R M Fitopatología: Evista Exicana de
R M Fitopatología: Evista Exicana de
REVISTA MEXICANA DE
FITOPATOLOGÍA
MEXICAN JOURNAL OF PHYTOPATHOLOGY
Fully Bilingual
Portada: Zoospora de Phytophthora capsici germinada con y sin inoculación de Bacillus amyloliquefaciens y B. thu-
ringiensis. B, C y D, zoosporas afectadas por la actividad bacteriana.
Original: Raymundo Saúl García Estrada/Pág. 215-232.
Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology
Response of ten yellow mango cultivars to powdery mildew (Erysiphe quercicola) dama- 196
ge in Mexico * Respuesta de diez cultivares de mango amarillo al daño por cenicilla (Erysi-
phe quercicola) en México.
Pérez-Rodríguez A, Mora-Aguilera JA, De León-García de Alba C, Sandoval-Islas JS, Her-
nández-Castro E, Vásquez-López A.
Effect of biocontrol and germinative inhibition of Bacillus spp. on zoospