxicity, priming and fa-
chanisms to field application. International Journal cilitation of pathogen recognition. PLoS One 9, e87860.
Molecular Sciences 17:1-25. [Link] [Link]
ijms17101673 Daniel R and Guest D. 2006. Defence responses induced by
Amiri A and Bompeix G. 2011. Control of Penicillium ex- potassium phosphonate in Phytophthora palmivora-cha-
pansum with potassium phosphite and heat treatment. llenged Arabidopsis thaliana. Physiologycal and Molecu-
Crop Protection 30:222-227. [Link] lar Plant Pathology 67:194-201. [Link]
pro.2010.10.010 pmpp.2006.01.003
Anderson JM, Pegg KG, Scott C and Drenth A. 2012. Phos- Davis AJ and Grant GR. 1996. The effect of phosphonate
phonate applied as a pre-plant dip controls Phytophthora on the sporulation of Fusarium oxysporum f. sp. cuben-
cinnamomi root and heart rot in susceptible pineapple hy- se. Australasian Plant Pathology 25:31-35. [Link]
brids. Australasian Plant Pathology 41:59-68. [Link] org/10.1071/AP96007
org/10.1007/s13313-011-0090-6 Dias-Arieira CRP, Marini PM, Fontana LF, Roldi M and
Araujo L, Valdebenito-Sanhueza RM and Stadnik MJ. 2010. Silva TRB. 2012. Effect of Azospirillum brasilense, Sti-
Avaliação de formulações de fosfito de potássio sobre mulate® and potassium phosphite to control Pratylen-
Colletotrichum gloeosporioides in vitro e no controle pó- chus brachyurus in soybean and maize. Nematropica
sinfeccional da mancha foliar de Glomerella em macieira. 42:170-175. [Link]
Tropical Plant Pathology 35:54-59. [Link] view/79597/76915
pdf/tpp/v35n1/a10v35n1 Deliopoulos T, Kettlewell PS and Hare MC. 2010. Fungal
Becót S, Pajot E, Le Corred D, Monot C and Silué D. 2000. disease suppression by inorganic salts: a review. Crop
Phytogard (K2HPO3) induces localized resistance in Protection 29:1059-1075. [Link]
cauliflower to downy mildew of crucifers. Crop Pro- pro.2010.05.011
tection 19:417-425. [Link] Eshraghi L, Anderson J, Aryamanesh N, Shearer B, McComb
2194(00)00034-X J, Hardy GES and O’Brien PA. 2011. Phosphite primed
Bock CH, Brenneman TB, Hotchkiss MW and Wood BW. defence responses and enhanced expression of defence
2012. Evaluation of a phosphite fungicide to control pecan genes in Arabidopsis thaliana infected with Phytophtho-
scab in the southeastern USA. Crop Protection 36:58-64. ra cinnamomi. Plant Pathology 60:1086-1095. [Link]
[Link] org/10.1111/j.1365-3059.2011.02471.x
Borin RC, Possenti JC, Rey MS, Bernardi C and Mazaro SM. Förster H, Adaskaveg JE, Kim DH and Stanghellini ME. 1998.
2017. Phosphites associated to fungicides for diseases con- Effect of phosphite on tomato and pepper plants and on
trol and sanity in corn seeds. Applied Research and Agro- susceptibility of pepper to Phytophthora root and crown
technology 10:83-92. [Link] rot in hydroponic culture. Plant Disease 82:1165-1170.
N1.09 [Link]
Borza T, Peters RD, Wu Y, Schofield A, Rand J, Ganga Z, Al- Gómez-Merino FC and Trejo-Téllez LI. 2015. Biostimulant
Mughrabi KI, Coffin RH and Wang-Pruski G. 2017. Phos- activity of phosphite in horticulture. Scientia Horticulturae
phite uptake and distribution in potato tubers following 196:82-90. [Link]
foliar and postharvest applications of phosphite-based fun- Hardy GES, Barrett S and Shearer BL. 2001. The future of
gicides for late blight control. Annals of Applied Biology phosphite as a fungicide to control the soilborne plant pa-
1:127-139. [Link] thogen Phytophthora cinnamomi in natural ecosystems.

Publicación en línea, enero 2018 92

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Australians Plant Pathology 30:133-139. [Link] Crops 90:11-13. [Link]

org/10.1071/AP01012 $webindex/3EF696A6E5851563852572140026EACD/$fi
Hofgaard IS, Ergon A, Henriksen B and Tronsmo AM. 2010. le/[Link]
The effect of potential resistance inducers on development MacKenzie SJ, Mertely JC and Peres NA. 2009. Curative and
of Microdochium majus and Fusarium culmorum in winter protectant activity of fungicides for control of crown rot
wheat. European Journal of Plant Pathology 128:269-281. of strawberry caused by Colletotrichum gloeosporioides.
[Link] Plant Disease 93:815-820. [Link]
Hukkanen A, Kostamo K, Kärenlampi S and Kokko H. 2008. 93-8-0815
Impact of agrochemicals on Peronospora sparsa and phe- Manna M, Achary VMM, Islam T, Agrawal PK and Reddy
nolic profiles in three Rubus arcticus cultivars. Journal of MK. 2016. The development of a phosphite-mediated fer-
Agricultural and Food Chemistry 56:1008-1016. https:// tilization and weed control system for rice. Scientific Re-
[Link]/10.1021/jf072973p ports 6:1-13. [Link]
Jackson TJ, Burgess T, Colquhoun I and Hardy GESTJ. 2000. McDonald AE, Grant BR and Plaxton WC. 2001. Phosphite
Action of the fungicide phosphite on Eucalyptus margi- (phosphorous acid): its relevance in the environment and
nata inoculated with Phytophthora cinnamomi. Plant agriculture and influence on plant phosphate starvation
Pathology 49:147-154. [Link] response. Journal Plant Nutrition 24:1505-1519. http://
3059.2000.00422.x [Link]/10.1081/PLN-100106017
Kammerich J, Beckmann S, Scharafat I and Ludwig-Müller Méndez LW, Arauz LF y Ríos R. 2010. Evaluación de fun-
J. 2014. Suppression of the clubroot pathogen Plasmodio- gicidas convencionales e inductores de resistencia para el
phora brassicae by plant growth promoting formulations combate de mildiú velloso (Pseudoperonospora cuben-
in roots of two Brassica species. Plant Pathology 63:846- sis) en melón (Cucumis melo). Agronomía Costarricense
857. [Link] 34:153-164. [Link]
King M, Reeve W, Van der Hoek M.B, Williams N, McComb article/view/3629/3534
J, O’Brien PA and Hardy GE. 2010. Defining the phos- Meyer MD and Hausbeck MK. 2013. Using soil-applied fun-
phite-regulated transcriptome of the plant pathogen Phyto- gicides to manage Phytophthora crown and root rot on
phthora cinnamomi. Mol Genet Genomics 284:425-35. summer squash. Plant Disease 97:107-112. [Link]
[Link] org/10.1094/PDIS-12-11-1071-RE
Kromann P, Pérez WG, Taipe A, Schulte-Geldermann E, Shar- Mofidnakhaei M, Abdossi V, Dehestani A, Pirdashti H and
ma BP, Andrade-Piedra JL and Forbes GA. 2012. Use of Babaeizad V. 2016. Potassium phosphite affects growth,
phosphonate to manage foliar potato late blight in develo- antioxidant enzymes activity and alleviates disease dama-
ping countries. Plant Disease. 96:1008-1015. [Link] ge in cucumber plants inoculated with Pythium ultimum.
[Link]/doi/pdf/10.1094/PDIS-12-11-1029-RE Archives of Phytopathology and Plant Protection 49:207-
Lai T, Wang Y, Fan Y, Zhou Y, Bao Y and Zhou T. 2017. The 221. [Link]
response of growth and patulin production of postharvest Mogollón AM y Castaño J. 2012. Evaluación in vitro de induc-
pathogen Penicillium expansum to exogenous potassium tores de resistencia sobre Mycosphaerella fijiensis Morelet.
phosphite treatment. International Journal of Food Mi- Revista Facultad Nacional de Agronomía 65:6327-6336.
crobiology 244:1-10. [Link] [Link]
cro.2016.12.017 Monchiero M, Lodovica MG, Pugliese M, Spadaro D and
Liljeroth E, Lankinen Å, Wiik L, Burra DD, Alexandersson E Garibaldi A. 2015. Efficacy of different chemical and bio-
and Andreasson E. 2016. Potassium phosphite combined logical products in the control of Pseudomonas syringae
with reduced doses of fungicides provides efficient pro- pv. actinidiae on kiwifruit. Australasian Plant Pathology
tection against potato late blight in large-scale field trials. 44:13-23. [Link]
Crop Protection 86:42-55. [Link] Monsalve V, Viteri RSE, Rubio CNJ and Tovar DF. 2012.
pro.2016.04.003 Efectos del fosfito de potasio en combinación con el fun-
Lobato MC, Machinandierena MF, Tambascio C, Dosio GAA, gicida metalaxyl + mancozeb en el control de mildeo ve-
Caldiz DO, Dalio GR, Andreu AB and Olivieri FP. 2011. lloso (Peronospora destructor Berk) en cebolla de bulbo
Effect of foliar applications of phosphite on post-harvest (Allium cepa L.). Revista Facultad Nacional de Agrono-
potato tubers. European Journal Plant Pathology 130:155- mía-Medellin 65:6317-6325. [Link]
163. [Link] [Link]?id=179924340003
Lobato MC, Olivieri FP, González AEA, Wolski EA, Daleo Nascimento KJT, Araujo L, Resende RS, Schurt DA, Sil-
GR, Caldiz DO and Andreu AB. 2008. Phosphite com- va WL and Rodrigues FA. 2016. Silicon, acibenzolar-
pounds reduce disease severity in potato seed tubers and S-methyl and potassium phosphite in the control of
foliage. European Journal Plant Pathology 122:349-358. brown spot in rice. Bragantia 75:212-221. [Link]
[Link] org/10.1590/1678-4499.281
Lobato MC, Olivieri FP, Daleo GR and Andreu AB. 2010. An- Ogoshi C, de Abreu MS, da Silva BM, Neto HS, Júnior PMR
timicrobial activity of phosphites against different potato and de Resende MLV. 2013. Potassium phosphite: a pro-
pathogens. Journal Plant Disease Protection 3:102-109. mising product in the management of diseases caused by
[Link] Colletotrichum gloeosporioides in coffee plants. Bioscien-
Lovatt CJ and Mikkelsen RL. 2006. Phosphite fertilizers: what ce Journal 29:1558-1565. [Link]
are they? Can you use them? What can they do? Better php/biosciencejournal/article/view/17148/13302

Publicación en línea, enero 2018 93

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Oka Y, Tkachi N and Mor M. 2007. Phosphite inhibits develo- efficacy of azoxystrobin and potassium phosphite for con-
pment of the nematodes Heterodera avenae and Meloido- trolling leather rot of strawberry caused by Phytophtho-
gyne marylandi in cereals. Phytopathology 97:396-404. ra cactorum. Crop Protection 29:349-353. [Link]
[Link] org/10.1016/[Link].2009.12.009
Olivieri FP, Feldman ML, Machinandiarena MF, Lobato MC, Reuveni M, Sheglov D and Cohen Y. 2003. Control of moldy-
Caldiz DO, Dalo GR and Andreu AB. 2012. Phosphi- core decay in apple fruits by β-aminobutyric acids and po-
te applications induce molecular modifications in potato tassium phosphites. Plant Disease 87:933-936. [Link]
tuber periderm and cortex that enhance resistance to pa- org/10.1094/PDIS.2003.87.8.933
thogens. Crop Protection 32:1-6. [Link] Silva OC, Santos HAA, Dalla-Pria M and May-De Mio LL.
cropro.2011.08.025 2011. Potassium phosphite for control of downy mildew
Oyarburo NS, Machinandiarena MF, Feldman ML, Daleo GR, of soybean. Crop Protection 30:598-604. [Link]
Andreu AB and Olivieri FP. 2015. Potassium phosphite org/10.1016/[Link].2011.02.015
increases tolerance to UV-B in potato. Plant Physiology Smillie R, Grant BR and Guest D. 1989. The mode of action
and Biochemistry 88:1-8. [Link] of phosphite: evidence for both direct and indirect modes
phy.2015.01.003 of action on three Phytophthora spp. in plants. Phytopa-
Pagani APS, Dianese AC and Café-Filho AC. 2014. Manage- thology 79:921-926. [Link]
ment of wheat blast with synthetic fungicides, partial resis- Tkaczyk M, Kubiak KA, Sawicki J, Nowakowska JA and Os-
tance and silicate and phosphite minerals. Phytoparasitica zako T. 2016. The use of phosphates in forestry. Forest Re-
42:609-617. [Link] search Papers 77:76-81. [Link]
Percival GC, Noviss K and Haynes I. 2009. Field evaluation of 0009
systemic inducing resistance chemicals at different growth Vawdrey LL and Westerhuis D. 2007. Field and glasshouse
stages for the control of apple (Venturia inaequalis) and evaluations of metalaxyl, potassium phosphonate, aciben-
pear (Venturia pirina) scab. Crop Protection 28:629-633. zolar and tea tree oil in managing Phytophthora root rot
[Link] of papaya in far northern Queensland, Australia. Australa-
Pilbeam RA, Howard K, Shearer BL and Hardy GEJ. 2011. sian Plant Pathology 36:270-276. [Link]
Phosphite stimulated histological responses of Eucalyptus AP07016
marginata to infection by Phytophthora cinnamomi. Tree Wilkinson CJ, Holmes JM, Tynan KM, Colquhoun IJ, Mc-
25:1121-1131. [Link] comb JA, Hardy GESTJ and Dell B. 2001. Ability of phos-
Pinto KM, Do Nascimento C, Gomes EC, Da Silva HF and phite applied in a glasshouse trial to control Phytophthora
Miranda J. 2012. Efficiency of resistance elicitors in the cinnamomi in five plant species native to Western Austra-
management of grapevine downy mildew Plasmopara lia. Australasian Plant Pathology 30:343-351. [Link]
viticola: epidemiological, biochemical and economic as- org/10.1071/AP01055
pects. European Journal Plant Pathology 134:745-754. Wong MA, McComb BJ, Hardy BGEJ and O’Brien PA. 2009.
[Link] Phosphite induces expression of a putative proteophos-
Puerari HH, Dias-Arieira CR, Cardoso MR, Hernandes I and phoglycan gene in Phytophthora cinnamomi. Australa-
Brito ODC. 2015. Resistance inducers in the control of sian Plant Pathology 38:235-241. [Link]
root lesion nematodes in resistant and susceptible culti- AP08101
vars of maize. Phytoparasitica 43:383-389. [Link] Yáñez JMG, Ayala TF, Partida RL, Velázquez AT, Godoy ATP
org/10.1007/s12600-014-0447-9 y Díaz VT. 2014. Efecto de bicarbonatos en el control de
Quintero-Vargas C y Castaño-Zapata J. 2012. Evaluación de cenicilla (Oidium sp.) en pepino (Cucumis sativus L.). Re-
inductores de resistencia para el manejo de nematodos vista Mexicana de Ciencias Agrícolas 5:991-1000. http://
fitoparásitos en plántulas de plátano. Revista de la Aca- [Link]/[Link]?script=sci_arttext&pid
demia Colombiana de Ciencias Exactas, Físicas y Natu- =S2007-09342014000600007
rales 36:575-586. [Link] Yáñez JMG, León DJF, Godoy ATP, Gastélum LR, López MM,
v36n141/[Link] Cruz OJE y Cervantes DL. 2012. Alternativas para el con-
Rebollar-Alviter A, Wilson LL, Madden LV and Ellis MA. trol de la cenicilla (Oidium sp.) en pepino (Cucumis sativus
2010. A comparative evaluation of post-infection efficacy L.). Revista Mexicana de Ciencias Agrícolas 3:259-270.
of mefenoxam and potassium phosphite with protectant [Link]

Publicación en línea, enero 2018 94

 The genus Bacillus as a biological control agent and
its implications in the agricultural biosecurity

El género Bacillus como agente de control biológico y sus

implicaciones en la bioseguridad agrícola

María Fernanda Villarreal-Delgado, Eber Daniel Villa-Rodríguez, Luis Alberto Cira-Chávez, María Isa-
bel Estrada-Alvarado, Instituto Tecnológico de Sonora, 5 de Febrero 818 Sur, Colonia Centro CP. 85000,
Ciudad Obregón, Sonora, México; Fannie Isela Parra-Cota, Campo Experimental Norman E. Borlaug, CP.
85000, Ciudad Obregón, Sonora, México; Sergio de los Santos-Villalobos*, CONACYT-Instituto Tecnológico
de Sonora, 5 de Febrero 818 Sur, Colonia Centro CP. 85000, Ciudad Obregón, Sonora, México. *Autor para
correspondencia: [Link]@[Link].

Recibido: 30 de Junio, 2017. Aceptado: 15 de Diciembre, 2017.

Villarreal-Delgado MF, Villa-Rodríguez ED, Cira- Abstract. The genus Bacillus is widely
Chávez LA, Estrada-Alvarado MI, Parra-Cota FI, De distributed in agro-systems, being one of its main
los Santos-Villalobos S. 2017. The genus Bacillus as a applications the control of diseases in agricultural
biological control agent and its implications in the agri- crops. The present review describes and analyzes
cultural biosecurity. Revista Mexicana de Fitopatología the genus Bacillus, and its main mechanisms of
36(1): 95-130. action, such the excretion of antibiotics, toxins,
DOI: 10.18781/[Link].1706-5 siderophores, lytic enzymes and Induced systemic
resistance, focused on its ability to be used as
Primera publicación DOI: 03 de Enero, 2018. biocontrol agent of pests and diseases in plants;
First DOI publication: January 03, 2018. as well as its use in formulations of biopesticides,
which have been incorporated into Integrated
Pest Management programs. In addition, the
Resumen. El género Bacillus se encuentra am- Bacillus genus is analyzed in terms of agricultural
pliamente distribuido en los agro-sistemas y una de biosecurity, as well as the principal criteria for the
sus principales aplicaciones es el control de enfer- effective selection of biocontrol agents, considering
medades de cultivos agrícolas. En la presente revi- strains not pathogenic to humans, and that do
sión se describe y analiza al género Bacillus, y sus not negatively impact the microbial communities
principales mecanismos de acción, tales como la of agro-ecosystems, as a side-effect by its non-
excreción de antibióticos, toxinas, sideróforos, en- specific biological activity against a particular
zimas líticas e induciendo la resistencia sistémica, plant pathogen.

Publicación en línea, enero 2018 95

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

enfocado en su capacidad para ser utilizado como Key words: biocontrol, phytopathogens,
agente de control biológico de plagas y enfermeda- biopesticides.
des en plantas; así como su uso en la formulación
de bioplaguicidas, que han sido incorporados a los
programas de Manejo Integrado de Plagas y En- Agriculture is a decisive activity in worldwide
fermedades. Además, se analiza el uso del género economic, social and environmental development,
Bacillus en la agricultura bajo un enfoque de biose- since it contributes to 80% of the food consumed
guridad agrícola, así como los principales criterios globally (FAO, 2014). However, approximately 20
indispensables de selección de agentes de control to 30% of the agricultural production is affected by
biológico promisorios, considerando cepas no pa- pests and diseases, with fungi, bacteria, nematodes,
togénicas para el ser humano, y que no impacten viruses and insects being the main causal agents
negativamente a las comunidades microbianas de (Pérez-García et al., 2011). In this way, in order to
los agro-ecosistemas, como efecto secundario por fight diseases in crops, chemical compounds have
su actividad biológica no específica contra un fito- been widely used, including insecticides, fungicides
patógeno en particular. and nematicides. However, despite the success in
the application of these compounds in the increase
Palabras clave: biocontrol, fitopatógenos, biopla- of worldwide agricultural activity, their excessive
guicidas. use has had a negative impact on soils, ecosystems
and human health, i.e. captan, a fungicide used
in Mexico, the use of which has been prohibited
in other countries due to its carcinogenic effect
La agricultura representa una actividad determi- (Arellano-Aguilar and Rendón, 2016).
nante en el desarrollo económico, social y ambien- On the other hand, the incidence of pests and
tal del mundo, ya que contribuye con el 80% de diseases can be minimized by the use of cultural
los alimentos que se consumen (FAO, 2014). Sin practices such as crop rotation and the system of
embargo, aproximadamente entre el 20 y 30% de planting in separate plots; however, these are not
la producción agrícola anual es afectada por pla- entirely efficient (Sainju et al., 2016). Thus, the
gas y enfermedades, siendo los hongos, bacterias, Integrated Pest and Disease Management (IPDM)
nematodos, virus e insectos los principales agentes is a crucial alternative in the development of a
causales (Pérez-García et al., 2011). De esta mane- sustainable agriculture that guarantees global food
ra, con el objetivo de combatir las enfermedades en security, which uses the combination of biological,
los cultivos agrícolas se han utilizado ampliamente cultural and chemical methods in a compatible way
diversos compuestos químicos tales como: insec- (from Olivar et al., 2008). The IPDM highlights
ticidas, fungicidas y nematicidas. No obstante, el the use of biological control agents (BCA) as a
éxito de la aplicación de estos compuestos en el sustainable alternative to mitigate the negative
incremento de la productividad agrícola mundial, effects in the productivity and quality of the crops
su uso excesivo ha impactado negativamente los caused by different diseases, reducing the resistance
suelos, ecosistemas y la salud humana, i.e. el cap- of phytopathogenic organisms, and reducing the
tan, fungicida utilizado en México, cuyo uso se ha contamination of soils and water tables. This helps
prohibido en otros países por su efecto cancerígeno produce innocuous foods and reduces the costs of
(Arellano-Aguilar y Rendón, 2016). agricultural production (Reyes et al., 2015).

Publicación en línea, enero 2018 96

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Por otra parte, la incidencia de plagas y enfer- The use of BCA began in the early 19th Century,
medades puede ser minimizada por el uso de prácticas using live organisms or their metabolites to mitigate
culturales, por ejemplo, la rotación de cultivos y diseases in agricultural crops (Badii et al., 2000).
el sistema de siembra por parcelas separadas; sin In recent decades, the effect of a large diversity
embargo, éstas no son completamente eficientes of rhizospheric microorganisms in the control of
(Sainju et al., 2016). Así, el Manejo Integrado de phytopathogenic organisms has been reported, since
Plagas y Enfermedades (MIPE) es una alternativa the rhizosphere represents the first line of defense
indispensable en el desarrollo de una agricultura of the plant against edaphic phytopathogenic
sustentable que garantiza la seguridad alimentaria organisms, thus avoiding their establishment in
global, en el cual se utiliza la combinación de mé- the roots (Tejera-Hernández et al., 2011). This has
todos biológicos, culturales y químicos de forma led to the study of multiple mechanisms used by
compatible (de Olivar et al., 2008). En el MIPE the BCA to control the growth, development and
se destaca el uso de agentes de control biológico infection of phytopathogenic organisms in diverse
(ACB) como una alternativa sustentable para miti- economically important crops; some of the most
gar los efectos negativos en la productividad y ca- important of these mechanisms include: a) contact
lidad de los cultivos agrícolas causada por distintas mechanisms such as hyperparasitism and predation
enfermedades, disminuyendo la resistencia de los (Chen et al., 2016); b) the production of compounds
organismos fitopatógenos, y reduciendo la conta- with low molecular weights with a direct effect on
minación de los suelos y mantos acuíferos. Lo cual the growth of the antibiotic pathogen (phenazines,
permite la producción de alimentos inocuos y dis- 2,4-diacetylfluoroglucinol, cyclic lipopeptides),
minuye los costos de producción agrícola (Reyes lytic enzymes (chitnases, glucanases, proteases),
et al., 2015). products of unregulated residues (ammonia, carbon
El uso de ACB inició a principios del siglo XIX, dioxide, hydroxide cyanide) (Yan et al., 2011;
utilizando organismos vivos o sus metabolitos para Zhang et al., 2016; Jaaffar et al., 2017; Piechulla
mitigar las enfermedades en cultivos agrícolas et al., 2017) and c) indirect mechanisms from the
(Badii et al., 2000). En las últimas décadas, se ha competition for space and nutrients (consumption
descrito el efecto que ejerce una gran diversidad of leached-exudates, production of siderophores,
de microorganismos rizosféricos en el control de induction to the systemic response in plants
organismos fitopatógenos, ya que la rizósfera re- through the production of phytohormones and
presenta la primera línea de defensa de la planta molecular patterns) (Pal and Gardener, 2006; Yu et
contra organismos fitopatógenos edáficos, evitando al., 2011; Chowdhury et al., 2015). These action
así el establecimiento de éstos en la raíz (Tejera- mechanisms have been observed in the microbial
Hernández et al., 2011). Lo anterior ha conducido strains used as BCA, in which the Bacillus genus
al estudio de múltiples mecanismos utilizados por has been widely studied due to its high abundance
los ACB para controlar el crecimiento, desarrollo e and diversity in agro-systems (soil, water and
infección de organismos fitopatógenos en diversos plant), with a significantly higher population in
cultivos agrícolas de importancia económica, entre comparison to other microbial genera, and also
estos mecanismos destacan: a) mecanismos de con- due to its diverse metabolic capabilities, with an
tacto como, hiperparasitismo y predación (Chen outstanding capability to produce antibiotics and
et al., 2016); b) la producción de compuestos de other antimicrobial and antifungal metabolites

Publicación en línea, enero 2018 97

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

bajo peso molecular con efecto directo sobre el (Tejera-Hernández et al., 2011). For example,
crecimiento del patógeno antibióticos (fenazinas, several molecular studies have revealed that a
2,4-diacetilfloroglucinol, lipopéptidos cíclicos), significant percentage of the genome of strains
enzimas líticas (quitinasas, glucanasas, proteasas), of the Bacillus genus is related to the production
productos de residuos no regulados (amoniaco, of secondary metabolites related to the control of
dióxido de carbono, cianuro de hidróxido) (Yan et phytopathogens, i.e. 8.5 and 4% of the genome of
al., 2011; Zhang et al., 2016; Jaaffar et al., 2017; strains B. amyloliquefaciens FZB42 and B. subtilis
Piechulla et al., 2017) y c) mecanismos indirectos 168, respectively (Raaijmakers and Mazzola,
por competencia de espacio y nutrientes (consumo 2012). This justifies the wide use of strains of this
de lixiviados-exudados, producción de sideróforos, bacterial genus as BCA for the control of diseases
inducción a la respuesta sistémica en plantas me- that affect agricultural crops. However, the
diante la producción de fitohormonas y patrones efficiency of strains without risks to the biosecurity
moleculares) (Pal y Gardener, 2006; Yu et al., 2011; of the Bacillus genus used as BCA is maximized
Chowdhury et al., 2015). Estos mecanismos de ac- by their effective introduction to the agro-system,
ción han sido observados en las cepas microbianas inducing their biological control mechanisms.
utilizadas como ACB, entre las cuales el género Therefore, this study focuses on the analysis and
Bacillus ha sido ampliamente estudiado debido a su discussion of the Bacillus genus, its main action
alta abundancia y diversidad en los agro-sistemas mechanisms against plant diseases, as well as
(suelo, agua y planta), siendo significativamente its implementation, without risks to biosafety
mayor su población en comparación a otros géne- with the development of biopesticides, since the
ros microbianos, y además por sus diversas capa- scientific foundation of these bioproducts on its
cidades metabólicas, destacando su capacidad para action mechanisms, environmental and biosafety
producir antibióticos y otros metabolitos antimi- implications, and the formulation of biopesticides
crobianos y antifúngicos (Tejera-Hernández et al., are decisive for the development of a sustainable
2011). Por ejemplo, diversos estudios moleculares agriculture.
han revelado que un porcentaje significativo del
genoma de cepas del género Bacillus está relacio- The Bacillus genus
nado con la producción de metabolitos secundarios
asociados al control de fitopatógenos, i.e. el 8.5 y Classification
4% del genoma de las cepas B. amyloliquefaciens
FZB42 y B. subtilis 168, respectivamente (Raaij- The Bacillus genus was first reported by
makers y Mazzola, 2012). Esto justifica el amplio Cohn (1872), who described it as heat-resistant,
uso de cepas de este género bacteriano como ACB endospore-producing bacteria. The species of
para el control de enfermedades que afectan los Bacillus belong to the bacteria kingdom; Phylus
cultivos agrícolas. Sin embargo, la eficiencia de Firmicutes; Class Bacilli; Order Bacillales and
cepas sin riesgos a la bioseguridad del género Ba- Family Bacillaceae (Maughan and van der Auwera,
cillus utilizadas como ACB es maximizada por su 2011). Currently, the genus includes over 336
introducción efectiva al agro-sistema, induciendo species, which, because of their genetic similarity,
sus mecanismos de control biológico. Así, la pre- can be classified into different groups, the most
sente revisión se centra en analizar y discutir el important of which are a) the group of B. cereus,

Publicación en línea, enero 2018 98

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

género Bacillus, sus principales mecanismos de related to pathogenicity, which includes B. cereus-
acción contra enfermedades en plantas, así como anthracis-thuringiensis; b) the environmental
su implementación, sin riesgos a la bioseguridad, bacilli, which are characteristically present in
mediante el desarrollo de bioplaguicidas, ya que el different habitats, such as the group of Bacillus
sustento científico de estos bioproductos sobre sus subtilis, composed of B. subtilis-licheniformis-
mecanismos de acción, implicaciones ecológicas, pumilus; c) the group of B. clausii-halodurans; and
de bioseguridad, y la formulación de los bioplagui- d) the group that includes Bacillus sp. NRRLB-
cidas son determinantes para el desarrollo de una 14911-coahuilensis (Alcaraz et al., 2010; LPSN,
agricultura sustentable. 2016).

El género Bacillus Ecology

Clasificación The Bacillus species are widely distributed

worldwide due to their ability to form endospores,
El género Bacillus fue reportado por prime- a characteristic that provides them with resistance
ra vez por Cohn (1872), quien lo describió como and boosts its isolation in several habitats, both
bacterias productoras de endosporas resistentes al water and terrestrial ecosystems, and even in
calor. Las especies de Bacillus pertenecen al Rei- environments under extreme conditions (Tejera-
no Bacteria; Filo Firmicutes; Clase Bacilli; Orden Hernández et al., 2011). However, soils are
Bacillales y Familia Bacillaceae (Maughan y van considered the main reservoir of this bacterial genus,
der Auwera, 2011). Actualmente, el género incluye since most Bacillus species are saprophytic and are
más de 336 especies, las cuales por su similitud ge- able to use the large diversity of organic substrates
nética pueden clasificarse en distintos grupos, sien- in the soil, making this a complex matrix for the
do los más destacados: a) el grupo de B. cereus, establishment of a large genetic and functional
asociado a patogenicidad, que incluye a B. cereus- diversity of microbial species (McSpadden, 2004).
anthracis-thuringiensis; b) los bacilos ambientales For this reason, the multiple Bacillus species can
que son caracterizados por su presencia en distintos grow in soil, the cultivable counts are found in the
hábitats, como el grupo de Bacillus subtilis, com- range of log 3 to log 6 per gram of fresh weight
prendido por B. subtilis-licheniformis-pumilus; c) of soil, essentially in genetically similar species to
el grupo de B. clausii-halodurans; y d) el grupo the group of B. subtilis and B. cereus (Vargas-Ayala
que incluye a Bacillus sp. NRRLB-14911-coahui- et al., 2000). Regardless of rRNA studies in soil
lensis (Alcaraz et al., 2010; LPSN, 2016). contradicting the relative abundance of cultivable
and un-cultivable species of this bacterial genus
Ecología (Kumar et al., 2011).
Under a focus aimed at agricultural
Las especies de Bacillus se encuentran amplia- sustainability, few investigations have aimed at
mente distribuidas a nivel mundial debido a su ha- understanding the specific population diversity
bilidad para formar endosporas, característica que and dynamics of Bacillus in rhizospheric soils, in
les confiere resistencia y potencia su aislamiento which the bacterial communities that inhabit the
en diversos hábitats, tanto ecosistemas acuáticos rhizosphere respond particularly to the soil fertility

Publicación en línea, enero 2018 99

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

como terrestres, e incluso en ambientes bajo con- and the exudates of plant roots, which vary with
diciones extremas (Tejera-Hernández et al., 2011). the phenology and genotype of the plant (de Souza
Sin embargo, el suelo es considerado el principal et al., 2015), and therefore bacteria that interact
reservorio de este género bacteriano, debido a que with plants and present associative or endophytic
la mayoría de especies de Bacillus son saprófitas capacities, or symbiotic processes to adapt to the
pudiendo utilizar la gran diversidad de sustratos or- rhizospheric conditions are acknowledged as
gánicos presentes en el suelo, siendo ésta una ma- potential microbial inoculants. Rudrappa et al.
triz compleja para el establecimiento de una gran (2008) reported that the production of B. subtilis
diversidad genética y funcional de especies micro- FB17 biofilm is a rhizosphere colonization
bianas (McSpadden, 2004). Por lo cual, múltiples mechanism, due to its attraction to the L-malic
especies de Bacillus pueden desarrollarse en los acid secreted by the roots of Arabidopsis thaliana
suelos, cuyos recuentos cultivables se encuentra en and induced by the foliar pathogen Pseudomonas
el intervalo de log 3 a log 6 por gramo de peso fres- syringae  pv  tomato. On the other hand, Kumar
co de suelo, esencialmente en especies similares et al. (2011), López-Fernández et al. (2016) and
genéticamente al grupo de B. subtilis y B. cereus Selim et al. (2016) point out that diverse species
(Vargas-Ayala et al., 2000). No obstante que estu- of Bacillus may reside in internal tissues of grape
dios de ARNr en suelo contradicen la abundancia (Vitis vinífera) and cotton plants (Gossypium
relativa de especies cultivables y no cultivables de barbadense L). These characteristics play a crucial
este género bacteriano (Kumar et al., 2011). role in the development, colonization and function
Bajo un enfoque dirigido a la sustentabilidad of Bacillus, stimulating their relationship with the
agrícola se han realizado escasas investigaciones host plant, the biological control characteristics of
con el objetivo de comprender la diversidad y diná- which are strengthened.
mica poblacional específica de Bacillus en suelos
rizosféricos, donde las comunidades bacterianas Main characteristics
que habitan la rizósfera responden particularmente
a la fertilidad del suelo y los exudados de las raíces Some of the main characteristics of the Bacillus
de las plantas, los cuales varían con la fenología genus are its optional aerobic or sometimes
y genotipo vegetal (de Souza et al., 2015), por lo anaerobic growth, Gram-positive, bacillary
que bacterias que interaccionen con las plantas y morphology, flagellar motility, and variable size
presenten capacidades asociativas, endofíticas o (0.5 to 10 μm), its optimal growth being in a neutral
procesos simbióticos para adaptarse a las condicio- pH, with a wide interval of growth temperatures,
nes rizosféricas son reconocidas como potenciales although most species are mesophilic (temperature
inoculantes microbianos. Rudrappa et al. (2008) between 30 and 45 °C), its metabolic diversity
reportaron que la producción de biopelículas de B. related to the promotion of plant growth and control
subtilis FB17 es un mecanismo de colonización ri- of pathogens (Tejera-Hernández et al., 2011); other
zosférica, esto debido a su atracción por el ácido features that stand out are its capacity to produce
L-málico secretado por las raíces de Arabidopsis endospores (oval or cyllindrical) as a mechanism
thaliana e inducido por el patógeno foliar Pseudo- of resistance to diverse types of stress (Calvo
monas syringae pv tomato. Por otra parte, Kumar and Zúñiga, 2010; Layton et al., 2011; Tejera-
et al. (2011), López-Fernández et al. (2016) y Hernández et al., 2011) (Figure 1).

Publicación en línea, enero 2018 100

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Selim et al. (2016) señalan que diversas especies de The presence of endospores confers the Bacillus
Bacillus pueden ser residentes de tejidos internos genus its capacity to spread and its prevalence in
en plantas de uva (Vitis vinífera) y algodón (Gossy- ecosystems. These form during the second phase
pium barbadense L). Estas características tienen un of its life cycle, which is composed of a phase
papel determinante en el desarrollo, colonización y of vegetative growth and a phase of sporulation
función de Bacillus estimulando su asociación con (Figure 2). During the first stage, the bacteria
la planta hospedera, cuyas características de con- grows exponentially by binary fission, since it is
trol biológico son potenciadas. found in a medium with favorable conditions for
its growth. The second phase begins as a strategy
Principales características for survival in the presence of some type of stress
(high population density, lack of nutrients, external
Entre las características del género Bacillus des- factors such as salinity, temperature, pH, and others).
taca su crecimiento aerobio o en ocasiones anae- In this way, the vegetative cell begins the formation
robio facultativo, Gram positivas, morfología ba- of the endospore, which implies an asymmetric
cilar, movilidad flagelar, y tamaño variable (0.5 a cell division, giving way to the formation of two
10 μm), su crecimiento óptimo ocurre a pH neutro, compartments: a mother cell and the immersion
presentando un amplio intervalo de temperaturas of a prespore. Later, the prespore is swallowed,
de crecimiento, aunque la mayoría de las especies forming a cell within the mother cell. During the
son mesófilas (temperatura entre 30 y 45 °C), su later stages, the prespore is covered by protective
diversidad metabólica asociada a la promoción del layers (protein components, peptidoglycan and
crecimiento vegetal y control de patógenos (Tejera- a wall that resides below it formed by germ
Hernández et al., 2011); además destaca su capaci- cells), followed by the dehydration and the final
dad de producir endosporas (ovales o cilíndricas) maturation of the prespore. Finally, the mother cell
como mecanismo de resistencia a diversos tipos de is lysed by programmed cell death, releasing the
estrés (Calvo y Zúñiga, 2010; Layton et al., 2011; endospore. The endospore can remain viable in the
Tejera-Hernández et al., 2011) (Figura 1). environment until the conditions become favorable
La presencia de endosporas le confiere al gé- to begin their metabolic processes and generate a
nero de Bacillus su capacidad de diseminación y vegetative cell (Errigton 2003; Tejera-Hernández et
prevalencia en los ecosistemas, éstas se forman du- al., 2011; CALS; 2016). Due to this, the formation
rante su segunda fase del ciclo de vida, el cual se of endospores resistant to heat and desiccation is
encuentra conformado por una fase de crecimiento an important characteristic for the formulation of
vegetativo y una fase de esporulación (Figura 2). biotechnological products based on strains of this
Durante la primera etapa, la bacteria crece de for- bacterial genus (Pérez-García et al., 2011).
ma exponencial mediante fisión binaria, ya que se
encuentra en un medio con las condiciones favora- The Bacillus genus as a Biological Control Agent
bles para su desarrollo. La segunda fase comienza
como una estrategia de supervivencia en presencia Large diversity of species of the Bacillus
de algún tipo de estrés (alta densidad de población, genus have proven to have antagonistic activity
escasez de nutrientes, factores externos como sali- against diverse phytopathogenic microorganisms
nidad, temperatura, pH, entre otros), así la célula in agricultural crops, such as maize, rice, fruit

Publicación en línea, enero 2018 101

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Figura 1. Características morfológicas de Bacillus sp. TE3 perteneciente a la Colección de Microorganismos Edáficos y
Endófitos Nativo ([Link]/COLMENA). A) Células bacilares, Gram positivas; B) endosporas (flecha
blanca) y células bacilares (flecha negra); y C) morfología macroscópica de la cepa TE3.
Figure 1. Morphological characteristics of Bacillus sp. TE3 belonging to the Collection of Native Edaphic and Endophytic
Microorganisms ([Link]/COLMENA). A) Bacillary cells, Gram positive; B) endospores (white arrow)
and bacillary cells (black arrow); and C) macroscopic morphology of strain TE3.

vegetativa inicia la formación de la endospora, lo trees, and others (Wang et al., 2014; Li et al.,
cual implica la división celular asimétrica, dando 2015). The study of this ability of Bacillus began
lugar a la formación de dos compartimentos, célula with the discovery of insecticidal activity of Cry

Figura 2. Ciclo de reproducción del género Bacillus. Modificado de Errigton, (2003).

Figure 2. Reproduction cycle of the genus Bacillus. Modified from Errigton, (2003).

Publicación en línea, enero 2018 102

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

madre y la inmersión de una preespora. Posterior- proteins produced by B. thuringiensis; currently,

mente, la preespora es engullida, formando una cé- several species of the Bacillus genus (B. subtilis, B.
lula dentro de la célula madre. Durante las etapas pumilus, B. amyloliquefaciens and B. licheniformis)
posteriores, la preespora es recubierta de capas pro- are widely studied to mitigate the incidence of
tectoras (componentes proteicos, peptidoglicano y diseases of importance to agriculture (Raaijmakers
una pared que reside debajo de ésta, formada por and Mazzola, 2012). Some of the main ways in
células germinales), seguido de la deshidratación, which these strains avoid the establishment and
y la maduración final de la preespora. Finalmen- development of phytopathogenic organisms is
te, la célula madre se lisa mediante muerte celular through different mechanisms, which include A) the
programada, liberando la endospora. La endospo- excretion of antibiotics, B) siderophores, C) lytic
ra puede permanecer viable en el ambiente hasta enzymes, D) toxins and E) inducing the systemic
que las condiciones son favorables para iniciar sus resistance of the plant (ISR) (Figure 3) (Layton et
procesos metabólicos y generar una célula vegeta- al., 2011; Tejera-Hernández et al., 2011).
tiva (Errigton 2003; Tejera-Hernández et al., 2011;
CALS; 2016). Por lo anterior, la formación de en- Main mechanisms of biological control of the
dosporas resistentes al calor y desecación es una Bacillus genus
característica de importancia para la formulación
de productos biotecnológicos a base de cepas de Production of lipopeptides
este género bacteriano (Pérez-García et al., 2011).
One of the most important characteristics of
El género Bacillus como Agente de Control Bio- the Bacillus genus is its capacity to produce a
lógico large variety of antibiotics capable of inhibiting
the growth of phytopathogenic agents, including
Una gran diversidad de especies del género Ba- non-ribosomal cyclic peptides, which have been
cillus han demostrado tener actividad antagónica the most widely studied. Lipopeptides (LPs)
contra diversos microorganismos fitopatógenos de structurally consist of a cyclic peptide joined to a
cultivos agrícolas, tales como maíz, arroz, frutales, chain of β-hydroxy or β-amino fatty acids (Figure
entre otros (Wang et al., 2014; Li et al., 2015). El 4-A), classified into 3 different families (iturines,
estudio de esta capacidad de Bacillus se inició por fengicines and surfactines), according to their
el descubrimiento de la actividad insecticida de las amino acid sequences and length of the fatty acid
proteínas Cry producidas por B. thuringiensis; en (Ongena and Jaques, 2008; Falardeau et al., 2013).
la actualidad diversas especies del género Baci- These molecules are synthesized by multienzymatic
llus (B. subtilis, B. pumilus, B. amyloliquefaciens complexes, known as nonribosomal peptide
y B. licheniformis) son ampliamente estudiadas synthetase (NRPS), which are independent to
para mitigar la incidencia de enfermedades de messenger RNA (Chowdhury et al., 2015). The
importancia agrícola (Raaijmakers y Mazzola, families of iturines, fengicines and surfactines
2012). Entre las principales vías por las cuales have been widely studied for their antibacterial and
estas cepas evitan el establecimiento y desarrollo antifungal activity (Meena and Kanwar, 2015). The
de organismos fitopatógenos es a través de dife- antimicrobial activity of these LPs occurs because
rentes mecanismos, que incluyen A) la excreción of their interaction with the cytoplasmic membrane

Publicación en línea, enero 2018 103

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

de antibióticos, B) sideróforos, C) enzimas líticas, of bacterial or fungal cells, causing the formation of
D) toxinas y E) induciendo la resistencia sistémica pores and an osmotic imbalance, which triggers the
de la planta (IRS) (Figura 3) (Layton et al., 2011; cell death of the phytopathogenic microorganisms
Tejera-Hernández et al., 2011). (Figure 4-B) (Aranda et al., 2005; Gong et al.,
2006). However, recent reports claim that some
Principales mecanismos de control biológico del lipopeptides can have multiple action mechanisms,
género Bacillus altering cell processes such as intracellular calcium
homeostasis, energetic metabolism and RNA
Producción de lipopéptidos processing (Zhang et al., 2016).
The role of the LPs has become evident
Una de las características más importantes del in the growth inhibition in phytopathogenic
género Bacillus es su capacidad de producir una microorganisms. Touré et al. (2004) identified
gran variedad de antibióticos con capacidad de in- several isoforms of lipopeptides in extracts
hibir el crecimiento de agentes fitopatógenos, entre produced from liquid cultures of B. subtilis GA1.
éstos, los lipopéptidos cíclicos no ribosomales han Later, in a test for co-inoculation of strains GA1
sido los más estudiados. Los lipopéptidos (LPs), and Botrytis cinerea in apple fruits, they identified
estructuralmente consisten en un péptido cícli- the presence of fengicines and iturines in inhibitory
co unido a una cadena de ácido graso β-hidroxi o concentrations, showing the activity of these
β-amino (Figura 4-A), clasificándose en 3 diferen- lipopeptides in-situ. Likewise, genetic expression
tes familias (iturinas, fengicinas y surfactinas), and mutagenesis analyses have contributed
de acuerdo con su secuencia de aminoácidos significantly to the understanding the role of
y longitud del ácido graso (Ongena y Jaques, lipopeptides in the microbial activity of the Bacillus
2008; Falardeau et al., 2013). Estas moléculas genus against phytopathogenic microorganisms

A) B) C) D) E)

Figura 3. Principales mecanismos de control biológico del género Bacillus. Producción de A) lipopéptidos, B) sideróforos,
C) enzimas líticas, D) δ-endotoxinas, E) inducción a la respuesta sistémica.
Figure 3. Main biological control mechanisms of the genus Bacillus. Production of A) lipopeptides, B) siderophores, C) lytic
enzymes, D) δ-endotoxins, E) induction to the systemic response.

Publicación en línea, enero 2018 104

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 4. Los lipopéptidos como metabolitos involucrados en el control biológico de fitopatógenos. A) Representantes de
las familias de lipopéptidos, B) Mecanismo de acción de los lipopéptidos. Modificado de Ongena y Jaques (2008);
Bayer (2016).
Figure 4. Lipopeptides as metabolites involved in the biological control of plant pathogens. A) Representatives of the family
of lipopeptides, B) Action mechanism of lipopeptides. Modified from Ongena and Jaques (2008); Bayer (2016).

son sintetizadas por complejos multi-enzimáticos, (Xu et al., 2013). For example, Li et al. (2014)
conocidos como sintetasas de péptidos no ribo- mutated the gene of the phosphopantetheine
somales (NRPS del inglés, nonribosomal peptide transferase (sfp) in the strain SQR9 of B.
synthetase), las cuales son independientes del RNA amyloliquefaciens, crucial for the functioning
mensajero (Chowdhury et al., 2015). Las familias of non-ribosomal peptide synthetase (NRPS),
de las iturinas, fengicinas y surfactinas, han sido and therefore the synthesis of lipopeptides. This
ampliamente estudiadas por su actividad antibac- mutation resulted in a phenotype lacking antifungal
teriana y antífúngica (Meena y Kanwar, 2015). La activity against diverse agriculturally important
actividad antimicrobiana de estos LPs tiene lugar phytopathogens, including Verticillium dahliae,
por su interacción con la membrana citoplasmáti- Sclerotinia sclerotiorum, Fusarium oxysporum,
ca de células bacterianas o fúngicas, provocando Rhizoctonia solani, Fusarium solani, Phytophthora
la formación de poros y un desbalance osmótico, parasiticaThe efficient control of diseases by the
lo que desencadena la muerte celular de los micro- biological control agents requires these to be able
organismos fitopatógenos (Figura 4-B) (Aranda et to establish in, and interact with, their host plant
al., 2005; Gong et al., 2006). Sin embargo, recien- (Pérez-García et al., 2011). Likewise, along with
temente se ha reportado que algunos lipopéptidos antibiosis, lipopeptides have an influence on the
pueden tener múltiples mecanismos de acción, al- establishment of Bacillus with the regulation of

Publicación en línea, enero 2018 105

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

terando procesos celulares como homeostasis intra- cell processes such as motility and the formation
celular de calcio, metabolismo energético y proce- of biofilms (Choudhary and Jhori, 2009; Xu et al.,
samiento del RNA (Zhang et al., 2016).El papel de 2013). The latter has been observed in the mutant
los LPs se ha evidenciado en la inhibición del cre- of B. subtilis 6051, deficient in the production of
cimiento de microorganismos fitopatógenos. Touré surfactines, producing an irregular biofilm during
et al. (2004) identificaron múltiples isoformas de li- colonization, as well as the reduction in its capacity
popéptidos en extractos generados a partir de culti- to control infections caused by Pseudomonas
vos líquidos de B. subtilis GA1. Posteriormente, en syringae pv. tomato in Arabidopsis thaliana (Bais
un ensayo de co-inoculación de la cepa GA1 y Bo- et al., 2004). Similarly, the role of lipopeptides in
trytis cinerea en frutos de manzano, identificaron la the motility of Bacillus has been proven with the
presencia de fengicinas e iturinas en concentracio- study of deficient mutants in the production of
nes inhibitorias, demostrando la actividad de estos lipopeptides, i.e. Bacillus subtilis 168 deficient
lipopéptidos in-situ. Además, análisis de expresión of the gen sfp gene, displayed a loss in motility
génica y mutagénesis dirigida han contribuido de in semi-solid agar, although it was restored when
manera significativa a comprender el papel de los purified lipopeptides were added to the culture
lipopéptidos en la actividad antimicrobiana del gé- medium (Kinsinger et al., 2003). Due to the
nero Bacillus contra microorganismos fitopatóge- role of the lipopeptides in several cell processes
nos (Xu et al., 2013). Por ejemplo, Li et al. (2014) (antibiosis, formation of biofilms and motility), its
mutaron el gen de la fosfopanteteína transferasa isolated study on the motility in situ of Bacillus is
(sfp) en la cepa SQR9 de B. amyloliquefaciens, in- complex.
dispensable en el funcionamiento de sintetasas de Despite lipopeptides not being the only
péptidos no ribosomales (NRPS), y por tanto de la metabolites of the antibiome of the Bacillus
síntesis de lipopéptidos. Dicha mutación resultó en genus involved in the biological control of
un fenotipo carente de actividad antifúngica con- phytopathogens, they have been proposed as
tra diversos fitopatógenos de importancia agrícola, the most efficient metabolites for this biological
incluyendo Verticillium dahliae, Sclerotinia sclero- activity, due to its ecological role and antimicrobial
tiorum, Fusarium oxysporum, Rhizoctonia solani, capability, which explains their use in the search
Fusarium solani, Phytophthora parasítica. and selection of promissory BCA of this genus
El control eficiente de enfermedades por parte (Cawoy et al., 2015; Mora et al., 2015).
de los agentes de control biológico requiere que és-
tos sean capaces de establecerse e interactuar con Production of lytic enzymes
su planta hospedera (Pérez-García et al., 2011).
Así, además de la antibiosis, los lipopéptidos in- The production of enzymes involved in the
fluyen en el establecimiento de Bacillus mediante degradation of the cell wall of phytopathogenic
la regulación de procesos celulares como motilidad agents is one of the most widely reported
y formación de biopelículas (Choudhary y Jhori, biological control mechanisms, in particular
2009; Xu et al., 2013). Esto último ha sido obser- against pathogens of fungal origins. The fungal cell
vado en la mutante de B. subtilis 6051 deficiente is made up of glycoproteins, polysaccharides and
en la producción de surfactinas, observándose la other components that vary according to the fungal
formación de una biopelícula irregular durante la species (Bowman and Free, 2006). The fraction

Publicación en línea, enero 2018 106

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

colonización, así como la disminución de su ca- of polysaccharides can comprise up to 80% of the
pacidad para controlar infecciones causadas por cell wall of fungi, particularly chitin (~ 10 – 20%)
Pseudomonas syringae pv. tomato en Arabidopsis and glucane (~ 50 – 60%), which are composed
thaliana (Bais et al., 2004). De manera similar, el of residues of beta-1,3-glucose and beta-1,4-N-
papel de los lipopéptidos en la motilidad de Ba- acetylglucosamine, respectively (Bowman and
cillus ha sido demostrado mediante el estudio de Free, 2006; Latgé, 2007). These polymers play a
mutantes deficientes en la producción de lipopép- crucial role in the firmness of the cell wall by a
tidos, i.e. Bacillus subtilis 168 deficiente del gen wide network of glycosidic bonds. Therefore, the
sfp, mostró perdida de la motilidad en agar semi- interference in these bonds can deteriorate the cell
sólido, sin embargo, ésta fue restablecida cuando wall of phytopathogenic fungi, causing their lysis
lipopéptidos purificados fueron agregados al medio and cell death.
de cultivo (Kinsinger et al., 2003). Debido al papel The production of lytic enzymes such as
de los lipopéptidos en múltiples procesos celulares chitinases (EC [Link]) and β-glucanases (EC
(antibiosis, formación de biopelículas y motilidad), [Link] and EC [Link]) excreted by the BCA,
su estudio aislado sobre la motilidad in situ de Ba- including the Bacillus genus, have displayed
cillus es complejo. an inhibitory effect against pathogens of fungal
No obstante que los lipopéptidos no son los úni- origins (Compant et al., 2005). These enzymes
cos metabolitos del antibioma del género Bacillus are responsible for the degradation of the main
involucrados en el control biológico de fitopatóge- polysaccharides that make up the cell wall of the
nos, éstos han sido propuestos como los metabo- fungi, by the hydrolysis of their glycosidic bonds
litos más eficientes para esta actividad biológica (Figure 5). There are currently diverse scientific
debido a su papel ecológico y capacidad antimicro- studies that report the role of these enzymes in the
biana, por lo cual se han utilizado para la búsque- in vitro antifungal activities obtained from strains
da y selección de ACB promisorios de este género of the Bacillus genus (Kishore et al., 2005; Liu et
(Cawoy et al., 2015; Mora et al., 2015). al., 2010; Shafi et al., 2017). For example, Yan et
al. (2011) demonstrated the role a chitinase in the
Producción de enzimas líticas control of Rhizoctonia solani by B. subtilis SL-13,
evaluating the inhibitory activity of the purified
La producción de enzimas involucradas en la enzyme, confronted with this pathogen. Chien-Jui
degradación de la pared celular de agentes fitopató- et al. (2004) cloned the gene chiCW of B. cereus
genos es uno de los mecanismos de control bioló- 28-9 on Escherichia coli DH5α and showed that
gico más reportados, especialmente contra patóge- the purified products presented a high inhibitory
nos de origen fúngico. La pared celular de hongos activity in the germination of Botrytis elliptica
está conformada por glicoproteínas, polisacáridos spores. Likewise, Martínez-Absalón et al. (2014)
y otros componentes que varían según la especie observed that when placing liquid B. thuringiensis
fúngica (Bowman y Free, 2006). La fracción de UM96 supernatants in the specific inhibitor of
polisacáridos puede comprender hasta un 80% de chitinases, alosamidine, they lost their ability to
la pared celular de hongos, encontrándose princi- inhibit the growth of Botrytis cinerea, thus showing
palmente quitina (~ 10 – 20%) y glucano (~ 50 – the importance of chitinases on the biological
60%), los cuales están compuestos por residuos de control activity of the strain. Similarly, different
beta-1,3-glucosa y beta-1,4-N-acetilglucosamina, authors have reported β-glucanases as important

Publicación en línea, enero 2018 107

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

respectivamente (Bowman y Free, 2006; Latgé, components in the activity for the biological
2007). Estos polímeros tienen un papel estructural control strains of the Bacillus genus; Aktuganov et
determinante en la rigidez de la pared celular, me- al. (2007), reported that β-1,3-glucanases are the
diante una red extensa de enlaces glucosídicos. Así, main lytic enzymes involved in the in vitro control
la interferencia en estos enlaces puede deteriorar la of Bipolaris sorokiniana by Bacillus sp. 739, and
pared celular de hongos fitopatógenos, provocando in studies with B. amyloliquefaciens MET0908,
su lisis y muerte celular. with the aid of scanning electronic microscopy,
La producción de enzimas líticas como quiti- the lytic activity of a β -1,3-glucanases on the
nasas (EC [Link]) y β-glucanasas (EC [Link] y Colletotrichum lagenarium hyphae was observed.
EC [Link]) excretadas por los ACB, incluyendo Also, genetic engineering studies focused on
al género Bacillus, han mostrado un efecto inhibi- the increase of antifungal activity of Bacillus
torio contra patógenos de origen fúngico (Compant strains have successfully achieved the insertion of
et al., 2005). Estas enzimas son responsables de la codifying genes into lytic enzymes, such as gene
degradación de los principales polisacáridos que ChiA of B. subtilis F29–3 in B. circulans, obtaining
conforma la pared celular de hongos, mediante la a more aggressive phenotype against Botrytis
hidrólisis de sus enlaces glucosídicos (Figura 5). elliptica (Chen et al., 2004). In addition, Zhang
Actualmente, existen diversos estudios científicos et al. (2012) significantly increased the antifungal
que reportan el papel de estas enzimas en la acti- activity of Burkholderia vietnamiensis P418 in
vidad antifúngica in vitro obtenidas de cepas del the face of different fungal phytopathogens by the
género Bacillus (Kishore et al., 2005; Liu et al., chromosomal insertion of the gene Chi113, from a
2010; Shafi et al., 2017). Por ejemplo, Yan et al. B. Subtilis strain.
(2011) demostraron el papel de una quitinasa en el
control de Rhizoctonia solani por B. subtilis SL- Production of siderophores
13, evaluando la actividad inhibitoria de la enzima
purificada y confrontada contra dicho patógeno. Iron (Fe) is an essential nutrient for important
Chien-Jui et al. (2004) clonaron el gen chiCW de B. cell functions, such as in redox reactions of proteins

Figura 5. Degradación de la pared celular de hongos fitopatógenos por enzimas líticas. Modificado de Moebius et al. (2014).
Figure 5. Degradation of the cell walls of plant pathogenic fungi by lytic enzymes. Modified from Moebius et al. (2014).

Publicación en línea, enero 2018 108

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

cereus 28-9 en Escherichia coli DH5α y demostra- with cofactors (Fe-S), in the electron transportation
ron que los productos purificados presentaron una chain, and catalyzing vital enzyme reactions, such
alta actividad inhibitoria en la germinación de es- as those involving hydrogen, oxygen and nitrogen
poras de Botrytis elliptica. Así también, Martínez- (Faraldo-Gómez and Sansom, 2003). Fe is found
Absalón et al. (2014) observaron que al someter so- in nature mostly in a ferric form (Fe3+) with a low
brenadantes líquidos de B. thuringiensis UM96 al solubility, making its use impossible for some live
inhibidor especifico de quitinasas, alosamidina, és- beings (Aguado-Santacruz et al., 2012). In response
tos perdieron la capacidad de inhibir el crecimiento to the iron restriction in the environment, some
de Botrytis cinerea, evidenciando la importancia de microorganisms have developed diverse receptor
las quitinasas en la actividad de control biológico de protein structures with low molecular weights and
dicha cepa. De manera similar, diferentes autores high affinity to iron, called siderophores, facilitating
han reportado a las β-glucanasas como componen- the capturing of Fe+3 (Thyagarajan et al., 2017).
tes importantes en la actividad control biológico de Siderophores are secondary metabolites that act as
cepas del género Bacillus; Aktuganov et al. (2007), iron sequestrants or chelators, as a consequence of
reportaron que las β-1,3-glucanasas son las princi- their high dissociation constant due to this metal,
pales enzimas líticas involucradas en el control in fluctuating between 1022 and 1055. This allows for
vitro de Bipolaris sorokiniana por Bacillus sp. 739, the formation of Fe3+- siderophore complexes, so
y en estudios con B. amyloliquefaciens MET0908 siderophore-producing microorganisms, using a
se evidenció a través de microscopia electrónica de specific receptor located in the membrane, can use
barrido la actividad lítica de una β -1,3-glucana- it using two mechanisms: 1) directly with the Fe3+-
sas sobre las hifas de Colletotrichum lagenarium. siderophore complex through the cell membrane,
Además, estudios de ingeniería genética enfoca- or 2) reducing extracellularly to Fe2+ complexes
dos a incrementar la actividad antifúngica de cepas (Neilands, 1995) (Figure 6-A). Siderophores,
de Bacillus han logrado exitosamente la inserción based on their main chelating group, are
de genes codificantes a enzimas líticas, tal como classified into: hydroxamates (using hydroxamic
el gen ChiA de B. subtilis F29–3 en B. circulans, acids), catecholates (containing catechol rings),
obteniendo un fenotipo más agresivo contra Bo- carboxylates, phenolates, and in a combination of
trytis elliptica (Chen et al., 2004). Además, Zhang two or more of these groups (Wilson et al., 2016)
et al. (2012) incrementaron significativamente la (Figure 6-B). A wide diversity of strains with the
actividad antifúngica de Burkholderia vietnamien- capacity of biological control belonging to the
sis P418 frente a diferentes fitopatógenos fúngicos Bacillus genus have shown the ability to synthesize
mediante la inserción cromosómica de gen Chi113, siderophores, regulating the concentration of
proveniente de una cepa de B. subtilis. iron in the medium through its chelation (Fe3+-
siderophore), causing this metal to become
Producción de sideróforos unavailable for pathogenic microorganisms, which
depend highly on this element for growth (Scharf
El hierro (Fe) es un nutriente esencial para im- et al., 2014). On the other hand, the formation of
portantes funciones celulares, tales como en las such complexes does not affect the development
reacciones redox de las proteínas con cofactores of the plants, since most of them can grow in
(Fe-S), en la cadena de transporte de electrones, y lower iron concentrations than required by these

Publicación en línea, enero 2018 109

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

catalizando reacciones enzimáticas vitales, como biological control agents; likewise, some plants
aquellas en las que se encuentra involucrado el hi- have the ability to use these microbial complexes,
drógeno, oxígeno y nitrógeno (Faraldo-Gómez y increasing their bioavailability to this element
Sansom, 2003). El Fe es encontrado en la naturaleza (Aguado-Santacruz et al., 2012).
mayormente en forma férrica (Fe3+) de baja solu- In this way, several species of the Bacillus genus
bilidad, imposibilitando su uso por algunos seres have been reported for their ability to control plant
vivos (Aguado-Santacruz et al., 2012). En respues- diseases by the secretion of siderophores, limiting
ta a la restricción de hierro en el ambiente algunos the growth and colonization of iron-dependent
microorganismos han desarrollado diversas estruc- phytopathogenic microorganisms (Fgaier and
turas proteicas receptoras, de bajo peso molecular Eberl, 2011). Yu et al. (2011) showed, in co-culture
y con alta afinidad por el hierro, llamadas siderófo- tests in chrome azurol sulfonate (CAS) agar slides
ros, facilitando la captación de Fe+3 (Thyagarajan et that B. subtilis CAS15 strongly antagonized the
al., 2017). Los sideróforos son metabolitos secun- growth of 15 pathogenic fungi belonging to the
darios que actúan como secuestrantes o quelantes genera of Fusarium, Colletotrichum, Pythium,
de hierro, consecuencia de su elevada constante de Magnaporthe and Phytophthora, with inhibition
disociación por este metal, oscilando entre 1022 y rates in the interval of 19 to 94%, attributing
1055. Lo cual permite la formación de complejos this effect to the catecholate siderophores
Fe3+- sideróforo, así los microorganismos produc- (Bacillibactin), identified by ESI-MS and DHB.
tores de sideróforos, mediante un receptor especí- Similarly, May et al. (2001) reported the potential
fico localizado en la membrana, pueden utilizarlo of strains of the Bacillus genus on the production of
por dos mecanismos: 1) directamente mediante el siderophores by the analysis of genes involved in
complejo Fe3+- sideróforo a través de la membrana the synthesis of Bacillibactin (BB), particularly in
celular, o 2) reducido extracelularmente a comple- B. subtilis, observing that the mutant strain JJM405
jos Fe2+ (Neilands, 1995) (Figura 6-A). Los side- in gene dhb, presented a limited production of BB,
róforos en función de su principal grupo quelante while ATCC21332 (wild strain) presented a higher
se clasifican en: hidroxamatos (utilizando ácidos production of this siderophore.
hidroxámicos), catecolatos (conteniendo anillos
catecol), carboxilatos, fenolatos, y en combinación Production of δ-endotoxins
de dos o más de estos grupos (Wilson et al., 2016)
(Figura 6-B). Una amplia diversidad de cepas con δ-endotoxins, produced particularly by Bacillus
capacidad de control biológico pertenecientes al thuringiensis (Bt), are protein parasporal bodies
género Bacillus han mostrado la capacidad de sin- made up of polypeptide units of different molecular
tetizar sideróforos, regulando la concentración de weights, from 27 to 140 kDa. There are currently
hierro en el medio a través de su quelación (Fe3+- 300 reported holotypes of Bt toxins, classified inti
sideróforo), ocasionando que este metal no se en- 73 Cry and 3 Cyt families (Porcar and Juárez, 2004;
cuentre disponible para microorganismos patóge- Xu et al., 2014). Bt toxins are produced during
nos, cuyo crecimiento es altamente dependiente de the sporulation phase; the Cry (crystal) protein is
este elemento (Scharf et al., 2014). Por otra parte, known for its toxic effects in an objective organism
la formación de dichos complejos no afecta el de- (most belong to the order of insects); likewise,
sarrollo de las plantas, la mayoría de ellas pueden Cyt (cytolitic) protein has been related to toxic

Publicación en línea, enero 2018 110

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Figura 6. Los sideróforos como mecanismo de inhibición a fitopatógenos. A) Captura y solubilización de hierro, B) princi-
pales estructuras quelantes de los sideróforos. Modificado de Neilands (1995); Wilson et al. (2016).
Figure 6. Siderophores as a mechanism for the inhibition of plant pathogens. A) Capture and solubilization of iron, B) main
chelating structures of siderophores. Modified from Neilands (1995); Wilson et al. (2016).

crecer en concentraciones de hierro inferiores que effects on a large variety of insects, particularly
aquellas requeridas por estos agentes de control diptera; however, its cytotoxicity has been tested
biológico, así mismo algunas plantas presentan on mammal cells (Soberón and Bravo, 2007).
la capacidad de aprovechar estos complejos Cry proteins are widely used for their efficiency
microbianos, incrementando su biodisponibilidad in the biological control of insects, the action
a este elemento (Aguado-Santacruz et al., 2012). mechanism of which begins once the Cry proteins
Así, diversas especies de género Bacillus han are processes proteolytically through proteases
sido reportadas por su capacidad para controlar en- present in the host’s middle intestine, separating
fermedades de plantas mediante la secreción de si- a section of amino acids in the N-terminal region
deróforos, limitando el crecimiento y colonización and in the C-terminal end (depending on the
de microorganismos fitopátogenos dependientes nature of the Cry protein), thus releasing active
hierro (Fgaier y Eberl, 2011). Yu et al. (2011) de- and toxic fragments that interact with the receptor
mostraron en ensayos de co-cultivo en placas de proteins present in the intestine cells (Figure 7).
agar cromo azurol sulfonato (CAS) que B. subtilis These fragments are acknowledged by specific
CAS15 antagonizó fuertemente el crecimiento de receptors in the membrane and inserted through the
15 patógenos fúngicos, pertenecientes a los géne- cadherin (1), giving rise to a series of signals for
ros de Fusarium, Colletotrichum, Pythium, Magna- the formation of a pre-porous oligomeric structure
porthe y Phytophthora, con tasas de inhibición que (2-3), and consequently lytic porous (4), which
se ubicaron en el intervalo de 19 a 94%, atribuyendo triggers an osmotic imbalance, which destroys the

Publicación en línea, enero 2018 111

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

este efecto a sideróforos de tipo catecolato (Bacilli- intestinal epithelium and the consequent cell death
bactina), identificado por ESI-MS y DHB. De for- (5) (Portela-Dussán et al., 2013; Xu et al., 2014).
ma similar, May et al. (2001) reportaron el poten- Several authors have reported the potential of Cry
cial de cepas del género Bacillus sobre la produc- proteins in the toxicity of agriculturally important
ción de sideróforos mediante el análisis de genes pests. For example, Niedmann and Meza-Basso
involucrados en la síntesis de Bacillibactina (BB), (2006) point out that the tomato leafminer (Tuta
particularmente en B. subtilis, observando que la absoluta) causes losses of between 60 and 100%
cepa mutante JJM405 en el gen dhb, presentó una of the crops that are not treated with insecticides,
limitada producción de BB, mientras ATCC21332 thus showing the potential of Bt, highlighting
(cepa silvestre) presentó una mayor producción de that in tests run on tomato leaves with added Cry
este sideróforo. protein concentrates extracted from strains LM-11,
LM-12, LM-14 and LM-33 of Bt, mortality was
Producción de δ-endotoxinas reduced to between 20 and 60% of the T. Absoluta
larvae, which would suggest the reduction in losses
Las δ-endotoxinas, producidas particularmente of up to 12 and 60%. On the other hand, Vázquez-
por Bacillus thuringiensis (Bt), son cuerpos para- Ramírez et al. (2015) highlight the prevailing
esporales proteicos conformados por unidades po- role Bt strains can take against the pest of the fall
lipeptídicas de diferentes pesos moleculares, desde armyworm (Spodoptera frugiperda), on biotests
27 a 140 kDa. Actualmente se han reportado 300 carried out with Cry protein extracts obtained from
holotipos de toxinas Bt, clasificándose en 73 fa- strains LBIT-13, LBIT-44, LBIT-383, LBIT-418
milias Cry, y 3 Cyt (Porcar y Juárez, 2004; Xu et and LBIT-428 of Bt, showed that they all had a
al., 2014). Las toxinas Bt son producidas durante toxic effect on the fall armyworm, although strains
la fase de esporulación, la proteína Cry (cristal) es LBIT-13 and LBIT-418 showed a high toxicity
conocida por sus efectos tóxicos específicos en un towards S. frugiperda, with CL50 of 137.2 and
organismo objetivo (la mayoría pertenece al orden 197.2 ng cm-2, respectively, in comparison with the
de los insectos), así mismo las proteínas Cyt (cito- commercial standard HD-1 (CL50 of 142 ng cm-2).
lítica) han sido relacionadas con efectos tóxicos so-
bre una gran variedad de insectos, principalmente Induced systemic response
dípteros; sin embargo, también se ha comprobado
su citotoxicidad contra células de mamíferos (So- Throughout evolutionary history, plants have
berón y Bravo, 2007). developed mechanisms to defend themselves
Las proteínas Cry se encuentran ampliamente against the invasion of pathogenic organisms
utilizadas por su eficacia en el control biológico de (bacteria, fungi, nematodes, insects, etc.). These
insectos, cuyo mecanismo de acción inicia una vez mechanisms are latent and are activated by stimuli
que las proteínas Cry son procesadas proteolítica- during the interaction with pathogenic agents. In
mente a través de proteasas presentes en el intesti- general terms, these mechanisms are known as
no medio del huésped, separando una sección de systemic acquired resistance (SAR) and become
aminoácidos en la región N-terminal y en el extre- activated, not only in the site of the infection, but
mo C-terminal (dependiendo de la naturaleza de la systemically in other tissues (Pieterse et al., 2014).
proteína Cry), liberando así fragmentos activos y SAR is activated by stimuli perceived mainly
tóxicos que interactúan con las proteínas receptoras by two receptors, the PRRs (pattern recognition

Publicación en línea, enero 2018 112

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

presentes en células intestinales (Figura 7). Estos receptors) and NB-LRRs (nucleotide-binding-
fragmentos son reconocidos por receptores especí- leucine-rich repeat) (Pieterse et al., 2014). The
ficos en la membrana e insertados a través de la former perceives cell components such as fungal
caderina (1), dando sucesión a una serie de señales chitin or flagellins (PAMPs o MAMPs, pathogen o
para la formación de una estructura oligomérica microbe associated molecular patterns) triggering
pre-poro (2-3) y consecuentemente el poro lítico the first line of defense, known as PTI (PAMP-
(4), por el cual se efectúa un desequilibrio osmó- triggered immunity). In pathogens with mechanisms
tico, que finalmente destruye el epitelio intestinal for the evasion of PTI, a second line of defense
y en consiguiente la muerte celular (5) (Portela- is activated, which perceives virulence effector
Dussán et al., 2013; Xu et al., 2014). proteins via receptors NB-LRRs (Boller et al.,
Diversos autores han reportado el potencial de 2009). SAR depends on the signaling of salicylic
las proteínas Cry en la toxicidad de plagas de im- acid (SA), which activates PR (pathogenesis-
portancia agrícola. Por ejemplo, Niedmann y Me- related) genes by codifying many of them to PR
za-Basso (2006) señalan que la polilla del tomate proteins with antimicrobial ability (e.i. PR1) (Vlot
(Tuta absoluta) ocasiona pérdidas de un 60 al 100% et al., 2009).
de los cultivos que no son tratados con insecticidas, Similarly to SAR, the systemic response in
con ello, demuestran el potencial de Bt destacando plants may be induced (ISR, induced systemic
que en ensayos en hojas de tomate adicionadas con resistance) by chemical signals (elicitors) produced
concentrados de proteínas Cry extraías de las cepas by beneficial microorganisms (Pérez-Montaño
LM-11, LM-12, LM-14 y LM-33 de Bt, se logró et al., 2014) (Figure 3-E). Despite SAR and ISR
la mortalidad entre un 20 y 60% de las larvas de T. being considered synonymous due to the similarity
absoluta, lo cual sugeriría la disminución de las pér- between the mechanisms (Pieterse et al., 2014),
didas en un 12 y 60%. Por otra parte, Vázquez-Ra- signaling in ISR depends on the jasmonic acid
mírez et al. (2015) destacan el papel preponderante and ethylene (Pieterse, 1998The protection of

Figura 7. El mecanismo de acción de las proteínas Cry en insectos. Modificado de Xu et al. (2014).
Figure 7. Action mechanism of Cry proteins in insects. Modified from Xu et al. (2014).

Publicación en línea, enero 2018 113

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

que pueden ocupar cepas de Bt contra la plaga del agriculturally important crops (tomato, peppers,
gusano cogollero del maíz (Spodoptera frugiperda), bean, rice, etc.) by inducing the systemic response
en bioensayos realizados con extractos de proteínas using strains of the Bacillus genus has been
Cry obtenidos de las cepas LBIT-13, LBIT-44, documented (Akram et al., 2016; Choudhary and
LBIT-383, LBIT-418 y LBIT-428 de Bt, demostra- Johri, 2009; Wang et al., 2013; Yi et al., 2013).
ron que todas ellas tenían un efecto tóxico en el Bacillus produces a large diversity of eliciting
gusano cogollero, sin embargo, las cepas LBIT-13 molecules that induce a systemic response in
y LBIT-418 mostraron alta toxicidad hacia S. fru- plants, including lipopeptides (Chowdhury et
giperda, con CL50 de 137.2 y 197.2 ng cm-2, res- al., 2015), phytohormones (Ryu et al., 2003) and
pectivamente, esto en comparación con el estándar volatile compounds (Kim et al., 2015). The latter
comercial HD-1 (CL50 de 142 ng cm-2). activate PR genes, which protect from the invasion
of pathogenic genes. This has been observed in
Respuesta sistémica inducida tobacco plants, where PR2 codifies for one β-1,3
glucanase and PR3 codifies for one chitinase, they
Durante la historia evolutiva, las plantas han de- were activated in response to volatile compounds
sarrollado mecanismos para defenderse de la inva- of Bacillus sp. JS, conferring resistance to
sión de organismos patógenos (bacterias, hongos, Rhizocronia solani and Phytophthora nicotianae
nematodos, insectos, etc.). Dichos mecanismos se (Kim et al., 2015). Along with PR genes, Bacillus
encuentran latentes y son activados por estímulos activates other plant protection mechanisms, which
durante la interacción con agentes patógenos. En include structural changes in the cell wall with
términos generales, estos mecanismos se conocen the accumulation of lignin (Singh et al., 2016) or
como resistencia sistémica adquirida (SAR del in- the production or secondary metabolites such as
glés, systemic acquiered resistance) y se caracteri- flavonoids, phytoalexins, auxins or glucosinolates
za por activarse no solo en el sitio de la infección, in general (Pretali et al., 2016). Despite the plant
sino de manera sistémica en otros tejidos (Pieterse protection mechanisms induced by elicitors being
et al., 2014). activated by different metabolically routes, a
SAR es activado a través de estímulos per- microorganism can activate multiple protection
cibidos principalmente por dos receptores, los mechanisms. This has been observed in wheat
PRRs (pattern recognition receptors) y NB-LRRs plants, where after the inoculation of Bacillus
(nucleotide-binding-leucine-rich repeat) (Pieterse amyloliquefaciens B-16, the production of multiple
et al., 2014). El primero de éstos percibe compo- PR proteins and secondary metabolites such as
nentes celulares como quitina fúngica o flagelinas gallic acid and ferulic acid was induced, conferring
(PAMPs o MAMPs, pathogen o microbe associated resistance against Bipolaris sorokiniana (Singh et
molecular patterns) desencadenando la primera lí- al., 2016).
nea de defensa, conocida como PTI (PAMP-trig-
gered inmmunity). En patógenos con mecanismos The Bacillus genus and pesticides
para evadir a PTI, una segunda línea de defensa es
activada, la cual percibe proteínas efectoras de vi- The use of chemical pesticides as the main
rulencia mediante receptores NB-LRRs (Boller et method for the control of pests and diseases
al., 2009). SAR es dependiente de la señalización in agriculture has helped increase agricultural

Publicación en línea, enero 2018 114

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

de ácido salicílico (SA), el cual, activa genes PR productivity significantly in the past decades.
(pathogenesis-related) codificando muchos de ellos However, their excessive use has created
a proteínas PR con capacidad antimicrobiana (e.i. resistance to these compounds by phytopathogenic
PR1) (Vlot et al., 2009)De manera similar al SAR, microorganisms, while having harmful effects on
la respuesta sistémica en plantas puede ser inducida human health and the environment. This shows
(ISR, induced systemic resistance) por señales quí- the need to generate efficient and environmentally
micas (elicitores) producidas por microorganismos friendly alternatives to reduce the use of synthetic
benéficos (Pérez-Montaño et al., 2014) (Figura products in order to achieve an efficient and
3-E). No obstante que SAR e ISR son considerados sustainable control of diseases in agricultural crops
sinónimos debido a la similitud entre los mecanis- (Pérez-García et al., 2011).
mos (Pieterse et al., 2014), la señalización en ISR Biological control is an important part of the
es dependiente del ácido jasmónico y etileno (Pie- management of pests and diseases, and it consists of
terse, 1998). the use of living organisms to reduce and maintain
La protección de cultivos de importancia agrí- the abundance of a pest or pathogen below the
cola (tomate, pimiento, frijol, arroz, etc.) mediante levels of economic damage. The potential of this
la inducción de respuesta sistémica utilizando ce- alternative is based on an efficient control of a pest
pas del género Bacillus ha sido bien documentada or disease in the middle and long terms, compatible
(Akram et al., 2016; Choudhary and Johri, 2009; with a low environmental risk and a sustainable
Wang et al., 2013; Yi et al., 2013). Bacillus produ- production. In this way, the management of
ce una gran diversidad de moléculas elicitoras que pests and diseases can be carried out by several
inducen respuesta sistémica en plantas, incluyendo methods: the use of synthetic pesticides, crops
a lipopéptidos (Chowdhury et al., 2015), fitohor- modified genetically to resist pests, biological
monas (Ryu et al., 2003) y compuestos volátiles control or the combination of one or more of these
(Kim et al., 2015). Estos últimos activan genes PR, strategies. Biopesticides are a particular group of
los cuales protegen de la invasión de agentes pató- tools for the protection of crops used in the MIPE.
genos. Este hecho ha sido observado en plantas de Although there is not a formal definition for this
tabaco, donde PR2 codifica por una β-1,3 glucanasa term, a biopesticide refers to an agent produced at
y PR3 codifica por una quitinasa, fueron activados a massive scale, from a living microorganism or a
en respuesta a compuestos volátiles de Bacillus sp. natural product, and sold for the control of pests
JS, confiriendo resistencia ante Rhizocronia solani or diseases in plants (this definition covers most
y Phytophthora nicotianae (Kim et al., 2015). Ade- of the products classified as biopesticides, within
más de genes PR, Bacillus activa otros mecanis- the countries of the Organization for the Economic
mos de protección en plantas, los cuales incluyen Co-operation and Development, OCDE, 2009).
cambios estructurales en la pared celular median- Biopesticides can be classified into three groups,
te la acumulación de lignina (Singh et al., 2016) depending on the active substance: i) biochemical
o la producción de metabolitos secundarios como products, that mainly comprise secondary
flavonoides, fitoalexinas, auxinas o glucosinolatos metabolites of plants and microorganisms; ii) semi-
en general (Pretali et al., 2016). No obstante que chemical products, mostly made up of pheromones;
los mecanismos de protección de plantas indu- and iii) microorganisms, which include bacteria,
cidos por elicitores son activados por diferentes viruses, fungi, and protozoa (Chandler et al., 2011).

Publicación en línea, enero 2018 115

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

rutas metabólicas, un microorganismo es capaz de Of the commercially available microbial

activar múltiples mecanismos de protección. Esto pesticides, Bacillus is the most widely exploited
último ha sido observado en plantas de trigo, donde in agricultural biotechnology, with 85% of the
tras la inoculación de Bacillus amyloliquefaciens bacterial products, due to its large metabolic
B-16, se indujo producción de múltiples proteínas versatility that allow it to perform a biological
PR y metabolitos secundarios como ácido gálico y control of pests and diseases through diverse
ácido ferúlico, confiriendo resistencia contra Bipo- mechanisms. Also, this bacterial genus is able to
laris sorokiniana (Singh et al., 2016). produce endospores, which are the main active
ingredient of the formulae, and confer to them – as
El género Bacillus y los bioplaguicidas a property – a greater viability in time (Ongena and
Jaques, 2008).
El uso de plaguicidas químicos como principal One of the biological control mechanisms that
método de control de plagas y enfermedades en la has been most exploited in the biopesticides market
agricultura, ha permitido incrementar significati- is the ability of the Bacillus genus of producing
vamente la productividad agrícola en las últimas δ-endotoxins. This mechanism was the milestone in
décadas; sin embargo, su uso excesivo ha origina- the development of the first microbial biopesticide
do resistencia a estos compuestos por microorga- for the biological control of lepidoptera, produces
nismos fitopatógenos, y a su vez se han asociado from B. thuringiensis var. kurstaki HD-1. As
efectos nocivos a la salud humana, y al medio am- mentioned earlier, B. thuringiensis (Bt) produces
biente. Lo anterior, hace evidente la necesidad de Cry proteins (Bt- δ endotoxins) during spore
generar alternativas eficientes y amigables con el formation, which is capable of producing lysis
ambiente para reducir el uso de productos sintéti- in cells of the digestive tract when consumed by
cos, logrando de esta manera un manejo eficaz y susceptible insects. Strain HD-1 is one of the most
sustentable del control de enfermedades en los cul- studied strains, since it characteristically carries
tivos agrícolas (Pérez-García et al., 2011). varieties of cry antilepidoptera genes: cry1Aa,
El control biológico es una parte importante para cry1Ab, cry1Ac, cry2Aa, cry2Ab and cry1Ia (Höfte
el manejo de plagas y enfermedades, que consiste and Whiteley, 1989; Sauka and Benintende, 2008).
en la utilización de organismos vivos para reducir y Currently, B. Thuringiensis-based products
mantener la abundancia de una plaga o un patógeno account for 75% of the biopesticides sold globally
por debajo de los niveles de daño económico. El (Olson, 2015), with a substantial impact on the
potencial de esta alternativa se fundamenta en un Mexican biopesticide market since 1980. In
control eficiente de una plaga o enfermedad a me- Mexico, the use of Bt-based formulae is an efficient
diano y largo plazo, compatible con un bajo riesgo formula for the control of insects and it accounts for
ambiental, y una producción sustentable. Así, el between 4 and 10% of the total of insecticides used
manejo de plagas y enfermedades se puede llevar for maize, cotton and vegetable crops (Tamez et al.,
a cabo por varios métodos alternativos: el uso de 2001). Likewise, other species of the Bacillus genus,
plaguicidas sintéticos, cultivos genéticamente mo- such as: B. subtilis, B. pumilus, B. licheniformis and
dificados resistentes a plagas, el control biológico, B. amyloliquefaciens, stand out for their successful
o bien la combinación de una o más de estas estra- implementation in commercial formulations, and
tegias. Los bioplaguicidas son un grupo particular those developed mainly for the control of fungal

Publicación en línea, enero 2018 116

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

de herramientas de protección de cultivos utiliza- diseases (Table 1). For example, Galindo et al.,
dos en el MIPE, aunque no existe una definición (2015) developed the first Mexican wide-spectrum
formalmente para este término, un bioplaguicida biofungicide “Fungifree AB”, produced with viable
hace referencia a un agente producido en masa a B. subtilis 83 spores. This bacteria is a natural
partir de un microorganismo vivo o un producto antagonist to diverse phytopathogens, used to
natural, y comercializado para el control de plagas prevent at least 8 pathogens of different etiologies:
o enfermedades de plantas (esta definición abar- Colletotrichum, Erysiphe, Leveillula, Botrytis,
ca la mayoría de los productos clasificados como Sphaerothecamacularis, in over 20 agriculture
bioplaguicidas, dentro de los países de la Organi- crops; They even indicate that the success of its
zación de Cooperación y Desarrollo Económicos) formula resides, not only in the support provided by
(OCDE, 2009). Los bioplaguicidas pueden ser cla- scientists, but also in the publication of its results
sificados en tres tipos, de acuerdo con la sustancia in a journal read by professionals in agribusiness,
activa: i) productos bioquímicos, que comprenden thus allowing the linked that bonded crop exporting
principalmente metabolitos secundarios de plantas companies in search for sustainable alternatives
y microorganismos; ii) productos semi-químicos, that could allow them to control phytopathogens (i.
constituidos principalmente por feromonas; y iii) e. Colletotrichum gloeosporioides).
microorganismos, incluyen bacterias, virus, hon- In recent years, the chemical pesticide
gos y protozoarios, (Chandler et al., 2011). production market has declined 2% every year,
Dentro de los bioplaguicidas microbianos dis- while the production of biopesticides presents
ponibles comercialmente, Bacillus es el género an annual increase of 20% (Cheng et al., 2010).
más explotado en la biotecnología agrícola, con There are several reasons for the increasing interest
un 85% de los productos bacterianos, debido a su towards microbial biopesticides, including the
gran versatilidad metabólica que le permiten llevar limited development of resistance of pathogenic
a cabo el control biológico de plagas y enfermeda- organisms to them, a reduction in the rate of
des por diversos mecanismos. Además, este género discovery of new insecticides, a greater public
bacteriano es capaz de producir endosporas, siendo perception of the dangers related to synthetic
éstas el principal ingrediente activo de los formula- pesticides, the highest number of studies on the
dos, y confiriéndoles -como propiedad- una mayor specificity of microbial pesticides, improvements
viabilidad en el tiempo (Ongena y Jaques, 2008). in production, the technology of formulation and
Uno de los mecanismos de control biológico dissemination, as well as the interaction with
que ha sido mayormente explotado en el mercado producers and regulation bodies. In this way,
de los bioplaguicidas, es la capacidad del género biopesticides account for a small fraction of the
Bacillus de producir δ-endotoxinas. Este mecanis- global market focused on crop protection: 5%
mo fue el parteaguas en el desarrollo del primer (approximate value of $3 billion USD). However,
bioplaguicida microbiano para el control biológico biopesticides are expected to have a Compound
de lepidópteros, el cual fue elaborado a base de B. Annual Growth Rate (CAGR) of at least 8.64%
thuringiensis var. kurstaki HD-1. Como se men- by 2023, estimating a value of over $4.5 billion
cionó anteriormente, B. thuringiensis (Bt) produce USD (Olson et al., 2013; Olson, 2015). It is worth
proteínas Cry (Bt- δ endotoxinas) durante la forma- mentioning that the transition and integration of the
ción de esporas, la cual es capaz de producir lisis use of biopesticides in current agricultural practices

Publicación en línea, enero 2018 117

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

en células del tracto digestivo cuando es consumida should comply with the following requirements:
por insectos susceptibles. La cepa HD-1 es una de a) effectiveness against the pest or disease; b)
las cepas mejor estudiadas, ya que se caracte- compatibility with other control methods; c)
riza por la portación de variedad de genes cry low or no environmental impact; d) long-lasting
antilepidópteros: cry1Aa, cry1Ab, cry1Ac, cry2Aa, effect on the medium; e) economy, from a cost/
cry2Ab y cry1Ia (Höfte y Whiteley, 1989; Sauka y benefit viewpoint; f) technical feasibility of its
Benintende, 2008). use; and g) acceptance by producers and society in
Actualmente, los productos a base de B. thu- general. Therefore, the use of biopesticides offers
ringiensis  representan el 75% de los bioplaguici- an opportunity to stimulate the development and
das comercializados mundialmente (Olson, 2015), modernization of current agricultural practices,
impactando sustancialmente el mercado de biopla- with the aim of contributing to food security under
guicidas nacional, desde 1980. En México, la apli- the scope of biosecurity.
cación de formulados a base de Bt representa una
alternativa eficaz para el control de insectos, pre- Discussion and perspectives of biosecurity and
sentando un porcentaje de uso de 4 a 10% del total biodiversity in the use of the Bacillus genus in
de insecticidas utilizados para los cultivos de maíz, agro-systems
algodón y hortalizas (Tamez et al., 2001). Además,
otras especies del género de Bacillus, tales como: The species of the Bacillus genus have a great
B. subtilis, B. pumilus, B. licheniformis y B. amylo- metabolic and functional diversity, promoting its
liquefaciens, destacan por su implementación exi- wide use in agriculture. In this sense, the groups of
tosa en formulaciones comerciales y desarrolladas Bacillus cereus and Bacillus subtilis are the most
principalmente para el control de enfermedades widely used. However, in terms of biosecurity,
fúngicas (Cuadro 1). Por ejemplo, Galindo et al., they should be studied broadly before being used
(2015) desarrollaron el primer biofungicida mexi- as biological control agents in the field. The group
cano de amplio espectro “Fungifree AB”, formula- of Bacillus subtilis, which includes important
do con esporas viables de B. subtilis 83. Esta bac- species for agriculture, such as B. subtilis, B.
teria es un antagonista natural de diversos fitopató- licheniformis and B. pumilus, are not traditionally
genos, utilizado para la prevención de por lo menos considered as pathogens for humans, and B.
8 patógenos de distinta etiología: Colletotrichum, subtilis has even been granted the status of QPS
Erysiphe, Leveillula, Botrytis, Sphaerothecamacu- (Qualified Presumption of Safety) by the European
laris, en más de 20 cultivos agrícolas; incluso se- Food Security Authority (EFSA, 2015). However,
ñalan que el éxito de su formulado reside, además there are some isolated cases of intoxications form
del sustento científico, en la publicación de sus re- digestive manifestations, such as the one reported
sultados en una revista de divulgación consultada by Pavic et al. (2005), pointing out B. subtilis and
por los profesionales en agronegocios, permitiendo B. licheniformis as causal agents of the intoxication
con esto el vínculo que enlazó a las compañías ex- outbreak in a kindergarten caused by the
portadoras de cultivos en búsqueda de alternativas consumption of powdered milk, which contained
sustentables que les permitiera el control de fitopa- these bacterial species. On the other hand, in the
tógenos (i. e. Colletotrichum gloeosporioides). group of Bacillus cereus made up of species such
En los últimos años, el mercado de la produc- as B. cereus, B. thuringiensis, B. anthracis, B.
ción de plaguicidas químicos ha declinado un 2% mycoides, B. seudomycoides, B. cytotoxicus and

Publicación en línea, enero 2018 118

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cuadro 1. Bacillus como ingrediente activo en formulaciones comerciales.

Table 1. Bacillus as an active ingredient in commercial formulations.

Agente de Control Producto

Patógeno Cultivos Empresa
Biológico (Año)

Erysiphe sp., Puccinia spp., Pyricularia sp., Gramíneas,

B. pumilus QST2808q Ballad Plus (2007) Rhizoctonia sp., Tilletia sp., Xanthomonas spp, oleaginosas, AgraQuest
entre otros. entre otros.
Frutales,
Serenade ASO Pythium spp., Rhizoctonia spp., Fusarium spp., Bayer
B. subtilis QST713r, s hortalizas,
(2017) Phytophthora sp., entre otros. CropScience
entre otros.
Fungifree AB Colletotrichum sp., Leveillula sp., Botrytis sp., Frutales, Agro &
B. subtilis 83t
(2012) entre otros hortalizas biotecnia
Diversas
B. subtilis var.
Rhizoctonia sp., Fusarium sp., Pythium sp., frutas, plantas
amyloliquefaciens Taegro 2 (2014) ISAGRO
Botrytis sp., entre otros. ornamentales,
FZB24u, v
entre otros.
Plantas
B. licheniformis EcoGuard-GN Colletotrichum sp., Sclerotinia sp., Rhizoctonia
ornamentales, Novozymes
SB3086w, x (2013) sp., entre otros.
entre otros.
Frutales,
B. thuringiensis var Cydia sp., Otiorhychus sp., Spodoptera sp, entre Valent
DiPel WG (2007) hortalizas, entre
kurstakiy, z otros. BioSciences
otros.

(qAgraQuest, 2007; rBayer CropScience, 2016; sEPA, 2004; tGalindo et al., 2015; uISAGRO, 2017; vEPA, 2014; wNovozymes,
2017; xEPA, 2013; yValent BioSciences, 2017; zEPA, 2007) / (qAgraQuest, 2007; rBayer CropScience, 2016; sEPA, 2004; tGalindo
et al., 2015; uISAGRO, 2017; vEPA, 2014; wNovozymes, 2017; xEPA, 2013; yValent BioSciences, 2017; zEPA, 2007).

anual, mientras que la producción de bioplaguici- B. weihenstephanensis, some strains have been
das presenta un incremento anual del 20% (Cheng identified as pathogens for humans (Ceuppens
et al., 2010). Existen varias razones para el interés et al., 2013; Kim et al., 2016). Among these, B.
creciente por los bioplaguicidas microbianos, las cereus has been identified in a large diversity of
cuales incluyen el limitado desarrollo de resisten- foods (dairy products, fresh vegetables and others),
cia por parte de los organismos patógenos a éstos, causing important worldwide epidemiological
una disminución en la tasa de descubrimiento de crises, and in some cases, even death by emetic and
nuevos insecticidas, una mayor percepción pública diarrheal infections (Oh et al., 2012; Kim et al.,
de los peligros asociados a los plaguicidas sintéti- 2016; Glasset et al., 2016). Also, B. thuringiensis
cos, el mayor número de estudios sobre la especi- strains have recently been related to intoxications
ficidad de los bioplaguicidas microbianos, mejoras caused by the ingestion of contaminated foods (Oh
en la producción, la tecnología de formulación y et al., 2012).
divulgación, así como la interacción con produc- The virulence of these species has been mainly
tores e instancias de regulación. De esta manera, related to the presence of two toxins, hemolysin BL
los bioplaguicidas representan una pequeña frac- (HBL) and the nonhemolytic enteric toxin (NHE),
ción del mercado global enfocados a la protección which form a protein complex (Kim et al., 2016).
de cultivos, el 5% (valor aproximado de $3 000.00 Other toxins have also been identified in pathogenic

Publicación en línea, enero 2018 119

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

millones de USD). Sin embargo, se espera que para strains, including cytotoxin K (cytK), enterotoxin
el 2023 los bioplaguicidas posean una tasa anual FM (entFM), enterotoxin S (entS) and enterotoxin
compuesta (CAGR) de, al menos, el 8.64%, esti- T (bceT). In strains that produce the emetic toxin
mando un valor de más de $4 500 millones de USD (toxin of high resistance to thermal treatments,
(Olson et al., 2013; Olson, 2015). Cabe mencionar extreme pH values and the activity of proteases),
que la transición e integración del uso de biopla- virulence has been related to the presence of the
guicidas en las prácticas agrícolas actuales deberá dodeca depsipeptide synthesized by non-ribosomal
cumplir con los siguientes requisitos: a) efectividad peptide synthases (NRPS) codified by genes ces,
contra la plaga o enfermedad; b) compatibilidad found in type pXO1 plasmids. Likewise, products
con otros métodos de control; c) impacto ambien- of other genes, such as hemolysin A (hlyA),
tal bajo o nulo; d) efecto duradero en el medio; e) hemolysin II and III (hlyI, hlyII), cereolysin A and
economía, desde el punto de vista costo/beneficio; B (cerA, cerB), and the pleitropic transcription
f) factibilidad técnica de su empleo; y g) aceptación factor (pclR) are involved in the pathogenicity of
por los productores y sociedad en general. Por lo these strains (Ceuppens et al., 2013).
tanto, el uso de bioplaguicidas ofrece una oportu- Historically, the classification and
nidad para estimular el desarrollo y modernización differentiation of species in the Bacillus cereus
de las prácticas agrícolas actuales con el objetivo group has been carried out using gene 16S RNAr
de contribuir a la seguridad alimentaria bajo enfo- and other characteristics such as i) virulence (B.
ques de bioseguridad. cereus), ii) content of plasmids (B. anthracis
and B. thuringiensis), iii) growth conditions (B.
Discusión y perspectivas de bioseguridad y bio- cytotoxicus and B. weihenstephanensis) and iv)
diversidad en el uso del género Bacillus en los morphological characteristics (B. mycoides and
agro-sistemas B. seudomycoides). However, in widely related
species such as B. cereus, B. anthracis and B.
Las especies del género Bacillus poseen gran thuringiensis, the differentiation using virulence
diversidad metabólica y funcional, propiciando su factors and contents of plasmids is limited, due to
amplio uso en la agricultura. En este sentido, los its loss and transference during the evolutionary
grupos de Bacillus cereus y Bacillus subtilis son history of these species (Hoffmaster et al., 2006;
los mayormente utilizados; sin embargo, en térmi- Liu et al., 2015). Recent comparative studies with
nos de bioseguridad éstos deben ser estudiados am- complete genomes using dDDH (digital DNA:
pliamente antes de su utilización como agentes de DNA hybridization) showed the distribution of cry
control biológico en el campo. El grupo de Bacillus genes and type pXO plasmids in members of this
subtilis que incluye especies de gran importancia group, showing the low correlation between the
en la agricultura como B. subtilis, B. licheniformis phylogenetic position and the presence or absence
y B. pumilus, tradicionalmente no son considerados of these plasmids (Liu et al., 2015). The above study
como patógenos para humanos, incluso a B. subtilis also showed the low resolution of the multilocus
se le ha otorgado el estado de QPS (Qualified Pre- sequence typing (MLST) for the differentiation at
sumption of Safety) por la Autoridad Europea de Se- the level of species.
guridad Alimentaria (EFSA, 2015). Sin embargo, In this way, due to the high metabolic versatility
existen algunos casos aislados de intoxicaciones with agricultural application shown by members
por manifestaciones digestivas, es así el reportado of the B. Cereus group, particularly B. cereus and

Publicación en línea, enero 2018 120

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

por Pavic et al. (2005), señalando a B. subtilis y B. B. thuringiensis, the correct identification and the
licheniformis como agentes causantes del brote de determination of its virulence for the human being
intoxicación en un jardín de niños, ocasionado por is decisive for the selection and commercialization
la ingesta de leche en polvo, la cual contenía dichas of biological control agents of these species.
especies bacterianas. Por otra parte, en el grupo de Although the study of comparative genomics using
Bacillus cereus conformado por especies como B. complete genomes is the only accurate alternative
cereus, B. thuringiensis, B. anthracis, B. mycoi- for the classification and determining its virulence,
des, B. seudomycoides, B. cytotoxicus y B. wei- it is important to consider that they are costly
henstephanensis, algunas cepas se han identificado tools for the discrimination of pathogenic strains
como patógenos para humanos (Ceuppens et al., during the primary process of selection of potential
2013; Kim et al., 2016). Entre éstos, B. cereus se biological control agents.
ha identificado en una gran diversidad de alimentos On the other hand, in agro-systems, soil is a
(productos lácticos, vegetales frescos, entre otros), dynamic matrix that houses a large amount (~
provocando crisis epidemiológicas importantes a 1x109 cells/gram of soil) and diversity (1x104
nivel mundial, y en algunos casos hasta la muerte, species/ gram of soil) of microorganisms (Curtis
debido a infecciones eméticas y diarreicas (Oh et et al., 2002). This edaphic microbiota plays a very
al., 2012; Kim et al., 2016; Glasset et al., 2016). important ecological part, offering several eco-
Además, recientemente, cepas de B. thuringiensis systemic services, such as i) social and ecological
han sido asociados a intoxicaciones por el consumo sustainability, ii) adaptation to, and mitigation
de alimentos contaminados (Oh et al., 2012). of, climate change, iii) biotechnological resource
La virulencia de estas especies se ha asociado for humanity, iv) cycling of water and nutrients,
principalmente a la presencia de dos toxinas, la he- and v) food security, mainly by the cycling of
molisina BL (HBL) y la toxina entérica no hemo- nutrients (van der Heijden et al., 2008), and the
lítica (NHE), los cuales forman un complejo pro- boosting of plant growth through the production of
teico (Kim et al., 2016). Además, otras toxinas se phytohormones, solubilization of nutrients (Hayat
han identificado en cepas patógenas, incluyendo la et al., 2010) and avoiding the establishment of
citotoxina K (cytK), enterotoxina FM (entFM), en- phytopathogenic agents (Compant et al., 2005).
terotoxina S (entS) y enterotoxina T (bceT). En ce- In this way, the use of biopesticides has acquired
pas que producen la toxina emética (toxina de alta great relevance in the agricultural sector, offering a
resistencia a los tratamientos térmicos, valores de sustainable alternative, focused on increasing crop
pH extremos y la actividad de proteasas), la viru- production. This generally implies the application
lencia se ha relacionado con la presencia del dode- of large populations of the microorganism of
ca depsipéptido sintetizado por sintasas de péptidos interest with the aim of promoting its establishment
no ribosomales (NRPS) codificadas por genes ces, and colonization. However, this practice may cause
encontrándose en plásmidos tipo pXO1. Asimismo, disturbances in the microbial communities of the
productos de otros genes, como la hemolisina A agro-systems (Trabelsi et al., 2013), particularly
(hlyA), hemolisina II y III (hlyI, hlyII), cereolisina when inoculating biological control agents, since
A y B (cerA, cerB), y el factor transcripción pleitró- their biological activity is not specific or selective
pico (pclR) están involucrados en la patogenicidad for the phytopathogenic agent in question, which
de estas cepas (Ceuppens et al., 2013). may cause unpredictable changes in the microbial

Publicación en línea, enero 2018 121

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Históricamente, la clasificación y diferencia- structure of said agro-systems. It is therefore

ción de especies en el grupo de Bacillus cereus important to evaluate the impact of the inoculation
se ha llevado a cabo utilizando el gen 16S RNAr of biological control agents on the structure and
y otras características como i) virulencia (B. ce- composition of the microbial communities in agro-
reus), ii) contenido de plásmidos (B. anthracis y systems, to guarantee the ecological balance, as
B. thuringiensis), iii) condiciones de crecimiento well as the desired biological effect.
(B. cytotoxicus y B. weihenstephanensis) y iv) ca- Different studies have shown the impact of the
racterísticas morfológicas (B. mycoides y B. seu- inoculation of strains with the ability for biological
domycoides). Sin embargo, en especies estrecha- control on microbial communities in different
mente relacionadas como B. cereus, B. anthracis crops. For example, Li et al. (2015) evaluated
y B. thuringiensis, la diferenciación utilizando fac- the effect of the B. subtilis strain B068150 on
tores de virulencia y contenido de plásmidos es li- the microbial communities in the rhizosphere of
mitada, debido a su pérdida y transferencia durante cucumber plants using the DGGE (denaturing
la historia evolutiva de estas especies (Hoffmaster gradient gel electrophoresis) technique. The study
et al., 2006; Liu et al., 2015). Recientemente, es- was carried out using three different soil types, with
tudios comparativos con genomas completos me- no significant changes in the microbial diversity
diante dDDH (digital DNA: DNA hybridization), related to the cucumber rhizosphere, after the
evidenciaron la amplia distribución de genes cry y inoculation of strain B068150. On the other hand,
plásmidos tipo pXO en miembros de este grupo, You et al. (2016) reported that with the inoculation
demostrando la baja correlación que existe entre of B. subtilis Tpb55, not only was the Phytophthora
posición filogenética y la presencia o ausencia de parasitica infection reduced, but significant changes
estos plásmidos (Liu et al., 2015). Además, el ante- were also observed in the microbial community
rior estudio demostró la baja resolución del análisis related to the rhizosphere of a tobacco plantation,
multilocus (MLST) para la diferenciación a nivel with an ANDRA (Amplified ribosomal 16S rDNA
de especies. restriction analysis), highlighting that the relative
Así, debido a la gran versatilidad metabólica abundance of some communities was favored,
con aplicación agrícola que exhiben miembros essentially in those belonging to the dominant fila:
del grupo de B. cereus, en especial B. cereus y B. Acidobacteria and Proteobacteria, in an increase
thuringiensis, la correcta identificación y la deter- of 2 and 10% respectively in regard to the control,
minación de su virulencia para el ser humano es yet reducing by at least 50% the relative abundance
determinante para la selección y comercialización of the communities belonging to Planctomycetes,
de agentes de control biológico de estas especies. Nitrospirae, Bacteroidetes and Chloroflexi, which
Siendo el estudio de genómica comparativa uti- may be involved in an important activity for plant
lizando genomas completos, la única alternativa development. In this way, each BCA is a particular
precisa de clasificar y determinar su virulencia, sin organism that performs its action in a specific
embargo, es importante considerar que son herra- manner, in which the studies of each microbial
mientas costosas para la discriminación de cepas strain chosen must be explored in depth in order to
patogénicas durante el proceso de selección prima- acquire further knowledge on the way to strengthen
rio de potenciales agentes de control biológico. its biological control with an effective formulation,
Por otra parte, en los agro-sistemas, el suelo es considering aspects of ecological risk and biosafety
una matriz dinámica que alberga una gran canti- for the agro-system.

Publicación en línea, enero 2018 122

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

dad (~ 1x109 células/gramo de suelo) y diversidad CONCLUSIONS

(1x104 especies/gramo de suelo) de microorganismos
(Curtis et al., 2002). Esta microbiota edáfica tienen The negative impacts of chemical pesticides
un papel ecológico muy importante ofreciendo di- on the environment has been widely documented,
versos servicios eco-sistémicos, por ejemplo: i) la include health damages, resistance to compounds
sostenibilidad social y ecológica, ii) adaptación y by phytopathogens, soil and water pollution, and
mitigación del cambio climático, iii) recurso bio- produce the need to develop sustainable alternatives
tecnológico para la humanidad, iv) ciclaje de agua to protect agricultural soils against pathogens, for
y nutrientes, y v) seguridad alimentaria, principal- example, biological control agents.
mente por el ciclaje de nutrientes (van der Heijden The Bacillus genus presents a large metabolic
et al., 2008), y la promoción del crecimiento ve- diversity involved in the biological control of
getal a través de la producción de fitohormonas, phytopathogens; given this, the academic and
solubilización de nutrientes (Hayat et al., 2010) industrial sectors have concentrated on generating
y evitando el establecimiento de agentes fitopató- commercial formulae for their use in the field, and
genos (Compant et al., 2005). De esta manera, el in the description of the main action mechanisms
uso de bioplaguicidas ha adquirido gran relevan- involved in this effect (competition for space and
cia en el sector agrícola, ofreciendo una alternativa nutrients, antibiosis, production of lytic enzymes,
sostenible enfocada a incrementar la producción secretion of toxins, inducing host resistance).
de los cultivos. Lo cual, generalmente implica la However, it is unusual for a single action
aplicación de altas poblaciones del microorganis- mechanism to be used by said antagonist for the
mo de interés con el objetivo de potenciar su es- suppression of phytopathogens in situ. In this way,
tablecimiento y colonización. Sin embargo, esta the knowledge of the mechanisms with which the
práctica puede causar perturbaciones en las comu- antagonist exerts its action is decisive for both the
nidades microbianas de los agro-sistemas (Trabelsi guarantee of its effect and for the development of
et al., 2013), aún más cuando se inoculan agentes commercial formulations, the success of which
de control biológico, ya que generalmente su ac- lies in the creation of microenvironments that
tividad biológica no es específica o selectiva para boost their biological activity without stimulating
el agente fitopatógeno en cuestión, lo cual puede the growth of the pathogen. Currently, several
generar cambios impredecibles en la estructura mi- commercial formulations consider strains of the
crobiana de dichos agro-sistemas. De esta manera, Bacillus genus as an active ingredient, due to its
es importante evaluar el impacto de la inoculación ability to colonize, reproduce easily and its high
de agentes de control biológico sobre la estructura persistence related to the formation of endospores,
y composición de las comunidades microbianas en with the latter being a characteristic of interest,
los agro-sistemas, con el objetivo de garantizar el since it allows it to live under conditions of abiotic
equilibrio ecológico, además del efecto biológico stress, making its production and long-term storage
buscado. easier. On the other hand, after the inoculation of
Diferentes estudios han demostrado el impacto biopesticides, it is possible to observe a dual effect
de la inoculación de cepas con capacidad de con- on crops due to the action of biological control
trol biológico, sobre comunidades microbianas en agents, mitigating phytopathogens and indirectly
diferentes cultivos. Por ejemplo, Li et al. (2015) promoting plant growth with the improvement

Publicación en línea, enero 2018 123

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

evaluaron el afecto de la cepa B068150 de B. subtilis of the plant’s health. However, it is necessary to
sobre las comunidades microbianas en la rizósfera de carry out basic studies in depth, which integrate
plantas de pepino utilizando la técnica de DGGE other MIPE strategies (cultural practices, chemical
(denaturing gradient gel electrophoresis). El estu- control), as well as in the correct identification of
dio se llevó a cabo utilizando tres diferentes tipos pathogenic strains for humans, such as Bacillus
de suelo, no encontrando cambios significativos cereus NS Bacillus anthracis, which are even
en la diversidad microbiana asociada a la rizósfe- potentially effective strains for the control of
ra de pepino, posterior a la inoculación de la cepa phytopathogens. The potential risk of these species
B068150. Por otra parte, You et al. (2016) repor- may be detected with taxonomy studies, β-hemolytic
taron que con la inoculación de B. subtilis Tpb55, activity, detection with defined virulence molecular
además de reducir la infección de Phytophthora markers, guaranteeing the use of biologically safe
parasítica, también se observaron cambios signi- strains for agriculture. In addition, studies on the
ficativos en la comunidad microbiana asociada a la ecological impact of the introduction of a BCA
rizósfera del cultivo de tabaco, mediante el análi- to agro-systems must be developed, since under
sis ANDRA (Amplified ribosomal 16S rDNA res- certain circumstances, they can cause changes in
triction analysis), destacando que la abundancia the microbial communities with agro-ecologically
relativa de algunas comunidades fue favorecida, unpredictable results. Finally, the success of the
esencialmente en las pertenecientes a los filos do- use of biopesticides will depend largely on the
minantes: Acidobacterias y Proteobacterias, en un innovation, research, marketing strategies and
2 y 10% de aumento respectivamente respecto al dissemination of results amongst producers and
control, sin embargo, reduciendo en al menos un the bodies in charge of making decisions related to
50% la abundancia relativa de las comunidades co- regulation and the use of this type of technologies.
rrespondientes a Planctomycetes, Nitrospirae, Bac-
teroidetes y Chloroflexi, las cuales pudiesen estar Acknowledgements
involucradas en alguna actividad importante para el
desarrollo de la planta. De esta manera, cada ACB The authors would like to thanks and acknowledge the
es un organismo particular que efectúa su acción de support given by Dr. Angélica Herrera for her suggestions
forma específica, donde los estudios de cada cepa for the improvement of this manuscript. The authors also
microbiana seleccionada se deben profundizar, con wish to thank the National Science and Technology Council
el objetivo de incrementar el conocimiento sobre la for the funding of the project 253663 “Fortalecimiento de la
forma de potenciar su control biológico mediante infraestructura del Laboratorio de Biotecnología del Recurso
una formulación efectiva, considerando aspectos Microbiano del ITSON para la creación de COLMENA:
de riesgo ecológico y la bioseguridad para el agro- Colección de Microrganismos Edáficos y Endófitos Nativos,
sistema. para contribuir a la seguridad alimentaria regional y nacional
(Fortifying the Infrastructure of the ITSON Microbial Resource
Biotechnology Laboratory for the creation of COLMENA:
CONCLUSIONES Collection of Native Edaphic and Endophytic Microorganisms,
to contribute to the regional and national food security)”
El impacto negativo de los plaguicidas quími- and project 257246 “Interacción trigo x microorganismos
cos en el ambiente se ha documentado amplia- promotores del crecimiento vegetal: identificando genes con

Publicación en línea, enero 2018 124

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

mente, tales como: daños a la salud, resistencia a potencial agro-biotecnológico (Interaction Wheat x Plant
compuestos por los fitopatógenos, contaminación Growth Promoting Microorganisms: Identifying Genes with
de suelos y mantos acuíferos, surgiendo así la ne- Agro-biotechnological Potential)”.
cesidad de desarrollar alternativas sostenibles para
proteger a los cultivos agrícolas contra organismos End of the English version

patógenos, por ejemplo, la utilización de agentes de

control biológico.
El género Bacillus presenta gran diversidad me- de la planta. Sin embargo, es necesario profundizar
tabólica involucrada para el control biológico de en estudios básicos que integren otras estrategias
fitopatógenos, así el sector académico e industrial de MIPE (prácticas culturales, control químico),
ha enfocado esfuerzos para la generación de formu- así como en la correcta identificación de cepas pa-
laciones comerciales para su aplicación en campo, togénicas para el ser humano, por ejemplo, Bacillus
y en la descripción de los principales mecanismos cereus y Bacillus anthracis, que incluso son cepas
de acción involucrados en dicho efecto (competen- potencialmente eficientes en el control de fitopató-
cia por espacio y nutrientes, antibiosis, producción genos. La detección del riesgo potencial de estas
de enzimas líticas, secreción de toxinas, inducien- especies se puede llevar a cabo mediante estudios
do la resistencia del hospedero); sin embargo, es de taxonomía, actividad β-hemolítica, detección
inusual el hecho que un único mecanismo de ac- con marcadores moleculares de virulencia defini-
ción sea utilizado por dicho antagonista para la su- dos, garantizando el uso de cepas bioseguras en la
presión de fitopatógenos in situ. De esta manera, el agricultura. Por otra parte, estudios sobre el impac-
conocimiento de los mecanismos por los cuales el to ecológico de la introducción de un ACB a los
antagonista ejerce su acción es determinante tanto agro-sistemas deben ser desarrollados, ya que bajo
para garantizar su efecto como para el desarrollo ciertas condiciones pudiesen ocasionar cambios en
de formulaciones comerciales, cuyo éxito radica en las comunidades microbianas con resultados agro-
la creación de microambientes que potencialice su ecológicamente impredecibles. Finalmente, el éxi-
actividad biológica sin estimular el desarrollo del to del uso de bioplaguicidas dependerá en gran me-
patógeno. Actualmente, diversas formulaciones dida de la innovación, investigación, eficiencia, es-
comerciales cuentan como ingrediente activo ce- trategias de marketing y divulgación de resultados
pas del género Bacillus, debido a su capacidad de entre los productores y las instancias encargadas de
colonización, fácil reproducción y alta persistencia la toma de decisiones referentes a la regulación y
asociada a la formación de endosporas, siendo esta uso de este tipo de tecnologías.
última una característica de especial interés ya que
les permite sobrevivir bajo condiciones de estrés Agradecimientos
abiótico, facilitando su producción y almacena-
miento durante largos periodos de tiempo. Por otra Los autores agradecen y reconocen el apoyo recibido por
parte, posterior a la inoculación del bioplaguicidas, la Dra. Angélica Herrera por sus sugerencias para la mejora del
es posible observar un efecto dual en los cultivos manuscrito. Además, los autores agradecen al Consejo Nacional
agrícolas por la acción de control biológico, miti- de Ciencia y Tecnología por el financiamiento del proyecto
gando a fitopatógenos e indirectamente promovien- 253663 “Fortalecimiento de la infraestructura del Laboratorio
do el crecimiento vegetal con la mejora de la salud de Biotecnología del Recurso Microbiano del ITSON para la

Publicación en línea, enero 2018 125

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

creación de COLMENA: Colección de Microrganismos Edáfi- Bayer CropScience. 2016. Serenade ASO. Disponible en lí-
nea  : [Link]
cos y Endófitos Nativos, para contribuir a la seguridad alimen- SERENADE__ASO_20170517.pdf
taria regional y nacional”; y el proyecto 257246 “Interacción Boller T and Felix G. 2009. A renaissance of elicitors: percep-
tion of microbe-associated molecular patterns and danger
trigo x microorganismos promotores del crecimiento vegetal: signals by pattern-recognition receptors. Annual Review
identificando genes con potencial agro-biotecnológico”. Plant Biology. 60:379-406. [Link]
[Link].57.032905.105346
Bowman SM and Free SJ. 2006. The structure and synthesis of
the fungal cell wall. BioEssays 28:799-808. [Link]
org/10.1002/bies.20441
LITERATURA CITADA CALS, College of Agriculture and Life Sciences. 2016. Bac-
terial Endospores. Department of Microbiology. Cornell
AgraQuest. 2007. BALLAD PLUS, Biofungicide. Disponi- University. Ithaca, Nueva York 14850, EE. UU. Dispo-
ble en línea: [Link] nible en línea: [Link]
May_2007)_Label.pdf cium/bacterial-endospores
Aguado-Santacruz GA, Moreno-Gómez B, Jiménez-Francisco Calvo P y Zúñiga D. 2010. Caracterización fisiológica de ce-
B, García-Moya E y Preciado-Ortiz RE. 2012. Impacto pas de Bacillus spp. aisladas de la rizósfera de papa (So-
de los sideróforos microbianos y fitosidéforos en la asi- lanum tuberosum). Ecología Aplicada. 9:31-39. http://
milación de hierro por las plantas: una síntesis. Revista [Link]/10.21704/rea.v9i1-2.393
Fitotecnia Mexicana. 35:9-21. Disponible en línea: http:// Cawoy H, Debois D, Franzil L, De Pauw E, Thonart P and
[Link]/[Link]?script=sci_arttext&pid Ongena M. 2015. Lipopeptides as main ingredients for
=S0187-73802012000100004 inhibition of fungal phytopathogens by Bacillus subtilis/
Akram W, Anjum T and Ali B. 2016. Phenylacetic Acid Is amyloliquefaciens. Microbial Biotechnology. 8:281-295.
ISR Determinant Produced by Bacillus fortis IAGS162, [Link]
Which Involves Extensive Re-modulation in Metabolo- Ceuppens S, Boon N and Uyttendaele M. 2013. Diversity of
mics of Tomato to Protect against Fusarium Wilt. Fron- Bacillus cereus group strains is reflected in their broad
tiers in Plant Science. 7:1-12. [Link] range of pathogenicity and diverse ecological lifestyles.
fpls.2016.0049Aktuganov GE, Galimzyanova NF, FEMS Microbiology Ecology. 84:433-450. [Link]
Melent’ev AI and Kuz’mina L. 2007. Extracellular hydro- org/10.1111/1574-6941.12110
lases of strain Bacillus sp. 739 and their involvement in Chandler D, Bailey AS, Tatchell GM, Davison G, Graves J
the lysis of micromycete cell walls. Microbiology. 76:413- and Grant WP. 2011. The development, regulation and use
of biopesticides for integrated pest management. Philosophi-
120. [Link]
cal Transactions of the Royal Society B, Biological Sciences.
Alcaraz LD, Moreno-Hagelsieb G, Eguiarte LE, Souza V,
366:1987-1998. [Link]
Herrera-Estrella L and Olmedo G. 2010. Understanding Chen CY, Wang YH and Huang CJ. 2004. Enhancement of
the evolutionary relationships and major traits of Bacillus the antifungal activity of Bacillus subtilis F29-3 by the
through comparative genomics. BMC Genomics. 11:332. chitinase encoded by Bacillus circulans chiA gene. Cana-
[Link] dian Journal of Microbiology. 50:451-454. [Link]
Aranda FJ, Teruel JA and Ortiz A. 2005. Further aspects on org/10.1139/w04-027
the hemolytic activity of the antibiotic lipopeptide iturin Chen YY, Chen PC, Tsay TT. 2016. The biocontrol efficacy and
A. Biochimica et Biophysica Acta (BBA) - Biomem- antibiotic activity of Streptomyces plicatus on the oomy-
branes. 1713:51-56. [Link] cete Phytophthora capsica. Biological Control. 98:34-42.
mem.2005.05.003 [Link]
Arellano-Aguilar O y Rendón OJ. 2016. La huella de los pla- Cheng XL, Liu CJ and Yao JW. 2010. The Current Status, De-
guicidas en México. E. Martínez. Greenpeace México A. velopment Trend and Strategy of the Bio-pesticide Indus-
C. Las Flores 35 Col. Pueblo de Los Reyes, C.P. 04330, try in China. Hubei Agricultural Sciences. 49:2287-2290.
Coyoacán, México. 39 p. Disponible en línea: [Link] Disponible en línea: [Link]
[Link]/mexico/Global/mexico/Graficos/2016/ [Link]
comida-sana/Plaguicidas_en_agua_ok_EM.pdf Chien-Jui H, Tang-Kai W, Shu-Chung C and Chao-Ying C.
Badii MH, Tejada LO, Flores AE, Lopez CE y Quiróz H. 2000. 2004. Identification of an Antifungal Chitinase from a
Historia, fundamentos e importancia. Pp: 3-17. In: Badii Potential Biocontrol Agent, Bacillus cereus 28-9. Journal
MH, Flores AE y Galán LJ (eds.). Fundamentos y Perspec- of Biochemistry and Molecular Biology. 38:82-88. http://
tivas de Control Biológico. UANL, Monterrey. [Link]/10.5483/BMBRep.2005.38.1.082
Bais HP, Fall R and Vivanco JM. 2004. Biocontrol of Ba- Choudhary DK and Johri BN. 2009. Interactions of Bacillus
cillus subtilis against infection of Arabidopsis roots by spp. and plants with special reference to induced systemic
Pseudomonas syringae is facilitated by biofilm formation resistance (ISR). Microbiological Research. 164:493-513.
and surfactin production. Plant Physiology. 134:307-319. [Link]
[Link] Chowdhury SP, Hartmann A, Gao X and Borriss R. 2015. Bio-
Bayer AG. 2016. Serenade, Fungicida Biológico, Mejorando control mechanism by root-associated Bacillus amyloli-
la Protección de Cultivos. Bayer Crop Science. Folleto Se- quefaciens FZB42 - a review. Frontiers in Microbiology.
renade. Santiago, Chile. 5p. 6:780. [Link]

Publicación en línea, enero 2018 126

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cohn F. 1872. Untersuchungen Über Bakterien. Beitrage zur Fgaier H and Eberl HJ. 2011. Antagonistic control of micro-
Biologie Pflanz. 1:127-1224. bial pathogens under iron limitations by siderophore pro-
Compant S, Duffy B, Nowak J, Clément C and Barka EA. ducing bacteria in a chemostat setup. Journal of Theore-
2005. Use of plant growth-promoting bacteria for biocon- tical Biology. 273:103-114. [Link]
trol of plant diseases: principles, mechanisms of action, and jtbi.2010.12.034
future prospects. Applied Environmental Microbiology. Galindo E, Serrano-Carreón L, Gutiérrez CR, Balderas-Ruíz
71:4951-4959. [Link] KA, Muñoz-Celaya AL, Mezo-Villalobos M y Arroyo-
4959.2005 Colín J. 2015. Desarrollo histórico y los retos tecnológi-
Curtis TP, Sloan WT and Scannel JW. 2002. Estimating cos y legales para comercializar Fungifree AB®, el primer
prokaryotic diversity and its limits. PNAS USA. 99:10494- biofungicida 100% mexicano. TIP Revista Especializada
10499. [Link] en Ciencias Químico-Biológicas. 18:52-60. [Link]
de Olivar CG, Castillo CCE, Cañizales BLM y Olivar R. 2008. org/10.1016/[Link].2015.05.005
Control Biológico: Una herramienta para el desarrollo sus- Glasset B, Herbin S, Guillier L, Vignaud M, Grout J, Pairaud S
tentable y sostenible. Academia Trujillo Venezuela. 7:50- and Ramarao N. 2016. Bacillus cereus -induced food-borne
74. Disponible en línea: [Link] outbreaks in France, 2007 to 2014: epidemiology and ge-
php/academia/article/view/6030/5831 netic characterisation. Eurosurveillance. 21:1-11. https://
de Souza R, Ambrosini A and Passaglia LMP. 2015. Plant [Link]/10.2807/[Link].2016.21.48.30413  
growth-promoting bacteria as inoculants in agricultural Gong M, Wang JD, Zhang J, Yang H, Lu XF, Pei Y and Cheng
soils. Genetics and Molecular Biology. 38:401-419. http:// JQ. 2006. Study of the Antifungal Ability of Bacillus
[Link]/10.1590/S1415-475738420150053 subtilis Strain PY-1 in vitro and Identification of its Anti-
Environmental protection agency, EPA. 2004. Office of Pes- fungal Substance (Iturin A). Acta Biochimica et Biophy-
ticide Programs Biopesticides and Pollution Prevention sica Sinica. 38:233–240. [Link]
Division (7511C). Disponible en línea: [Link] 7270.2006.00157.x
[Link]/pesticides/chem_search/ppls/070127-00012- Hayat R, Ali S, and Amara U. 2010. Soil beneficial bacteria
[Link] and their role in plant growth promotion: a review. Annals
Environmental protection agency, EPA. 2004. United Sta- of Microbiology. 60:579-598. [Link]
tes environmental protection agency. Disponible en lí- s13213-010-0117-1
nea: [Link] Hoffmaster AR, Hill KK, Gee JE, Marston CK, De B K, Popo-
ppls/[Link] vic T, Sue D, Wilkins PP, Avashia SB, Drumgoole R, Hel-
Environmental protection agency, EPA. 2007. Office of Pes- ma CH, Ticknor LO, Okinaka RT and Jackson PJ. 2006.
ticide Programs Biopesticides and Pollution Prevention Characterization of Bacillus cereus isolates associated
Division (7611C). Disponible en línea: [Link] with fatal pneumonias: strains are closely related to Ba-
[Link]/pesticides/chem_search/ppls/000004-00252- cillus anthracis and harbor B. anthracis virulence genes.
[Link] Journal of Clinical Microbiology. ca44:3352-3360. https://
Environmental protection agency, EPA. 2013. Office of che- [Link]/10.1128/jcm.00561-06 
mical safety and pollution prevention. Disponible en lí- Höfte H and Whiteley H. 1989. Insecticidal crystal proteins
nea: [Link] of Bacillus thuringiensis. Microbiological Reviews.
ppls/[Link] 53:242-255. Disponible en línea: [Link]
Errigton J. 2003. Regulation of endospore formation in Ba- content/53/2/[Link]
cillus subtilis. Nature Reviews Microbiology. 1:117-126. ISAGRO. 2017. Isagro, TAEGRO 2, biofungicide – Pro-
[Link] duct Training. Disponible en línea: [Link]
European Food Safety Authority, EFSA. 2015. Statement on [Link]/assets/taegro-2-training-presentation-usa-fi-
the update of the list of QPS-recommended biological [Link]
agents intentionally added to food or feed as notified to Jaaffar AKM, Parejko JA, Paulitz TC, Weller DM and Tho-
EFSA. 2: Suitability of taxonomic units notified to EFSA mashow LS. 2017. Sensitivity of Rhizoctonia Isolates to
until March 2015. EFSA Journal. 13:4138. [Link] Phenazine-1-Carboxylic Acid and Biological Control by
org/10.2903/[Link].2015.4138   Phenazine-Producing Pseudomonas spp. Phytopathology.
Falardeau J, Wise C, Novitsky L and Avis TJ. 2013. Ecolo- 107:692-703. [Link]
gical and mechanistic insights into the direct and indirect 0257-R
antimicrobial properties of Bacillus subtilis lipopeptides Kim JS, Lee J, Lee CH, Woo SY, Kamg H, Seo SG and
on plant pathogens. Journal of Chemical Ecology. 39:869- Kim SH. 2015. Activation of pathogenesis-related
878. [Link] genes by the rhizobacterium, Bacillus sp. JS, which in-
FAO, Food and Agriculture Organization of the United Na- duces systemic resistance in tobacco plants. Plant Patho-
tions. 2014. El estado mundial de la agricultura y la ali- logy Journal. 31:195-201. [Link]
mentación. FAO. Viale delle Terme di Caracalla 00153 NT.11.2014.0122
Roma, Italia. Disponible en línea: [Link] Kim MJ, Han JK, Park JS, Lee JS, Lee SH, Cho JI and Kim
[Link] KS. 2016. Various Enterotoxin and Other Virulence Fac-
Faraldo-Gómez JD and Sansom MS. 2003. Acquisition of side- tor Genes Widespread Among Bacillus cereus and Baci-
rophores in gram-negative bacteria. Nature Reviews Mo- llus thuringiensis Strains. Journal of Microbiology and
lecular Cell Biology. 4:105-116. [Link] Biotechnology. 25:872-879 [Link]
nrm1015 jmb.1502.02003 

Publicación en línea, enero 2018 127

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Kim Y, Kim H, Kim K, Chon J, Kim D and Seo K. 2016. High Martínez-Absalón S, Rojas-Solís D, Hernández-León R, Prie-
Occurrence Rate and Contamination Level of Bacillus to-Barajas C, Orozco-Mosqueda MC, Peña-Cabriales JJ,
cereus in Organic Vegetables on Sale in Retail Markets. Sakuda S, Valencia-Cantero E and Santoyo G. 2014. Po-
Foodborne Pathogens and Disease. 13:656-660. https:// tential use and mode of action of the new strain Bacillus
[Link]/10.1089/fpd.2016.2163 thuringiensis UM96 for the biological control of the gray
Kinsinger RF, Shirk MC and Fall R. 2003. Rapid surface mold phytopathogen Botrytis cinerea. Biocontrol Science
motility in Bacillus subtilis is dependent on extracellu- Technology. 24:1349-1362. [Link]
lar surfactin and potassium ion. Journal of Bacteriology. 83157.2014.940846
185:5627-5631. Disponible en línea: [Link] Maughan H and van der Auwera G. 2011. Bacillus taxonomy in
content/185/18/[Link] the genomic era finds phenotypes to be essential though of-
Kishore GK, Pande S and Podile AR. 2005. Biological Control ten misleading. Infection, Genetics and Evolution. 11:789-
of Late Leaf Spot of Peanut (Arachis hypogaea) with Chi- 797. [Link]
tinolytic Bacteria. Phytopathology. 95:1157-1165. http:// May JJ, Wendrich TM and Marahiel MA. 2001. The dhb ope-
[Link]/10.1094/PHYTO-95-1157 ron of Bacillus subtilis encodes the biosynthetic template
Kumar A, Prakash A and Johri BN. 2011. Bacillus as PGPR in for the catecholic siderophore 2,3-dihydroxybenzoate-
Crop Ecosystem. Bacteria in Agrobiology: Crop Ecosys- glycine-threonine trimeric ester bacillibactin. Journal
tems. 37-59. [Link] of Biological Chemistry. 276:7209-7217. [Link]
7_2 org/10.1074/jbc.M009140200
Latgé JP. 2007. The cell wall: a carbohydrate armour for the Mc Spadden GBB. 2004 Ecology of Bacillus and Paenibacillus
fungal cell. Molecular Microbiology. 66:279-290. http:// spp. in Agricultural Systems. Phytopathology. 94:1252-
[Link]/10.1111/j.1365-2958.2007.05872.x 1258. [Link]
Layton C, Maldonado E, Monroy L, Corrales LC y Sánchez Meena KR and Kanwar SS. 2015. Lipopeptides as the Antifun-
LC. 2011. Bacillus spp.; perspectiva de su efecto bio- gal and Antibacterial Agents: Applications in Food Safety
controlador mediante antibiosis en cultivos afectados and Therapeutics. BioMed Research International. 2015:1-
por fitopatógenos. Revista NOVA Publicación Cientí- 9. [Link]
fica en Ciencias Biomédicas. 9:177-187. [Link] Moebius N, Üzüm Z, Dijksterhuis J, Lackner G and Hertweck
org/10.22490/24629448.501 C. 2014. Active invasion of bacteria into living fungal
Li B, Li Q, Xu Z, Zhang N, Shen Q and Zhang R. 2014. Res- cells. Microbiology and infectious disease. 1:1-20. http://
ponse of beneficial Bacillus amyloliquefaciens SQR9 to di- [Link]/10.7554/eLife.03007
fferent soilborne fungal pathogens through the alteration of Mora I, Cabrefiga J and Montesinos E. 2015. Cyclic Lipo-
antifungal compounds production. Frontiers in Microbio- peptide Biosynthetic Genes and Products, and Inhibitory
logy. 5:636. [Link] Activity of Plant-Associated Bacillus against Phytopatho-
Li L, Ma J, Ibekwe AM, Wang Q and Yang C. 2016. Cucumber genic Bacteria. PLoS One. 10: e0127738. [Link]
Rhizosphere Microbial Community Response to Biocon- org/10.1371/[Link].0127738
trol Agent Bacillus subtilis B068150. Agriculture. 6:1-15. Neilands JB. 1995. Siderophores: structure and function of
[Link] microbial iron transport compounds. Journal of Biological
Li Y, Gu Y, Li J, Xu M, Wei Q and Wang Y. 2015. Biocontrol Chemistry. 270:26723-26726. [Link]
agent Bacillus amyloliquefaciens LJ02 induces systemic jbc.270.45.26723
resistance against cucurbits powdery mildew. Frontiers Niedmann LL y Meza-Basso L. 2006. Evaluación de Cepas
Microbiology. 6:883. [Link] Nativas de Bacillus thuringiensis Como una Alternativa de
cb.2015.00883 Manejo Integrado de la Polilla del Tomate (Tuta absoluta
Liu D, Cai J, Xie C, Liu C and Chen Y. 2010. Purification and Meyrick; Lepidoptera: Gelechiidae) en Chile. Agricultura
partial characterization of a 36-kDa chitinase from Baci- Técnica. 66:235-246. [Link]
llus thuringiensis subsp. colmeri, and its biocontrol poten- 28072006000300002
tial. Enzyme Microbial Technology. 46:252-256. http:// Novozymes. 2017. EcoGuard-GN, BioFungicide. Dis-
[Link]/10.1016/[Link].2009.10.007 ponible en línea: [Link]
Liu Y, Lai Q, Göker M, Meier-kolthoff JP, Wang M, Sun Y and newals/documentsubmit/KellyData%5CNC%5Cpes
Shao Z. 2015. Genomic insights into the taxonomic status ticide%5CProduct%20Label%5C70127%5C70127-
of the Bacillus cereus group. Scientific Reports. 5:1-11. 3%5C70127-3_ROOTS_ECOGUARD_GN_BIOFUNGI-
[Link] CIDE_12_9_2010_2_33_14_PM.pdf
López-Fernández S, Compat S, Vrhovsek U, Bianchedi PL, OECD, Organization for Economic Co-operation and De-
Sessitsch A, Pertot I and Campisano A. 2016. Grapevine velopment. 2009. Series on pesticides no. 44. Report of
colonization by endophytic bacteria shifts secondary meta- Workshop on the Regulation of Biopesticides: Registration
bolism and suggests activation of defense pathways. Plant and Communication Issues. Disponible en línea: http://
and Soil. 405:155-175. [Link] [Link]/env/ehs/pesticides-biocides/ENV-JM-
015-2631-1 MONO(2009)[Link]
LPSN, List of Prokaryotic names with Standing in Nomencla- Oh, M., Ham, J. and Cox, J. M. 2012. Diversity and toxige-
ture. 2016. Genus Bacillus. Microbiology Society. Charles nicity among members of the Bacillus cereus group. In-
Darwin House, 12 Roger St, London WC1N 2JU, United ternational Journal of Food Microbiology, 152:1-8. https://
Kingdom. [Link] (consul- [Link]/10.1016/[Link].2011.09.018
ta, mayo 2017)

Publicación en línea, enero 2018 128

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Olson S, Ranade A, Kurkjy N, Pang K and Hazekamp C. 2013. 002Raaijmakers JM and Mazzola M. 2012. Diversity and
Green Dreams or Growth Opportunities: Assessing the Natural Functions of Antibiotics Produced by Beneficial
Market Potential for “Greener” Agricultural Technologies. and Plant Pathogenic Bacteria. Annual Reviews of Phyto-
Lux Research Inc, Boston, MA, USA. Disponible en línea: pathology. 50:403-424. [Link]
[Link] phyto-081211-172908
Olson S. 2015. An analysis of the biopesticide market now and Reyes A, Ricón G, López L, Martínez ZE y Quiñones E. 2015.
where it is going. Outlooks on Pest Management. 26:203- Lucha entre microbios: una herramienta para el control
206. [Link] de enfermedades de plantas. Revista Digital Universitaria
Ongena M and Jacques P. 2008. Bacillus lipopeptides: versatile UNAM. 16:2-15. Disponible en línea: [Link]
weapons for plant disease biocontrol. Trends Microbiolgy. [Link]/vol.16/num11/art92/
16:115-125. [Link] Rudrappa T, Czymme KJ, Paré PW and Bais HP. 2008.
Pal KK and Gardener BM. 2006. Biological Control of Plant Root-Secreted Malic Acid Recruits Beneficial Soil Bac-
Pathogens. The Plant Health Instructor. 1:1-25. http:// teria. Plant Physiology. 148:1547-1556. [Link]
[Link]/10.1094/PHI-A-2006-1117-02 org/10.1104/pp.108.127613
Pavic S, Brett M, Petric N, Lastre D, Smoljanovic M and At- Ryu C-M, Hu C-H, Reddy MS and Kloepper JW. 2003. Di-
kinson M. 2005. An outbreak of food poisoning in a kin- fferent signaling pathways of induced resistance by rhi-
dergarten caused by milk powder containing toxigenic Ba- zobacteria in Arabidopsis thaliana against two pathovars
cillus subtilis and Bacillus licheniformis. Archiv Fur Le- of Pseudomonas syringae. New Phytologist. 160:413-20.
bensmittelhygiene. 56:20-22. Disponible en línea: https:// [Link]
[Link]/en/search/id/BLSE%3ARN163847095/An- Sainju UM, Lenssen AW, Allen BL, Stevens WB and Jabro
outbreak-of-food-poisoning-in-a-kindergarten/ J. 2016. Nitrogen balance in response to dryland crop
Pérez-García A, Romero D and de Vicente A. 2011. Plant rotations and cultural practices. Agriculture, Ecosystems
protection and growth stimulation by microorganisms: and Environment. 233:25-32. [Link]
biotechnological applications of Bacilli in agriculture. Cu- agee.2016.08.023
rrent Opinion in Biotechnology. 22:187-193. [Link] Sauka DH y Benintende GB. 2008. Bacillus thuringiensis: ge-
org/10.1016/[Link].2010.12.003 neralidades. Un acercamiento a su empleo en el biocontrol
Pérez-Montaño F, Alías-Villegas RA, Bellogín RA, del Ce- de insectos lepidópteros que son plagas agrícolas. Revis-
rro P, Espuny MR, Jiménez-Guerrero I, López-Baena FJ, ta argentina de microbiología. 40:124-140. Disponible en
Ollero FJ and Cubo T. 2014. Plant growth promotion in línea: [Link]
cereal and leguminous agricultural important plants: From pdf
microorganism capacities to crop production. Microbiolo- Scharf DH, Heinekamp T and Brakjage AA. 2014. Human
gical Research. 169:325-336. [Link] and Plant Fungal Pathogens: The Role of Secondary Me-
micres.2013.09.011 tabolites. PLoS Pathogens. 10(1):e1003859. [Link]
Piechulla B, Lemfack MC and Kai M. 2017. Effects of discre- org/10.1371/[Link].1003859
te bioactive microbial volatiles on plants and fungi. Plant, Selim HMM, Gomaa NM and Essa AMM. 2016. Application
Cell & Environment. 40: 2042-2067. of endophytic bacteria for the biocontrol of Rhizoctonia
[Link] solani (Cantharellales: Ceratobasidiaceae) damping-off
Pieterse CMJ, Zamioudis C, Berendsen RL, Weller DM, Van disease in cotton seedlings. Biocontrol Science and Tech-
Wees SC and Bakker PA. 2014. Induced Systemic Resis- nology. 27:81-95. [Link]
tance by Beneficial Microbes. Annual Review of Phyto- 6.1258452
pathology, 52:347-375. [Link] Shafi J, Tian H and Ji M. 2017. Bacillus species as versatile
phyto-082712-102340 weapons for plant pathogens: a review. Biotechnology and
Pieterse CMJ. 1998. A Novel Signaling Pathway Controlling Biotechnological Equipment. 31:446-459. [Link]
Induced Systemic Resistance in Arabidopsis. The Plant g/10.1080/13102818.2017.1286950
cell. 10:1571-1580. [Link] Singh UB, Malvivya D, Wasiullah, Singh S, Imran M, Pa-
Porcar M y Juárez V. 2004. Aislamiento y establecimiento de thak N, Alam M, Rai JP, Singh RK, Sarma Bk, Sharma
una colección de Bacillus thuringiensis. Pp:69-100. In: PK and Sharma AK. 2016. Compatible salt-tolerant rhi-
Bravo A y Cerón J (eds). Bacillus thuringiensis en el con- zosphere microbe-mediated induction of phenylpropanoid
trol biológico. Universidad Nacional de Colombia, Bogo- cascade and induced systemic responses against Bipola-
tá. ris sorokiniana (Sacc.) Shoemaker causing spot blotch
Portela-Dussán DD, Chaparro-Giraldo A y López-Pazos disease in wheat (Triticum aestivum L.). Applied Soil
SA. 2013. La biotecnología de Bacillus thuringiensis Ecology: 108:300-306. [Link]
en la agricultura. Revista NOVA Publicación Cientí- oil.2016.09.014
fica en Ciencias Biomédicas. 11:87-96. [Link] Soberón M y Bravo A. 2007. Las toxinas Cry de Bacillus thu-
org/10.22490/24629448.1031 ringiensis: modo de acción y consecuencias de su apli-
Pretali L, Bernardo L, Butterfield TS, Trevisan M and Lu- cación. Biotecnología. 14:303-314. Disponible en línea:
cini L. 2016. Botanical and biological pesticides elicit a [Link]
similar Induced Systemic Response in tomato (Solanum capitulo_27.pdf
lycopersicum) secondary metabolism. Phytochemistry, Tamez GP, Galán WLJ, Medrano RH, García GC, Rodríguez
130:56-63. [Link] PC, Gómez FRA y Tamez GGRS. 2001. Bioinsecticidas:

Publicación en línea, enero 2018 129

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

su empleo, producción y comercialización en México. in response to inoculation with Bacillus cereus. Letters
Ciencia UANL. 4:143-152. Disponible en línea: http:// in Applied Microbiology. 56(3):208-215. [Link]
[Link]/pdf/402/[Link] org/10.1111/lam.12035
Tejera-Hernández B, Rojas-Badía MM y Heydrich-Pérez Wang X, Wang L, Wang J, Jin P, Liu H and Zheng Y. 2014.
M. 2011. Potencialidades del género Bacillus en la pro- Bacillus cereus AR156-Induced Resistance to Colletotri-
moción del crecimiento vegetal y el control de hongos chum acutatum Is Associated with Priming of Defense
fitopatógenos. Revista CENIC Ciencias Biológicas. Responses in Loquat Fruit. PLos ONE. 9(11):e112494.
42:131-138. Disponible en línea: [Link] [Link]
pdf/1812/[Link] Wilson BR, Bogdan AR, Miyazawa M, Hashimoto K and
Thyagarajan SI, Ramanathan G, Singaravelu S, Kandhasamy Tsuji Y. 2016. Siderophores in Iron Metabolism: From
S, Perumal PT and Sivagnam UT. 2017. Microbial Side- Mechanism to Therapy Potential. Trends in Molecular
rophore as MMP inhibitor: An interactive approach on Medicine. 22:1077-1090. [Link]
wound healing application. Wound Medicine. 17:7-14. med.2016.10.005
[Link] Xu C, Wang BC, Yu Z and Sun M. 2014. Structural Insights
Touré Y, Ongena M, Jacques P, Guiro A and Thonart P. into Bacillus thuringiensis Cry, Cyt and Parasporin
2004. Role of lipopeptides produced by Bacillus subtilis Toxins. Toxins. 6:2732-2770. [Link]
GA1 in the reduction of grey mould disease caused by toxins6092732
Botrytis cinerea on apple. Journal of Applied Microbio- Xu Z, Shao J, Li B, Yan X, Shen Q and Zhang R. 2013. Con-
logy. 96: 1151-1160. [Link] 10.1111/j.1365- tribution of bacillomycin D in Bacillus amyloliquefa-
2672.2004.02252.x ciens SQR9 to antifungal activity and biofilm formation.
Trabelsi D and Mhamdi R. 2013. Microbial Inoculants and Applied Environmental Microbiology. 79:808-815. http://
Their Impact on Soil Microbial Communities: A Review. [Link]/10.1128/aem.02645-12
BioMed Research International. ID 863240:1-11. http:// Yan L, Jing T, Yujun Y, Bin L, Hui L and Chun L. 2011. Bio-
[Link]/10.1155/2013/863240 control Efficiency of Bacillus subtilis SL-13 and Characte-
Valent BioSciences. 2017. DiPel WG (Bacillus thuringiensis). rization of an Antifungal Chitinase. Chinese Journal Che-
Disponible en línea: [Link] mical Engineering. 19:128-134. [Link]
les/etiquetas/Dipel_WG.pdf s1004-9541(09)60188-9
Van der Heijden M, Bardgett R and van Straalen N. 2008. The You C, Zhang C, Kong F, Feng C and Wang J. 2016. Com-
unseen majority: soil microbes as drivers of plant diver- parison of the effects of biocontrol agent Bacillus sub-
sity and productivity in terrestrial ecosystems. Ecology tilis and fungicide metalaxyl – mancozeb on bacterial
Letters. 11: 296-310. [Link] communities in tobacco rhizospheric soil. Ecological
0248.2007.01139.x Engineering. 91:119-125. [Link]
Vargas-Ayala R, Rodríguez-Kábana R, Morgan-Jones G, leng.2016.02.011
Mclnroy JA and Kloepper JW. 2000. Shifts in Soil Mi- Yu X, Ai C, Xin L and Zhou G. 2011. The siderophore-produ-
croflora Induced by Velvetbean (Mucuna deeringiana) cing bacterium, Bacillus subtilis CAS15, has a biocontrol
in Cropping Systems to Control Root-Knot Nematodes. effect on Fusarium wilt and promotes the growth of pe-
Biological Control. 17:11-22. [Link] pper. European Journal of Soil Biology. 47:138-145. http://
bcon.1999.0769 [Link]/10.1016/[Link].2010.11.001
Vázquez-Ramírez MF, Rangel-Nnúñez JC, Ibarra JE y del Rin- Zhang B, Qin Y, Han Y, Dong C, Li P and Shang Q. 2016.
cón-Castro MC. 2015. Evaluación como agentes de control Comparative proteomic analysis reveals intracellular tar-
biológico y caracterización de cepas mexicanas de Bacillus gets for bacillomycin L to induce Rhizoctonia solani Kühn
thuringiensis contra el gusano cogollero del maíz Spodop- hyphal cell death. Biochimica Biophysica Acta (BBA),
tera frugiperda. Interciencia. 40:397-402. Disponible en Proteins and Proteomics. 1864:1152-1159. [Link]
línea: [Link] org/10.1016/[Link].2016.06.003
Vlot AC, Dempsey DA and Klessig DF. 2009. Salicylic acid, a Zhang X, Huang Y, Harvey PR, Ren Y, Zhang G, Zhou H and
multifaceted hormone to combat disease. Annual Review Yang H. 2012. Enhancing plant disease suppression by
of Phytopathology. 47:177–206 [Link] Burkholderia vietnamiensis through chromosomal inte-
[Link].050908.135202 gration of Bacillus subtilis chitinase gene chi113. Biote-
Wang W, Chen LN, Wu H, Zang H, Yang Y, Xie S and Gao chnology Letters. 34:287-293. [Link]
X. 2013. Comparative proteomic analysis of rice seedlings s10529-011-0760-z

Publicación en línea, enero 2018 130

 Variability and symptoms caused by Iris yellow
spot virus in Nicotiana benthamiana

Variabilidad y síntomas causados por Iris yellow

spot virus en Nicotiana benthamiana

Katya Ornelas-Ocampo, Daniel Leobardo Ochoa-Martínez*, Sergio Aranda-Ocampo, Posgrado en Fi-

tosanidad-Fitopatología. Colegio de Postgraduados, Km 36.5 carretera México-Texcoco, C.P. 56230, Mon-
tecillo, Texcoco, Estado de México; Sergio Ramírez-Rojas, Campo Experimental Zacatepec, INIFAP. Km.
0.5 carretera Zacatepec-Galeana, C.P. 62780, Colonia Centro Zacatepec, Morelos; Hernán García-Ruíz,
Department of Plant Pathology and Nebraska Center for Virology, University of Nebraska-Lincoln, Lin-
coln, NE, USA. *Autor para correspondencia: ldaniel@[Link].

Recibido: 13 de Julio, 2017. Aceptado: 05 de Octubre, 2017.

Ornelas-Ocampo K, Ochoa-Martínez DL, Aranda- Abstract. In onion Allium cepa crops in the state
Ocampo S, Ramírez-Rojas S, García-Ruíz H. 2017. Va- of Morelos, Mexico, typical and severe symptoms
riability and symptoms caused by Iris yellow spot virus associated with Iris yellow spot virus (IYSV) are
in Nicotiana benthamiana. Revista Mexicana de Fitopa- observed. In this work the alterations caused by
tología 36(1): 131-140. IYSV isolates from typical and severe symptoms
DOI: 10.18781/[Link].1707-2 in Nicotiana benthamiana, the differences in the N
gene and their phylogeny were studied. Four typical
Primera publicación DOI: 18 de Octubre, 2017. and five severe isolates mechanically inoculated
First DOI publication: October 18, 2017. caused systemic infection. Severe isolates caused
more severe symptoms in bioclimatic chamber.
The N gene sequence of both isolates had 98-
Resumen. En cultivos de cebolla Allium cepa 99% identity with the IYSV nucleoprotein and no
del estado de Morelos, México, se observan sínto- changes in nucleotide sequence between them were
mas típicos y severos asociados a Iris yellow spot observed. Both isolates were grouped with the
virus (IYSV). En esta investigación se estudiaron IYSVBR genotype and had greater similarity with
las alteraciones que ocasionan los aislamientos de those reported in Canada and the United States.
IYSV procedentes de síntomas típicos y severos en
Nicotiana benthamiana, las diferencias en el gen Key words: Tospovirus, phylogeny, genomic
N y su filogenia. Cuatro aislamientos típicos y changes.

Publicación en línea, enero 2018 131

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

cinco severos inoculados mecánicamente causaron The most important viral disease that affects
infección sistémica. En cámara bioclimática los onion crops (Allium cepa) is yellow spot
aislamientos severos ocasionaron mayor severi- caused by the Iris yellow spot virus (IYSV)
dad de síntomas. La secuencia del gen N de ambos (Bunyaviridae:Tospovirus) (Kritzman et al., 2001),
aislamientos tuvo 98-99% de identidad con la nu- because it leads to major reductions in bulb size
cleoproteína de IYSV y no se observaron cambios (Gent et al., 2004). Symptoms of IYSV on onion
en la secuencia de nucleótidos entre ellos. Ambos leaves and flower stems appear as elongated or
aislamientos se agruparon con el genotipo IYSVBR diamond-shaped straw colored and dry-looking
y tuvieron mayor similitud con los reportados en chlorotic spots, with or without green areas in the
Canadá y Estados Unidos. middle of the lesions (Gent et al., 2006). The IYSV
genome consists of three negative-sense, single-
Palabras clave: Tospovirus, filogenia, cambios ge- strand RNA segments defined as large (L), medium
nómicos. (M) and small (S) (Bag et al., 2009, 2010). The S
segment contains the N gene that encodes for capsid
nucleoprotein that is commonly used to identify
La enfermedad viral más importante del cul- and classify tospoviruses, because of its degree
tivo de cebolla Allium cepa es la mancha ama- of divergence (Pappu et al., 2006), as well as to
rilla causada por Iris yellow spot virus (IYSV) study geographic distribution and genetic diversity
(Bunyaviridae:Tospovirus) (Kritzman et al., 2001) (Iftikhar et al., 2014). IYSV is widely distributed
ya que ocasiona una importante disminución del worldwide (Gent et al., 2006) but in Mexico it has
tamaño del bulbo (Gent et al., 2004). En hojas y been reported since 2012 on onion crops in the state
tallos florales de cebolla el IYSV ocasiona man- of Morelos, where it causes a disease known as
chas cloróticas de forma alargada o de diamante, “yellow spot” with 100% incidence and more than
color pajizo y aspecto seco, con ausencia o pre- 90% severity (Ramírez et al., 2016). In Morelos,
sencia de islas verdes en el centro de las lesiones two types of symptoms associated with IYSV have
(Gent et al., 2006). El genoma de IYSV consiste de been observed and, for this reason, the objective of
tres segmentos de ARN monocatenario de sentido this research was to describe the symptoms caused
negativo denominados grande (L), mediano (M) y by both isolates on Nicotiana benthamiana, and to
pequeño (S) (Bag et al., 2009; Bag et al., 2010). find out if there are differences in the N segment
El segmento S contiene al gen N que codifica para of the genome and its phylogenetic relation with
la nucleoproteína de la cápside comúnmente utili- other isolates. In the 2014-2015 cycle, onion plants
zado para la identificación y clasificación de tos- showing symptoms of “yellow spot” associated
povirus debido a su grado de divergencia (Pappu with IYSV were collected in the municipalities
et al., 2006), además de estudios de distribución of Ayala, Axochiapan, Emiliano Zapata, Jojutla,
geográfica y diversidad genética (Iftikhar et al., Puente de Ixtla, Tlaquiltenango, Xochitepec and
2014). Este virus se encuentra ampliamente dis- Zacatepec in the state of Morelos, Mexico. Onion
tribuido a nivel mundial (Gent et al., 2006) y en leaf tissue was classified based on the severity of
México ha sido reportado desde 2012 en cultivos the symptoms observed, frozen with liquid nitrogen
de cebolla del estado de Morelos causando la enfer- and stored at -80 °C. Nicotiana benthamiana plants
medad conocida como “mancha amarilla” con una were mechanically inoculated (Mandal et al.,

Publicación en línea, enero 2018 132

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

incidencia de 100% y severidad superior al 90% 2006) with onion leaf tissue that tested positive for
(Ramírez et al., 2016). En esta entidad se han ob- Iris yellow spot virus using RT-PCR and showed
servado dos tipos de síntomas asociados a IYSV typical or severe symptoms. Two N. benthamiana
por lo que la presente investigación tuvo como ob- plants were used as negative controls, but they
jetivo describir los síntomas que ocasionan ambos were only rubbed with a buffer and carborundum
aislamientos en Nicotiana benthamiana, conocer si (silicon carbide). A group of five plants were
hay diferencias en el segmento N del genoma y su inoculated with each of the typical or severe isolates
relación filogenética con otros aislamientos. En el and kept in a bioclimatic chamber at 25 °C average
ciclo 2014-2015 se colectaron plantas de cebolla temperature and 91% average relative humidity
en los municipios de Ayala, Axochiapan, Emilia- (RH), 77% minimum RH and 99% maximum
no Zapata, Jojutla, Puente de Ixtla, Tlaquiltenango, RH, and a photoperiod of 16 h light and 8 h
Xochitepec y Zacatepec en el estado de Morelos, darkness. Another group of plants was kept in the
México, con síntomas de “mancha amarilla” aso- greenhouse at 25 °C average temperature (13 °C
ciados a IYSV. El tejido foliar de cebolla se cla- and 39 °C minimum and maximum temperature,
sificó de acuerdo con la severidad de los síntomas respectively) and 50% average RH (27% and 71%,
observados, se congeló con nitrógeno líquido y se minimum and maximum HR, respectively). The
almacenó a -80 °C. Se inocularon mecánicamente plants were observed every other day for three
(Mandal et al., 2006) plantas de N. benthamiana weeks to record the incubation period and type
con tejido foliar de cebolla positivo para Iris yellow of symptoms. Total RNA was extracted from 0.1
spot virus por RT-PCR que mostraron síntomas tí- g of leaf tissue of onions plants collected in the
picos o severos. Como control negativo se utiliza- field that showed symptoms associated with IYSV,
ron dos plantas de N. benthamiana frotadas única- and from 0.25 g of mechanically inoculated N.
mente con el amortiguador y el carborundum. Un benthamiana leaves; RNA was extracted from
grupo de cinco plantas inoculadas con cada uno de the latter 10, 15 and 20 days post inoculation
los aislamientos típicos o severos se mantuvieron (dpi) with TriReagent® (Ambion®), following
en cámara bioclimática (temperatura media de the manufacturer’s protocol. The concentration
25 °C, 91% de humedad relativa (HR) promedio, and quality of the RNA was determined using a
77% de HR mínima y 99% de HR máxima; con Nanodrop® (Thermo Fisher Scientific, Inc), and its
un fotoperíodo de 16 h luz y 8 h de oscuridad) y integrity through electrophoresis on 1% agarose
otro grupo de plantas en invernadero (temperatura gel stained with ethidium bromide (0.5 µg/ml).
promedio de 25 °C, mínima y máxima de 13 y The cDNA synthesis was performed using M-MLV
39 °C, respectivamente; 50% de HR promedio, 27 Reverse Transcriptase (Promega®), according to the
y 71%, mínima y máxima, respectivamente). Las manufacturer’s instructions. Primers IYSV917L
plantas se observaron cada tercer día durante tres and IYSV56U were selected to detect IYSV on
semanas para registrar el período de incubación y onion because they amplify a segment of 896 bp
tipo de síntomas. Se extrajo ARN total a partir 0.1 corresponding to the N gene (Robène et al., 2006).
g de tejido foliar de plantas de cebolla colectadas A region of ribosomal gene 18S was amplified as
en campo que presentaban síntomas asociados a control for the PCR reaction (Zamboni et al., 2008).
IYSV y a partir de 0.25 g de hojas de N. bentha- To determine whether there were differences in the
miana inoculadas mecánicamente, en este último nucleotide sequence between the two IYSV isolates

Publicación en línea, enero 2018 133

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

caso, a los 10, 15 y 20 días post-inoculación (dpi) inoculated into N. benthamiana, primers IYSV-KO4
con TriReagent® (Ambion®) siguiendo el protoco- (5’-CTTAACTAACACAAATACTG-3’) and IYSV-
lo del fabricante. Se determinó la concentración y KO6 (5’-AGAGCAATCGAGGTATAAAAC-3’)
calidad del ARN en un Nanodrop® (Thermo Fisher were designed to amplify the N gene using the
Scientific, Inc) y su integridad mediante electrofo- Vector NTI™ Suite 8.0 program and based on
resis en un gel de agarosa 1% teñido con bromuro the AF001387 sequence of IYSV stored in the
de etidio (0.5 µg/ml). La síntesis de cDNA se reali- GenBank. The obtained sequences were edited
zó con M-MLV Reverse Transcriptase (Promega®) with the Chromas Lite 2.0 and Vector NTI™
de acuerdo con las indicaciones del fabricante. La Suite 8.0 programs and deposited in the GenBank
detección de IYSV en cebolla se realizó con los database (KX434621-434623, KX443600-443604,
iniciadores IYSV917L e IYSV56U que ampli- KX443598 and KX443599). Multiple alignment
fican un segmento de 896 pb correspondiente al was performed with the ClustalW program, and
gen N (Robène et al., 2006). Como control de la the phylogenetic analysis following the Neighbor-
reacción de PCR se amplificó una región del gen joining method (2000 replications) by using
ribosomal 18S (Zamboni et al., 2008). Con el pro- the MEGA6 program (Tamura et al., 2013).
pósito de determinar si existían diferencias en la Seventy-eight onion plants showing “yellow spot”
secuencia de nucleótidos entre ambos aislamientos symptoms associated with IYSV were collected at
de IYSV inoculados en N. benthamiana, se dise- 14 sites of the eight sampled municipalities. The
ñaron los iniciadores IYSV-KO4 (5’-CTTAACTA- collected plants belonged to six onion varieties:
ACACAAATACTG-3’) e IYSV-KO6 (5’-AGA- Stratus (33.3%), Carta Blanca (24.4%), Florentina
GCAATCGAGGTATAAAAC-3’) para amplificar (10.2%), Cirrus (6.4%), Cal 214 (6.4%) and Joya
el gen N con el programa Vector NTI™ Suite 8.0 (2.6%); it was not possible to identify the variety
con base en la secuencia AF001387 de IYSV de- of the remaining 16.7% of samples. The plants
positada en el GenBank. Las secuencias obtenidas were divided into two groups according to the
fueron editadas con los programas Chromas Lite symptoms they showed: a) typical symptoms in
2.0 y Vector NTI™ Suite 8.0 y depositadas en la the form of elongated yellow-to-whitish dry spots
base de datos del GenBank (KX434621-434623, with a chlorotic halo (Figura 1B), and b) severe
KX443600-443604, KX443598 y KX443599). El symptoms consisting of white to yellow elongated
alineamiento múltiple se llevó a cabo con ClustalW and dry-looking spots with or without a necrotic
y el análisis filogenético se realizó por el método halo, that in most cases covered the leaf (Figura
Neighbor-joining (2000 repeticiones) con el pro- 1C). Four typical isolates and five severe isolates
grama MEGA6 (Tamura et al., 2013). Se colecta- were selected for analysis.
ron 78 plantas de cebolla que mostraron síntomas Primers IYSV917L and IYSV56U amplified
de “mancha amarilla” asociados a IYSV en 14 lo- the expected fragment of ~ 900 bp in all the
calidades de los ocho municipios muestreados. Las typical isolates, while in the case of severe
plantas colectadas fueron de seis variedades de ce- isolates the amplicon was ~500 bp (Figure 1D).
bolla: Stratus (33.3%), Carta Blanca (24.4%), Flo- However, both shared 99% identity with the capsid
rentina (10.2%), Cirrus (6.4%), Cal 214 (6.4%) y nucleoprotein of the N segment of IYSV reported
Joya (2.6%); el 16.7% restante de las muestras no in the GenBank. These results show that the 900
fue posible identificar la variedad. Las plantas se and 500 bp amplicons are associated with typical

Publicación en línea, enero 2018 134

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

dividieron en dos grupos con base en los síntomas or severe IYSV isolates, respectively. The severity
que mostraban: a) síntomas típicos, consistentes en of the symptoms induced by typical and severe
manchas secas amarillas a blanquecinas con halo IYSV isolates on N. benthamiana was different
clorótico y forma alargada (Figura 1B) y b) sínto- depending on the environmental conditions under
mas severos, en los cuales se observaban manchas which the plants were kept after inoculation,
blancas con o sin halo clorótico, alargadas, de as- regardless of the inoculum source. When kept in a
pecto seco que en muchos casos cubrían la lámina bioclimatic chamber, at 7 dpi the symptoms induced
foliar (Figura 1C). Se seleccionaron cuatro aisla- by four of the five severe isolates were systemic
mientos típicos y cinco aislamientos severos para and consisted of necrotic leaf venation, petiole
su análisis. constriction, necrotic leaf lesions surrounded by a
Los iniciadores IYSV917L e IYSV56U amplifi- dark brown halo, chlorosis and wilting. At 22 dpi,
caron el fragmento esperado de ~ 900 pb en todos severe wilting was observed similar to that reported
los aislamientos típicos, mientras que en el caso by Bag et al. (2012) (Figure 2B). In the case of the
de los aislamientos severos se tuvo un amplicón typical isolates, one produced chlorotic and necrotic
de ~500 pb (Figura 1D) y ambos tuvieron 99% de lesions with necrotic veins and petioles; two more
identidad con la nucleoproteína de la cápside del produced chlorotic and necrotic lesions but did not
segmento N de IYSV reportadas en el GenBank. affect veins and petioles; the fourth isolate did not
Estos resultados muestran que los amplicones de induce symptoms. On the other hand, when kept in
900 y 500 pb están asociados a aislamientos típicos the greenhouse, four severe and two typical isolates
o severos de IYSV, respectivamente. La severidad produced systemic infection at 10 dpi in the form
de los síntomas ocasionados por los aislamientos of chlorosis and leaf wrinkling. One typical and one
típicos y severos de IYSV en N. benthamiana fue severe isolate caused more necrotic lesions on the
diferente según la condición ambiental en la que se leaves (Figure 2B). The fact that not all the typical
mantuvieron las plantas después de la inoculación or severe isolates caused the same symptoms (or

D kb MP - Pa St Ss
1.5
1.0 -900 pb

0.5 -500 pb

0.1

A B C -188

Figura 1. Síntomas asociados a Iris yellow spot virus en cebolla. A. Planta asintomática (Pa). B. Síntoma típico (St). C.
Síntoma severo (Ss). D. Productos de PCR obtenidos con los iniciadores IYSV917L e IYSV56U que amplifican un
segmento del gen N de IYSV. -: control negativo. MP: Marcador de peso molecular 100 pb.
Figure 1. Symptoms associated with Iris yellow spot virus in onion. A. Asymptomatic plant (Pa). B. Typical symptom (St).
C. Severe symptom (Ss). D. PCR products obtained using the IYSV917L and IYSV56U primers that amplify a
segment of the N gen of IYSV. -: negative control. MP: 100 bp molecular weight marker.

Publicación en línea, enero 2018 135

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

independientemente de la fuente de inóculo. En that some did not even cause visible alterations)
cámara bioclimática, a los 7 dpi los síntomas oca- during that evaluation period can be attributed to
sionados por cuatro de los cinco aislamientos seve- the mechanical inoculation process, because it is
ros fueron sistémicos, consistentes en necrosis de known that the mechanical transmission of IYSV
nervaduras, constricción de peciolos, lesiones ne- is difficult (Bag and Pappu, 2009). In spite of the
cróticas foliares rodeadas por un halo café oscuro, inconsistency of the first symptoms observed, in the
clorosis y marchitamiento. A los 22 dpi se obser- greenhouse all the inoculated plants showed wilting
vó una marchitez severa similar a la reportada por at 30-35 dpi regardless of the isolate. On the other
Bag et al. (2012) (Figura 2B). En el caso de los hand, in a study using Tobacco mosaic virus strains

A
Aislamientos Aislamientos
kb MP - severos típicos
1.0 -1.1 kb
0.2 188

B
Control Aislamiento típico Aislamiento severo

Figura 2. A. Productos de PCR obtenidos con los iniciadores IYSV-KO4 e IYSV-KO6 que amplifican el gen N + UTR5’
provenientes de aislamientos típicos y severos de IYSV. MP: Marcador de peso molecular 1 kb (Promega), -:
control negativo planta asintomática. B. Síntomas en plantas y hojas de N. benthamiana inoculadas mecánicamente
con dos aislamientos de Iris yellow spot virus mantenidas en dos condiciones ambientales.
Figure 2. Figure 2. A. PCR products obtained using the IYSV-KO4 and IYSV-KO6 primers that amplify the N + UTR5’
gen from typical and severe IYSV isolates. MP: Molecular weight marker 1 kb (Promega), -: negative control
asymptomatic plant. B. Symptoms in N. benthamiana plants and leaves mechanically inoculated with two Iris
yellow spot virus isolates kept under two environmental conditions.

Publicación en línea, enero 2018 136

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

asilamientos típicos, uno ocasionó lesiones cloróti- inoculated in Nicotiana tabacum, differences
cas y necróticas con necrosis de venas y peciolos, in symptoms associated with temperature were
dos más causaron lesiones cloróticas y necróticas observed (Scholthof, 2008). It is known that the
sin la afectación de venas y peciolos; el cuarto environment can naturally contribute to increasing
aislamiento no ocasionó síntomas. Por otro lado, or decreasing the frequency of virus populations
en invernadero cuatro aislamientos severos y dos (García et al., 2001). In the case of IYSV, no specific
típicos ocasionaron una infección sistémica a los environmental conditions account for symptom
10 dpi consistente en clorosis y arrugamiento de variations. However, the genetic divergence among
hojas. Un aislamiento típico y uno severo causaron isolates, the host range and host response has been
más lesiones cloróticas en las hojas (Figura 2B). El attributed to environmental adaptation (Pozzer et
hecho de que no todos los aislamientos típicos o al., 1999).
severos produjeran los mismos síntomas (o incluso In all the typical and severe isolates analyzed
que alguno no causara alteraciones visibles) en esta in this research using RT-PCR and primers IYSV-
fecha de evaluación puede atribuirse al proceso de KO4 and IYSV-KO6, the expected fragment of
inoculación mecánica pues se sabe que existen pro- 1,100 bp was found that includes the N + UTR5’
blemas para la transmisión mecánica de IYSV (Bag gene (Figure 2A). A comparison of the sequences
y Pappu, 2009). A pesar de la inconsistencia en los obtained from both isolates showed no differences
síntomas iniciales observados, en invernadero to- between them; these results are similar to those
das las plantas inoculadas mostraron marchitez a reported by Bag et al. (2012). According to García
los 30-35 dpi independientemente del aislamiento. et al. (2001), viral strains are groups of isolates with
Por otro lado, en un estudio realizado con variantes similar properties such as host range, transmission
de Tobacco mosaic virus inoculadas en Nicotiana capacity and similar nucleotide sequences, among
tabacum se encontraron diferencias en síntomas others. In Mexico, TSWV is the only tospovirus that
asociadas a la temperatura (Scholthof, 2008). Se has been biological and molecularly characterized.
sabe que de manera natural el ambiente puede con- González (2014) studied three Mexican isolates of
tribuir al incremento o disminución de la frecuen- TSWV and found that the difference in severity
cia de poblaciones de virus (García et al., 2001). may be associated with changes in the amino acids
En el caso de IYSV no se precisan condiciones in the Nsm and NSs proteins, as well as those in
ambientales que determinen variación en síntomas. the intergenic regions (IGR). This may be due to
No obstante, se ha relacionado la divergencia ge- the fact that the tospovirus NSs protein acts a gene
nética entre aislamientos, la gama de hospedantes silencing suppressor (Ocampo et al., 2016), and,
y la respuesta de éstos a una adaptación ambiental for this reason, it would be necessary to analyze
(Pozzer et al., 1999). other genes in molecular characterization studies.
En todos los aislamientos típicos y severos ana- The sequences obtained with the IYSV-KO4 and
lizados en la presente investigación mediante RT- IYSV-KO6 primers of the typical and severe
PCR usando los iniciadores IYSV-KO4 e IYSV- isolates tested (Figure 2B) had 98 to 99% identity
KO6, se obtuvo el fragmento esperado de 1,100 with the nucleoprotein of the capsid of IYSV gene
pb que incluye el gen N + UTR5’ (Figura 2A). N. The in silico analysis of the sequences obtained
La comparación de las secuencias obtenidas en (data not shown) using the IYSV-KO4 and IYSV-
ambos aislamientos no mostró diferencias entre KO6 primers of both isolates through RFLP with

Publicación en línea, enero 2018 137

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

ellas, resultados similares reportados por Bag et HinfI showed a restriction pattern that includes a
al. (2012). De acuerdo con García et al., (2001) las fragment larger than 308 bp which corresponds to
cepas virales se consideran como un conjunto de the IYSVBR genotype associated with isolates from
aislamientos que mantienen propiedades similares Asia (Iftikhar et al., 2014). On the other hand, it
como son el rango de hospedantes, capacidad de was found that IYSV isolates from the state of
transmisión y similitud de secuencias de nucleóti- Zacatecas corresponded to the IYSVNL genotype
dos, entre otras. En México el TSWV es el único associated with isolates from North America
tospovirus caracterizado biológica y molecular- (Velásquez-Valle et al., 2016). The presence of
mente. González (2014) estudió tres aislamientos chlorotic lesions on leaves with small green islands
mexicanos de TSWV y encontró que la diferencia in the middle has also been reported in Zacatecas
en la severidad podría estar asociada a cambios en and Michoacán (Velásquez-Valle et al., 2016;
los aminoácidos de las proteínas NSm, NSs y de Ávila et al., 2017), while in Morelos there is no
las regiones intergénicas (IGR). Esto podría expli- record of this type of symptom (Ramírez-Rojas
carse debido a que la proteína NSs de tospovirus et al., 2016). These results suggest that there are
actúa como un supresor del silenciamiento génico IYSV variants in Mexico that are biological and
(Ocampo et al., 2016) por lo que sería necesario molecularly different. Regarding the phylogenetic
analizar otros genes en estudios de caracterización analysis, isolates from Morelos were found to be
molecular. Las secuencias obtenidas con los inicia- more similar to those reported in Canada, United
dores IYSV-KO4 e IYSV-KO6 de los aislamientos States and New Zealand and not to those from Asia,
típicos y severos analizados (Figura 2B) tuvieron where the IYSVBR genotype is mainly concentrated.
de 98 a 99% de identidad con la nucleoproteína de Iftikhar et al. (2014) mentioned in their study that
la cápside del gen N de IYSV. El análisis in silico there are exceptions where the IYSVBR genotypes
de las secuencias obtenidas (Datos no mostrados) are grouped with IYSVNL, and vice versa; however,
con IYSV-KO4 e IYSV-KO6 de ambos aislamien- those results may provide information on how the
tos mediante RFLP con HinfI, mostró un patrón de virus spreads across countries (Smith et al., 2006).
restricción que incluye un fragmento mayor de 308 Also, typical and severe isolates are concentrated
pb correspondiente con el genotipo IYSVBR asocia- in a clade that is divided into three groups: group I
do con aislamientos de Asia (Iftikhar et al., 2014). consists mainly of severe isolates, while groups II
Por otro lado, se encontró que aislamientos de y III consist of moderate isolates (data not shown).
IYSV del estado de Zacatecas correspondieron al Abad et al. (2003) and Bag et al. (2012) studied
genotipo IYSVNL relacionado con aislamientos de isolates from different states of western United
Norteamérica (Velásquez-Valle et al., 2016). Asi- States. In the first study, greater genetic diversity
mismo, en Zacatecas y Michoacán se ha reportado was found among isolates that were grouped with
la presencia de lesiones cloróticas en hojas con pe- other isolates from different countries, while in
queñas islas verdes en el centro (Velásquez-Valle the second study, the isolates were grouped in the
et al., 2016; Ávila et al., 2017), mientras que en same clade. Based on these results, the fact that
Morelos no se tiene registro de este tipo de síntoma different groups of IYSV isolates have developed
(Ramírez-Rojas et al., 2016). Estos resultados su- in Zacatecas and Morelos suggests that there is
gieren la existencia de variantes de IYSV en Méxi- greater genetic diversity of the virus in Mexico
co que difieren biológica y molecularmente. Con (Smith et al., 2006). Such diversity may affect the

Publicación en línea, enero 2018 138

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

respecto al análisis filogenético, los aislamientos de efficiency of virus transmission by vector thrips,
Morelos mostraron mayor similitud con los repor- the range of host weed species, the severity and
tados en Canadá, Estados Unidos y Nueva Zelanda incidence of plants with symptoms and, in general,
y no con los asiáticos donde se concentra princi- the spatio-temporal disease progress in both states
palmente el genotipo IYSVBR. Iftikhar et al. (2014) (Ávila et al., 2017).
mencionan en su estudio que existen excepciones In conclusion, the typical and severe Iris
donde los genotipos IYSVBR se agrupan con los yellow spot virus isolates analyzed in the present
IYSVNL y viceversa; sin embargo, tales resultados research infected N. benthamiana and caused
podrían proporcionar información sobre el movi- similar symptoms at different severity levels under
miento del virus entre países (Smith et al., 2006). two environmental conditions. The analysis of the
A su vez, los aislamientos típicos y severos se con- N gene did not show changes in the sequence of
centran en un clado que se divide en tres grupos: nucleotides between both isolates.
grupo I formado principalmente con aislamientos
severos, mientras que el II y III por aislamientos End of the English version
moderados (Datos no mostrados). Por su parte,
Abad et al. (2003) y Bag et al. (2012) estudiaron
aislamientos procedentes de distintos estados del
oeste de Estados Unidos; en el primer caso se en- LITERATURA CITADA
contró mayor diversidad genética entre aislamien-
tos agrupándose con otros procedentes de diversos Abad JA, Speck J, Mohan SK and Moyer JW. 2003. Diversity
of the Iris yellow spot virus N gene in the USA. Phyto-
países, mientras que en el segundo estudio los ais- pathology 93: S1. Disponible en línea: [Link]
lamientos se agruparon dentro en un mismo clado. [Link]/doi/pdf/10.1094/PHYTO.2003.93.6.S1
Ávila-Alistac N, Ramírez-Rojas S, Lozoya-Saldaña H, Rebo-
Con base en lo anterior, la formación de distintos llar-Alviter A, Guzmán-Plazola RA. 2017. Alternate hosts
grupos de aislamientos de IYSV que se generan of Iris yellow spot virus and trips on onion crops in Mo-
relos and Michoacan, Mexico. Revista Mexicana de Fito-
de Zacatecas y Morelos sugiere una mayor diver- patología 35: 242-262. [Link]
sidad genética de este virus en el país (Smith et al., FIT.1701-1
Bag S, Druffel KL and Pappu HR. 2010. Structure and ge-
2006). Esta diversidad puede influir en la eficiencia nome organization of the large RNA of Iris yellow spot
de transmisión del virus por trips vectores, gama virus (genus Tospovirus, family Bunyaviridae). Archives
of Virology 155:275-279. [Link]
de malezas hospedantes, severidad e incidencia de 009-0568-5
plantas con síntomas y, en general, en el progreso Bag S, Druffel KL, Salewsky T and Pappu HR. 2009. Nucleo-
tide sequence and genome organization of the medium
espacio-temporal de la enfermedad en ambas enti- RNA of Iris yellow spot virus from the United States. Ar-
dades (Ávila et al., 2017). chives of Virology 154:715-718. [Link]
s00705-009-0349-1
En conclusión se tiene que los aislamientos tí- Bag S, Schwartz HF and Pappu HR. 2012. Identification and
picos y severos de Iris yellow spot virus analiza- characterization of biologically distinct isolates of Iris ye-
llow spot virus (genus Tospovirus, family Bunyaviridae),
dos en el presente estudio tuvieron la capacidad de a serious pathogen of onion. European Journal of Plant
infectar N. benthamiana y desarrollar síntomas si- Pathology 134: 97-104. [Link]
012-0026-1
milares con diferente severidad en dos condiciones Bag S and Pappu HR. 2009. Symptomatology of Iris yellow
ambientales. En el análisis del gen N no se encon- spot virus in selected indicator hosts. Online. Plant Health
Progress. [Link]
traron cambios de secuencia de nucleótidos entre García-Arenal F, Fraile A and Malpica JM. 2001. Variability
ambos aislamientos. and genetic structure of plant virus populations. Annual

Publicación en línea, enero 2018 139

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Review of Phytopathology 39: 157-86. Disponible en lí- Pozzer L, Bezerra IC, Kormelink R, Prins M, Peters D, Re-
nea: [Link] sende RO and de Ávila AC. 1999. Characterization of a
[Link].39.1.157 tospovirus isolate of Iris yellow spot virus associated with
Gent DH, du Toit LJ, Fichtner SF, Mohan SK, Pappu HR and a disease in onion fields in Brazil. Plant Disease 83: 345-
Schwartz HF. 2006. Iris yellow spot virus: An emerging 350. [Link]
threat to onion bulb and seed production. Plant Disease 90: Ramírez-Rojas S, Ornelas-Ocampo K, Osuna-Canizalez FJ,
1468-1480. [Link] Bartolo-Reyes JC, Varela-Loza V, Hernández-Romano
Gent DH, Schwartz HF and Khosla R. 2004. Distribution and J y Ochoa-Martínez DL. 2016. Detection of Iris yellow
incidence of Iris yellow spot virus in Colorado and its re- spot virus in onion plants from Tepalcingo, Morelos state,
lation to onion plant population and yield. Plant Disease Mexico. Revista Mexicana de Fitopatología 34: 309-315.
88: 446-452. [Link] [Link]
González PBE. 2014. Caracterización biológica y molecu- Robène-Soustrade I, Hostachy B, Roux-Cuvelier M, Minat-
lar del Tomato spotted wilt virus (TSWV) en aislamien- chy J, Hédont M, Pallas R, Couteau A, Cassam N and
tos mexicanos. Tesis Doctoral. Instituto de Fitosanidad- Wuster G. 2006. First report of Iris yellow spot virus in
Fitopalogía. Colegio de Postgraduados. Disponible en onion bulb- and seed-production fields in Réunion Island.
línea: [Link] Plant Pathology 55: 288. [Link]
dle/10521/2271 3059.2005.01262.x
Iftikhar R, Bag S, Ashfaq M and Pappu HR. 2014. First report Scholthof KBG. 2008. Tobacco Mosaic Virus: The Beginning
of Iris yellow spot virus infecting onion in Pakistan. Plant of Plant Pathology. Online. APSnet Features. DOI:10.1094/
Disease 97: 1517. [Link] APSnetFeatures-2008-0408
0502-PDN Smith TN, Jones RAC and Wylie SJ. 2006. Genetic diversity
Kritzman A, Lampel M, Raccah B and Gera A. 2001. Distribu- of the nucleocapsid gene of Iris yellow spot virus. Austra-
tion and transmission of Iris yellow spot virus. Plant Disease lian Plant Pathology 35: 359. [Link]
85: 838-842. [Link] AP06031
Mandal B, Pappu HR, Csinos AS and Culbreath AK. 2006. Tamura K, Stecher G, Peterson D, Filipski A and Kumar S.
Response of peanut, pepper, tobacco, and tomato culti- 2013. MEGA6: Molecular Evolutionary Genetics Analysis
vars to two biologically distinct isolates of Tomato spot- version 6.0. Molecular Biology and Evolution 30: 2725-
ted wilt virus. Plant Disease 90: 1150-1155. [Link] 2729. [Link]
org/10.1094/PD-90-1150 Velásquez-Valle R, Reveles-Torres LR, Salas-Muñoz S,
Ocampo OT, Gabriel PSM, Bacheller N, Uiterwaal S, Knapp Mauricio-Castillo JA and Pappu HR. 2016. First confir-
A, Hennen A, Ochoa-Martinez DL and Garcia-Ruiz H. med report of Iris yellow spot virus in onion nurseries in
2016. Antiviral RNA silencing suppression activity of Zacatecas, Mexico. Plant Disease 100: 1509. [Link]
Tomato spotted wilt virus NSs protein. Genetics and Mo- org/10.1094/PDIS-01-16-0061-PDN
lecular Research 15(2): gmr.15028625. DOI: 10.4238/ Zamboni A, Pierantoni L and De Franceschi P. 2008. Total
gmr.15028625 RNA extraction from strawberry tree (Arbutus unedo) and
Pappu HR, duToit LJ, Schwartz HF and Mohan SK. 2006. Se- several other woody plants. iForest-Biogeosciences and
quence diversity of the nucleoprotein gene of Iris yellow Forestry 1: 122-125. [Link]
spot virus (genus Tospovirus, family Bunyaviridae) isola- 0010122.
tes from the western region of the United States. Archives
of Virology 151: 1015-1023. [Link]
s00705-005-0681-z

Publicación en línea, enero 2018 140

 Effect of natural oils against Mycosphaerella fijiensis under
in vitro conditions and detection of active plant chemicals

Efecto de aceites naturales contra Mycosphaerella fijiensis en

condiciones in vitro y detección de fitoquímicos activos

Eduardo Gutiérrez-Jiménez, Universidad Autónoma Chapingo, Departamento de Parasitología Agrícola,

Km. 38.5 Carretera México-Texcoco, CP. 56230, Chapingo, Estado de México; Aurelio Pedroza-Sandoval*,
Universidad Autónoma Chapingo, Unidad Regional de Zonas Áridas, Carretera Gómez Palacio - Ciudad Juárez
Km 40, CP. 35230, Bermejillo, Durango; Luciano Martínez-Bolaños, Universidad Autónoma Chapingo, Uni-
dad Regional Sur Sureste, Km 7 Carretera Teapa - Vicente Guerrero, CP. 86800, Teapa, Tabasco; José Alfredo
Samaniego-Gaxiola, Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias. Blvd. José Santos
Valdéz No. 1200, Centro, CP. 27440, Matamoros, Coahuila; Fabián García-González, Universidad Autónoma
Chapingo, Unidad Regional de Zonas Áridas. Km 40 Carretera Gómez Palacio - Ciudad Juárez, CP. 35230,
Bermejillo, Durango. *Autor para correspondencia: apedroza@[Link].

Recibido: 25 de Julio, 2017. Aceptado: 19 de Octubre, 2017.

Gutiérrez-Jiménez E, Pedroza-Sandoval A, Martínez- Abstract. Chemical control of black sigatoka in

Bolaños L, Samaniego-Gaxiola JA, García-González banana Mycosphaerella fijiensis has increased the
F. 2017. Effect of natural oils against Mycosphaerella selection pressure on the pathogen, a fact which
fijiensis under in vitro conditions and detection of acti- in turn creates an environmental impact. The
ve plant chemicals. Revista Mexicana de Fitopatología objective of this study was to evaluate the effect of
36(1): 141-150. essential Pimenta dioica, Piper auritum, Sysygium
DOI: 10.18781/[Link].1707-4 aromaticum, Cinnamomum zeylanicum, Origanum
vulgare, Artemisia ludoviciana, and Origanum
Primera publicación DOI: 04 de Noviembre, 2017. majorana oils on M. fijiensis growth under in vitro
First DOI publication: November 04, 2017. conditions, and to identify their active metabolites.
The oils were obtained by hydrodistillation. M.
fijiensis was isolated and developed on PDA
Resumen. El control químico de la sigatoka ne- culture medium. Thin layer chromatography (TLC)
gra en banano Mycosphaerella fijiensis ha incre- and column chromatography (CC) were used to
mentado la presión de selección en el patógeno, con identify the metabolites of each essential oil. Five
el consecuente impacto en el ambiente. El objetivo concentrations: 50, 100, 500, 1000 y 5000 ppm of
de este estudio, fue evaluar el efecto de los acei- each oil were used. P. dioica, C. zeylanicum and
tes esenciales de Pimenta dioica, Piper auritum, O. vulgare oils had a significant effect with lower
Syzygium aromaticum, Cinnamomum zeylanicum, M. fijiensis mycelial growth at a concentration of

Publicación en línea, enero 2018 141

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Origanum vulgare, Artemisia ludoviciana y Origanum 500 ppm, whereas the effect on O. majorana and
majorana, en el crecimiento micelial de M. fijensis A. ludoviciana was observed at a concentration
en condiciones in vitro e identificar sus metabolitos of 1000 ppm. Cinnamic aldehyde was the main
activos. Los aceites se obtuvieron mediante el mé- metabolite detected in C. zeylanicum species, and
todo de hidrodestilación. El patógeno se aisló y de- eugenol and carvacrol in P. dioica y O. vulgare
sarrolló en medio de cultivo PDA. Se usaron cinco species.
concentraciones: 50, 100, 500, 1000 y 5000 ppm de
cada aceite. Para identificar los metabolitos de cada Key words: plants extract, secondary metabolites,
uno de los aceites esenciales, se usó cromatogra- fungi inhibition, biological control.
fía en capa fina (CCF) y cromatografía en columna
(CC). Los aceites de P. dioica, C. zeylanicum, O.
vulgare presentaron menor crecimiento micelial de The use of chemicals to control crop pests is a
M. fijiensis a una concentración de 500 ppm; mien- useful tool to fulfill productivity and sustainability
tras que O. majorana y A. ludoviciana a 1000 ppm. objectives, provided that such tool is combined with
El aldehído cinámico fue el principal metabolito proper management technologies (Wheeler, 2002).
detectado en la especie C. zeylanicum; el eugenol This is necessary because most of the phytopathogen
y carvacrol, en las especies P. dioica y O. vulgare. microorganisms have become resistant to active
ingredients of chemical fungicides (Chávez-Solís et
Palabras clave: extractos vegetales, metabolitos al., 2014). An efficient and inexpensive alternative
secundarios, inhibición fúngica, control biológico. for controlling diseases is the use of plant extracts
with fungicidal properties (Guerrero et al., 2007).
Plant extracts and essential oils are biodegradable
El uso de plaguicidas en la agricultura, es una and have a limited environmental impact (Bravo
herramientas que permite alcanzar los objetivos de et al., 2000). Based on this, there is an increased
productividad y sustentabilidad si se combina con interest in using essential spice and other plants oils
tecnologías adecuadas de manejo (Wheeler, 2002). as natural antimicrobials in food and agricultural
Esto es necesario porque la mayoría de los micro- crops (Celis et al., 2012). Lambert et al. (2001)
organismo fitopatógenos han generado resistencia state that nowadays there is an increasing demand
a los ingredientes activos de los fungicidas quí- to precisely obtain the values of the inhibitory
micos (Chávez-Solís et al., 2014). Una alternativa minimum concentration (CMI) of diverse essential
eficiente y económica para el control de enferme- oils so as to achieve a balance between sensory
dades es el uso de extractos de plantas que tengan acceptation and antimicrobial effectiveness, which
propiedades fungicidas (Guerrero et al., 2007). Los can be attained by conducting in vitro and in vivo
extractos vegetales y aceites esenciales, son bio- studies.
degradables con un impacto negativo menor en el In Mexico, the most used fungicides against
ambiente (Bravo et al., 2000). Con base en lo an- M. fijiensis are: mancozeb and chlorothalonil,
terior, se ha incrementado el interés por el uso de as well as systemic ingredients from the groups
aceites esenciales de especias y otras plantas como of benzimidazoles, triazoles, strobirulins and
antimicrobianos naturales en alimentos y cultivos anilopyrimidines (Martínez-Bolaños et al., 2012).
agrícolas (Celis et al., 2012). Lambert et al. (2001), Chemical management of black sigatoka requires

Publicación en línea, enero 2018 142

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

señalan que existe actualmente una demanda cre- from 10 to 45 fungicide applications per year
ciente por obtener en forma precisa los valores (mainly mancozeb, propiconazole and tridemorph),
de la concentración mínima inhibitoria (CMI) de but there is the risk that the pathogen may develop
diversos aceites esenciales, con la finalidad de ob- resistance to those fungicides (Mena-Espino and
tener un balance entre la aceptación sensorial y la Couoh-Uicab, 2015). The objective of this study
eficacia antimicrobiana, lo cual puede lograrse me- was to evaluate the biological effectiveness of
diante estudios in vitro e in vivo. different essential oils extracted from native plants
En México, los fungicidas más usados contra on M. fijiensis mycelial growth under in vitro
M. fijiensis son: mancozeb y clorotalonil e ingre- conditions, and identify their main active chemical
dientes sistémicos de los grupos benzimidazoles, compounds.
triazoles, estrobirulinas, y anilopirimidinas (Martí- Essential oils were obtained from momo (Piper
nez-Bolaños et al., 2012). El manejo químico de la auritum), cinnamon (Cinnamomum zeylanicum),
sigatoka negra requiere de 10 a 45 aplicaciones de oregano (Origanum vulgare), estafiate (Artemisia
fungicidas por año, principalmente de mancozeb, ludoviciana), marjoram (Origanum majorana)
propiconazol y tridemorf, con el consecuente ries- leaves, and pepper (Pimenta dioica) and clove
go de desarrollo de resistencia del patógeno a estos (Syzygium aromaticum) fruits. Plant samples were
fungicidas (Mena-Espino y Couoh-Uicab, 2015). collected in the municipalities of Teapa, Tabasco,
El objetivo de este estudio fue evaluar la efecti- and Pichucalco, Chiapas, Mexico. The samples
vidad biológica de diferentes aceites esenciales were dried under shade and grinded using a
extraídos de plantas nativas, sobre el crecimiento
manual mill. The obtained powder was subjected
micelial de M. fijiensis en condiciones in vitro y la
to hydrodistillation for two hours in a proportion of
identificación de los principales compuestos quími-
30 g in 500 ml of water (Domínguez, 1979), and the
cos activos.
oil was collected using a Clevenger-type equipment
Los aceites esenciales se obtuvieron a partir de
(Muñoz et al., 2001). The oil was poured in amber
hojas de momo (Piper auritum), canela (Cinnamo-
jars and kept in refrigeration.
mum zeylanicum), orégano (Origanum vulgare),
Mycosphaerella fijiensis was directly isolated
estafiate (Artemisia ludoviciana), mejorana (Ori-
from infected tissue from infected banana plants
ganum majorana), y frutos de pimienta (Pimenta
collected at the producing zones of the municipalities
dioica) y clavo (Syzygium aromaticum). Las mues-
of Teapa, Tabasco. Bits of around 1 cm2 from
tras vegetales fueron colectadas en los Municipios
diseased-plant tissue were cut and stuck to filter
de Teapa, Tabasco y Pichucalco, Chiapas, México.
paper discs. The infected tissue was superficially
El material se secó bajo sombra y se trituró en mo-
lino manual. El polvo resultante se sometió a un disinfected in a 3% hypochlorite solution and then
proceso de hidrodestilación por dos horas en una washed three times with distilled water. The discs
proporción de 30 g en 500 ml de agua (Domínguez, were placed on Petri dish covers that contained
1979) y el aceite fue capturado mediante uso de solid culture medium (agar-water). Three days
un aparato tipo Clevenger (Muñoz et al., 2001). El after the fungus started to grow, it was transferred
aceite se conservó en frascos color ámbar bajo re- to PDA culture medium for development (Stover,
frigeración. 1963).
Mycosphaerella fijiensis fue aislado directa- Different concentrations of each oil were
mente de tejido infectado a partir de plantas enfer- prepared in assay tubes with 10 mL of sterile

Publicación en línea, enero 2018 143

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

mas de banano colectadas en las zonas productoras distilled water: 50, 100, 500, 1000 and 5000 ppm.
del Municipio de Teapa, Tabasco. Se cortaron tro- The content of each tube was mixed in flasks
zos de tejido vegetal enfermo de aproximadamente containing PDA medium (30 mL) and then the
1 cm2 y se pegaron a discos de papel filtro. El mate- content of each flask was distributed among four
rial enfermo se desinfectó superficialmente en una Petri dishes (10 mL). PDA plates without treatment
solución de hipoclorito al 3% y posteriormente se were used as control. Essential oils extracted from
lavó por triplicado con agua destilada. Los discos seven plant species were evaluated at the five
se colocaron en la tapa de placas Petri con medio concentrations (50, 100, 500, 1000 and 5000 ppm),
de cultivo sólido (Agar-Agua). A los tres días de except for S. aromaticum that was not evaluated at
crecimiento del hongo, éste se transfirió a medio the concentration of 50 ppm. For inoculation, small
de cultivo PDA para su desarrollo (Stover, 1963). discs of around 0.4 mm2 from the culture medium
Se prepararon las diferentes concentraciones containing the M. fijiensis isolate were cut and
de cada aceite vegetal: 50, 100, 500, 1000 y 5000 placed in the middle of each Petri dish.
ppm, en tubos de ensaye con 10 mL de agua destila- In this study, a completely randomized design
da estéril. El contenido de cada tubo se mezcló en with four replications was used, where the
matraces con medio PDA (30 mL) y a continuación treatments were the five concentrations of each
el contenido de cada matraz se distribuyó en cua- plant oil plus an absolute control (PDA).
tro placas Petri (10 mL). Como testigo se utilizaron The measured variables were the percentage of
placas PDA sin tratamiento. Los aceites esenciales radial growth inhibition (PICR) as well as that of
extraídos de siete especies vegetales fueron evalua- M. fijiensis own growth. To evaluate the efficacy of
dos en las cinco concentraciones, excepto S. aro- the treatments, the fungal colony development was
maticum, el cual no fue evaluado a la concentración measured (in mm) until the Petri dishes containing
de 50 ppm. Para la inoculación, a partir del medio the control were completely covered with
de cultivo con la cepa de M. fijiensis, se cortaron mycelium. The PICR was calculated according to
pequeños discos de 0.4 mm2 aproximadamente y se the following formula:
colocaron al centro de cada placa Petri.
Se usó un diseño experimental completamente FG RC  RT IJ100
al azar con cuatro repeticiones, donde los trata-
PICR(%) 
H RC K
mientos fueron las cinco concentraciones de cada
aceite vegetal, más un testigo absoluto (PDA). where RC= mycelium radius in the control, and
Las variables medidas fueron el porcentaje de RT= mycelium radius in the treatments.
inhibición del crecimiento radial (PICR) y el pro-
pio crecimiento de M. fijiensis. Para evaluar la efi- Data were analyzed using the SAS version 9.0
cacia de los tratamientos, se midió el desarrollo de software. To determine the effect of the treatment,
la colonia fúngica (mm) hasta que las cajas Petri a variance analysis and Tukey’s multiple range test
del testigo estuvieron completamente cubiertas con of means were carried out.
micelio. El PICR se calculó con la fórmula: After the antifungal activity of the plant oils
ended, those showing the highest biological
FG RC  RT IJ100 activity were selected to know their approximate
PICR(%) 
H RC K chemical composition using the thin-layer

Publicación en línea, enero 2018 144

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

donde RC= radio del micelio en el testigo y RT= chromatography (CCF) (Randerath, 1970) and
radio del micelio en los tratamientos. column chromatography (CC) techniques (Abbot
and Andews, 1970). Before using chromatography,
Los datos fueron analizados con el programa the literature was reviewed to know what type
SAS, versión 9.0. Se realizó un análisis de varianza of metabolites were present in the raw extracts
y prueba de rango múltiple de medias Tukey, para obtained, as well as their biological activity, and
identificar el efecto de tratamiento. then the corresponding relation was established
Después de determinar la actividad antifúngica with the phytochemical results achieved in this
de los aceites vegetales, se eligieron aquéllos que study.
mostraron la mayor actividad biológica, para cono- According to the percentage of M. fijensis
cer su composición química aproximada, aplican- radial growth inhibition (RGI) and mycelial
do las técnicas cromatografía en capa fina (CCF) growth, the oils with the best inhibitory effect on
(Randerath, 1970) y cromatografía en columna Mycosphaerella fijiensis development were those
(CC) (Abbot y Andews, 1970). Previo a la croma- extracted from C. zeylanicum, O. vulgare and
tografía, se revisó la literatura para tener referencia P. dioica, whose inhibitory effect was observed
del tipo de metabolitos presentes en los extractos at a dose of 100 ppm, with inhibition values of
crudos obtenidos y su actividad biológica, con lo 90.5, 71.5 and 58%, respectively. When the oils
cual se efectuó la relación correspondiente con los were used at a concentration of 500 ppm, 100%
resultados de fitoquímicos identificados en este es- inhibition was achieved. The other oils showed
tudio. lower values: S. aromaticum: 10.5%, P. auritum:
De acuerdo al porcentaje de inhibición del cre- 22.5%, A. ludoviciana: 38% and O. majorana:
cimiento radial (PICR) y el crecimiento del micelio 45.9%. A. ludoviciana and O. majorana oils had
de M. fijensis, los aceites de mejor efecto inhibito- a significant inhibitory effect at a concentration of
rio sobre el desarrollo de Mycosphaerella fijiensis, 1000 and 5000 ppm. S. aromaticum did not show
fueron los extraídos de C. zeylanicum, O. vulgare y any inhibitory effect on the fungus (Table 1).
P. dioica, con efecto inhibitorio a partir de la dosis On the first day of exposure, C. zeylanicum,
de 100 ppm, con valores de 90.5, 71.5 y 58%, de O. vulgare and P. dioica oils at a dose of 100 ppm
inhibición, respectivamente; a una concentración showed 100% PICR with no M. fijiensis growth.
de 500 ppm, la inhibición fue del 100 %. Los otros The same effect lasted up to three days when
aceites registraron valores menores: S. aromaticum essential C. zeylanicum oil was used. On day five
10.5%, P. auritum 22.5%, A. ludoviciana 38% y O. of exposure, the same oils showed minimum M.
majorana 45.9%. Los aceites de A. ludoviciana y fijiensis mycelial growth, with values from 2 to
O. majorana, mostraron efecto inhibitorio signifi- 9 mm (Figure 1A), but when the three oils were
cativo a una concentración de 1000 y 5000 ppm. used at a concentration of 500 ppm, fungal growth
S. aromaticum no mostró ningún efecto inhibitorio inhibition was 100% (Figure 1B).
sobre el hongo (Cuadro 1). The antifungal capacity of the essential C.
El primer día de exposición, los aceites de C. ze- zeylanicum oil partially coincides with that
ylanicum, O. vulgare y P. dioica a una dosis de 100 reported by Barrera and García (2008), who found
ppm, registraron un 100% PICR, con nulo creci- a growth inhibitory effect of 70% in Fusarium
miento de M. fijiensis y este mismo efecto se spp isolated from papaya at a concentration of

Publicación en línea, enero 2018 145

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Cuadro 1. Porcentaje de inhibición de crecimiento radial (PICR) de Mycosphaerella fijiensis por efecto de los
aceites esenciales, cinco días después de la inoculación.
Table 1. Percentage of radial growth inhibition (PRGI) of Mycosphaerella fijiensis by the effect of essential oils five
days after inoculation.

Concentración (ppm)
Especie
Control 50 100 500 1000 5000

Origanum vulgare 0D 23 C b 71.5 B b 100 A a 100 A a 100 A a

Artemisia ludoviciana 0D 13.5 C c 17 C e 38 B cd 100 A a 100 A a
Cinnamomum zeylanicum 0D 32.5 C a 90.5 B a 100 A a 100 A a 100 A a
Piper auritum 0D 9.5 D cd 8.5 D ef 22.5 C def 49.5 B c 90.0 A a
Pimenta dioica 0D 14.5 C bc 58 B c 100 A a 100 A a 100 A a
Syzygium aromaticum 0A 3.5 A de 10.5 A ef 10.5 A efg 10 A de 10.5 A c
Origanum majorana 0D -------- 36.9 C d 45.9 B c 94.7 A a 98.0A a
Control ---- 0f 0f 0g 0e 0d

Cifras con la misma letra en las filas no son estadísticamente diferentes (Pruebas de agrupamiento Tukey, p≤0.01).
Letras mayúsculas: agrupamiento entre concentraciones por cada aceite (fila). Letras minúsculas: agrupamiento entre
concentraciones entre aceites (columna) / Figures with the same letter in the rows are not statistically different (Tukey’s
grouping test, p≤0.01). Capital letters: grouping among concentration of each oil (row). Lowercase letters: grouping
among oil concentrations (column).

prolongó hasta los tres días con el aceite esencial 150 µg mL-1. In the case of O. vulgare oil, Soylu
de C. zeylanicum. A los cinco días de exposición, et al. (2006) found Phytophthora infestans total
estos mismos aceites registraron un mínimo desa- growth inhibition at concentrations from 0.3 to
rrollo micelial de M. fijiensis con valores de 2 a 9 mm 6.4 ug ml-1. Cáceres et al. (2013) reported that an O.
(Figura 1A); mientras que, con la concentración de vulgare extract at a concentration of 200 ppm caused

30 30
A) B)
25 25

20 20

15 15

10 10

5 5

0 0
0 1 2 3 4 5 0 1 2 3 4 5
O. vulgare A. ludoviciana O. vulgare A. ludoviciana
C. zeylanicum P. auritum C. zeylanicum P. auritum
P. dioica S. aromatiucm P. dioica S. aromatiucm
Control O. majorana Control O. majorana

Figura 1. Crecimiento del hongo Mycosphaerella fijiensis (mm) en los aceites esenciales obtenidos a partir de diferentes
especies de plantas. a) 100 ppm y b) 500 ppm. DDI= días después de la inoculación.
Figure 1. Mycosphaerella fijiensis growth (in mm) in essential oils obtained from different plant species. a) at 100 ppm and
b) at 500 ppm. DAI= days after inoculation.

Publicación en línea, enero 2018 146

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

500 ppm en los tres aceites, la inhibición del creci- total growth inhibition of Fusarium oxysporum and
miento del hongo fue del 100% (Figura 1B). Aspergillus niger, whereas in the case of Alternaria
La capacidad antifúngica del aceite esencial de alternata, Geotrichum candidum, Trichoderma
C. zeylanicum coincide parcialmente con lo repor- spp. and Penicillum digitatum, growth inhibition
tado por Barrera y García (2008), quienes encon- started at a concentration of 0.25 ᶙL mL-1. Ramírez
traron que este aceite tuvo un efecto inhibitorio del et al. (2011) reported that Moniliophthora roreri
70% en el crecimiento de Fusarium spp aislado de development in culture medium was totally
papaya a una concentración de 150 µg mL-1. Con inhibited by the same oil obtained as a hydrolate
respecto al aceite de O. vulgare, Soylu et al. (2006) by distillation at 50% (volume-volume). Also,
encontraron inhibición completa del crecimiento Ramírez et al. (2016) state that hydrodistillates and
de Phytophthora infestans a partir de 0.3 y 6.4 ug C. zeylanicum, S. aromaticum and P. dioica oils
ml-1. Cáceres et al. (2013) reportaron que el extrac- obtained by microwaving can efficiently inhibit A.
to de O. vulgare a una concentración de 200 ppm, solani and C. gloesporioides development.
causó inhibición total de Fusarium oxysporum y Origanum majorana oil had a 95% inhibition
Aspergillus niger; en tanto que para Alternaria al- effect at a concentration of 1000 ppm. The
ternata, Geotrichum candidum, Trichoderma spp. fungistatic effect of this species was reported by
y Penicillum digitatum la inhibición fue a partir de Gamboa et al. (2003), who found that the methanol
0.25 ᶙL mL-1. Ramírez et al. (2011) reportaron que extract of marjoram inhibited 100% of P. infestans
el mismo aceite obtenido como hidrolato por desti- mycelial growth at 8000 ppm, and from 59-80%
lación al 50% (volumen-volumen) inhibió comple- Rhizoctonia solani growth at 2000 and 4000 ppm,
tamente el desarrollo de Moniliophthora roreri en respectively. Damian et al. (2010) observed that
medio de cultivo. También Ramírez et al. (2016), the active principle of the extract of A. ludoviciana
concluyen que los hidrodestilados y aceites de C. was dichloromethanol-methanol (1:2 v/v), which
zeylanicum, S. aromaticum y P. dioica obtenidos inhibited 100% of Phytophthora cactorum, P.
por microondas, son eficientes en inhibir el desa- capsici, P. cinnamomi and P. mirabilis growth, and
rrollo de A. solani y C. gloesporioides. 60% of P. infestans growth, at a concentration of
El aceite de O. majorana mostró efecto inhi- 100 ppm. In this study, A. ludoviciana oil inhibited
bitorio del 95% a la concentración de 1000 ppm. 100% of M. fijiensis mycelial development at a
El efecto fungistático de esta especie fue reporta- concentration of 1000 ppm.
do por Gamboa et al. (2003), quienes encontraron The main active chemical components identified
que el extracto metanólico de mejorana inhibió el were cinnamic aldehyde and eugenol in essential
100% del crecimiento micelial de P. infestans a C. zeylanicum oils (50 and 10%, respectively); P.
partir de 8000 ppm y 59 a 80% de inhibición de dioica and O. vulgare. P. dioica and O. vulgare
Rhizoctonia solani a 2000 y 4000 ppm, respecti- had the highest concentration of eugenol (72.6 and
vamente. Damian et al. (2010), observaron que el 76.3%), followed by caryophyllene and limonene.
principio activo del extracto de A. ludoviciana fue The other components were reported in lower
el diclometanol-metanol (1:2 v/v), el cual inhibió concentrations; for example, safrole was present
el 100% del crecimiento micelial de Phytophthora only in C. zeylanicum oil; myrcene and O-cimene
cactorum, P. capsici, P. cinnamomi y P. mirabilis, were present only in P. dioica oil; and limonene
así como un 60% de P. infestans, a una concentración and carvacrol were present only in O. vulgare oil
de 100 ppm. En estudio, el aceite de A. ludoviciana (Table 2).

Publicación en línea, enero 2018 147

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

inhibió el 100% del desarrollo micelial de M. fijien- Cuadro 2. Principales compuestos químicos activos como
constituyentes de los aceites esenciales de tres
sis a una concentración de 1000 ppm. especies de plantas.
Los componentes químicos principales activos Table 2. Main active chemical compounds as ingredients
of essential oils from three plant species.
identificados fueron el aldehído cinámico y el eu-
genol en los aceites esenciales de C. zeylanicum (50 Concentración (%)
y 10%, respectivamente), P. dioica y O. vulgare. El Compuestos Cinnamomum Pimenta Origanum
eugenol, es el de mayor concentración en P. dioica zeylanicum dioica vulgare

y O. vulgare, con 72.6 y 76.3%, respectivamente,

Mirceno 4.17
seguido del cariofileno y limoneno. El resto de los
Felandreno 1.11 0.06
compuestos se reportaron en concentraciones me-
Limoneno 6.19
nores, de los cuales el safrol solo se presenta en el
O-cimeno 0.98
aceite de C. zeylanicum, mientras que el mirceno y
Carvacrol 1.06
el O-cimeno solo están en el aceite de P. dioica; el
Safrol 8
limoneno y el carvacrol, solo están presentes en el
Eucaliptol 3.4 0.24
aceite de O. vulgare (Cuadro 2).
Aldehído cinámico 50 0.82 0.39
Barrera y García (2008), reportaron que el al- Terpineno 0.47 0.06
dehído cinámico y el carvacrol inhibieron com- Terpinoleno 1.39 2.20
pletamente el crecimiento del micelio del hongo Alpha-terpineol 1.07 2.20
Fusarium spp. a partir de 100 µg mL-1. Wang et Eugenol 10 72.6 76.31
al. (2010) reportaron que Fusarium moniliforme, Cariofileno 6.13 0.21
Sclerotinia sclerotiorum, Cercospora beticola,
Mycogone perniciosa, Macrophoma kawatsukai,
Thanatephorus cucumeris, Alternaria alternata y Barrera and García (2008) reported that cinnamic
Botrytis cinerea, fueron altamente sensibles a la aldehyde and carvacrol inhibited completely
aplicación de eugenol, de los cuales B. cinerea y S. Fusarium spp fungal mycelial growth at 100 µg
sclerotiorum fueron los más sensibles a este prin- mL-1. Wang et al. (2010) reported that Fusarium
cipio activo, con valores de CE50 de 38.6 y 39.9 ᶙg moniliforme, Sclerotinia sclerotiorum, Cercospora
mL-1, respectivamente. beticola, Mycogone perniciosa, Macrophoma
Gill y Holley (2006) evaluaron el eugenol, car- kawatsukai, Thanatephorus cucumeris, Alternaria
vacrol y cinamaldehido sobre los cambios de ATP alternata and Botrytis cinereal were highly sensible
y viabilidad celular de Escherichia coli, Listeria to eugenol applications, and from these B. cinerea
monocytogenes y Lactobacillus sakei. Los resul- and S. sclerotiorum were the most sensible to such
tados indican que el mecanismo de acción del eu- active principle, with values of CE50 of 38.6 and
genol y carvacrol es la disrupción de la actividad 39.9 ᶙg mL-1, respectively.
citoplasmática de la membrana, lo que aumenta Gill and Holley (2006) evaluated eugenol,
su permeabilidad no específica. La ausencia de un carvacrol and cinnamic aldehyde to observe ATP
aumento en el ATP extracelular de células tratadas changes and cell variability in Escherichia coli,
con cinamaldehído, sugiere que eugenol y carva- Listeria monocytogenes and Lactobacillus sakei.
crol poseen actividad inhibidora de la ATPasa que Their results show that eugenol and carvacrol
carece de cinamaldehído. Ante estas evidencias, se action mechanism is a disruption of the membrane

Publicación en línea, enero 2018 148

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

relaciona que el efecto de los aceites de C. zeyla- cytoplasmic activity, which increases their non-
nicum, P. dioica y O. vulgare, inhibieron el creci- specific permeability. The absence of extracellular
miento del micelio de M. fijiensis, por la presencia ATP of cells treated with cinnamic aldehyde
de eugenol y aldehído cinámico; así como el carva- suggests that eugenol and carvacrol have inhibitory
crol en el aceite de O. vulgare. activity from ATPase, which contains no cinnamic
aldehyde. These results suggest that the effect
of C. zeylanicum, P. dioica and O. vulgare oils
CONCLUSIONES inhibited M. fijiensis mycelial growth because of
the presence of eugenol and cinnamic aldehyde, as
Los aceites esenciales de C. zeylanicum y O. well of carvacrol in O. vulgare oil.
vulgare y P. dioica fueron los de mejor efecto inhi-
bitorio sobre el crecimiento micelial de M. fijiensis
en condiciones in vitro a una concentración de 100 CONCLUSIONS
ppm, con una inhibición del 100% a partir de 500
ppm. Los aceites de A. ludoviciana, y O. majorana, Essential C. zeylanicum, O. vulgare and P.
presentaron efecto inhibitorio a concentraciones de dioica oils had the best inhibitory effect on M.
1000 ppm; P. auritum a 5000 ppm y S. aromaticum, fijiensis mycelial growth under in vitro conditions
no presentó efecto inhibitorio. El aldehído cinámi- at a concentration of 100 ppm, with 100% inhibition
co fue el principal compuesto químico detectado en at 500 ppm. A. ludoviciana and O. majorana oils
C. zeylanicum; el eugenol en P. dioica y O. vulgare, showed an inhibitory effect at concentrations of
ésta última también con pequeñas concentraciones 1000 ppm; P. auritum at 5000 ppm; S. aromaticum
de carvacrol. did not show any inhibitory effect. Cinnamic
aldehyde was the main chemical compound
principle detected in C. zeylanicum; eugenol in P.
LITERATURA CITADA dioica and O. vulgare. The latter also showed small
concentration of carvacrol.
Abbott D, and Andews RS. 1970. Introducción a la Cromato-
grafía, 3ª ed. Alhambra, Madrid. 122p.
End of the English version
Barrera NLL, y García BL. J. 2008. Actividad antifúngica de
aceites esenciales y sus compuestos sobre el crecimiento
de Fusarium sp. aislado de papaya (Carica papaya). Re-
vista científica UDO Agrícola 8(1):33-41. Disponible en
línea: [Link]/pdf?cg08005
Celis FA, Mendoza FC, Pachón SE. 2012. Plantas aromáticas
Bravo LL, Bermudez TK and Montes BR. 2000. Inhibition of
silvestres promisorias por su contenido de aceites esen-
Fusarium moniliforme by plant powders and some of their
ciales. Universidad de Cundinamarca, Editorial Produme-
chemical constituents. Manejo Integrado de Plagas (CA-
dios. Bogotá DC. Colombia. 56 p.
TIE) 57:29-34. Disponible en línea: [Link]
Chávez-Solís AL, Pedroza SA, Nava DC, Cano RP y Castro
cgibin/[Link]/?IsisScript=[Link]&method=post&for
FR. 2014. Control de la cenicilla del melón (Podosphaera
mato=2&cantidad=1&expresion=mfn=073431 (consulta,
xanthii) mediante el uso de extracto de Larrea tridentata
mayo 2014)
(D.C.) Coville (L.). Revista Chapingo Serie Zonas Áridas
Cáceres-Rueda de León I, Colorado-Vargas R, Salas-Muñoz E,
2:103-113. DOI:10.5154/[Link]. 2012.08.038
Muñoz-Castellanos LN y Hernández-Ochoa L. 2013. Acti-
Damian BLM, Martínez MRE, Salgado GR and Martínez
vidad Antifúngica in vitro de extractos acuosos de especias
PMM. 2010. In vitro antioomycete activity of Artemisia
contra Fusarium oxysporum, Alternaria alternata, Geotri-
ludoviciana extracts against Phytophthora spp. Boletín
chum candidum, Trichoderma spp., Penicillum digitatum
Latinoamericano y del Caribe de Plantas Medicinales y
y Aspergillus niger. Revista Mexicana de Fitopatología
Aromáticas 9(2):136-142. Disponible en línea: [Link]-
31(2):105-112. Disponible en línea: [Link]/
[Link]/html/856/85612475009/
Vol3122013/Integrado/[Link]

Publicación en línea, enero 2018 149

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Domínguez XA. 1979. Método de investigación fitoquímica. Martínez-Bolaños L, Téliz-Ortiz D, Rodríguez-Maciel JC,
Ed Limusa. Mexico, D. F. 281p. Mora-Aguilera JA, Nieto-Ángel D, Cortés-Flores JI,
Gamboa AR, Hernández CFD, Guerrero RE, Sánchez AA y Mejía-Sánchez D, Nava-Diaz C y Silva-Aguayo G. 2012.
Lira SSH. 2003. Inhibición del crecimiento micelial de Fungicides resistance on Mycosphaerella fijiensis popula-
Rhizoctonia solani Kühn y Phytophthora infestans Mont tions of southeastern Mexico. Agrociencia 46: 707-717.
(De Barry) con extractos vegetales metanólicos de hojasén Disponible en línea: [Link]
(Flourensia cernua D.C.), mejorana (Origanum majora- v46n7/[Link]
na L.) y trompetilla [Bouvatdia ternifolia (Ca.) Schlecht.]. Ramírez GSI, López BO, Espinosa ZS y Wong VA. 2016.
Revista Mexicana de Fitopatología 21:13-18. Disponible Actividad antifúngica de hidrodestilados y aceites sobre
en línea: [Link] Alternaria solani, Fusarium oxysporum, Colletotrichum
Gill A and Holley RA. 2006. Disruption of Escherichia coli, gloesporioides. Revista Mexicana de Ciencias Agrícolas.
Listeria monocytogenes and Lactobacillus sakei cellular Noviembre-Diciembre, 1879-1891. Disponible en línea:
membranes by plant oil aromatics. International Journal of [Link]
Food Microbyology 108(1):1-9. [Link] Ramírez GS, López BO, Guzmán HT, Munguía US y Espi-
ijfoodmicro.2005.10.009 nosa ZS. 2011. Actividad antifúngica in vitro de extractos
Guerrero E, Solís S, Hernández F, Flores A, Sandoval V y de [Link] L., Tradescantia spathacea Swartz
D Jasso. 2007. Actividad biológica in vitro de extractos y Zingiber officinale Roscoe sobre Moniliophthora roreri
de Flourensia cernua D. C. en patógenos de postcose- (Cif & Par). Tecnología en Marcha 24(2):3-17. Disponi-
cha: Alternaria alternata (Fr.:Fr.) Keissl, Colletotrichum ble en línea: [Link]
gloesporioides (Penz) Penz y Sacc y Penicillium digitatum lo/[Link]
(Pers.:Fr.) Sacc. Revista Mexicana de Fitopatología 25:48- Randerath K. 1970. Cromatografía de capa fina. Ediciones
53. Disponible en línea: [Link] Urmo, S.A. Bilbao 3.
oa?id=61225107 Soylu EM, S Soylu and S. Kurt. 2006. Antimicrobial activities
Lambert RJW, Skandaims PN, Coote PJ and Nychas GJ. 2001. of the essential oils of various plants against tomato late
A study of the mínimum inhibitory concentration and mode blight disease agent Phytophthora infestans. Mycopatho-
of action of oregano essential oil, thymol and carvacrol. logy 161(2):119-128. [Link]
Journal of Applied Mycrobiology 91:453-462. Disponible 0206-z
en línea: [Link] Stover RH. 1963. Leaf spot of bananas caused by Mycosphae-
Mena-Espino X y Couoh-Uicab Y. 2015. Efectos de los pla- rella musicola: Associated ascomycetous fungi. Cana-
guicidas utilizados para el control de la Sigatoka negra en dian Journal of Botany 41(10):1481-1485. [Link]
plantaciones bananeras en México, así como su efecto en org/10.1139/b63-128
el ambiente y la salud pública. Tecnociencia Chihuahua Wheeler WB. 2002. Pesticides in Agriculture and the Environ-
9(2): 91-98. Disponible en línea: [Link] ment. Ed. Dekker. New York. 337p.
mx/numeros/v9n2/data/Efectos_de_los_plaguicidas_utili- Wang C, Zhang J, Chen H, Fan Y, & Shi Z. 2010. Antifun-
zados_para_el_control_de_la_Sigatoka_negra_en_planta- gal activity of eugenol against Botrytis cinerea. Tropical
ciones_bananeras.pdf Plant Pathology 35(3):137-143. [Link]
Muñoz L, Montes M y Wilkomirsky T. 2001. Plantas medici- S1982-56762010000300001
nales de uso en Chile. Química y Farmacología. Editorial
Universitaria, Santiago de Chile. 330p.

Publicación en línea, enero 2018 150

 Differential gene expression of avocado defense genes in
response to avocado sunblotch viroid infection

Expresión diferencial de genes de defensa en aguacate en respuesta

a la infección del viroide de la mancha de sol del aguacate

Luis Alberto López-Rivera, Iván Ramírez-Ramírez, Víctor Arturo González-Hernández, Nicacio Cruz-
Huerta*, Posgrado de Recursos Genéticos y Productividad-Fisiología Vegetal, Colegio de Postgraduados, Km
36.5 Carretera México-Texcoco, Montecillo, Texcoco, Estado de México, CP 56230, México; Daniel Téliz-
Ortiz, Posgrado en Fitosanidad-Fitopatología, Colegio de Postgraduados, Km 36.5 Carretera México-Texcoco,
Montecillo, Texcoco, Estado de México, CP 56230, México. *Autor para correspondencia: ncruzh@[Link].

Recibido: 29 de Julio, 2017. Aceptado: 09 de Octubre, 2017.

López-Rivera LA, Ramírez-Ramírez I, González-Her- Abstract. Involvement of pathogenesis related

nández VA, Cruz-Huerta N, Téliz-Ortiz D. 2017. Di- proteins in defense against some of the most
fferential gene expression of avocado defense genes in important avocado pathogens has been shown.
response to avocado sunblotch viroid infection. Revista However, infections caused by Avocado sunblotch
Mexicana de Fitopatología 36(1): 151-161. viroid (ASBVd) require further research to elucidate
DOI: 10.18781/[Link].1707-5 the response components. Avocado response to
ASBVd infections can be either asymptomatic or
Primera publicación DOI: 22 de Noviembre, 2017. symptomatic, which further raises questions about
First DOI publication: November 22, 2017. plant defense mechanisms. This research analyzed
the expression of genes PaNPR1, EREBP, PR-5
and PR-6, which encode defense proteins, in
Resumen. En aguacate se ha demostrado la parti- symptomatic and asymptomatic avocado leaves and
cipación de proteínas relacionadas con patogénesis fruits infected with ASBVd. Data analysis shows
en la defensa contra algunos de sus patógenos más that ASBVd infections modify the expression of
importantes. Sin embargo, en la enfermedad de la PR-5 and PR-6, while the expression of PaNPR1
mancha de sol del aguacate causada por el Avoca- and EREBP does not change. Expression differences
do sunblotch viroid (ASBVd) aún quedan algunos on fruit were more evident with PR-5 on fruit from
componentes de la respuesta de defensa por acla- asymptomatic trees; PR-6 had higher expression
rar. En particular, la infección por ASBVd puede on infected fruits but there were no differences
ser asintomática o causar síntomas, lo cual gene- between symptomatic and asymptomatic fruits.
ra incógnitas sobre el mecanismo de defensa de la The coordinated expression of both genes on fruit
planta. En esta investigación se analiza la expre- suggest the activation of a synergistic defense
sión de genes codificantes de proteínas de defensa, mechanism in response to ASBVd infection.

Publicación en línea, enero 2018 151

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

PaNPR1, EREBP, PR-5 y PR-6 en hojas y frutos de Key words: Avocado sunblotch viroid, Persea
aguacate infectado por ASBVd, en condición sin- americana, PR genes.
tomática y asintomática. El análisis de datos mues-
tra que la infección de ASBVd modifica la expre-
sión de los genes PR-5 y PR-6, mientras que la de Avocado sunblotch is a disease caused by
PaNPR1 y EREBP no se modifica. Se encontraron Avocado sunblotch viroid (ASBVd), one of the
diferencias en la expresión en frutos, siendo nota- most persistent infections that affects avocado
ble con PR-5 en frutos de árboles asintomáticos; a production in Mexico (Vallejo-Pérez et al., 2017).
su vez, PR-6 se expresa más en frutos infectados Avocado sunblotch causes cytopathic effects
pero sin diferencias entre sintomático y asintomá- and physiological changes (Di Serio et al., 2013;
tico. La expresión coordinada de ambos genes en Saucedo-Carabez et al., 2014; Vallejo-Pérez et al.,
frutos sugiere la activación de un mecanismo si- 2014; Saucedo-Carabez et al., 2015; Vallejo-Pérez
nérgico de respuesta de defensa a la infección de et al., 2015) that result in smaller fruit, low external
ASBVd. and internal quality and reduced yield. Severe
damages on fruit include depressed wounds on the
Palabras clave: Avocado sunblotch viroid, Persea surface with yellow to necrotic spots (Desjardins,
americana, genes PR. 1987). In spite of its severity, a particular feature
of ASBVd is that it causes asymptomatic infections
in trees (Semancik and Szychowski, 1994), a fact
La enfermedad de la mancha de sol causada that poses a high risk of non-intentional dispersion
por el Avocado sunblotch viroid (ASBVd) es una by plant material or seed. The first strategy to
de las infecciones más persistentes en el aguacate control this disease is the identification of infected
producido en México (Vallejo-Pérez et al., 2017). trees, followed by identification of the defense
Esta enfermedad causa efectos citopáticos y cam- mechanisms that allow a tree to show no symptoms.
bios fisiológicos (Di Serio et al., 2013; Saucedo- Genes regulated during the defense response
Carabez et al., 2014; Vallejo-Pérez et al., 2014; to pathogens in avocado have been found in gene
Saucedo-Carabez et al., 2015; Vallejo-Pérez et al., expression profiles and have shown the molecular
2015), que finalmente resultan en frutos de menor basis of the plant-pathogen interaction. These
tamaño y calidad externa e interna, y con menor studies have mainly focused on infections by
rendimiento de fruto. En los frutos, los daños se- Colletotrichum gloeosporioides (Djami-Tchatchou
veros incluyen heridas deprimidas en su superficie et al., 2012) and Phytophthora cinnamomi
que varían desde un color amarillo hasta manchas (Mahomed and Van Den Berg, 2011). PR genes in
necróticas (Desjardins, 1987). A pesar de su seve- avocado are particularly important because they
ridad, el ASBVd tiene la particularidad de causar favor an induced immune mechanism known as
infecciones asintomáticas en los árboles (Semancik systemic acquired resistance. This study initiated
y Szychowski, 1994), y con ello un mayor riesgo with the hypothesis that the gene expression
de diseminación no intencionada, por material ve- cascade in the avocado defense response to ASBVd
getal o por semilla. La primera estrategia de con- (responsible for avocado sunblotch infection) is
trol de la enfermedad es la identificación de árboles different between asymptomatic and symptomatic
infectados y esta se puede complementar con la trees, possibly due to differential defensive capacity

Publicación en línea, enero 2018 152

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

identificación de los mecanismos de defensa que le against the disease. Thus, this study described
permiten a un árbol no manifestar los síntomas de changes in the level of expression of defense
la enfermedad. genes selected in symptomatic and asymptomatic
En la búsqueda de destacar genes regulados du- ASBVd-infected plants.
rante las respuestas de defensa a patógenos en agua- Mature leaves and unripe fruit from nine
cate se han elaborado estudios de perfiles de expre- avocado trees (Persea americana Mill.) cv. Hass
sión que han revelado las bases moleculares de la were collected in a commercial orchard (19º26’6”
interacción planta-patógeno, enfocadas principal- N 101º52’28” O, 1610 m altitude). Trees were
mente en infecciones causadas por Colletotrichum previously classified as healthy, positive for
gloeosporioides (Djami-Tchatchou et al., 2012) y ASBVd with visible symptoms, and positive for
Phytophthora cinnamomi (Mahomed y Van Den ASBVd without symptoms (Vallejo-Pérez et al.,
Berg, 2011). En aguacate han destacado los genes 2015), and with no visible symptoms from another
PR por favorecer un mecanismo inmune inducido disease. Three leaves and three fruits from three
de defensa de la planta conocido como resistencia trees of each group were sampled.
sistémica adquirida. En este trabajo se partió de la Four genes associated with pathogen defense
hipótesis que la cascada de expresión en respuesta in avocado were selected: PaNPR1 (Backer et al.,
de defensa del aguacate al ASBVd, causante de la 2015), PR-5, PR-6 and EREBP (Djami-Tchatchou
enfermedad de la mancha de sol, es diferente en et al., 2013). The actin gene (Reeksting et al., 2014)
árboles asintomáticos de aquellos que presentan was used as a reference gene. Sequences of the
síntomas, posiblemente indicando una capacidad primers were taken from the mentioned references.
de defenderse del ataque de esta enfermedad. El ASBVd detection required primers designed by
objetivo de este estudio fue describir los cambios Schnell et al. (1997).
en niveles de expresión de los genes de defensa se- Total RNA extraction involved tandem use of
leccionados en plantas infectadas con síntomas y PureLink® Plant RNA Reagent (Invitrogen) and
asintomáticas de la infección de ASBVd. Direct-zol® RNA MiniPrep (Zymo Research) as per
Se colectaron hojas maduras y frutos inmaduros manufacturer’s directions to deal with high phenol
de nueve árboles de aguacate (Persea americana and polysaccharides content in sample tissue.
Mill.) cv. Hass de un huerto comercial (19º26’6”N RNA concentration and quality were measured
101º52’28”O, 1610 m de elevación). Los árboles in a Nanodrop 8000 (Thermo Scientific, USA),
fueron previamente identificados como árboles sa- and the integrity of each sample was verified on a
nos, árboles positivos a ASBVd con síntomas visi- denaturing gel, according to the protocol by Aranda
bles y árboles positivos asintomáticos (Vallejo-Pé- et al. (2012).
rez et al., 2015) y sin síntomas de otra enfermedad. A mixture (10 μL final volume per reaction)
Se muestrearon tres hojas y tres frutos por árbol en containing the following substances was prepared
tres árboles de cada grupo. to perform reverse transcription and amplification:
Se eligieron cuatro genes relacionados con de- 1X of Reaction Mix buffer (0.2 mM of each dNTP
fensa a patógenos en aguacate: PaNPR1 (Backer et and 1.6 mM of MgSO4), 0.2 μM of sense primer,
al., 2015), PR-5, PR-6 y EREBP (Djami-Tchatchou 0.2 mM of antisense primer, 0.4 μL of Super
et al., 2013). El gen de actina (Reeksting et al., 2014) Script® III RT/Platinum® TaqMix (Invitrogen), and
se usó como gen de referencia. Las secuencias de los 100 ng of total RNA; the volume was completed by

Publicación en línea, enero 2018 153

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

iniciadores se tomaron de las referencias mencio- adding DEPC-treated water. PCR reactions were
nadas. Para la detección del ASBVd se emplearon conducted in a thermocycler (Applied Biosystems
los iniciadores diseñados por Schnell et al. (1997). 2720, EUA) under the following conditions: cDNA
Para la extracción de RNA total, se usaron en synthesis 1 cycle of 32 min at 50 °C; 1 cycle of 2
forma conjunta los métodos PureLink® Plant RNA min at 94 °C, followed by 40 cycles of 15 s at 94 °C, 15 s
Reagent (Invitrogen) y Direct-zol® RNA MiniPrep using the calculated annealing temperature (TA) for
(Zymo Research), de acuerdo con los manuales de each primer (Table 1), and 15 s at 68 °C. Finally, a 5
cada kit, debido al alto contenido de fenoles y po- min elongation step at 68 °C was added. RT-PCR
lisacáridos en el tejido. La concentración y calidad products were separated by electrophoresis in
del RNA se midieron en un Nanodrop 8000 (Ther- 2%/TAE agarose gel at 80 V for 60 min. Gels
mo Scientific, EUA), y la integridad de cada mues- were exposed to UV light in a UV-transilluminator
tra se verificó en gel desnaturalizante de acuerdo (Vilber Lourmat Infinity-1000/26MX, France)
con el protocolo de Aranda et al. (2012). to capture images of the final products. Pathogen
Para la retrotranscripción y amplificación, en un detection tests were carried out using single-step
volumen final de 10 μL por reacción se mezclaron: duplex RT-PCR, ASBVd and actin primers. The
1X de Reaction Mix buffer (0.2 mM de cada dNTP mixture used for a 10 μL final volume of reaction
y 1.6 mM de MgSO4), 0.2 μM de iniciador senti- contained 1X Reaction Mix buffer, 0.2 μM of
do, 0.2 mM de iniciador antisentido, 0.4 μL de Su- both primers (sense and antisense), 0.4 μL of
perScript® III RT/Platinum® TaqMix (Invitrogen), SuperScript® III RT/Platinum® TaqMix, and 100 ng
100 ng de RNA total, y se completó el volumen of total RNA; the volume was completed by adding
con agua tratada con DEPC. Las reacciones se co- DEPC-treated water. Amplification conditions
rrieron en un termociclador (Applied Biosystems were similar to those described previously. Defense
2720, EUA) con las siguientes condiciones: sínte- genes and ASBVd viroid were detected in three
sis de cDNA 1 ciclo de 32 min a 50 °C; 1 ciclo de 2 samples of mature leaves and three samples of
min a 94 °C; seguido de 40 ciclos de 15 s a 94 °C,
15 s con la temperatura de alineamiento calculada
(TA) para cada iniciador (Cuadro 1), 15 s a 68 °C. Cuadro 1. Temperaturas de alineamiento calculadas (TA)
para ejecutar la RT-PCR de un solo paso y ta-
Por último, se programó un paso de elongación fi- maño de los productos esperados en pares de
nal por 5 min a 68 °C. Los productos obtenidos de bases (pb).
Table 1. Calculated annealing temperature (TA) for one-
la RT-PCR se separaron por electroforesis en gel de step RT-PCR, and size of the expected products in
agarosa al 2%/TAE a 80 V por 60 min. Los geles base pairs (pb).

fueron expuestos a luz UV en el fotodocumenta- Iniciador TA (°C) Tamaño del producto (pb)
dor (Vilber Lourmat Infinity-1000/26MX, Francia)
para obtener imágenes de los productos finales. La ASBVd 52.0x 250
Actina 57.1 103
prueba de detección del patógeno se ejecutó con PaNPR1 56.3 119
RT-PCR dúplex en un solo paso empleando los ini- PR-5 55.6 171
ciadores del ASBVd y de actina. La mezcla utiliza- PR-6 52.0 158
EREBP 61.6 96
da para un volumen final de 10 μL de reacción fue:
1X Reaction Mix buffer, 0.2 μM de ambos iniciado-
x
Temperatura de alineamiento para la prueba de detección del
ASBVd por RT-PCR dúplex / xAnnealing temperature to de-
res, sentido y antisentido; 0.4 μL de SuperScript® III tect ASBVd through duplex RT-PCR.

Publicación en línea, enero 2018 154

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

RT/Platinum® TaqMix; 100 ng de RNA total, y se unripe fruit per group from healthy, symptomatic
completó el volumen con agua tratada con DEPC. and asymptomatic trees. Nine viroid bands from
Las condiciones en el termociclador son iguales a leaf tissue, four from symptomatic trees and
las ya mencionadas. En los análisis de los genes de five from asymptomatic trees were sequenced
defensa y detección de ASBVd, se analizaron tres (Macrogen Inc, Seul, Corea) and compared using
muestras de hoja madura y tres muestras de fru- BLASTn from the NCBI.
to inmaduro por grupo de árboles sanos, con sín- Band density was compared using image
tomas y asintomáticos. Nueve bandas del viroide processing with ImageJ® (Schneider et al., 2012).
obtenidas de tejido de hoja, cuatro de árboles con Band density values were normalized by data
síntomas y cinco de árboles asintomáticos, fueron transformation √(x+1), compared with the actin
secuenciadas (Macrogen Inc, Seul, Corea) y com- density values and then plotted. The resulting
paradas con BLASTn del NCBI. graphs display a profile of the average relative
Con el programa de análisis de imágenes ImageJ® intensity taken from a constant region of interest.
se comparó la densidad de bandas en gel de agarosa Differences between tissue and trees were analyzed
(Schneider et al., 2012). Los valores de densida- using Student’s t-test. Statistical significance was
des de las bandas fueron normalizados por trans- considered as p ≤ 0.05.
formación de datos √(x+1) y comparados con los The detection test for ASBVd on tissue from
valores de densidad de actina y después graficados. infected trees amplified a band of approximately
Las gráficas resultantes indican un perfil de intensi- 250 pb, which coincides with the expected size
dad relativa media, tomada de una región de interés of the studied pathogen; this band is not present
constante. Las diferencias entre los tejidos y los ár- in healthy trees (Figure 1). Amplification of the
boles se analizaron por la prueba t de Student. La actin gene shows that a reaction occurred in all the
significancia estadística se consideró con p ≤ 0.05. analyzed samples. Sequencing of the bands highly
La prueba de detección del ASBVd indica que matched three ASBVd isolates (KF562705.1,
el tejido de árboles infectados amplificó una banda KF562706.1 and KF562704.1, greater than 92%
de aproximadamente 250 pb, que coincide con el identity, and E-value less than 7x10-67, data not
tamaño esperado del patógeno en cuestión, banda shown) found in avocado production areas (Beltrán
que no se presenta en árboles sanos (Figura 1). La et al., 2014).
amplificación del gen de actina indica que la re- Amplified products separated by electrophoresis
acción se llevó a cabo en todas las muestras ana- are shown in Figure 2. Healthy tree samples show
lizadas. Las secuencias analizadas mostraron alta basal expression of the tested genes and serve as
coincidencia con tres aislamientos del ASBVd expression reference to ASBVd infection between
(KF562705.1, KF562706.1 y KF562704.1, Iden- infected trees (symptomatic and asymptomatic)
tidad>92%; valor E<7x10-67, datos no mostrados) and healthy trees. Surface and percentage data
reportados en las zonas productoras de aguacate calculated by ImageJ® were used to calculate
(Beltrán et al., 2014). relative density of each band; this relative density
Los productos de la amplificación separados por was adjusted to the level of expression of the actin
electroforesis se presentan en la Figura 2. Los teji- gene reference (Figure 3).
dos de árboles sanos muestran expresión basal de The PaNPR1 and EREBP genes did not show
los genes evaluados, por lo que las comparaciones significant differences in differential expressions

Publicación en línea, enero 2018 155

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

300 pb ASBVd 250 pb

200 pb
Actina 103 pb
100 pb

Figura 1. Detección del Avocado sunblotch viroid (ASBVd) en aguacate. Productos amplificados por RT-PCR dúplex de un
solo paso. Los tejidos positivos para la infección con ASBVd muestran dos productos, el que pertenece al viroide
de 250 pb y el de la amplificación del gen de actina de 103 pb. Carril 1: marcador de 100 pb; Carriles 2 y 3: tejido
foliar, y Carril 6 fruto de árboles sanos; Carriles 4 y 7: hoja y fruto de árboles asintomáticos; Carriles 5 y 8: hoja
y fruto de árboles con síntomas visibles. La banda correspondiente al viroide se expresa sólo en árboles infectados.
Figure 1. Detection of Avocado sunblotch viroid (ASBVd) in avocado. Amplified products using duplex one-step RT-PCR.
Tissues that tested positive for ASBVd show two products, one that belongs to the 250 bp viroid, and one from the
amplification of the 103 bp actin gene. Lane 1, 100 bp marker; Lanes 2 and 3, healthy leaf samples; Lane 4 and 7,
leaf and fruit samples from asymptomatic trees; Lane 6, fruit sample from healthy tree; Lanes 5 and 8, leaf and
fruit samples from trees with visible symptoms. The band corresponding to the viroid is expressed only in infected
trees.

Hojas Frutos

Actina

PaNPR1

PR-5

PR-6

EREBP

H S A H S A

Figura 2. Productos de la amplificación de genes de defensa. Los primeros tres carriles corresponden a tejido foliar, los tres
restantes a tejido de frutos. H, sano; S, sintomático; A, asintomático.
Figure 2. Amplification products from defense genes. The first three lanes correspond to leaf tissues, and the other three to
fruit tissue. H, healthy; S, symptomatic; A, asymptomatic.

del efecto de la infección del ASBVd se realizaron among infected, symptomatic or asymptomatic
entre árboles con síntomas y árboles asintomáticos, trees, nor regarding their basal expression
con respecto al sano. Los datos de área y porcen- on healthy tissue (Figures 3A and 3B). PR-5
taje calculados por ImageJ® se usaron para obtener expression on asymptomatic trees is over-expressed
densidades relativas de cada banda y se ajustó al and significantly different from expression of
nivel de expresión del gen de actina usado como symptomatic trees and basal expression, while
referencia (Figura 3). fruits from symptomatic trees did not show any

Publicación en línea, enero 2018 156

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

A) PaNPR1 B) EREBP
1.60 1.20

1.40 1.00

Densidad relativa
Densidad relativa

1.20 0.80

1.00 0.60

0.80 0.40

0.60 S A S A 0.20 S A S A
Hojas Frutos Hojas Frutos
0.40 0.00

C) PR-5 * D) PR-6
1.40 2.00 *

1.60
*

Densidad relativa
Densidad relativa

1.20
1.20

0.80
1.00
0.40 *
S A S A S A S A
Hojas Frutos Hojas Frutos
0.80 0.00

Figura 3. Análisis cuantitativo de las intensidades de los productos de la RT-PCR de los genes relacionados con defensa.
Se muestran los promedios de las densidades relativas ajustadas, los cambios en la intensidad son negativos o
positivos a partir del valor de la expresión basal asignada como 1. La línea vertical sobre cada barra representa
el error estándar (n=3). S, tejido de árbol con síntomas; A, tejido de árbol sin síntomas; *, diferencia significativa
con respecto al tejido sano; †, diferencia significativa entre sintomático y asintomático.
Figure 3. Quantitative analysis of band intensity from RT-PCR bands for defense-related genes. The average of the adjusted
relative densities is shown; changes in intensity are negative or positive depending on the value of the basal expres-
sion assigned as 1. Vertical lines on each bar represent the standard error (n=3). S, tissue of trees with symptoms;
A, tissue of asymptomatic trees; *, significant difference in relation to healthy tissue; †, significant difference be-
tween symptomatic and asymptomatic.

Los genes PaNPR1 y EREBP no mostraron di- difference from basal expression (Figure 3C). No
ferencias significativas en la expresión diferencial expression differences were found in leaves from
entre los árboles infectados, con síntomas y asinto- symptomatic and asymptomatic trees, nor in the
máticos, ni con respecto a la expresión basal en los basal expression. The expression of PR-6 on fruit
tejidos sanos (Figuras 3A y 3B). La expresión de infected by ASBVd was up-regulated and, although
PR-5 en el fruto de árbol asintomático está sobre- it increased in asymptomatic fruits, no difference
regulada y es significativamente diferente a la de was observed on fruits from symptomatic trees
fruto de árbol con síntomas y a la expresión basal, (Figure 3D). As for leaf tissue, a significant down-
mientras que en los frutos de árbol con síntomas no se regulation was observed on asymptomatic trees.
encontraron diferencias con la expresión basal (Figura It is documented that changes in NPR1 gene
3C). En las hojas no se encontraron diferencias en la expression induce changes in PR-5 expression

Publicación en línea, enero 2018 157

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

expresión entre árboles sintomáticos y asintomáti- (Shah et al., 2001). However, results in this research
cos, ni con respecto a la expresión basal. La expre- suggest that changes in PR-5 expression on tissue
sión de PR-6 en frutos infectados con ASBVd tuvo infected by ASBVd were not produced by changes
regulación positiva, y, a pesar de su incremento en in PaNPR1 expression because it did not change
frutos asintomáticos, no se observó diferencia con significantly from basal. Backer et al. (2015)
los frutos de árboles con síntomas (Figura 3D). En reported that PaNPR1 constitutive expression was
el caso del tejido foliar se observó una regulación higher on leaves than on unripe fruits. Additionally,
negativa significativa en los árboles asintomáticos. and contrary to documented reports on NPR1
La expresión de genes NPR1 pueden inducir la activation by salicylic acid, they found PaNPR1
expresión de PR-5 (Shah et al., 2001). Sin embar- down-regulation 12 h after salicylic acid treatment;
go, los resultados siguieren que los cambios de ex- this behavior suggests an alternative function for
presión de PR-5 en tejidos infectados por ASBVd defense responses.
no fueron inducidos por PaNPR1, debido a que los On the other hand, it is known that viroids can
niveles de expresión de éste no muestran diferen- inactivate some transcription factors, including
cias significativas con respecto a la expresión basal. EREBP, usually by suppressing regulation ways
Backer et al. (2015) reportaron que la expresión of mRNA associated with them (Matoušek et al.,
constitutiva basal de PaNPR1 fue más alta en hojas 2015; Katsarou et al., 2016). In this research, no
que en frutos inmaduros; además, y a diferencia del differences were found in EREBP expression.
conocimiento que se tiene donde el ácido salicílico Although ethylene is a common hormone that
es activador de NPR1, los autores encontraron una can simulate a pathogens attack and favor the
regulación negativa de PaNPR1 en el tratamiento expression of some PR proteins, it has a limited
con ácido salicílico a las 12h después de la aplica- involvement in the development of symptoms
ción, lo que sugiere una función alternativa en las induced by viroids (Hu et al., 2011), a fact that is
respuestas de defensa. consistent with the obtained results.
Por otro lado, se sabe que los viroides pueden As for induction by PR-5 and PR-6 genes, the
inactivar algunos factores de transcripción, in- results in this research suggest that the mechanism
cluyendo EREBP, generalmente al suprimir las that activates PR genes expression acts as a non-
vías de regulación de los mRNA asociados a ellos specific coordinated set of genes that varies in
(Matoušek et al., 2015; Katsarou et al., 2016). En magnitude and can stop the primary infection (Fister
esta investigación no hubo diferencias en la expre- et al., 2016). The expression of PR-5 on fruit from
sión de EREBP. A pesar de que el etileno es una asymptomatic trees was high compared with that
hormona muy común que puede simular el ataque on other tissues, which suggest that this organ has
de patógenos y promover la expresión de algunas a more active defense mechanism. The expression
proteínas PR, éste tiene limitada participación en el of PR-5 genes may occur by the action of abscisic
desarrollo de síntomas inducido por viroides (Hu et acid, ethylene, salicylate, methyl jasmonate or any
al., 2011), lo cual es consistente con los resultados other elicitor (Velazhahan et al., 1999). Therefore,
obtenidos. PR-5 induction in fruits from asymptomatic trees
Con respecto a la inducción de los genes PR-5 may have resulted from the activation of another
y PR-6, los resultados obtenidos permiten suponer signaling messenger different from ethylene, which
que el mecanismo que activa la expresión de genes would also explain why the EREBP transcription

Publicación en línea, enero 2018 158

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

PR funciona como un conjunto de genes coordina- factor did not change its expression level (Figure
do, no específico, que varía en magnitud y puede 3B). However, the expression of PR-5 depends
llegar a detener la infección primaria (Fister et al., on the type of pathogen, since Colletotrichum
2016). La expresión de PR-5 en frutos de árboles gloeosporioides infection did not modify its
asintomáticos fue elevada en comparación con la expression level (Djami-Tchatchou et al., 2013).
de los otros tejidos, lo cual sugiere una respuesta PR-6 expression was up-regulated on fruits
de defensa más activa en este órgano. La expresión like PR-5. PR-6 proteins belong to the group of
de los genes PR-5 puede ocurrir por la acción de protease inhibitors reported to be present in an
ácido abscísico, etileno, salicilato, metil jasmonato extensive range of plants that respond to diverse
o algunos otros elicitores (Velazhahan et al., 1999). external stimuli, including wounds, insect-feed and
Consecuentemente, es posible que la inducción de microbial infections (Habib and Fazili, 2007; Turra
PR-5 en frutos de árboles asintomáticos se deba a and Lorito, 2011). The expression of PR-6 can
la activación por la señalización de otro mensajero be regulated by ethylene and activated in leaves
diferente al etileno, lo cual explicaría también por- during fruit ripening (Margossian et al., 1988); it
qué el factor de transcripción EREBP no cambió can also be induced by exogenous applications of
sus niveles de expresión (Figura 3B). Sin embargo, methyl jasmonate and abscisic acid (Wang et al.,
la expresión de PR-5 depende del tipo de patógeno, 2003). Given the poor EREBP expression on fruits
ya que la infección de Colletotrichum gloeospo- from asymptomatic trees, the expression of PR-6
rioides no modificó su nivel de expresión (Djami- on them seems to be associated with induction by
Tchatchou et al., 2013). jasmonic acid or through an alternate route (Koiwa
La expresión de PR-6 tuvo una regulación po- et al., 1997).
sitiva en los frutos, similar a lo que ocurrió con This study sets the basis to further explore
PR-5. Las proteínas PR-6 pertenecen al grupo de diverse defense routes in avocado that are induced
inhibidores de proteasas reportadas en una gran va- by ASBVd infection. The four studied genes showed
riedad de plantas respondiendo a diversos estímu- differential expression, both in leaf tissue and fruit
los externos incluyendo heridas, alimentación por tissue from healthy trees and infected with ASBVd.
insectos e infecciones microbiales (Habib y Fazili, The more significant changes in expression were
2007; Turra y Lorito, 2011). La expresión de PR-6 recorded in fruits from asymptomatic trees with
puede ser regulada por etileno y activada en hojas PR-5 and PR-6. In contrast, in leaf tissue from
durante la maduración de frutos (Margossian et al., asymptomatic trees only the PR-6 basal expression
1988); también puede ser inducida por aplicacio- was modified.
nes exógenas de metil jasmonato y ácido abscísico
(Wang et al., 2003). Debido a la escasa expresión End of the English version
de EREBP en los frutos de árboles asintomáticos, la
expresión de PR-6 en éstos parece relacionada con
la inducción por ácido jasmónico o a través de una
ruta alterna (Koiwa et al., 1997). estudiados presentaron expresión diferencial, tanto
Este estudio establece las bases para plantear di- en tejido foliar como en tejido de fruto de árboles
versas rutas de defensa del aguacate que son indu- sanos como infectados con ASBVd. Los cambios
cidas por la infección del ASBVd. Los cuatro genes más significativos en la expresión se dieron en frutos

Publicación en línea, enero 2018 159

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

de árboles asintomáticos en los genes PR-5 y PR-6. Katsarou K, Wu Y, Zhang R, Bonar N, Morris J, Hedley PE,
Bryan GJ, Kalantidis K and Hornyik C. 2016. Insight
En cambio, en tejido foliar únicamente se modificó on genes affecting tuber development in potato upon
la expresión basal de PR-6 en árboles asintomáti- Potato spindle tuber viroid (PSTVd) infection. PLoS
ONE 11: e0150711. [Link]
cos. pone.0150711
Koiwa H, Bressan RA and Hasegawa PM. 1997. Regulation
of protease inhibitors and plant defense. Trends in Plant
Science 2: 379–384. [Link]
LITERATURA CITADA 1385(97)90052-2
Mahomed W and Van den Berg N. 2011. EST sequencing
and gene expression profiling of defence-related ge-
Aranda PS, LaJoie DM and Jorcyk CL. 2012. Bleach gel: a sim- nes from Persea americana infected with Phytophthora
ple agarose gel for analyzing RNA quality. Electrophoresis cinnamomi. BMC Plant Biology 11: 167. [Link]
33: 366–369. [Link] org/10.1186/1471-2229-11-167
Backer R, Mahomed W, Reeksting BJ, Engelbrecht J, Ibarra- Margossian LJ, Federman AD, Giovannoni JJ and Fischer RL.
Laclette E and van den Berg NN. 2015. Phylogenetic and 1988. Ethylene-regulated expression of a tomato fruit ripe-
expression analysis of the NPR1-like gene family from ning gene encoding a proteinase inhibitor I with a glutamic
Persea americana (Mill.). Frontiers in Plant Science 6: 300. residue at the reactive site. Proceedings of the National
[Link] Academy of Sciences 85: 8012–8016. Disponible en línea:
Beltrán-Peña H, Soria-Ruiz J, Téliz-Ortiz D, Ochoa-Martínez [Link]
DL, Nava-Díaz C y Ochoa-Ascencio S. 2014. Detección Matoušek J, Piernikarczyk RJ, Týcová A, Duraisamy GS, Ko-
satelital y molecular del viroide de la mancha de sol del cábek T and Steger G. 2015. Expression of SANT/HTH
aguacate (Avocado sunblotch viroid, ASBVd). Revista Fi- Myb mRNA, a plant morphogenesis-regulating transcrip-
totecnia Mexicana 37: 21–29. Disponible en línea: http:// tion factor, changes due to viroid infection. Journal of
[Link]/documentos/37-1/2a. Plant Physiology 183: 85–94. [Link]
pdf jplph.2015.06.001
Desjardins P. 1987. Avocado sunblotch. Pp. 299–313. In: Die- Reeksting BJ, Coetzer N, Mahomed W, Engelbrecht J and
ner TO (eds.). The Viroids. Springer. Boston, MA., USA. Van Den Berg N. 2014. De novo sequencing, assembly,
344p. [Link] and analysis of the root transcriptome of Persea ameri-
Di Serio F, De Stradis A, Delgado S, Flores R and Navarro B. cana (Mill.) in response to Phytophthora cinnamomi and
2013. Cytopathic effects incited by viroid RNAs and puta- flooding. PLoS ONE 9: e86399. [Link]
tive underlying mechanisms. Frontiers in Plant Science 3: [Link].0086399
288. [Link] Saucedo-Carabez JR, Téliz-Ortiz D, Ochoa-Ascencio S,
Djami-Tchatchou AT, Straker CJ and Allie F. 2012. 454 sequen- Ochoa-Martínez D, Vallejo-Pérez MR and Beltrán-Peña
cing for the identification of genes differentially expressed H. 2014. Effect of Avocado sunblotch viroid (ASBVd) on
in avocado fruit (cv. Fuerte) infected by Colletotrichum avocado yield in Michoacan, Mexico. European Journal of
gloeosporioides. Journal of Phytopathology 160: 449–460. Plant Pathology 138: 799–805. [Link]
[Link] s10658-013-0354-9
Djami-Tchatchou AT, Allie F and Straker CJ. 2013. Expression Saucedo-Carabez JR, Téliz-Ortiz D, Ochoa-Ascencio S,
of defence-related genes in avocado fruit (cv. Fuerte) in- Ochoa-Martínez D, Vallejo-Pérez MR and Beltrán-Peña
fected with Colletotrichum gloeosporioides. South African H. 2015. Effect of Avocado sunblotch viroid (ASBVd)
Journal of Botany 86: 92–100. [Link] on the postharvest quality of avocado fruits from Mexi-
sajb.2013.02.166 co. Journal of Agricultural Science 7: 85–92. [Link]
Fister AS, Mejia LC, Zhang Y, Herre EA, Maximova SN and org/10.5539/jas.v7n9p85
Guiltinan MJ. 2016. Theobroma cacao L. pathogenesis- Schneider CA, Rasband WS and Eliceiri KW. 2012. NIH Ima-
related gene tandem array members show diverse expres- ge to ImageJ: 25 years of image analysis. Nature Methods
sion dynamics in response to pathogen colonization. BMC 9: 671-675. [Link]
Genomics 17: 363. [Link] Schnell R, Kuhn D, Ronning CM and Harkins D. 1997. Appli-
2693-3 cation of RT-PCR for indexing Avocado sunblotch viroid.
Habib H and Fazili KM. 2007. Plant protease inhibitors: Plant Disease 81: 1023–1026. [Link]
a defense strategy in plants. Biotechnology and Mole- PDIS.1997.81.9.1023
cular Biology Review 2: 68–85. Disponible en línea: Semancik JS and Szychowski JA. 1994. Avocado sunblotch
[Link] disease: a persistent viroid infection in which variants are
abstract/8EB195410993 associated with differential symptoms. Journal of General
Hu XX, Nie XZ, Song Y, Xiong XY and Tai H. 2011. Ethylene Virology 75: 1543–1549. [Link]
is involved but plays a limited role in tomato Chlorotic 1317-75-7-1543
dwarf viroid-induced symptom development in tomato. Shah J, Kachroo P, Nandi A and Klessig DF. 2001. A recessi-
Agricultural Sciences in China 10: 544–552. [Link] ve mutation in the Arabidopsis SSI2 gene confers SA- and
org/10.1016/S1671-2927(11)60035-7 NPR1-independent expression of PR genes and resistance

Publicación en línea, enero 2018 160

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

against bacterial and oomycete pathogens. The Plant Jo- Vallejo-Pérez MR, Téliz-Ortiz D, De La Torre-Almaraz R,
urnal 25: 563–574. [Link] López-Martínez JO, Nieto-Ángel D. 2017. Avocado sun-
313x.2001.00992.x blotch viroid: pest risk and potential impact to Mexico.
Turra D and Lorito M. 2011. Potato type I and II proteinase Crop Protection 99:118-127. [Link]
inhibitors: modulating plant physiology and host resistan- cropro.2017.05.015
ce. Current Protein and Peptide Science 12: 374–85. http:// Velazhahan R, Datta SK and Muthukrishnan S. 1999. The PR-5
[Link]/10.2174/138920311796391151 Family: Thaumatin-like Proteins. Pp107-129 In: Datta SK
Vallejo-Pérez MR, Téliz-Ortiz D, Colinas-León MT, De La and Muthukrishnan S (eds.). Pathogenesis-Related Pro-
Torre-Almaraz R, Valdovinos-Ponce G, Nieto-Ángel D teins in Plants. CRC Press. Boca Raton, FL., USA. 291p.
and Ochoa-Martínez DL. 2015. Alterations induced by [Link]
Avocado sunblotch viroid in the postharvest physiology Wang HY, Huang YC, Chen SF and Yeh KW. 2003. Molecular
and quality of avocado “Hass” fruit. Phytoparasitica 43: cloning, characterization and gene expression of a water
355–364. [Link] deficiency and chilling induced proteinase inhibitor I gene
Vallejo-Pérez MR, Téliz-Ortiz D, De La Torre-Almaraz R, family from sweet potato (Ipomoea batatas Lam.) leaves.
Valdovinos-Ponce G, Colinas-León MT, Nieto-Ángel D Plant Science 165: 191–203. [Link]
and Ochoa-Martínez DL. 2014. Histopathology of avoca- S0168-9452(03)00158-4
do fruit infected by Avocado sunblotch viroid. Journal of
Agricultural Science 6: 158–65. [Link]
jas.v6n9p158

Publicación en línea, enero 2018 161

 In vitro antifungal activity of garlic essential
oil (Allium sativum L.) against Alternaria tenuissima

Actividad antifúngica in vitro del aceite esencial de ajo

(Allium sativum L.) contra Alternaria tenuissima

María Dolores Muy-Rangel, Jesús Rosario Osuna-Valle, Raymundo Saúl García-Estrada, Centro de In-
vestigación en Alimentación y Desarrollo AC, unidad Culiacán, Carretera Eldorado Km 5.5, Colonia Campo El
Diez, Culiacán, Sinaloa, CP 80110, México; Cesar San Martín-Hernández, Eber Addí Quintana-Obregón*,
CONACYT-CIAD, Centro de Investigación en Alimentación y Desarrollo, A.C. Coordinación Culiacán, Carre-
tera a Eldorado Km 5.5, Colonia Campo El Diez, Culiacán, Sinaloa, CP 80110 México. *Autor para correspon-
dencia: [Link]@[Link].

Recibido: 12 de Agosto, 2017. Aceptado: 06 de Octubre, 2017.

Muy-Rangel MD, Osuna-Valle JR, García-Estrada RS, Abstract. Due to the environmental problems
San Martín-Hernández C, Quintana-Obregón EA. 2017. generated by the chemical control of phytopathogenic
In vitro antifungal activity of garlic essential oil (Allium fungi, it is necessary to look for alternatives for their
sativum L.) against Alternaria tenuissima. Revista control. The essential oil of garlic may be a viable
Mexicana de Fitopatología 36(1): 162-171. alternative for the control of A. tenuissima. In this
DOI: 10.18781/[Link].1708-3 study, the volatile compounds of garlic essential
oil were analyzed by Gas Chromatography-Mass
Primera publicación DOI: 06 de Diciembre, 2017. Spectrometry. Radial growth in vitro and biomass
First DOI publication: December 06, 2017. of A. tenuissima in presence of the garlic essential
oil. Diallyl disulphide and diallyl sulphide were
identified in 23.64 and 20.33%, respectively,
Resumen. Los problemas ambientales generados among other compounds in a smaller proportion.
por el control químico de hongos fitopatógenos, re- At a concentration of 1000 ppm, the radial growth
quiere de la búsqueda de alternativas amigables con and biomass production were inhibited 100 and
el medio ambiente para su control, como el aceite 86.20%, respectively, it compared with control
esencial de ajo (Allium sativum L.) para el control PDA-Tween® 80 without oil. The medium and
de Alternaria tenuissima. El objetivo del estudio minimum inhibitory concentrations obtained for A.
fue caracterizar los volátiles del aceite esencial de tenuissima were 229 and 1, 023 ppm, respectively.
ajo por cromatografía de gases acoplado a masas The spore germination of the fungus was inhibited
y evaluar el crecimiento radial y biomasa in vitro 88.89% with medium minimum concentration and
de A. tenuissima en presencia del aceite esencial. 94.17% with minimum inhibitory concentration.
Se identificaron el dialil disulfuro y dialil sulfuro Garlic essential oil showed antifungal capacity

Publicación en línea, enero 2018 162

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

en un 23.64 y 20.33%, respectivamente, entre otros against A. tenuissima, inhibiting spore germination,
compuestos en menor proporción. Con la concen- radial growth and biomass production.
tración de 1,000 ppm se inhibió el crecimiento ra-
dial y producción de biomasa en 100 y 86.20%, Key words: control, spore germination, fungal
respectivamente, comparado con el testigo PDA- biomass.
Tween® 80 sin aceite. Las concentraciones media
y mínima inhibitorias obtenidas para A. tenuissima
fueron 229 y 1,023 ppm, respectivamente. Se inhi- Alternaria tenuissima (Nees & T. Nees:
bió la germinación de esporas del hongo en 88.89 Fr.) Wilshire is a fungus that causes losses in
y 94.17% con las concentraciones media y mínima the production of crops such as apple (Malus x
inhibitorias, respectivamente. El aceite esencial de domestica Borkh.) and pear trees (Pyrus communis
ajo mostró capacidad antifúngica contra A. tenuis- L.), broccoli (Brassica oleracea var. italica), and
sima inhibiendo la germinación de esporas, creci- others. The problem becomes more important due
miento radial y la producción de biomasa. to the production of toxins (Jones and Aldwinckle,
2002; Fraire-Cordero et al., 2010; Agamy et al.,
Palabras clave: control, germinación de esporas, 2013). Alternaria is a widely distributed genus in
biomasa fúngica. agricultural areas and it has saprophytic, endophytic,
and phytopathogenic species. Likewise, as a product
of its activity, about 70 secondary metabolites have
Alternaria tenuissima (Nees & T. Nees: Fr.) been identified, all toxic to plants, and some may
Wilshire es un hongo que causa pérdidas en la affect human health, relating to cases of allergies
producción de cultivos como en manzano (Malus and esophagus cancer (Pavón-Moreno et al., 2012;
x domestica Borkh.), peral (Pyrus communis L.), Woudenberg et al., 2015).
brócoli (Brassica oleracea var. italica), entre otros, Traditionally, to prevent and control of the
agudizándose el problema por la producción de invasion of phytopathogenic fungi in agriculture,
toxinas (Jones y Aldwinckle, 2002; Fraire-Cordero synthetic fungicides have been used (Campbell and
et al., 2010; Agamy et al., 2013). Alternaria es un López-Ortíz, 2014). The most widely used against
género ampliamente distribuido en zonas agrícolas Alternaria are azoxystrobin, difenoconazole,
y cuenta con especies saprofitas, endofíticas y fito- mancozeb, tebuconazole, and others (Malandrakis
patógenas. Asimismo, como producto de su activi- et al., 2015; Savitha and Ajithkumar, 2016).
dad, se han identificado alrededor de 70 metaboli- However, these fungicides have adverse effects on
tos secundarios tóxicos para las plantas y algunos the environment and human health. It is therefore
pueden afectar la salud humana relacionándose en necessary to search for environmentally friendly
casos de alergias y cáncer de esófago (Pavón-Mo- alternatives for the control of phytopathogenic
reno et al., 2012; Woudenberg et al., 2015). fungi (Blair et al., 2015).
Tradicionalmente, para prevenir y controlar la Some compounds from botanical sources
invasión de los hongos fitopatógenos en la agricul- have the potential to be used for the control of
tura se han utilizado fungicidas sintéticos (Cam- plant pathogens in crops of agricultural interest.
pbell y López-Ortíz, 2014). Los más utilizados con- Considering that about 374,000 plant species
tra Alternaria son el azoxystrobin, difenoconazol, have been described, there is a wide window of

Publicación en línea, enero 2018 163

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

mancozeb, tebuconazole, entre otros (Malandrakis opportunity for the development of antifungal
et al., 2015; Savitha y Ajithkumar, 2016). Sin em- substances from the extracts of these plants (Cowan,
bargo, estos fungicidas causan efectos adversos al 1999; Christenhusz and Byng, 2016). Among the
ambiente y a la salud humana. Por lo que es ne- compounds of plants with antifungal capabilities,
cesario la búsqueda de alternativas amigables con a few that stand out are essential oils (Isman et
el entorno para el control de hongos fitopatógenos al., 2011), some of which have proven antifungal
(Blair et al., 2015). capabilities, such as those based on lemon
Algunos compuestos de fuentes botánicas tienen (Cymbopogon citratus (D.S.) Stapf.), eucaliptus
potencial de ser usados para el control de fitopató- (Eucalyptus spp.), cinnamon (Cinnamomum verum
genos en cultivos de interés agrícola. Considerando L.), clove teas (Syzygium aromaticum L.), and
que se han descrito alrededor de 374,000 especies others (Calo et al., 2015). Garlic (Allium sativum
de plantas, existe un amplio campo de oportunidad L.) contains an essential oil composed of aromatics
para el desarrollo de antifúngicos a partir de extrac- such as diallyl disulfide, diallyl trisulfate and other
tos de estas plantas (Cowan, 1999; Christenhusz y sulfurous compounds with antimicrobial activity
Byng, 2016). Entre los compuestos de las plantas with a potential to be used in fungal control (Casella
con capacidad antifúngica destacan los aceites et al., 2013; Kocić-Tanackov et al., 2012). The aim
esenciales (Isman et al., 2011). Algunos de los cua- of this study was to evaluate the antifungal activity
les han mostrado capacidad antifúngica tales como in vitro of garlic essential oil against A. tenuissima.
los extractos a base de té de limón (Cymbopogon The study was conducted in the laboratories
citratus (D.S.) Stapf.), eucalipto (Eucalyptus spp.), of the Centro de Investigación en Alimentación y
canela (Cinnamomum verum L.), clavo (Syzygium Desarrollo, AC (Food and Development Research
aromaticum L.), entre otros (Calo et al., 2015). El Center), Culiacán unit. The A. tenuissima strain was
ajo (Allium sativum L.) contiene aceite esencial provided by the Department of Food Research and
compuesto por aromáticos como el dialil disulfu- Postgraduate Studies of the University of Sonora,
ro, dialil trisulfuro y otros compuestos azufrados previously identified by Quintana-Obregón et al.
con actividad antimicrobiana con potencial para ser (2013). It was reactivated and grown in a potato-
utilizados en el control de hongos (Casella et al., dextrose-agar (PDA) medium at 25 °C with light
2013; Kocić-Tanackov et al., 2012). El objetivo del periods of 12 h light-darkness for seven days. Later,
estudio fue evaluar la actividad antifúngica in vitro spore suspensions were prepared with a Tween®
del aceite esencial de ajo contra de A. tenuissima. 20 at 0.1% (v/v), and finally, the concentration
El estudio se realizó en los laboratorios del Cen- was determined using a hematometer (Neubauer
tro de Investigación en Alimentación y Desarrollo, camera, BRAND ® Germany).
AC unidad Culiacán. La cepa de A. tenuissima fue The garlic essential oil used was of an analytical
proporcionada por el Departamento de Investiga- grade (Sigma-Aldrich® lot MKBB8390V). Oil
ción y Posgrado en Alimentos de la Universidad volatiles were identified using a GC-7890B
de Sonora, previamente identificada por Quintana- (Agilent Technology®, USA) gas chromatographer
Obregón et al. (2013), se reactivó y creció en medio linked to an Agilent 240 (CG-MS) selective mass
papa dextrosa agar (PDA) a 25 °C con fotoperiodos detector with an electric ionization system of 70 eV.
de 12 h luz-oscuridad por siete días. Posteriormen- The capillary column used was DB-5 (50 m*0.25
te, suspensiones de esporas con una solución de mm) (J&C Scientific, Agilent Technologies®,

Publicación en línea, enero 2018 164

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Tween® 20 al 0.1% (v/v) fueron preparadas y final- Pennsylvania, USA) and it was conditioned at 60
mente se determinó la concentración mediante un °C for 10 min. The temperature was raised (20 °C/
hematocitómetro (cámara de Neubauer, BRAND ® min) up to 180 °C for 2 min and finally (4 °C/min)
Alemania). up to 250 °C for 4.5 min. Helium carrier gas was
El aceite esencial de ajo utilizado fue grado used at a flow of 2 mL min-1. The temperatures
analítico (Sigma-Aldrich® lote MKBB8390V). La of the ionization chamber and of the line of
identificación de volátiles del aceite se realizó me- transfer were 220 and 280 °C, respectively. The
diante un cromatógrafo de gases GC-7890B (Agi- constituents were identified by comparing linear
lent Technology®, EUA), acoplado a un detector se- retention indices based on a mixture of n-alkanes
lectivo de masas Agilent 240 (CG-MS) con un sis- and times of retention of the spectra obtained using
tema de ionización eléctrico de 70 eV. La columna database NIST 98 (National Institute of Standard
capilar utilizada fue DB-5 (50 m*0.25 mm) (J&C and Technology, Maryland, EUA).
Scientific, Agilent Technologies®, Pennsylvania, Radial Growth. The PDA with Tween® 80
EUA) y se acondicionó a 60 °C por 10 min. La tem- (1% v/v) was sterilized for 15 min at 15 psi, then
peratura se incrementó (20 °C/min) hasta 180 °C cooled at 45 °C and mixed with garlic essential oil
por 2 min y finalmente (4 °C/min) hasta 250 °C por at different concentrations (0, 10, 100, 500, 1,000
4.5 min. Gas acarreador helio fue utilizado a un flu- and 10,000 ppm). In addition, PDA was prepared
jo de 2 mL min-1. Las temperaturas de la cámara de without Tween® 80 under the same conditions, and
ionización y de la línea de transferencia fueron de without mixing it with garlic essential oil, each
220 y 280 ºC, respectivamente. Los constituyentes mixture was placed, 15 mL at a time, in Petri dishes
se identificaron por comparación de índices de re- with diameter of 50 mm. Later, using a sterilized
tención lineales con base a una mezcla de n-alcanos glass Pasteur pipette, a 6 mm perforation was made
y tiempos de retención de los espectros obtenidos in the center of the solidified culture medium and
con la base de datos NIST 98 (National Institute of it was inoculated with 25 µL of the A. tenuissima
Standard and Technology, Maryland, EUA). spore solution (105 spores). Finally, the cultures
Crecimiento Radial. El PDA con Tween® 80 were incubated at 25 °C with photoperiods of 12 h
(1% v/v) se esterilizó por 15 min a 15 psi, se en- light-darkness and the radius of the fungal colony
frió a 45 °C y se mezcló con aceite esencial de was measured every 24 h until it covered 95%
ajo a diferentes concentraciones (0, 10, 100, 500, of the control (PDA without Tween® 80) taken
1,000 y 10,000 ppm). Adicionalmente, se preparó as a reference. The minimum inhibiting (CMI)
PDA sin Tween® 80 bajo las mismas condiciones, and average inhibiting (CI50) conditions were
pero sin mezclarlo con aceite esencial de ajo, cada determined at 120 h post-inoculation of the fungus
mezcla se depositó a razón de 15 mL en cajas de with a Probit analysis with the statistical program
Petri de 50 mm de diámetro. Posteriormente, con NCSS 2000 (Number Cruncher Statistical Systems,
una pipeta Pasteur de vidrio esterilizada se realizó Utah, USA).
una perforación de 6 mm en el centro del medio Production of Biomass. The Petri dishes with
de cultivo solidificado y se inoculó con 25 µl de la oil concentrations described above were inoculated
suspensión de esporas (105 esporas) de A. tenuissi- with 25 µL of the A. tenuissima spore suspension
ma. Finalmente, los cultivos se incubaron a 25 °C (105 spores) in the central section, spreading
con fotoperiodos de 12 h luz-oscuridad y se midió them by surface diffusion and kept in the same

Publicación en línea, enero 2018 165

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

el radio de la colonia fúngica cada 24 h hasta que conditions as described above. After 120 h, the dry
cubrió el 95% del testigo (PDA sin Tween® 80) weight was taken of the cultures that grew in the
tomado como referencia. Las concentraciones mí- culture medium, and for this, the mycelium was
nimas inhibitoria (CMI) y media inhibitoria (CI50) separated from the Petri dish and transferred to a
se determinaron a las 120 h post-inoculación del precipitate beaker with 50 mL of distilled water;
hongo mediante análisis Probit con el programa es- it was sterilized and the mycelium was separated
tadístico NCSS 2000 (Number Cruncher Statistical with Whatman® # 2 filter paper. The filter paper,
Systems, Utah, EUA). along with the mycelium, was dried in an air
Producción de biomasa. Las cajas de Petri con convection over at 105 °C for 2 h and collected in
las concentraciones de aceite previamente descri- a desiccator. The dry weight was expressed in mg
tas se inocularon con 25 µL de la suspensión de dish-1 (Larralde-Corona et al., 1997; López-Insunza
esporas (105 esporas) de A. tenuissima en la parte et al., 1997).
central distribuyéndolas por medio de la técnica de Spore Germination. An evaluation was carried
difusión en superficie y se mantuvieron bajo las out on the effect of the CI50 and CMI of the essential
mismas condiciones descritas anteriormente. A las oil obtained with a Probit analysis against the A.
120 h se cuantificó el peso seco de las colonias que tenuissima spores. For this, 25 μL of the spore
crecieron en el medio de cultivo para lo cual el mi- suspension (105 spores) were distributed on the
celio se separó de la caja de Petri y se trasfirió a un surface of the culture medium in the Petri dish
vaso de precipitado con 50 mL de agua destilada, in controls and treatments with essential oils.
se esterilizó y se separó el micelio con papel filtro The Petri dishes were incubated at 25 ºC with a
Whatman® # 2. El papel filtro junto con el micelio photoperiod of 12 h light-darkness for up to 24
se secó en una estufa de convección de aire a h. Random samples of each were taken every 4 h
105 °C por 2 h y se enfrió en un desecador. El peso and the number of germinated and not germinated
seco se expresó en mg caja-1 (Larralde-Corona et spores were counted, out of a total 200 spores,
al., 1997; López-Insunza et al., 1997). under a light microscope. The spore was considered
Germinación de esporas. Se evaluó el efecto germinated when the length of the germinative
de la CI50 y CMI del aceite esencial obtenidas por tube was at least 50% as long as the not germinated
análisis Probit contra las esporas de A. tenuissima. spore (Dantigny et al., 2006).
Para ello, se distribuyeron 25 μL de la suspensión Experimental Design and Statistical Analysis.
de esporas (105 esporas) sobre la superficie del A randomized design was used in the experiment,
medio de cultivo en la caja de Petri en testigos y in which the treatments were: PDA, PDA-Tween®
tratamientos con aceite esencial. Las cajas de Pe- 80 (controls) and concentrations of garlic essential
tri se incubaron a 25 °C con fotoperiodo de 12 h oils in PDA-Tween® 80 (10, 100, 250, 500 and
luz-oscuridad hasta un tiempo máximo de 24 h. Se 1,000 ppm). The seven treatments were evaluated
tomaron muestras aleatorias cada 4 h y se contó el against A. tenuissima, where the experimental unit
número de esporas germinadas y no germinadas de was a Petri dish. The response variables were radial
un total de 200 esporas bajo un microscopio óptico. growth and production of biomass. CI50 and CMI
Se consideró como una espora germinada cuando were evaluated in the spore germination stage. All
la longitud del tubo germinativo fue de al menos el experiments were carried out three times. Data
50% de la longitud de la espora sin germinar (Dan- were analyzed using the statistical program JMP
tigny et al., 2006). version 5.0 (SAS, 2002) for the analysis of variance

Publicación en línea, enero 2018 166

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Diseño experimental y análisis estadístico. En (ANOVA) and the averages of the treatments were
el experimento se utilizó un diseño completamente separated using a Tukey test (p≤0.05).
al azar donde los tratamientos fueron: PDA, PDA- Table 1 shows the tentative main volatile
Tween® 80 (testigos) y concentraciones de aceite components of the garlic extracts obtained by
esencial de ajo en PDA-Tween® 80 (10, 100, 250, CG-MS with relative proportions ≥1%. There is a
500 y 1,000 ppm). Los siete tratamientos se eva- predominance of compounds with sulfur in their
luaron contra A. tenuissima donde la unidad expe- structures, some of the most important of which are
rimental fue una caja de Petri. Las variables res- diallyl sulfate and diallyl disulfate, which derive
puesta fueron crecimiento radial y producción de from the activity of the enzyme allinase when
biomasa. Las CI50 y CMI se evaluaron en la etapa released by rupture from the tissue during the oil
de germinación de esporas. Todos los experimen- extraction (Kocić-Tanackov et al., 2012).
tos se realizaron por triplicado. Los datos fueron The radial growth of A. tenuissima in the
analizados utilizando el programa estadístico JMP treatment with PDA medium only covered 95% of
versión 5.0 (SAS, 2002) para el análisis de varianza the Petri dish after 120 h, reaching a radius of 22 mm.
(ANVA) y las medias de los tratamientos se separa- There were no significant differences in the radial
ron por la prueba de Tukey (p≤0.05). growth in treatments PDA and PDA-Tween® 80
En el Cuadro 1 se muestran los principales com- after 120 h. The essential oil achieved a significant
ponentes volátiles tentativos del extracto de ajo reduction of the radial growth of A. tenuissima with
obtenidos por CG-MS con proporciones relativas concentrations equal to or greater than 250 ppm,
≥1%. Predominan compuestos con azufre en su es- achieving, at 1,000 ppm, an inhibition of 100% in
tructura, entre los que destacan el dialil sulfuro y regard to the control PDA-Tween® 80 (Table 2).
dialil disulfuro, los cuales son derivados de la acti- In the production of biomass, medium PDA-
vidad de la enzima alinasa al ser liberada por rom- Tween® 80 with 10 ppm of essential oil showed
pimiento del tejido durante la extracción de aceite a significant increase in regard to the PDA alone.
(Kocić-Tanackov et al., 2012). However, when increasing the concentration of

Cuadro 1. Principales compuestos del aceite esencial de ajo identificados por reconocimiento estruc-
tural mediante CG-MSx.
Table 1. Main components of essential garlic oil identified by structural recognition using CG-MSx.

Tiempo de Retención (min) Identificación Cantidad Relativa (%)

6.867 Dialil sulfuro 20.33

8.885 1,3-Ditiano 6.1
11.205 Ciclopentano, 1-acetil-1,2-epoxi 2.51
12.144 [1,3] Ditiano-2-ona 1.15
13.784 Dialil disulfuro 23.64
14.038 2-etileden [1,3] ditiano 3.54
14.6893 Hidroxiperóxido, 1,4-dioxan-2-il 6.89
15.314 3-Vinil-1, 2-dithiacyclohex-4-ene 2.02
19.526 Cyclopenteno, 3-metil-3-(trimethylsily) acetil- 1.94
x
Con proporciones relativas ≥ 1%. / xWith relative proportions ≥ 1%.

Publicación en línea, enero 2018 167

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

El crecimiento radial de A. tenuissima en el tra- essential oil to 500 and 1,000 ppm, there were
tamiento con medio PDA solo cubrió el 95% de significant differences with the controls, presenting
la caja de Petri a las 120 h alcanzando un radio inhibition on the growth of A. tenuissima at these
de 22 mm. Entre los tratamientos PDA y PDA- concentrations, with the inhibition of biomass
Tween® 80 no hubo diferencias significativas en su production being of 86.20% at 1,000 ppm of oil
crecimiento radial a las 120 h. El aceite esencial in regard to the control PDA-Tween® 80 (Table 2).
logró una disminución significativa del crecimiento The increase in biomass in a culture medium with
radial de A. tenuissima con concentraciones iguales Tween® 80 at 10 ppm could be due to the interaction
o superiores a 250 ppm logrando a 1,000 ppm una between Tween® 80 and the essential oil. Reportedly,
inhibición del 100% con respecto al testigo PDA- Tween® 80 can increase cell permeability, favoring
Tween® 80 (Cuadro 2). nutrient absorption; in Aspergillus fumigatus it
En la producción de biomasa, el medio PDA- has been suggested that the compound is used as
Tween® 80 con 10 ppm de aceite esencial mostró un a source of carbon (Inouye et al., 2001; Taoka et
incremento significativo con respecto al PDA solo. al., 2011). Since the concentration of Tween® 80 is
Sin embargo, al incrementar la concentración de greater than the essential oil (10 ppm) the surface
aceite esencial a 500 y 1,000 ppm hubo diferencias of mycelial contact is competed for by Tween®
significativas con respecto a los testigos, eviden- 80, reducing the antifungal activity of the oil on
ciándose inhibición sobre el crecimiento de A. te- its own (Inouye et al., 2001). When increasing the
nuissima a estas concentraciones, siendo la inhibi- concentration of essential oil (500 and 1,000 ppm)
ción de producción de biomasa de 86.20% a 1,000 the oil-mycelium interaction increases, favoring
ppm de aceite con respecto al testigo PDA-Tween® its bioactivity, shown by the significant reduction
80 (Cuadro 2). El incremento en biomasa en medio of biomass at 500 and 1,000 ppm in regard to the
de cultivo con Tween® 80 a 10 ppm pudo deberse a PDA-Tween® 80 control (Table 2).
la interacción entre el Tween® 80 y el aceite esen- The CI50 and CMI of 229 ppm and 1,023 ppm,
cial. Se ha reportado que el Tween® 80 puede in- respectively, were obtained from the radial growth.
crementar la permeabilidad celular favoreciendo la The kinetics of the germination of A. tenuissima

Cuadro 2. Efecto antifúngico de aceite esencial de ajo a diferentes concentraciones sobre la producción de biomasa de Alter-
naria tenuissima a las 120 h.
Table 2. Anti-fungal effect of essential garlic oil at different concentrations on the production of biomass of Alternaria
tenuissima after 120 h.

Aceite esencial de ajo (ppm) Crecimiento radial (mm) ±DE Biomasa (mg caja-1) ±DE

0 (PDA) 22±0.0ax 161.13±11.60cx

0 (PDA-Tween® 80) 22±0.0a 522.60±83.01b
10 22±0.0a 692.35±16.47a
100 20±2.17a 148.10±19.74cd
250 9.67±0.76b 101.00±1.13cde
500 2.83±0.56c 68.03±1.86e
1000 0±0.0d 72.10±7.23de
x
Letras distintas entre columnas indican diferencias estadísticas de acuerdo con la prueba de Tukey (p≤0.05). Valores promedio de al
menos tres replicas / xDifferent letters between columns indicate statistical differences according to the Tukey test (p≤0.05). Average
values of at least three replicas.

Publicación en línea, enero 2018 168

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

absorción de nutrientes, en Aspergillus fumigatus spores exposed to the CI50 and CMI of garlic essential
se ha sugerido que el compuesto es utilizado como oil (Figure 1) showed significant differences with
fuente de carbono (Inouye et al., 2001; Taoka et al., those of the control averages (PDA and PDA-
2011). Al ser mayor la concentración de Tween® 80 Tween® 80) with spore germination inhibitors of
con respecto al aceite esencial (10 ppm) la super- 88.89 and 94.17% for CI50 y CMI, respectively.
ficie de contacto del micelio es competida por el According to Inouye et al. (2001), the inhibiting
Tween® 80 disminuyendo la actividad antifúngica capacity of the volatile compounds of essential
del aceite solo (Inouye et al., 2001). Al incremen- oils stands out for having three stages of fungal
tar la concentración de aceite esencial (500 y 1,000 development: spore germination, vegetative
ppm) la interacción de aceite-micelio se incremen- mycelia, and reproductive mycelia. This effect of
ta favoreciendo su bioactividad, evidenciado por la garlic essential oil has been reported in growth
disminución significativa de biomasa a las 500 y stages of Aspergillus versicolor and Penicillium
1,000 ppm con respecto al testigo PDA-Tween® 80 funiculosum (Kocić-Tanackov et al. 2012; Li et al.,
(Cuadro 2). 2014). When evaluating the CMI of the essential
A partir del crecimiento radial se obtuvo la CI50 y oil versus A. tenuissima, a fungistatic effect was
CMI de 229 ppm y 1,023 ppm, respectivamente. La observed. It is possible that garlic essential oil
cinética de germinación de esporas de A. tenussima interacts with the cell membrane, and when its
expuestas a las CI50 y CMI de aceite esencial de concentration is reduced in time by the volatility
ajo (Figura 1) mostró diferencias significativas con of its components, the interaction diminishes and
respecto a los medios testigo (PDA y PDA-Tween® the fungus normalizes its metabolism. Tian et al.
80) con inhibiciones de germinación de esporas del (2012) found alterations in the cell membrane
88.89 y 94.17% para CI50 y CMI, respectivamente. of Aspergillus flavus, particularly ergosterol,

100
Porcentaje de germinación de esporas

80

60
PDA
PDA TWEEN80
229 ppm
40 1023 ppm

20

0
0 4 8 12 16 20 24 28
Tiempo (h)

Figura 1. Cinética de germinación de esporas de A. tenuissima a 25 °C y fotoperiodos de 12 h en PDA, PDA-Tween® 80, CI50
y CMI de aceite esencial de ajo.
Figure 1. Kinetics of the germination of A. tenuissima spores at 25 °C and photoperiods of 12 h in PDA, PDA-Tween® 80,
CI50 and CMI of essential garlic oil.

Publicación en línea, enero 2018 169

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

De acuerdo con Inouye et al. (2001) la capacidad when treated with dill (Anethum graveolens).
inhibitoria de los compuestos volátiles de aceites The antimicrobial action mechanism of sulfured
esenciales se destaca por afectar tres etapas del de- compounds has been related the interaction with
sarrollo fúngico, la germinación de esporas, mice- hydrogen sulfide groups of the cell and the disulfide
lio vegetativo y micelio reproductor. Este efecto del bonds that may form (El-Sayed et al., 2017); it is
aceite esencial de ajo ha sido reportado en etapas de possible that the inhibition in A. tenuissima is due
crecimiento de Aspergillus versicolor y Penicillium to this type of chemical interactions. However,
funiculosum (Kocić-Tanackov et al. 2012; Li et al., additional studies are necessary to elucidate
2014). Al evaluar la CMI del aceite esencial contra mechanisms of interaction of the garlic essential oil
A. tenuissima se observó un efecto fungistático. Es on the in vitro growth of A. tenuissima.
posible que el aceite esencial del ajo interactúe con
la membrana celular y al disminuir su concentra-
ción a través del tiempo por la volatilidad de sus CONCLUSIONS
componentes la interacción disminuye y el hongo
regulariza su metabolismo. Tian et al. (2012) en- Essential garlic oils contain mostly diallyl
contraron alteraciones en la membrana celular de sulfide and diallyl disulfide, compounds with anti-
Aspergillus flavus, particularmente ergosterol al fungal capacities in vitro against A. tenuissima.
ser tratadas con eneldo (Anethum graveolens). El The CI50 if 229 ppm and CMI of 1,023 ppm can
mecanismo de acción antimicrobiana de los com- be considered to evaluate their pertinence in the
puestos azufrados se ha asociado la interacción control of the fungus.
con proteínas con grupos sulfhídricos de la célula
y a los enlaces disulfuro que puedan formarse (El-
End of the English version
Sayed et al., 2017), es posible que la inhibición en
A. tenuissima se deba a este tipo de interacciones
químicas. No obstante, son necesarios estudios adi-
cionales para elucidar mecanismos de interacción LITERATURA CITADA
del aceite esencial de ajo sobre el crecimiento in
vitro de A. tenuissima. Agamy R, Alamri S, Moustafa MFM and Hashem M. 2013.
Management of tomato leaf spot caused by Alternaria
tenuissima Wiltshire using salicylic acid and agrileen.
International Journal of Agriculture and Biology 15:
266-272. Disponible en línea: [Link]
CONCLUSIÓN net/profile/M_Hashem/publication/286315953_Manage-
ment_of_Tomato_Leaf_Spot_Caused_by_Alternaria_te-
nuissima_Wiltshire_using_Salicylic_Acid_and_Agrileen/
Los aceites esenciales de ajo contienen prin- links/[Link]
Blair A, Ritz B, Wesseling C and Freeman LB. 2015. Pesti-
cipalmente dialil sulfuro y dialil disulfuro, com- cides and human health. Occupational and Environmen-
puestos con capacidad antifúngica in vitro contra tal Medicine 72:81-82. [Link]
med-2014-102454
A. tenuissima. La CI50 de 229 ppm y CMI de 1,023 Calo JR, Crandall PG, O’Bryan CA, and Ricke SC. 2015. Es-
ppm pueden ser consideradas para evaluar su perti- sential oils as antimicrobials in food systems–A review.
Food Control 54: 111-119. [Link]
nencia en el control del hongo. odcont.2014.12.040

Publicación en línea, enero 2018 170

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Campbell WB and López-Ortiz S. 2014. Sustainable Food Pro- Larralde-Corona C, López-Insunza F, and Viniegra-González
duction Includes Human and Environmental Health, Issues G. 1997. Morphometric evaluation of the specific growth in
in Agroecology –Present Status and Future Prospectus agar plates at high glucose levels. Biotechnology Bioengi-
(vol.3). Springer Science and Business Media, New York neering 56: 287-294. [Link]
London. 232p. 0290(19971105)56:3<287::AID-BIT6>[Link];2-F
Casella S, Leonardi M, Melai B, Fratini F and Pistelli L. 2013. Li WR, Shi QS, Liang Q, Huang XM and Chen YB. 2014. An-
The role of diallyl sulfides and dipropyl sulfides in the in tifungal effect and mechanism of garlic oil on Penicillium
vitro antimicrobial activity of the essential oil of garlic, funiculosum. Applied Microbiology and Biotechnology
Allium sativum L., and leek, Allium porrum L. Phytothe- 98: 8337-8346. [Link]
rapy Research 27: 380-383. [Link] 9
ptr.4725 López-Insunza F, Larralde-Corona CP, Viniegra-González G.
Christenhusz MJ and Byng JW. 2016. The number of known 1997. Mass transfer and growth kinetics in filamentous
plants species in the world and its annual increase. Phyto- fungi. Chemical Engineering Science 52: 2629-2639.
taxa 261: 201-217. [Link] [Link]
taxa.261.3.1 Malandrakis A, Apostolidou ZA, Markoglou A, and Flouri
Cowan MM. 1999. Plant products as antimicrobial agents. Cli- F. 2015. Fitness and cross-resistance of Alternaria alter-
nical Microbiology Reviews 12: 564-582. Disponible en nata field isolates with specific or multiple resistance to
línea: [Link] single site inhibitors and mancozeb. European Journal of
Dantigny P, Bensoussan M, Vasseur V, Lebrihi A, Buchet C, Plant Patholology 142: 489-499. [Link]
Ismaili-Alaoui M. and Roussos S. 2006. Standardisation of s10658-015-0628-5
methods for assessing mould germination: A workshop re- Pavón-Moreno MÁ, González-Alonso I, Martín-de Santos R.
port. International Journal of Food Microbiology 108: 286- y García-Lacarra T. 2012. Importancia del género Alter-
291. [Link] naria como productor de micotoxinas y agente causal de
El-Sayed HS, Chizzola R, Ramadan AA, and Edris AE. 2017. enfermedades humanas. Nutrición Hospitalaria 27: 1772-
Chemical composition and antimicrobial activity of garlic 1781. [Link]
essential oils evaluated in organic solvent, emulsifying, Quintana-Obregón EA, Plascencia-Jatomea M, Burgos-Her-
and self-micro emulsifying water based delivery systems. nández A, Figueroa-López P and Cortez-Rocha MO. 2013.
Food Chemistry 221: 196-204. [Link] Isolation and identification of fungi from leaves infected
foodchem.2016.10.052 with false mildew on safflower crops in the Yaqui Valley,
Fraire-Cordero ML, Nieto-Ángel D, Cárdenas-Soriano E, Gu- Mexico. Revista Mexicana de Micología 37:19-27. Dis-
tiérrez-Alonso G, Bujanos-Muñiz R.L. y Vaquera-Huerta ponible en línea: [Link]
H. 2010. Alternaria tenuissima, A. alternata y Fusarium [Link]
oxysporum hongos causantes de la pudrición del florete SAS. 2002. JMP Scripting Guide V.5. SAS Institute Inc. North
de brócoli. Revista Mexicana de Fitopatología 28: 25- Carolina, USA. 456p.
33. Disponible en línea: [Link] Savitha AS, and Ajithkumar K. 2016. Evaluation of Newer
php?script=sci_arttext&pid=S0185-33092010000100003 Combination of Azoxystrobin and Tebuconazole for
Inouye S, Tsuruoka T, Uchida K and Yamaguchi H. 2001. Effect the Management of Purple Blotch of Onion. Ma-
of sealing and Tween 80 on the antifungal susceptibility dras Agricultural Journal 103: 233-236. Disponible
testing of essential oils. Microbiology and Immunology en línea: [Link]
45: 201-208. [Link] pdfviewer?vid=0&sid=a17e817e-fded-4696-801c-
tb02608.x 92182ad395fb%40sessionmgr4008
Isman MB, Miresmailli S and Machial C. 2011. Commercial Taoka Y, Nagano N, Okita Y, Izumida H, Sugimoto S and Ha-
opportunities for pesticides based on plant essential oils yashi M. 2011. Effect of Tween 80 on the growth, lipid
in agriculture, industry and consumer products. Phyto- accumulation and fatty acid composition of Thrausto-
chemistry Reviews 10: 197-204. [Link] chytrium aureum ATCC 34304. Journal of Bioscience and
s11101-010-9170-4 Bioengineering 111: 420-424. [Link]
Jones AL and Aldwinckle HS. 2002. Plagas y enfermedades jbiosc.2010.12.010
del manzano y del peral. APS - Ediciones Mundi-Prensa, Tian J, Ban X, Zeng H, He J, Chen Y and Wang Y. 2012. The
Madrid, España. 99 p. mechanism of antifungal action of essential oil from dill
Kocić-Tanackov S, Dimić G, Lević J, Tanackov I, Tepić A, (Anethum graveolens L.) on Aspergillus flavus. PloS One
Vujičić B and Gvozdanović-Varga J. 2012. Effects of onion 7: e30147. [Link]
(Allium cepa L.) and garlic (Allium sativum L.) essential Woudenberg JHC, Seidl MF, Groenewald JZ, de Vries M,
oils on the Aspergillus versicolor growth and sterigma- Stielow JB, Thomma BPHJ and Crous PW. 2015. Alter-
tocystin production. Journal of Food Science 77: M278- naria section Alternaria: Species, formae speciales or
M284. [Link] pathotypes?. Studies in Mycology 82: 1-21. [Link]
org/10.1016/[Link].2015.07.001

Publicación en línea, enero 2018 171

 Selection in vitro of mycoparasites with potential for
biological control on Coffee Leaf Rust (Hemileia vastatrix)

Selección in vitro de micoparásitos con potencial de control

biológico sobre roya del café (Hemileia vastatrix)

Irene Gómez-De La Cruz, Emiliano Pérez-Portilla, Esteban Escamilla-Prado, Centro Regional Univer-
sitario Oriente. Universidad Autónoma Chapingo, Carretera Huatusco-Xalapa, Km 6, CP. 94100, Huatusco,
Veracruz; Misael Martínez-Bolaños*, Campo Experimental Rosario Izapa. INIFAP. Carretera Tapachula-Ca-
cahoatan, Km 18, CP. 30870, Tuxtla Chico, Chiapas; Gloria Luz L. Carrión-Villarnovo, Instituto de Ecología,
A. C. Carretera antigua a Coatepec No. 351, El Haya, CP. 91070, Xalapa, Veracruz; Tania I. Hernández-Leal,
Instituto Tecnológico Superior de Xalapa, Sección 5ª de la Reserva Territorial S/N, CP. 91060, Xalapa, Vera-
cruz. *Autor para correspondencia: misael1480@[Link].

Recibido: 02 de Agosto, 2017. Aceptado: 11 de Diciembre, 2017.

Gómez-De La Cruz I, Pérez-Portilla E, Escamilla-Prado Abstract. In order to isolate and identify

E, Martínez-Bolaños M, Carrión-Villarnovo GLL, Her- mycoparasites of Hemileia vastatrix and to know
nández-Leal TI. 2017. Selection in vitro of mycoparasi- their potential as a biological control for Coffee
tes with potential for biological control on Coffee Leaf Leaf Rust, from December 2014 to January 2015,
Rust (Hemileia vastatrix). Revista Mexicana de Fitopa- samples of Arabica coffee with pustules and the
tología 36(1): 172-183. presence of possible mycoparasites were sampled.
DOI: 10.18781/[Link].1708-1 The fungi associated with the pustules were
isolated and identified morphometrically at the
Primera publicación DOI: 24 de Diciembre, 2017. genus level. The percentage of mycoparasitism
First DOI publication: December 24, 2017. in vitro of three of the isolates on rust pustules
was evaluated. We obtained 23 isolates of
microorganisms associated with rust pustules:
Resumen. Con el objetivo de aislar e identificar Lecanicillium spp. (7), Calcarisporium sp. (4),
micoparásitos de pústulas de Hemileia vastatrix y Sporothrix sp. (4) and Simplicillium spp. (8). All
conocer su potencial de control de la roya de café, the isolates evaluated showed mycoparasitism in
de diciembre del 2014 a enero del 2015 se mues- rust uredospores; however, 120 h after inoculation,
trearon hojas de café arábico con pústulas de roya the highest percentages (P = 0.05) were obtained
y presencia de posibles micoparásitos. Los hongos with Simplicillium sp. (89%) and Lecanicillium sp.
asociados a las pústulas se aislaron e identificaron (68%).
morfométricamente a nivel de género. Se evaluó el
porcentaje de micoparasitismo in vitro de tres de los Key words: Lecanicillium, Calcarisporium,
aislamientos sobre pústulas de roya. Se obtuvieron Sporothrix, Simplicillium.

Publicación en línea, enero 2018 172

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

23 aislamientos de microorganismos asociados a Coffee Leaf Rust is caused by the fungus

pústulas de roya: Lecanicillium spp. (7), Calcaris- Hemileia vastatrix, a biotrophic pathogen that
porium sp. (4), Sporothrix sp. (4) y Simplicillium affects Coffea leaves, and is considered the most
spp. (8). Todos los aislamientos evaluados mostra- important disease on this crop worldwide. This
ron micoparasitismo en las uredosporas de roya; fungus causes defoliation and reduces the yields of
sin embargo, 120 h después de la inoculación, los the coffee plants (Avelino et al., 2015). The severity
mayores porcentajes (P=0.05) se obtuvieron con of the recent rust epidemics in Central America
Simplicillium sp. (89%) y Lecanicillium sp. (68%). and Mexico has caused losses of 40 to 50% in the
yield of the crop (Cressey, 2013). According to the
Palabras clave: Lecanicillium, Calcarisporium, International Coffee Organization (ICO, 2015),
Sporothrix, Simplicillium. economic factors (decapitalization of farmers)
and agronomic factors (lack of management of the
crop) have contributed to reach these losses.
La roya del cafeto es causada por el hongo He- In response to the coffee crisis caused by Coffee
mileia vastatrix, un patógeno biotrófico que afecta Leaf Rust, short-term actions were implemented in
hojas de Coffea y se considera la enfermedad más Central America; however, the main strategies for
importante en el cultivo a nivel mundial. Este hon- their management focus particularly on chemical
go causa defoliación y reduce el rendimiento de los control and the use of resistant varieties (Zambolim
cafetos (Avelino et al., 2015). La severidad de las et al., 1997; Avelino et al., 2015 and Escamilla,
recientes epidemias de la roya en Centroamérica y 2016).
México ha ocasionado pérdidas del 40 al 50% en el Chemical control is considered scarcely
rendimiento del cultivo (Cressey, 2013). De acuer- promissory for Mexican coffee growing activities,
do a la Organización Internacional del Café (OIC, since it is a socially important crop, as well as
2015), los factores económicos (descapitalización considering the organic farming sector. Biological
de productores) y agronómicos (falta de manejo del control is an alternative, boosting the use of
cultivo) han contribuido a alcanzar dichas pérdidas. microorganisms that come from the same action
En respuesta a la crisis cafetalera debida a la environment as the plant pathogen.
roya de cafeto, en Centroamérica se implementaron Within the strategies for the biological control
acciones a corto plazo; sin embargo, las principales of plant pathogens, one of the options is the use
estrategias para su manejo se enfocan especialmen- of mycoparasites, fungi that are able to survive
te hacia el control químico y el uso de variedades at the expense of another fungus (Boosalis,
resistentes (Zambolim et al., 1997; Avelino et al., 1964), affecting the reproductive structures of
2015 y Escamilla, 2016). the pathogen, which limits its development and
El control químico se considera poco promiso- spreading (Barros et al., 1999).
rio para la cafeticultura mexicana, por tratarse de Different mycoparasites have been reported on
un cultivo de importancia social, además de consi- plant pathogens, including Trichoderma sp. and
derar el sector de productores orgánicos. El control Penicillium vermiculatum on Rhizoctonia solanii
biológico representa una alternativa, potenciando (Rolz et al., 2013); Calcarisporium parasiticum, as
el uso de microorganismos que provengan del mis- well as Physalospora spp., and Trichoderma spp.
mo ambiente de acción del fitopatógeno. only Armilaria mellea (Boosalis, 1964) and other

Publicación en línea, enero 2018 173

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Dentro de las estrategias de control biológico fungi such as Sclerotinia spp. (Hoyos et al., 2008),
de los fitopatógenos, una de las opciones es el uso Rhizoctonia solani, Phytophthora nicotianae,
de micoparásitos, hongos que tienen la capacidad P. capsici and Pythium aphanidermatum, on
de sobrevivir a expensas de otro hongo (Boosalis, Penicillium sp. and Fusarium sp. (Sandoval and
1964) afectando las estructuras reproductivas del López, 2001). Within the group of rusts, the main
patógeno, lo cual limita su desarrollo y disemina- mycoparasitic relations reported are: Cladosporium
ción (Barros et al., 1999). tenuissimum on Uromyces apendiculatus (Assante
Diferentes micoparásitos han sido reportados et al., 2004); Cladosporium uredinicola on
sobre fitopatógenos, entre ellos, Trichoderma sp. Puccinia puta (Barros et al., 1999); Simplicillium
y Penicillium vermiculatum sobre Rhizoctonia lanosoniveum affecting Phakopsora pachyrizi
solanii (Rolz et al., 2013); Calcarisporium para- (Gauthier et al., 2014) y Verticillium lecanii en
siticum, asi como Physalospora spp., y Trichoder- Puccinia recóndita (Spencer and Atkey, 1981).
ma spp. sobre Armilaria mellea (Boosalis, 1964) Given the importance of the Coffee Leaf Rust
y otros hongos como Sclerotinia spp. (Hoyos et disease, different Studies have been carried out to
al., 2008), Rhizoctonia solani, Phytophthora ni- determine the species with mycoparasitism related
cotianae, P. capsici y Pythium aphanidermatum, to H. vastatrix (Carrión, 1988; Carrión and Rico,
sobre Penicillium sp. y Fusarium sp. (Sandoval y 2002; Mahfud et al., 2006; Rolz, 2013 and Haddad
López, 2001). Dentro del grupo de las royas, las et al., 2014); however, most of them only recorded
principales relaciones micoparasíticas reportadas the presence of mycoparasites of Coffee Leaf
son: Cladosporium tenuissimum sobre Uromyces Rust and not their potential as possible agents of
apendiculatus (Assante et al., 2004); Cladospo- biological control of the disease.
rium uredinicola sobre Puccinia puta (Barros et Based on these precedents, the aim of this
al., 1999); Simplicillium lanosoniveum afectando investigation is to isolate and identify mycoparasites
a Phakopsora pachyrizi (Gauthier et al., 2014) y of H. vastatrix pustules, as well as to evaluate their
Verticillium lecanii en Puccinia recóndita (Spencer potential to control the disease in vitro.
y Atkey, 1981).
Dada la importancia de la enfermedad de la
roya de café, se han realizado diferentes estudios MATERIALS AND METHODS
para determinar las especies con micoparasitismo
asociados a H. vastatrix (Carrión, 1988; Carrión Collection sites. In an altitudinal profile in the
y Rico, 2002; Mahfud et al., 2006; Rolz, 2013 y state of Veracruz, three coffee-growing locations
Haddad et al., 2014); sin embargo, la mayoría de were chosen: Matlaluca, in the municipal area
ellos sólo registró la presencia de micoparásitos de of Zentla (at an altitude of 650 masl, an average
la roya del café y no su potencial como posibles annual temperature of 22°C and 1300 mm of yearly
agentes de control biológico de la enfermedad. rainfall); El Ocote (at an altitude of 1030 masl, an
Con base en los antecedentes descritos, en el pre- average annual temperature of 19.8°C and 1682
sente trabajo se plantearon los objetivos de aislar e mm of yearly rainfall) and Tlavictepan (1250 masl,
identificar micoparásitos de pústulas de H. vasta- an average annual temperature of 17.2°C and 1967
trix, así como evaluar su potencial de control de la mm of yearly rainfall), in the municipal area of
enfermedad in vitro. (Table 1).

Publicación en línea, enero 2018 174

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

MATERIALES Y MÉTODOS Sampling of plant material. In each location,

five plots, each with a surface area of one hectare,
Sitios de colecta. En un perfil altitudinal en el es- samples were taken of plants with symptoms of
tado de Veracruz, se seleccionaron tres localida- rust and with signs of possible mycoparasites in
des productoras de café: Matlaluca, del municipio the pustules. The collection period was between
de Zentla (con altitud de 650 msnm, temperatura December 2014 and January 2015, and in each plot,
media anual de 22 °C y 1300 mm de precipitación 40 leaves were taken from different coffee plants.
anual); El Ocote (con altitud de 1030 msnm, tem- The leaves were wrapped in sterile paper towels
peratura media anual de 19.8 °C y 1682 mm de and placed inside properly labeled plastic bags.
precipitación anual) y Tlavictepan (1250 msnm, They were transferred to the Fungus Biodiversity
temperatura media anual de 17.2 °C y 1967 mm and Systematics of the Environment Institute, A. C.
de precipitación anual), del municipio de Huatusco Lab for their preparation and analysis.
(Cuadro 1).
Isolation of mycoparasites. In the lab, six rust
Muestreo de material vegetativo. En cada locali- pustules were taken from each leaf, with signs
dad se recorrieron cinco parcelas de una hectárea, of possible mycoparasites. Under a stereoscopic
en cada una se realizaron muestreos dirigidos a microscope (Leica® Heerbrug, Suiza), and with
plantas con síntomas de roya y con signos de po- the aid of a hypodermic needle, portions of fungal
sibles micoparásitos en las pústulas. El periodo mycelia related to rust pustules were taken and
de colecta fue de diciembre de 2014 a enero de placed in Petri dishes with oat agar culture medium
2015 y en cada parcela se colectaron 40 hojas with an antibiotic (Cloranfenicol® Toluca, México)

Cuadro 1. Descripción de los sitios de colecta de micoparásitos de roya del cafeto.

Table 1. Description of the sites of collection of mycoparasites of the Coffee Leaf Rust.

Temperatura Precipitación
Altitud Sistema de
Localidad Coordenadas media anual media anual Variedad
(msnm) producción
(°C) (mm)

19°07´56´´ Policultivo Typica,

Matlaluca 650 22 1300
96°46´30´´ Tradicional Bourbon
Costa Rica,
19°07´56´´ Policultivo
El Ocote 1030 19.8 1682 Colombia,
96°53´30´´ comercial
Typica
Costa Rica,
19°09´40´´ Policultivo
Tlavictepan 1250 17.2 1967 Colombia,
96°56´34´´ comercial
Typica

Nota. Según la clasificación de Nolasco y Toledo (1996), se define como sistema de Policultivo comercial al que utiliza diferen-
tes combinaciones de árboles del bosque y frutales introducidas, incluyendo control de arvenses y poda selectiva de cafetos y sin
manejo fitosanitario, mientras que el Policultivo comercial utiliza especies comerciales de sombra, realizando labores generales y
particulares en los cultivos / Note. According to the classification by Nolasco and Toledo (1996), a commercial polyculture system
is one which used different combinations of introduced forest and fruit trees, including weed control and the selective trimming of
coffee plants and without phytosanitary management, whereas commercial polyculture uses commercial shade species, carrying out
general and particular tasks in the crops.
Fuente: Servicio Meteorológico Nacional, 2000 / Source: Servicio Meteorológico Nacional, 2000.

Publicación en línea, enero 2018 175

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

en diferentes cafetos. Las hojas se envolvieron con at 1%. The cultures were kept at 24+1°C for ten
papel absorbente estéril y se colocaron dentro de days and purified by hyphal tip isolation.
bolsas plásticas debidamente etiquetadas. Se trasla-
daron al laboratorio de Biodiversidad y Sistemática Taxonomic identification. The morphometric
de Hongos del Instituto de Ecología, A. C. para su characterization of the pure isolations was
preparación y análisis. carried out with the production of temporary and
permanent preparations of the isolations, followed
Aislamiento de micoparásitos. En laboratorio, by their observation under a compound microscope
de cada hoja colectada se seleccionaron seis pús- (Leica, DM550®, Heerbrug, Switzerland) and the
tulas de roya con presencia de signos de posibles software Leica Aplication Suite Educational Zoom
micoparásitos. Bajo un microscopio estereoscópi- (LAS EZ) version 3.0. The genus identification
co (Leica® Heerbrug, Suiza) y con la ayuda de una considered the presence and dimensions of phialides
aguja hipodérmica se tomaron porciones de mice- and conidia (n=30), and they were described with
lio de los hongos asociados a las pústulas de roya the aid of specialized taxonomic keys: Barranco
y se colocaron en cajas Petri con medio de cultivo (2004), Barnet and Lilly (1958), Domsch et al.,
agar avena con antibiótico (Cloranfenicol® Tolu- (1980), Hirose et al., (2011), Hoog (1974), Zare et
ca, México) al 1%. Los cultivos se mantuvieron a al. (2000), Zare and Gams, 2001.
24+1°C por diez días y se purificaron por punta de
hifa. Evaluation of the mycoparasitic potential
of isolated microorganisms. Three isolations
Identificación taxonómica. La caracterización (Lecanicillium sp.-TlaP4, Simplicillium sp.-MaP2
morfométrica de los aislamientos puros se realizó and Calcarisporium sp.-OcP2) were selected for
mediante la elaboración de preparaciones tempo- the evaluation of their potential as H. vastatrix
rales y permanentes de los aislamientos, y su pos- mycoparasitic microorganisms; the criterion for
terior observación en un microscopio compuesto selection was the growth rate of the isolations. The
(Leica, DM550®, Heerbrug, Suiza) y el software isolations were incubated in Potato Dextrose Agar
Leica Aplication Suite Educational Zoom (LAS (PDA) for 10 days, followed by the production
EZ) versión 3.0. La identificación a género consi- of a spore suspension at a concentration of 5x106
deró la presencia y dimensiones de fiálides y coni- spores ml-1; each suspension was added an aliquot
dios (n=30), y se describieron con ayuda de las cla- of Tween 20® at 0.01%.
ves taxonómicas especializadas: Barranco (2004), The test in vitro to evaluate the mycoparasitism
Barnet and Lilly (1958), Domsch et al., (1980), Hi- was carried out according to the methodology
rose et al., (2011), Hoog (1974), Zare et al. (2000), proposed by Eskes et al. (1991), with adaptations.
Zare y Gams, 2001. Leaves of Coffea arabica plants of the bourbon
variety, with symptoms of Coffee Leaf Rust, were
Evaluación del potencial micoparasítico de mi- taken in the field and kept in polypaper bags for their
croorganismos aislados. Tres aislamientos (Leca- analysis in the lab. Under a stereoscopic microscope,
nicillium sp.-TlaP4, Simplicillium sp.-MaP2 y Cal- pustules were analyzed to select only those that
carisporium sp.-OcP2) se seleccionaron para evaluar presented no mycoparasitic microorganisms.
su potencial como microorganismo micoparásito de Five leaf disks, each 1.5 cm in diameter, with the

Publicación en línea, enero 2018 176

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

H. vastatrix; el criterio de selección fue la tasa de presence of at least one rust pustule, were placed
crecimiento de los aislamientos. Los aislamientos in a Petri dish with agar water; each leaf disk was
se incubaron en Papa Dextrosa Agar (PDA) por 10 considered as a repetition of five. We sprayed 1 ml
días, posteriormente se realizó una suspensión de of the spore suspension previously prepared with
esporas a una concentración de 5x106 esporas ml-1, each one of the strains, and the control group was
a cada suspensión se le adicionó una alícuota de sprayed with sterile distilled water. The treatments
Tween 20® al 0.01%. were established under a totally random design
La prueba in vitro para evaluar el micoparasi- and kept under light periods of 12 h and 12 h of
tismo se realizó de acuerdo a la metodología pro- darkness, at 24 °C.
puesta por Eskes et al. (1991), con adaptaciones. To determine the percentage of mycoparasitism
Hojas de Coffea arabica de la variedad bourbón in rust pustules, in each leaf disk, the sporulating
con síntomas y signos de roya anaranjada, se co- lesions were scraped and suspended in 1 ml of
lectaron en campo y se conservaron en bolsas de distilled water, adding 100 µl of Tween 80 at 0.01%.
polipapel para su análisis en laboratorio. Bajo mi- From the dilution obtained, 100 µl were taken and
croscopio estereoscópico se analizaron las pústulas observed under the microscope to count the number
para seleccionar sólo aquellas que no presentaron of parasited and non-parasited uredospores in the
microorganismos micoparásitos. Cinco discos fo- sample. The evaluations were carried out every 24
liares de 1.5 cm de diámetro, con la presencia de hours for a period of 5 days.
al menos una pústula de roya, se colocaron en una
placa Petri con agar agua; cada disco se consideró Statistical analysis. The percentage of parasitism
como una repetición de cinco. Se asperjó 1 ml de la in the uredospores evaluated every 24 hours was
suspensión de esporas previamente preparada con analyzed with an analysis of variance and a Tukey
cada una de las cepas y al grupo testigo se le asper- average separation test, with the aid of the program
jó agua destilada estéril. Los tratamientos fueron Statistica version 6.0.
establecidos bajo un diseño completamente al azar
y se mantuvieron a fotoperiodos de 12 h luz y 12 h
obscuridad, a 24 °C. RESULTS AND DISCUSSION
Para determinar el porcentaje de micoparasitis-
mo en las pústulas de roya, de cada disco foliar se Isolation of mycoparasites. A total of 23
realizó un raspado de las lesiones esporulantes y mycoparasite isolations were obtained from the
se suspendió en 1 ml de agua destilada adicionán- different sampling sites. The highest number (10)
dole 100 µl de Tween 80 al 0.01%. De la dilución was obtained from the middle altitude zone (El
obtenida se tomaron 100 µl y se observaron bajo Ocote, 1030 masl), and the lowest number (6), from
microscopio para contabilizar el número de uredos- the low altitude zone with a higher temperature and
poras parasitadas y no parasitadas en la muestra. rainfall than the other sampling sites (Zentla, 650
Las evaluaciones se realizaron cada 24 horas por masl). Considering that weather conditions are
un periodo de cinco días. factors that determine the development of fungi,
our results differ from those reported by Martins
Análisis estadístico. El porcentaje de parasitis- et al., (2015), who report a greater incidence of
mo en las uredosporas evaluadas cada 24 horas mycoparasites on H. vastatrix in the dry season

Publicación en línea, enero 2018 177

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

se analizaron a través de un análisis de varianza y of the year, and also suggest that the mycoparasite
una prueba de separación de medias de Tukey con Lecanicillium lecanii could be more persistent
ayuda del programa Statistica versión 6.0. at lower temperatures. This is also different to
reports by Bagyaraj et al., (2015) who found a
greater bacteria and fungus populations in rustican
RESULTADOS Y DISCUSIÓN systems, and therefore, in this case, there are reports
of a higher diversity in conditions of commercial
Aislamiento de micoparásitos. Se obtuvieron un polyculture, where shade is less diverse than in the
total de 23 aislamientos de micoparásitos de los di- lower zone site.
ferentes sitios de muestreo. El mayor número (10) Four fungal genera were identified: Calcarisporium
se obtuvo de la zona altitudinal media (El Ocote, sp. (4), Lecanicillium spp. (7), Simplicillium spp.
1030 msnm), y el menor número (6) de la zona alti- (8), Sporothrix sp. (4), with Simplicillium spp. and
tudinal baja con mayor temperatura y precipitación Lecanicillium spp. being the most abundant.
respecto a los otros sitios de muestreo (Zentla, 650
msnm), considerando que las condiciones climá- Microscopic description of the genera.
ticas son factores que determinan el desarrollo de
los hongos, los resultados difieren de lo reportado Lecanicillium spp. Presented septated hyphae,
por Martins et al., (2015), que reporta mayor in- hyalines; with con phialides (15-23 x 0.5-1.2 µm)
cidencia de micoparásitos sobre H. vastatrix en la ordered in groups of three to five per whorl (Zare
estación seca del año, quien también sugiere que el and Gams, 2001), and not in pairs or individually,
micoparásito Lecanicillium lecanii podría ser más as pointed out by Cañedo and Ames (2004); they
persitente a bajas temperaturas. Esto también difie- were also slightly wider at the base. The conidia
re de lo reportado por Bagyaraj et al., (2015) que were elliptical (5-7x1-2 µm) and emerging in the
encontró mayor población de bacterias y hongos en top of the phialide (Figure 1 A); they were generally
sistemas de rusticanos, por lo que en este caso se observed in conidial heads (Barranco, 2004).
reporta mayor diversidad en condiciones de poli-
cultivo comercial donde la sombra es menos diver- Calcarisporium sp. Presented hyaline and septated
sa que en el sitio de zona baja. hyphae, which hold short conidiphora (Figure 1 B),
Se identificaron cuatro géneros de hongos: Cal- and on them, verticillated phialides measuring 4-6
carisporium sp. (4), Lecanicillium spp. (7), Simpli- x 1-2 µm. A characteristic that distinguishes this
cillium spp. (8), Sporothrix sp. (4), siendo los más genus is the shape of the phialides, which appeared
abundantes Simplicillium spp. y Lecanicillium spp. wider in the base and end in small denticles on the
apex (Hirose et al., 2011). The simple phialides are
Descripción microscópica de los géneros. formed directly from the hypha (Barnet, 1958). The
conidia are ovoidal and measure 3-5x1.3-1.8 µm.
Lecanicillium spp. Presentó hifas septadas, hiali-
nas; con fiálides (15-23 x 0.5-1.2 µm) ordenadas en Simplicilllium spp. Presented hialine, this and
grupos de tres a cinco por verticilo (Zare y Gams, septated hyphae; the conidiophora (15-35x0.8-
2001), y no en pares o solitarias como lo señaló 1µm) emerge in ones (Zare et al., 2000),
Cañedo y Ames (2004), además fueron ligeramente perpendicular to the hyphae and become thinner

Publicación en línea, enero 2018 178

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

más anchas en la base. Los conidios fueron elípti- towards the tip (Molina et al., 2012). Hyphae are
cos (de 5-7x1-2 µm) y emergiendo en el extremo generally interlaced (Figure 1 C). The conidia (1-3
superior de la fiálide (Figura 1 A); generalmente se µm) were circular and sometimes elliptical, with
observaron en cabezuelas (Barranco, 2004). an abundant sporulation and an arrangement in
mucoidal heads (Domsch et al., 1980).
Calcarisporium sp. Presentó hifas hialinas y septa-
das, las cuales sostienen conidióforos cortos (Figu- Sporothrix sp. Presented hyalin vegetative hyphae,
ra 1 B) y sobre ellos, fiálides verticiladas que miden with short septa and denticles (Figure 1 D); no
4-6 x 1-2 µm. Una característica que distingue a conidiophora were observed after 10 days; the
este género es la forma de las fiálides, las cuales conidia were observed on the denticles of the
se observaron anchas en la base y terminan en pe- hyphae (Hoog, 1974); there was an abundant
queños dentículos en el ápice (Hirose et al., 2011). sporulation in the Agar-Oat medium.

Figura 1. Micoparásitos encontrados en pústulas de Roya del Cafeto (Hemileia vastatrix) y sus características morfológicas
en Avena-Agar. Dónde: Lecanicillium sp. (A-40X); Calcarisporium sp. (B-40X); Simplicillium sp. (C-40X) y Sporo-
thrix sp. (D-40X). Barra: 10 µm.
Figure 1. Mycoparasites found in Coffee Leaf Rust pustules (Hemileia vastatrix) and their morphological characteristics in
Oat-Agar. Where: Lecanicillium sp. (A-40X); Calcarisporium sp. (B-40X); Simplicillium sp. (C-40X) and Sporo-
thrix sp. (D-40X). Bar: 10 µm.

Publicación en línea, enero 2018 179

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Las fiálides simples se forman directamente de la Mycoparasitism in vitro on H. vastatrix. Forty-

hifa (Barnet, 1958). Los conidios son ovoides con eight hours after the inoculation of treatments,
medidas de 3-5x1.3-1.8 µm. significant statistical differences (P=0.05) were
obtained between treatments (Table 2). The highest
Simplicilllium spp. Presentó hifas hialinas, delga- percentages of mycoparasitism observed in the first
das y septadas; los conidioforos (15-35x0.8-1µm) 72 hours were found in isolations of Simplicillium
emergiendo solitarios (Zare et al., 2000) en forma sp., and Calcarisporium sp., whereas 96 and 120 h
perpendicular a las hifas y adelgazan hacia la pun- after inoculation, the highest percentages were
ta (Molina et al., 2012). Las hifas generalmente se found in Simplicillium sp. and Lecanicillium sp.
observaron entrelazadas (Figura 1 C). Los conidios (Table 2).
(1-3 µm) fueron circulares y en ocasiones elípticos, The genus Simplicillium is reported as part of
con esporulación abundante y disposición en cabe- the fungi related to Coffee Leaf Rust in Puerto Rico
zas mucoides (Domsch et al., 1980). and Mexico (James et al., 2016). The species of
this genus have been registered mainly in relation
Sporothrix sp. Presentó hifas vegetativas hialinas, with H. vastatrix (Zare and Gams, 2001), while
con septos cortos y dentículos (Figura 1 D); no se its potential as a biological control agent of other
observaron conidióforos a los 10 días, los coni- diseases has had little studies. It has been recorded
dios se observaron sobre los dentículos de las hifas in association with pathogenic fungi in plants, such
(Hoog, 1974); se observó abundante esporulación as Alternaria brassicicola, Sclerotium rolfsii and
en medio Agar-Avena. Rhizoctonia solani (Shyang et al., 2017), as well as
with nematodes (Gams and Zare, 2003) and aphids
Micoparasitismo in vitro sobre H. vastatrix. Cua- (Shyang et al., 2017).
renta y ocho horas posteriores a la inoculación de The genus Lecanicillium has been widely
tratamientos, se obtuvieron diferencias estadísticas studied, and documented as a biological control
significativas (P=0.05) entre tratamientos (Cuadro agent for mildews and uredinales (Alavo, 2015).
2). Los mayores porcentajes de micoparasitismo ob- Mahfund et al. (2006) point out that the effects
servados durante las primeras 72 horas corresponden of two species of this genus can vary between

Cuadro 2. Evaluación del porcentaje de parasitismo de tres microorganismos sobre pústulas de

roya de café (Hemileia vastatrix) en condiciones in vitro.
Table 2. Evaluation of the percentage of parasitismo of three microorganisms on Coffee Leaf
Rust pustules (Hemileia vastatrix) in in vitro conditions.

Horas después de la inoculación

Tratamiento
24 48 72 96 120

Testigo 0.00+0a 0.00+b 0.00+c 0.00+c 0.00+0c

Calcarisporium sp. 0.00+0a 20.87+13ab 41.02+13ab 50.12+0.7b 51.60+10b
Lecanicillium sp. 2.68+2 a 9.85+6b 17.49+16bc 49.19+13b 68.10+12b
Simplicillium sp. 0.89+2 a 42.73+9az 51.19+16a z 83.48+3az 88.86+11a z

Medias +Desviación estándar, los valores con la misma letra en las columnas no difieren estadísti-
z=

camente (Tukey p=0.05) / z=Means +Standard deviation, values with the same letter in the columns
do not differ statistically (Tukey p=0.05)

Publicación en línea, enero 2018 180

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

a los aislamientos de Simplicillium sp., y Calcaris- the decoloring of uredospores, the formation of
porium sp., mientras que a las 96 y 120 h posterio- white mycellia on them, or necrosis, depending
res a la inoculación, los mayores porcentajes co- on the time of application. This suggests that the
rrespondieron a Simplicillium sp. y Lecanicillium percentage of parasitism of Lecanicillium sp. varies
sp. (Cuadro 2). between species and isolations (Arriola et al.,
1998).
El género Simplicillium se reporta como parte Finally, previous studies have pointed out the
de los hongos asociados a roya del café en Puerto natural parasitism of Calcarisporium sp. on Coffee
Rico y México (James et al., 2016). Las especies de Leaf Rust (Carrión and Rico, 2002).
este género han sido registradas principalmente en
asociación con H. vastatrix (Zare y Gams, 2001),
mientras que su potencial como agente de control CONCLUSIONS
biológico de otras enfermedades ha sido poco es-
tudiado. Ha sido registrado en asociación con hon- The genera Lecanicillium sp., Calcarisporium
gos fitopatógenos como Alternaria brassicicola, sp., Sporothrix sp. and Simplicillium sp. were
Sclerotium rolfsii y Rhizoctonia solani (Shyang et isolated from rust pustules in the municipal areas
al., 2017), también con nematodos (Gams y Zare, of Huatusco and Zentla, in the estate of Veracruz,
2003) y áfidos (Shyang et al., 2017). Mexico.
El género Lecanicillium ha sido ampliamente The highest percentages of mycoparasitism in
estudiado, documentándose como agente de control the in vitro tests were obtained with the strains of
biológico de mildius y uredinales (Alavo, 2015). Simplicillium sp. (88.86%) and Lecanicillium sp.
Mahfund et al. (2006) señala que los efectos de (68.10%), 120 hours after inoculation.
dos especies de este género pueden actuar desde la
decoloración de uredosporas, formación de micelio End of the English version
blanco sobre ellas o necrosamiento, dependiendo el
tiempo de aplicación. Esto sugiere que el porcenta-
je de parasitismo de Lecanicillium sp., varía entre
Los mayores porcentajes de micoparasitismo
especies y aislamientos (Arriola et al., 1998).
en las pruebas in vitro se obtuvieron con las cepas
Finalmente, en estudios previos se ha señala-
de Simplicillium sp. (88.86%) y Lecanicillium sp.
do el parasitismo de Calcarisporium sp., sobre
(68.10%), a las 120 horas posteriores a la inocu-
roya del cafeto de manera natural (Carrión y Rico,
lación.
2002).

CONCLUSIONES LITERATURA CITADA

Alavo BC. 2015. The insect pathogenic fungus Verticillium le-
Los géneros Lecanicillium sp., Calcarisporium canii (Zimm.) Viegas and its use for pests control: A review.
Journal of Experimental Biology and Agricultural Sciences
sp., Sporothrix sp. y Simplicillium sp. fueron aisla- 3:337-345. [Link] 10.18006/2015.3(4).337.345
dos de pústulas de roya de cafeto en los municipios Arriola MC, Chet I and Rölz C. 1998. Hongos que atacan la
roya del café: Un breve comentario. Universidad Del Valle
de Huatusco y Zentla, en el estado de Veracruz, de Guatemala 8:2-6. Disponible en línea: [Link]
México. publicaciones/revista/volumenes/[Link]

Publicación en línea, enero 2018 181

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Assante G, Maffi D, Sarachi M, Farina G, Morica S and Raga- Mycoparasitism of Phakosphora pachyrizi, the soybean
zzi A. 2004. Histological studies on the mycoparasitism of rust pathogen, by Simplicillium lanosoniveum. Biologi-
Cladosporium tenuissimum on urediniospores of Uromy- cal Control 76:87-94. [Link]
ces appendiculatus. Mycology 108:170-182. [Link] trol.2004.05.008
org/10.1017/S0953756203008852 Gams W and Zare R. 2003. A taxonomic review of the clavi-
Avelino J, Cristancho M, Georgiou S, Imbach P, Aguilar L, cipitaceous anamorphs parasitizing nematodes and other
Bornemann G, Läderac P, Anzueto F, Hruska AJ and Mo- microinvertebrates. 17-73. In: Clavicipitalean Fungi: Evo-
rales C. 2015. The coffee rust crisis in Colombia and Cen- lutionary biology, Chemistry, Biocontrol and Cultural Im-
tral America (2008-2013): impacts, plausible causes and pacts. DOI: 10.1201/9780203912706.pt1
proposed solutions. Food Security 7: 303-321. [Link] Haddad, F, Saraiva R, Mizubuti E, Romeiro R and Maffia L.
org/10.1007/s12571-015-0446-9 2014. Isolation and selection of Hemileia vastatrix antago-
Barnett HL and Lilly VG. 1958. Parasitism of Calcarispo- nists. European Journal of Plant Pathology 139:763-772.
rium parasiticum on species of Physalospora and related [Link]
fungi. Boletin 420T. West Virginia University Agricul- 0430-9
tural Experiment Station. 1-37 pp. Disponible en línea: Hirose D, Dewaga Y and Inaba S. 2012. The anamorphic genus
[Link] Calcarisporiella is a new member of the Mucoromycoti-
c420barn/parasitismofcalc420barn_bw.pdf na. Mycoscience 53:256-260. [Link]
Barranco, FJE. 2004. Contribución al estudio de las activida- S10267-011-0160-1
des enzimáticas involucradas en el mecanismo de patoge- Hoog GS. 1974. The genera Blatobotrys, Sporothrix, Calca-
nicidad de Lecanicillium (Verticillium) lecanii cultivado risporium and Calcarisporiella Gen. Nov. Studies in My-
en medio sólido. Universidad Autónoma Metropolitana. cology 7:70-73.
Iztapalapa, México, D.F. Hoyos L, Duque G y Orduz S. 2008. Antagonismo in vitro de
Barros ST, Oliveira TN, Bastos T G and Maia CL.1999. Hy- Trichoderma spp. sobre aislamientos de Sclerotinia spp., y
perparasitism of Cladosporium uredinicola over Puccinia Rhizoctonia spp. Revista Colombiana de Ciencias Hortíco-
puta on the host Ipomoea fistulosa. Mycologist 13:23-24. las 2: 76-86. [Link]
[Link] James T, Marino J, Perfecto I and Vandermeer J. 2016. Identifi-
Bagyaraj JD, Thilagar J, Ravisha C, Kashalapa GC, Krishna- cation of putative coffee rust micoparasites via single-mo-
murthy NK and Vaast P. 2015. Below ground microbial lecule DNA sequencing of infected pustules. Applied and
diversity as influenced by coffee agroforestry systems in Environmental Microbiology 83: 631-639. DOI: 10.1128/
the Western Ghats, India. Agriculture, Ecosystems and AEM.02639-15
Environment 202:198-202. [Link] Mahfund MC, Mior AZ, Meon S and Kadir J. 2006. In Vitro
agee.2015.01.015 and in Vivo Tests for Parasitism of Verticillium psallio-
Boosalis MG. 1964. Hyperparasitism. Annual Review of tae Treschow on Hemileia vastatrix Berk and Br. Ma-
Phytopathology 2:363-376. [Link] laysian Journal of Microbiology. 2:46-50. Disponible en
[Link].02.090164.002051 línea en: [Link]
Carrión G and Rico-Gray V. 2002. Mycoparasites on the coffee php?id=10291
rust in Mexico. Fungal Diversity 11:49-60. Disponible en Martins JS, Soares CA, Medeiros VH, Santos CV, Pozza EV.
línea: [Link] 2015. Contribution of host and environmental factors to
[Link] the Hyperparasitism of coffee rust under field conditions.
Carrión G. 1988. Estudios sobre el control biológico de la roya Australasian Plant Pathology 44:605-610. [Link]
del cafeto mediante Verticillium lecanii en México. Mico- org/10.1007/s13313-015-0375-2
logía Neotropical 1:79-86. Moguel P y Toledo V. 1996. El café en México, ecología, cul-
Cressey D. 2013. Coffee rust regains foothold: researchers tura y sustentabilidad. Ciencias 43:40-51.
marshal technology in bid to thwart fungal outbreak in Molina RE, Morales RR, Valenzuela FE, y Vives GI. 2012. Ca-
Central America. Nature 493 (7434):587. Disponible en racterización morfológica de Acremonium sp. asociado a
línea: [Link] Neonectria fuckeliana en Pinus radiata en Chile. Boletín
pdfs/Notas/Coffee%20rust%[Link] de Micología 27: 32-38. [Link]
Domsch KH, Gams W and Anderson TH. 1980. Compendium col.2012.27.2.883
of soil fungi. Vol.1. Academic Press. London, UK. 860p. OIC. 2015. Informe sobre el brote de la roya del café en Cen-
Escamilla PE. 2016. Boletín informativo: Políticas públicas. troamérica y Plan de acción para combatirla. Organi-
Las variedades de Café en México ante el desafío de la zación Internacional del Café. Disponible en línea: http://
Roya. Inédito. Disponible en línea: [Link] [Link]
pmc/descargas/proyectos/redd/Breves_de_Politicas_Pu- Rolz AC, De León LR y Paniagua O. 2013. Evidencia de un
blicas_No.4-Variedades_de_cafe_en_Mexico.pdf antagonismo in vitro de especies de Trichoderma contra
Eskes AB, Mendes MD and Robbs CF. 1991. Laboratory and Hemileia vastatrix (roya del café). Centro de Ingeniería
field studies on parasitism of Hemileia vastatrix with Ver- Bioquímica, Instituto de Investigaciones. Universidad
ticillium lecanii and V. leptobactrum. Café-Cacao-Thé, del Valle de Guatemala. Revista 25 de la Universidad del
35:275-282. Valle de Guatemala. Disponible en línea: [Link]
Gauthuier WN, Maruthachalam K, Subbarao VK, Browm gt/publicaciones/revista/volumenes/numero25/8_eviden-
M, Xiao Y, Robertson L and Schneider WR. 2014. cia%20de%[Link]

Publicación en línea, enero 2018 182

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Sandoval S y López OM. 2001. Hiperparasitismo de Tricho- Spencer DM and Atkey PT. 1981. Parasitic effects of Vertici-
derma harzianum, T. viridae y T. pseudokoningii sobre llium lecanii on two Rust fungi. Transactions of the British
diferentes hongos fitopatógenos. Revista de Fitosanidad, Mycological Society. 77:535-542. [Link]
5:41-44. Instituto de Investigaciones de Sanidad Vegetal. S0007-1536(81)80101-5
Playa, Ciudad La Habana, Cuba. Disponible en línea: Zambolim L, Vale FXR, Pereira A e Chaves G. 1997. Café
[Link] (Coffea arabica L.), Controle de Doenças. In: Vale FXR,
Servicio Meteorológico Nacional. (2000). Normales climato- Zambolim L. (eds.). Controle de Doenças de Plantas:
lógicas. Disponible en línea: [Link] Grandes Culturas, vol. 1. Suprema Gráfica e Editora, Vis-
Schieber E. 1972. Economic impact of coffee rust in Latin conde do Rio Branco, Brasil. 83-40 pp.
America. Annual Review of Phytopathology 10:491-510. Zare R and Gams W. 2001. A revision of Verticillium section
[Link] Prostata. IV. The genera Lecanicillium and Simplicillium
Shyang CR, Huang CC, Li CJ and Tsay GJ. 2017. Evaluation gen. Nov. Nova Hedwigia 73:1-50. DOI: 10.1127/nova.
of characteristics of Simplicillium lanosoniveum on patho- hedwigia/71/2001/1
genicity to aphids and in vitro antifungal potency against Zare R, Gams W and Culham A. 2000. A revision of Verticillium
plant pathogenic fungi. International Journal of Environ- sect. Prostata I. Phylogenetic studies using ITS sequences.
mental & Agriculture Research 3:55-61. Disponible en lí- Nova Hedwigia 71:465-480. Disponible en línea: https://
nea: [Link] [Link]/cabdirect/abstract/20023073040
[Link] Zare R, Gams W and Culham A. 2000. A revision of Verticillium
sect. Prostata I. Phylogenetic studies using ITS sequences.
Nova Hedwigia 71:465-480. Disponible en línea: https://
[Link]/cabdirect/abstract/20023073040

Publicación en línea, enero 2018 183

 Morphological and molecular identification of
Mortierella species associated to rhizosphere of
apple trees with symptoms of root diseases

Identificación morfológica y molecular de especies de Mortierella

asociados a rizosfera de manzanos con síntomas de
enfermedades radiculares

Yericka Mares-Ponce de León, Laila Nayzzel Muñoz-Castellanos, Universidad Autónoma de Chihuahua,

Facultad de Ciencias Químicas, Campus Universitario #2, Circuito Universitario, Chihuahua. CP. 31125, Chi-
huahua, Chihuahua, México; María Fernanda Ruiz-Cisneros, Daniel Alonso Pérez-Corral, José de Jesús
Ornelas-Paz, Carlos Horacio Acosta-Muñiz, David Ignacio Berlanga-Reyes, Claudio Rios-Velasco*, Cen-
tro de Investigación en Alimentación y Desarrollo, A.C., Campus Cuauhtémoc. Avenida Río Conchos S/N.
Parque Industrial, CP. 31570, Cuauhtémoc, Chihuahua, México. *Autor para correspondencia: [Link]@
[Link].

Recibido: 09 de Octubre, 2017. Aceptado: 13 de Diciembre, 2017.

Mares-Ponce de León Y, Muñoz-Castellanos LN, Ruiz- Abstract. Mortierella species were isolated on
Cisneros MF, Pérez-Corral DA, Ornelas-Paz JJ, Acosta- Potato Dextrose Agar and V8-agar as well as mature
Muñiz CH, Berlanga-Reyes DI, Rios-Velasco C. 2017. pear fruits and azalea leaves as substrate baits.
Morphological and molecular identification of Mortiere-
Four hundred and nineteen Mortierella isolates
lla species associated to rhizosphere of apple trees with
were obtained from soil samples in Chihuahua,
symptoms of root diseases. Revista Mexicana de Fitopa-
Mexico which were classified into 21 groups,
tología 36(1): 184-195.
DOI: 10.18781/[Link].1710-2 according to their morphological characters.
Mortierella was isolated more frequently when
Primera publicación DOI: 27 de Diciembre, 2017. pear fruits were used, obtaining 143 isolates
First DOI publication: December 27, 2017. (34.1%), followed by the V8-agar-antibiotics
medium with 133 isolates (31.7%), and azalea
leaves with 95 isolates (22.7%). An isolate from
Resumen. Se aislaron especies de Mortierella en each of the 21 groups was identified molecularly,
Agar Dextrosa Papa y agar V8, así como peras ma- 12 corresponded to Mortierella alpina, one to M.
duras y hojas de azalea, como sustratos trampa. Se gamsii, one to M. capitata, and six to Mortierella
obtuvieron 419 aislados de Mortierella, de mues-
sp., and one belonged to the Mortierelliales order.
tras de suelo en Chihuahua, México, los cuales se
In addition, the putative pathogenicity of the 21
clasificaron en 21 grupos de acuerdo con sus carac-
Mortierella isolates identified was tested in G30
teres morfológicos. Mortierella se aisló con mayor

Publicación en línea, enero 2018 184

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

frecuencia cuando se emplearon peras, obteniendo apple rootstocks under greenhouse conditions and
143 aislados (34.1%), seguido del agar V8-antibió- none was pathogenic. These species have not been
ticos con 133 aislados (31.7%) y las hojas de aza- reported previously in Mexico. The study showed
lea, con 95 aislados (22.7%). Se identificó molecu- that there are Mortierella species in the rhizosphere
larmente un aislado de cada uno de los 21 grupos, of apple trees in Chihuahua Mexico. These fungal
12 correspondieron a Mortierella alpina, uno a M. isolates might produce polyunsaturated fatty acids
gamsii, uno a M. capitata y seis a Mortierella sp. and exert effects of elicitation in horticultural
y uno perteneció al orden Mortierelliales. Adicio- plants and fruit trees improving their resistance to
nalmente se probó la patogenicidad putativa de los multiple pathogens.
21 aislados de Mortierella identificados, en porta
injertos de manzana G30 bajo condiciones de in- Key words: Mortierellales, diversity, substrate
vernadero y ninguno fue patogénico. Estas especies baits, isolation medium, pathogenicity.
no habían sido reportadas previamente en México.
El estudio demostró que existen especies de Mor-
tierella en la rizosfera de manzanos en Chihuahua, It has been estimated that only 5% of the existing
México. Estas podrían producir ácidos grasos po- fungi species have been recorded and described
liinsaturados y ejercer efectos elicitores en cultivos (Hawksworth, 2001). The Mortierellales is one
hortofrutícolas confiriéndoles resistencia a múlti- of the most abundant and diverse orders of basal
ples patógenos. fungi, with nearly 100 species described into 13
genera of the Mortierellaceae family (Yadav et al.,
Palabras clave: Mortierellales, diversidad, sustra- 2014), in which the Mortierella genus is located.
tos trampa, medio de aislamiento, patogenicidad. Most of species of this genus are able to produce
polyunsaturated fatty acids (PUFAs) by converting
excess of sugars and other carbon sources into lipids
Se estima que solo un 5% de las especies fún- under different fermentation conditions (Rayaroth
gicas existentes han sido registradas y descritas et al., 2016). Several studies have shown that
(Hawksworth, 2001). Mortierelliales es uno de los some Mortierella species are able to accumulate
órdenes más abundantes y diversos de los hongos arachidonic, γ-linolenic, eicosapentaenoic and
basales y hay cerca de 100 especies descritas en docosahexaenoic acids in the mycelium (Ho et al.,
13 géneros de la familia Mortierellaceae (Yadav 2007; Dedyukhina et al., 2014). These compounds
et al., 2014), género al cual corresponde el hon- are involved in induction of resistance to
go Mortierella. La mayoría de las especies de este phytopathogens in plants of agricultural importance
género producen ácidos grasos poliinsaturados (Zlotek and Wojcik, 2014). Additionally, these
(PUFA) al convertir el exceso de azúcares y otras PUFAs are widely used as food supplements and
fuentes de carbón en lípidos bajo diferentes con- drugs to improve the immune response in humans,
diciones de fermentación (Rayaroth et al., 2016). giving technological importance to the Mortierella
En varios estudios se ha demostrado que algunas genus as an alternative source of these compounds
especies de Mortierella pueden acumular ácidos (Dedyukhina et al., 2014). However, existing
araquidónico, gamma-linolénico, eicosapentae- information about the diversity of Mortierellales
noico y docosahexaenoico en el micelio (Ho et al., is limited or out of date. The identification of

Publicación en línea, enero 2018 185

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

2007; Dedyukhina et al., 2014). Estos compuestos Mortierella species has mainly been based on
están involucrados en la inducción de resistencia morphological characters (Watanabe, 2010).
a fitopatógenos en plantas de importancia agrícola Besides, the identity of species of this fungi by
(Zlotek and Wojcik, 2014). Asimismo, estos PUFA molecular techniques has received little attention,
son ampliamente utilizados como suplementos especially in México, where currently there is a high
alimenticios y fármacos que mejoran la respuesta interest to find out antagonistic microorganisms
inmunológica en los seres humanos, lo cual con- to control phytopathogens. Thus, the aim of the
fiere importancia tecnológica al género Mortierella study was to isolate and identify native Mortierella
como fuente alternativa de dichos compuestos (De- species associated to apple trees with apparent
dyukhina et al., 2014). Sin embargo, existe infor- symptoms of root diseases.
mación escasa u obsoleta acerca de la diversidad de Three apple orchards (Malus x domestica
los Mortierellales. La identificación de las especies Borkh. Rosales: Rosaceae) were sampled from June
de Mortierella se ha basado principalmente en sus through July of 2015 in the four most important
caracteres morfológicos (Watanabe, 2010). Ade- apple-producing areas: Cuauhtémoc, Guerrero,
más, la identidad de las especies de estos hongos Bachiniva and Namiquipa, Chihuahua, Mexico
mediante técnicas moleculares ha recibido poca (Table 1). Soil samples (500-600 g) were collected
atención, sobre todo en México, donde actualmente from the rhizosphere of five trees with apparent
existe un gran interés por encontrar microorganis- symptoms of root diseases caused by fungi and
mos antagónicos para el control de fitopatógenos. Oomycetes in each orchard (Ruiz-Cisneros et al.,
Por tanto, el objetivo del presente estudio fue aislar 2017).
e identificar especies nativas de Mortierella asocia- Two culture media (Potato Dextrose Agar and
das con manzanos con síntomas aparentes de enfer- V8-agar) were used for the isolation of Mortierella
medades radiculares. strains. The potato-dextrose-agar (PDA; BD
De junio a julio de 2015, se muestrearon tres Bioxon) and V8-agar [V8 juice, calcium carbonate
huertas de manzanos (Malus x domestica Borkh. (CaCO3) - agar], media contained antibiotics
Rosales: Rosaceae) en las cuatro zonas productoras [oxytetracycline, 0.01 g/L; rifampicin, 0.03 g/L;
de manzana más importantes: Cuauhtémoc, Gue- piramicin, 0.01 g/L, and 66.8 µL/L of the fungicidal
rrero, Bachiniva y Namiquipa, Chihuahua, Méxi- hymexazol formulated (Summit Agro, México].
co (Cuadro 1). Se recolectaron muestras de suelo The isolation of Mortierella strains on V8-agar
(500-600 g) de la rizosfera de cinco árboles con was performed with and without pear fruits (Pyrus
síntomas aparentes de enfermedades radiculares communis L.) and azalea leaves (Rhododendron
causadas por hongos y oomicetos en cada huerto simsii Planch.) as bait substrates. For isolation on
(Ruiz-Cisneros et al., 2017). PDA and V8-agar without bait substrates, serial
Para aislar las cepas de Mortierella se utilizaron dilutions (1:10) were performed in test tubes
dos medios de cultivo (Agar Dextrosa Papa y agar containing 9 mL of sterile peptone water (0.1%
V8). Los medios agar-dextrosa-papa (PDA; BD peptone and 0.85% NaCl in distilled water) by
Bioxon) y agar V8 [jugo V8, carbonato de calcio adding 1 g of soil previously sieved, to generate
(CaCO3) - agar] contenían antibióticos [oxitetraci- 103, 104 and 105 dilutions. Aliquots (50 µL) of each
clina, 0.01 g/L; rifampicina, 0.03 g/L; pimaricina, suspension were spread in triplicate on 90-mm
0.01 g/L, y 66.8 µL/L de un formulado fungicida Petri dishes containing one of the two media,

Publicación en línea, enero 2018 186

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cuadro 1. Localidad donde se recolectaron muestras de suelo rizosférico en huer-

tos de manzana en Chihuahua, México, en 2015.
Table 1. Location of apple orchards where samples of rhizosphere soil were
collected in Chihuahua, Mexico, in 2015.

Localidad Huerto Localización geográfica Altitud

Campo 2A N28°26’40”; O106°59’18” 2,130

Cuauhtémoc Campana 4 ½ N28°33’49”; O106°54’24” 1,995
Picacho N28°29’28”; O 106°40’08” 2,020
Alberto Gameros N28°31’58”; O 107°26’57” 2,096
Guerrero Alberto Gameros PIG30 N28°31’58”; O 107°26’57” 2,096
Efraín Sandoval N28º32’59”; O 107º27’10” 2,099
Carlos Márquez N29°11’20”; O 107°25’14” 1,877
Namiquipa San Rafael N29°12’19”; O 107°25’22” 1,858
El Terrero N29°18’84”; O107°44’21” 2,037
La Cienega N28°46’52”; O 107°15’21” 2,009
Bachiniva Santa Rosa N28°50’17”; O 107°14’12” 1,989
Los 40 N28°48’07”; O 107°16’06” 1,990

con hymexazol (Summit Agro, México]. El aisla- using a diffusion technique. The Petri dishes were
miento de cepas de Mortierella en agar V8 se llevó subsequently incubated at 28 ± 1 °C for 72 h in
a cabo con y sin frutos de pera (Pyrus communis L.) an environmental chamber without light (Precision
y hojas de azalea (Rhododendron simsii Planch.) Scientific, Winchester, VA, USA). For isolation
como sustratos trampa. Para el aislamiento en PDA of Mortierella strains using pear fruits as bait
y agar V8 sin sustratos trampa, se prepararon dilu- substrate, 200-250 g of moistened soil were placed
ciones seriadas (1:10) en tubos de ensayo con 9 mL in 1 L plastic cups with a lid, containing one pear
de agua estéril de peptona (peptona al 0.1% y NaCl that had been previously washed with 1.5% NaClO
al 0.85% en agua destilada), a las que se agregó 1 for 1 min. The cups were incubated at 26 ± 1 °C
g de suelo previamente tamizado para generar di- in darkness for 72 h. Then, the fruits were rinsed
luciones de 103, 104 y 105. Utilizando la técnica de three times with sterile distilled water and dried on
difusión, las alícuotas (50 µL) de cada suspensión sterile brown paper in a biosafety hood (Envirco
se distribuyeron por triplicado en cajas de Petri de Corporation, Albuquerque, USA). The fruits were
90 mm que contenían uno de los medios. Posterior- individually incubated at 26 ± 1 °C for 48 h. Three
mente, las cajas de Petri se incubaron a 28 ± 1 °C sections (5 mm2) of damaged epidermis (transition
por 72 h en una cámara ambiental sin luz (Precision zone) or mycelium-containing epidermis, were
Scientific, Winchester, VA, EUA). Para aislar las excised from the fruit and placed on Petri dishes
cepas de Mortierella utilizando frutos de pera como containing V8-agar with antibiotics. The dishes
sustrato trampa, se colocaron 200-250 g de suelo were incubated at 26 ± 1 °C for 72 h. For the
húmedo en vasos de plástico de 1 L con tapa que isolation using azalea leaves as bait substrate, fresh
contenían una pera previamente lavada con NaClO young leaves were treated in the same way than
al 1.5% por 1 min. Los vasos fueron incubados a 26 pear fruits. The leaves were cut in circles of 5 mm
± 1 °C en oscuridad por 72 h. En seguida, los frutos of diameter. The circles were placed on Petri dishes
se enjuagaron tres veces con agua destilada estéril (60 × 15 mm) containing 10-15 g of moistened

Publicación en línea, enero 2018 187

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

y se secaron en papel de estraza en una campana soil and incubated at room temperature for 24 h.
de bioseguridad (Envirco Corporation, Albuquer- The leaf circles were removed, washed with sterile
que, EUA). Los frutos fueron incubados de manera distilled water and dried on sterile brown paper.
individual a 26 ± 1 °C por 48 h. Se extirparon tres Leaf circles were placed in the four cardinal points
secciones (5 mm2) de la epidermis dañada del fruto and center of Petri dishes containing V8-agar with
(zona de transición), o de la epidermis con mice- antibiotics and incubated at 28 ± 1 °C for 72 h.
lio, y se colocaron en cajas de Petri que contenían These experiments were performed in triplicate.
agar V8 con antibióticos. Las cajas se incubaron The colonies with typical morphology of
a 26 ± 1 °C por 72 h. Para el aislamiento con ho- Mortierella were isolated and purified on V8-
jas de azalea como sustrato trampa, se utilizaron agar or PDA medium without antibiotics, using
hojas jóvenes y frescas que fueron sometidas al a monosporic culture technique followed by
mismo tratamiento que los frutos de pera. Las ho- incubation at 28 ± 1 °C, without light for 120 h.
jas se cortaron en círculos de 5 mm de diámetro. Putative Mortierellales isolates were grouped
Los círculos se colocaron en cajas de Petri (60 × according to their macroscopic morphological
15 mm) que contenían 10-15 g de suelo húmedo y characters and then an isolate of each group was
se incubaron a temperatura ambiente por 24 h. Los taken for identification (Watanabe, 2010) according
círculos de las hojas se desprendieron de la caja, se to its microscopic characters seen at an optical
lavaron con agua destilada estéril y se secaron en microscope (Carl Zeiss, Germany).
papel de estraza. Los círculos se colocaron en los Genomic DNA (gDNA) was extracted according
cuatro puntos cardinales y en el centro de las cajas to Raeder and Broda (1985) and Ruiz-Cisneros et
de Petri que contenían agar V8 con antibióticos y se al. (2017). This gDNA was used to amplify the
incubaron a 28 ± 1 °C por 72 h. Estos experimentos internal transcribed spacer (ITS) region of 18S
se hicieron por triplicado. rDNA gene using the universal primers ITS5 (5’–
Las colonias con morfología típica de Mortie- GGAAGTAAAAGTCGTAACAAGG–3’) and
rella se aislaron y purificaron en los medios agar ITS4 (5’–TCCTCCGCTTATTGATATGC–3’)
V8 o PDA sin antibióticos, aplicando la técnica de (White et al., 1990). The amplification was
cultivo monospórico, y se incubaron a 28 ± 1 °C sin performed according to the methodology described
luz por 120 h. by Ruiz-Cisneros et al. (2017). The PCR products
Los aislados putativos de Mortierellales fueron were examined by electrophoresis on a 1% agarose
agrupados según sus caracteres morfológicos ma- gel. Subsequently, these products were sequenced
croscópicos y después se tomó un aislado de cada at Macrogen Company (Rockville, MD, USA).
grupo para su identificación (Watanabe, 2010), de The obtained sequences were compared against
acuerdo con los caracteres microscópicos obser- the NCBI database using the BLAST algorithm
vados en un microscopio óptico (Carl Zeiss, Ger- (Altschul et al., 1990) to verify the percent
many). identity corresponding to the analyzed species.
La extracción de ADN genómico (ADNg) se Additionally, a phylogenetic tree by maximum
realizó de acuerdo con el método de Raeder y Broda likelihood method, to observe the grouping of
(1985) y Ruiz-Cisneros et al. (2017). El ADNg se Mortierellales fungi was constructed, using Mega
utilizó para amplificar la región espaciadora interna software version 6.0 (Tamura et al., 2013).

Publicación en línea, enero 2018 188

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

transcrita (ITS) del gen 18S ADNr con iniciadores The pathogenicity of 21 Mortierella strains was
universales ITS5 (5’–GGAAGTAAAAGTCGTA- tested in G30 apple rootstocks (one of the most
ACAAGG–3’) e ITS4 (5’–TCCTCCGCTTATT- planted in Mexico) under greenhouse conditions,
GATATGC–3’) (White et al., 1990). La amplifica- according to Ruiz-Cisneros et al. (2017) with
ción se llevó a cabo de acuerdo a la metodología modifications. Ten G30 rootstocks (1 year old) were
descrita por Ruiz-Cisneros et al. (2017). Los pro- tested for each Mortierella strain, along with ten
ductos de PCR fueron examinados por electro- control trees (without inoculum). Two months after
foresis en gel de agarosa al 1%. Posteriormente, planting, each tree was inoculated with 10 mL of
los productos fueron secuenciados por Macrogen unquantified Mortierella inoculum. The inoculum
Company (Rockville, MD, EUA). Las secuencias was 6-7 d old, grown in vegetable broth V8 [V8
obtenidas se compararon con la base de datos del juice (Campbell’s™) and calcium carbonate
NCBI mediante el algoritmo de BLAST (Altschul (CaCO3)] and maintained at 28 °C with constant
et al., 1990) para verificar el porcentaje de iden- orbital shaking at 140 rpm (Orbit 1900, Labnet
tidad correspondiente a las especies analizadas. International Inc.). Subsequently, the inoculated
Además, se construyó un árbol filogenético, por el rootstocks were maintained for another two months
método de máxima verosimilitud, a fin de observar under greenhouse conditions and during this time
el agrupamiento de los hongos Mortierellales, para were monitored weekly.
lo cual se utilizó el software Mega versión 6.0 (Ta- Four hundred and nineteen Mortierella isolates
mura et al., 2013). were obtained from tested soil samples (Table 1,
La patogenicidad de los 21 aislados de Mortie- Figure 1a-b). The use of pear fruits as bait substrate
rella se probó en porta injertos de manzana G30 allowed to obtain the highest number of isolates
(una de las que más se producen en México) en (143 isolates, 34.1%), followed by the V8-agar-
condiciones de invernadero, según el método de antibiotics medium (133 isolates, 31.7%) and the
Ruiz-Cisneros et al. (2017) con modificaciones. Se method involving leaves of azalea as bait substrate
evaluaron 10 porta injertos G30 (de 1 año de edad) (95 isolates, 22.7%). The least effective isolation
por cada aislado de Mortierella, junto con diez ár- method was the PDA-antibiotics medium (48
boles de testigo (sin inóculo). Dos meses después isolates, 11.5%) (Figure 1a). The high number of
de la plantación, cada árbol fue inoculado con 10 isolated microorganisms using pear fruits might be
mL de inóculo de Mortierella no cuantificado. El consequence of a higher contact area of this fruits
inóculo, de 6-7 días de edad, se sembró en jugo de with soil, and longer exposure. Azalea leaves and
verduras V8 [jugo V8 (Campbell’s™) y carbonato mature fruits have been used as bait substrates
de calcio (CaCO3)], y se mantuvo a 28 °C con agi- to isolate other microorganisms with favorable
tación orbital constante a 140 rpm (Orbit 1900, La- results. In contrast to our results, Yadav et al.
bnet International Inc.). Posteriormente, los porta (2014) efficiently isolated Mortierella alpina on
injertos inoculados se mantuvieron dos meses más PDA medium.
en condiciones de invernadero y durante este perio- The number of Mortierella isolates obtained
do fueron monitoreados cada semana. from each region is shown in Figure 1b. The highest
Se obtuvieron 119 aislados de Mortierella de number of isolates (136, 32%) was obtained from
las muestras de suelo evaluadas (Cuadro 1, Figu- the Cuauhtémoc area. Webster and Weber (2007)
ra 1a-b). El uso de frutos de pera como sustrato demonstrated that the isolation frequency for each

Publicación en línea, enero 2018 189

 Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

160 160
143 a b
133 136
Number of isolates by sustrate

140

Number of isolates by sustrate

140
120 120 109 104
100 95 100
80 80 70
60 48 60
40 40
20 20
0 0
Pear fruits V8-Agar Azalea PDA Cuauthemoc Guerrero Bachiniva Namiquipa
medium leaves medium Localities
Substrates

Figura 1. Aislados de Mortierella asociados con la rizosfera de manzanos enfermos en cuatro de las principales localidades
productoras de manzana en el estado de Chihuahua, México; a) número de aislados obtenidos por sustrato; b)
número de aislados obtenidos por localidad.
Figure 1. Mortierella isolates associated to diseased apple trees rhizosphere in four main producing localities of Chihuahua
State, Mexico; a) number of isolates obtained by substrate; b) number of isolates obtained by locality.

trampa nos permitió obtener el mayor número de fungus is highly variable, depending on the isolation
aislados (143 aislados, 34.1%), seguido del medio method, culture medium, temperature and other
de V8-agar-antibióticos (133 aislados, 31.7%) y del factors during processing of samples. The evident
método en que se utilizaron hojas de azalea como variation in abundance of Mortierella in tested
sustrato trampa (95 aislados, 22.7%). El método orchards might be due to multiple factors such as
menos eficaz de aislamiento fue el medio de PDA- the geographical location, soil type, rootstock type,
antibióticos (48 aislados, 11.5%) (Figura 1a). El age of trees, climatic conditions, technification
alto número de microorganismos aislados utilizan- level, organic matter content, existent vegetation,
do frutos de pera pudo haber sido consecuencia de among other factors. Bosso et al. (2017) found
una mayor área de contacto de los frutos con el sue- Mortierella species in soils with different uses and
lo y de una exposición más prolongada. Las hojas they attributed the high presence of Mortierella to
de azalea y frutos maduros de pera se han utilizado the possible control of phytopathogens, since this
como sustratos trampa para aislar otros organismos genus may have disease suppressive properties
con resultados favorables. A diferencia de nuestros (Dedyukhina et al., 2014; Zlotek and Wojcik,
resultados, Yadav et al. (2014) aislaron Mortierella 2014).
alpina en el medio PDA de manera eficiente. Four hundred and nineteen Mortierellales
El número de aislados de Mortierella que se ob- isolates were differentiated and identified according
tuvo en cada región se muestra en la Figura 1b. El to their macro- and microscopic distinctive
mayor número de aislados (136, 32%) se obtuvo en characters, such as the flower-shaped radial
la región de Cuauhtémoc. Webster y Weber (2007) growth of young colonies of white color (Figure
demostraron que la frecuencia de aislamiento de 2). However, some of these colonies turned yellow

Publicación en línea, enero 2018 190

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

cada hongo varía mucho, dependiendo del método when they grew up. The mycelium of the isolates
de aislamiento, el medio de cultivo, la temperatu- was hyaline and coenocytic but some hyphae
ra y otros factores durante el procesamiento de las became septated as they aged (Watanabe, 2010).
muestras. La evidente variación en la abundancia In addition, the microscopic structures typical of
de Mortierella en los huertos evaluados podría ser asexual reproduction of this genus were observed,
resultado de múltiples factores, como la ubicación besides, the resistance structures as catenulate and
geográfica, el tipo de suelo, el tipo de porta injertos, intercalary chlamydospores, were also observed in
la edad de los árboles, las condiciones climáticas, most of the isolates (Figure 2, Table 2; Watanabe,
el nivel de tecnificación, el contenido de materia 2010). Sexual reproductive structures such as
orgánica, la vegetación existente, entre otros. Bos- zygospores, were absent in the isolates. Park et
so et al. (2017) encontraron especies de Mortierella al. (2001) demonstrated that this structure type is
en suelo con diferentes usos y atribuyeron la alta uncommon and often surrounded by coenocytic
presencia de Mortierella al posible control de fito- mycelia and that the morphological changes of
patógenos, ya que este género podría tener propie- Mortierella, were dependent on culture conditions
dades supresoras de enfermedades (Dedyukhina et and strain genotype.
al., 2014; Zlotek y Wojcik, 2014). gDNA fragments obtained after amplification of
Se diferenciaron e identificaron 419 aislados the fungal samples, with ITS4 and ITS5 primers,
de Mortierellales, de acuerdo con sus caracteres showed high homogeneity. According to the
macro- y microscópicos distintivos, como el cre- morphological characters and sequences obtained
cimiento radial en forma de flor de las colonias jó- from the PCR products, 12 of the 21 Mortierellales
venes de color blanco (Figura 2). Sin embargo, al isolates belonged to Mortierella alpina, six to
crecer, algunas de las colonias cambiaron de color Mortierella sp., one to Mortierella gamsii, one to
blanco a amarillo. El micelio de los aislados era Mortierella capitata and one to the Mortierellales
hialino y cenocítico, pero en algunas, se observó order (Figure 3). All isolates had 99-100% identity
la presencia de hifas septadas conforme madura- and a maximum similarity with the molecular
ban (Watanabe, 2010). Se observaron también es- scores and taxonomic keys, corresponding to each
tructuras microscópicas típicas de la reproducción strain and according to the sequences available
asexual de este género, lo mismo que estructuras de in the GenBank database (NCBI) (Altschul et
resistencia en forma de clamidosporas catenuladas al., 1990). Melo et al. (2014) found M. alpina
e intercalares en la mayoría de los aislados (Figura from tissues of the antarctic moss Schistidium
2, Cuadro 2; Watanabe, 2010). No se observaron antarctici, demonstrating that Mortierella can be
estructuras de reproducción sexual como cigospo- found in high frequency. These differences could
ras. Park et al. (2001) demostraron que este tipo de be due to the sampling source, since in our study,
estructura es poco común y suele estar rodeada de soil samples were taken from agroecosystems
micelio cenocítico, y que los cambios morfológicos disturbed by anthropogenic activities, mainly by
de Mortierella dependen de las condiciones de cul- intensive use of pesticides for agricultural pests and
tivo y del genotipo del aislado. diseases management. Nicola et al. (2017) found
Los fragmentos de ADNg obtenidos después de that Mortierella is a fungus that is usually found
la amplificación de las muestras del hongo, con colonizing plant roots and is normally associated
los iniciadores ITS4 e ITS5, mostraron mayor with apple replant diseases. In our study, this

Publicación en línea, enero 2018 191

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

Figure 2. Morfología de Mortierella spp., a-c) características macroscópicas de M. alpina, M. alpina y Mortierella sp. sem-
bradas en un medio de cultivo PDA; d-f) caracteres microscópicos, d) esporangiosporas hialinas y ovaladas, e)
clamidospora intercalar, f) esporangios terminales.
Figure 2. Morphology of Mortierella spp., a-c) macroscopic characteristics grown of M. alpina, M. alpina and Mortierella
sp. on PDA culture medium; d-f) microscopic characters, d) sporangiospores hyaline and ovoid, e) intercalary
chlamydospore, f) terminal sporangia.

homogeneidad. De acuerdo con los caracteres replanting process was detected in some sampled
morfológicos y las secuencias obtenidas de los orchards.
productos de PCR, se determinó que 12 de los 21 The maximum likelihood tree showed
aislados de Mortierellales pertenecían a Mortiere- genetic differences between Mortierella isolates.
lla alpina, seis a Mortierella sp., uno a Mortierella According to O’Donnell et al. (2001), some
gamsii, uno a Mortierella capitata y uno al orden genera and even some species of the Mucorales
de los Mortierellales (Figura 3). Todos los aislados order are polyphyletic, as can be observed in the
mostraron de 99 a 100% de identidad y máxima phylogenetic tree obtained from the different
verosimilitud con las puntuaciones moleculares y isolates. Mortierellales isolates were not
las claves taxonómicas, que corresponden a cada pathogenic to apple rootstocks G30. Bosso et al.
aislado y según las secuencias disponibles en la (2017) demonstrated that these fungi species can
base de datos del GenBank (NCBI) (Altschul et al., be considered antagonistic due to the ability to
1990). Melo et al. (2014) encontraron M. alpina en produce different substances which can help in the
tejidos de musgo antártico Schistidium antarctici, defense of plants, as systemic resistance inducer.
y demostraron que la presencia de Mortierella es There are several Mortierella species associated
muy frecuente. Estas diferencias podrían derivar- to the rhizosphere of apple trees with apparent
se de la fuente de las muestras, ya que, en nuestro symptoms of root diseases in Chihuahua. The most

Publicación en línea, enero 2018 192

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

Cuadro 2. Principales caracteres microscópicos de aislados de Mortierella asociados con la rizosfera de manzanos enfermos
en el estado de Chihuahua, México.
Table 2. Main microscopic characters of Mortierella isolates associated to diseased apple trees rhizosphere in Chihuahua
State, Mexico.

Código del Forma de los Tamaño Esporangióforo Clamidospora Esporangiosporas

Identificación molecular esporangios (µm)
aislado (µm) (µm) (forma)

G11 Mortierella sp. (TR065) Ovalado 5 43 Ausente

G3-2 M. alpina (FCF20120803) Esférico 5 50 Intercalar (5-10)
G17 M. alpina (ATT234) Esférico 5-7 35-50 Intercalar (5)
G18 M. alpina (C051D16) Ovalado 10 50 Intercalar (5-7)
G21 Mortierella sp. (FMR13-4) Ovalado 8-12 20 Intercalar (5)
G26 Mortierella sp. (MEL2385001) Esférico 5-10 40-55 Catenulada (7-10)
G29-1 M. alpina C08ID17 Esférico 10-15 30-50 Intercalar (7-10)
G61 M. alpina MUT: 5194 Ovalado 5-7 20-30 Intercalar (5)
G31 M. alpina strain xds08088 Esférico 5-10 50-60 Ausente
G12 M. alpina voucher RIFA 12B Esférico 10-7 40-70 Intercalar (8-10)
G54 M. alpina A03ID2 Esférico 10-7 30-50 Intercalar (5-7) Ovalada
G52 M. alpina ATCC16266 Esférico 7-10 30-50 Intercalar (5-7)
G14 M. alpina A01ID1 Ovalado 5-10 40-50 Ausente Ovalada
G44 Mortierella sp. FMR23-12 Esférico 10-15 30-40 Intercalar (5-10)
G16 M. gamsii aurium 1205 Esférico 5-10 20-40 Intercalar (7-10)
G2 Uncultured Mortierellales Esférico 5-10 30-50 Intercalar (5-10) Ovalada
G9 Mortierella sp. 11MA04 Esférico 5-10 20-40 Intercalar (7-10)
G25 M. capitata Ovalado 10 30-40 Catenulada (5-7)
G32 Mortierella sp. (FMR23-12) Esférico 5 40-50 Intercalar (5-10)
G35 Mortierella sp. F0210-20S2 Esférico 7-10 40-50 Intercalar (10-15)
G43 Mortierella sp. SD006 Ovalado 8-10 30-40 Ausente

estudio, las muestras de suelo fueron recolectadas efficient method for the isolation of Mortierella
en agroecosistemas disturbados por actividades an- involved the use of pear fruits as bait substrate.
tropogénicas, principalmente por el uso intensivo
End of the English version
de plaguicidas para el control de plagas agrícolas
y el manejo de enfermedades. Nicola et al. (2017)
descubrieron que Mortierella es un hongo que por
lo general coloniza las raíces de las plantas y que aislados de Mortierellales no fueron patogénicos
normalmente se le asocia con enfermedades de re- en los porta injertos de manzana G30. Bosso et al.
planteo de manzana. En nuestro estudio detectamos (2017) demostraron que estas especies de hongos
este proceso de replanteo en algunos huertos donde pueden ser consideradas antagonistas debido a su
recolectamos las muestras. capacidad de producir diferentes sustancias que
El árbol de máxima verosimilitud mostró dife- pueden ayudar en la defensa de las plantas como
rencias genéticas entre los aislados de Mortierella. inductores de resistencia sistémica.
Según O’Donnell et al. (2001), algunos géneros, e En Chihuahua existen varias especies de Mor-
incluso algunas especies, del orden Mucorales son tierella asociadas con la rizosfera de los manza-
polifiléticos, tal como se puede observar en el ár- nos que muestran síntomas aparentes de enfer-
bol filogenético de los diferentes aislados. Los medades radiculares. El método más eficaz para

Publicación en línea, enero 2018 193

Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology Fully Bilingual

96 G18 Mortierella alpina C051D16

50 G29-1 Mortierella alpina C081D17
G54 Mortierella alpina A031D2
50
G32 Mortierella sp. FMR13-7
G21 Mortierella sp. FMR13-4
G12 Mortierella alpina RIFA 12B
G31 Mortierella alpina xsd08088
51 G2 Uncultured Mortierellales
84 G43 Mortierella sp. SD006
G3-2 Mortierella alpina FCF20120803-49
G14 Mortierella alpina A01IDI
G17 Mortierella alpina ATT234
G61 Mortierella alpina MUT:5194
G35 Mortierella sp. F0210-20S2
G52 Mortierella alpina ATCC16266
G9 Mortierella sp. 11MA04
G25 Mortierella capitata
56 G16 Mortierella gamsii aurim1205
78 G11 Mortierella sp. TR-065
97 G26 Mortierella sp. MEL2385001
G44 Mortierella sp. FMR23-12
Y-24 Cunninghamella elegans xsd08061
0.1

Figura 3. Árbol de máxima verosimilitud de aislados de Mortierella obtenidos en la rizosfera de árboles de manzana en-
fermos en Chihuahua, México, con base en los resultados de BLAST utilizando las secuencias de la región ITS4
e ITS5 de cada aislado. La barra de escala representa las sustituciones de un nucleótido y los puntos de la rama
numérica indican valores de soporte como porcentaje con base en 1,000 repeticiones de bootstrap (se muestran
únicamente los valores > 50%).
Figure 3. Maximum likelihood tree of Mortierella isolates, obtained in diseased apple trees rhizosphere in Chihuahua, Mex-
ico, based on BLAST results from sequences of the ITS4 and ITS5 region of each isolate, the scale bar represents
one nucleotide substitutions and numbers branch points indicate values support as percentage based on 1,000
bootstrap replicates (only values > 50% are shown).

el aislamiento de Mortierella incluyó el uso de fru- in soil fungal communities across a land abandonment
tos de pera como sustrato trampa. gradient in a Mediterranean landscape. Acta Oecologica,
78:1-6. [Link]
Dedyukhina EG, Chistyakova TI, Mironov AA, Kamzolova
SV, Morgunov IG and Vainshtein MB. 2014. Arachidonic
acid synthesis from biodiesel-derived waste by Mortierella
LITERATURA CITADA alpina. European Journal of Lipid Science and Technolo-
gy, 116:429-437. [Link]
Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ. Hawksworth DL. 2001. The magnitude of fungal diversi-
1990. Basic local alignment search tool. Journal of Mo- ty: the 1.5 million species estimate revisited. Mycologi-
lecular Biology, 215:403-410. [Link] cal Research, 105:1422-1432. [Link]
S0022-2836(05)80360-2 S0953756201004725
Bosso L, Lacatena F, Varlese R, Nocerino S, Cristinzio G and Ho SY, Jiang Y and Chen F. 2007. Polyunsaturated fatty acids
Russo D. 2017. Plant pathogens but not antagonists change (PUFAs) content of the fungus Mortierella alpina isola-

Publicación en línea, enero 2018 194

 Revista Mexicana de FITOPATOLOGÍA
Fully Bilingual Mexican Journal of Phytopathology

ted from Soil. Journal of Agricultural of Food Chemistry, Ruiz-Cisneros MF, Rios-Velasco C, Berlanga-Reyes D.I,
55:3960-3966. [Link] Ornelas-Paz JJ, Acosta-Muñiz CH, Romo-Chacón A,
Melo IS, Santos SN, Rosa LH, Parma MM, Silva LJ, Quei- Zamudio-Flores PB, Pérez-Corral DA, Salas-Marina MÁ,
roz SCN and Pellizari VH. 2014. Isolation and biological Ibarra-Rendón JE, and Fernández-Pavía SP. 2017. Inciden-
activities of an endophytic Mortierella alpina strain from ce and causal agents of root diseases and its antagonists in
the antarctic moss Schistidium antarctici. Extremophiles, apple orchards of Chihuahua, Mexico. Revista Mexicana
18:15-23. [Link] de Fitopatología, 35:437-462. [Link]
Nicola L, Turco E, Albanese D, Donati C, Thalheimer M, Pin- [Link].1704-3
do M, Cavalieri ID and Pertot I. 2017. Fumigation with Tamura K, Glen S, Peterson D, Filipski A and Sudhir K. 2013.
dazomet modifies soil microbiota in apple orchards affec- MEGA6: Molecular evolutionary genetics analysis ver-
ted by replant disease. Applied Soil Ecology, 113:71-79. sion 6.0. Molecular Biology and Evolution, 30:2725-2729.
[Link] [Link]
O’Donnell KL, Lutzoni FM, Ward TJ and Benny GL. Watanabe T. 2010. Pictorial atlas of soil and seed fungi:
2001. Evolutionary relationships among Mucoralean Morphologies of cultured fungi and key to species (3rd
fungi (Zygomycota): Evidence for family polyphyly ed.):153-155. CRC Press.
on a large scale. Mycologia, 93:286-296. [Link] Webster J and Weber R. 2007. Introduction to fungi. Cam-
org/10.2307/3761650 bridge University PresWhite TJ, Bruns, T, Lee SB and
Park EY, Koike Y, Cai HJ, Higashiyama K and Fujikaya S. Taylor JW. 1990. Amplification and direct sequencing of
2001. Morphological diversity of Mortierella alpina: fungal ribosomal RNA genes for phylogenetics. In: Innis
Effect of consumed carbon to nitrogen ratio in flask cul- MA, Gelfand DH, Sninsky JJ and White TJ, Eds. PCR
ture. Biotechnology and Bioprocess Engineering, 6:161- protocols: A guide to methods and applications, Academic
166. [Link] Press, New York, 315-322. [Link]
Raeder U and Broda P. 1985. Rapid preparation of DNA from 0-12-372180-8.50042-1
filamentous fungi. Letters in Applied Microbiology, 1:17- Yadav DR, Kim SW, Babu AG, Adhikari M, Kim C, Lee HB
20. [Link] and Lee YS. 2014. First report of Mortierella alpina (Mor-
Rayaroth A, Tomar RS and Mishra RK. 2017. Arachidonic tierellaceae, Zygomycota) isolated from crop field soil in
acid synthesis in Mortierella alpina: Origin, evolution and Korea. Mycobiology, 42:401-404. [Link]
advancements. Proceedings of the National Academy of MYCO.2014.42.4.401
Sciences, India, Section B: Biological Sciences, 87:1053- Zlotek U and Wójcik W. 2014. Effect of arachidonic acid elici-
1066. [Link] tation on lettuce resistance towards Botrytis cinerea. Scien-
tia Horticulturae, 179:16-20. [Link]
scienta.2014.08.026

Publicación en línea, enero 2018 195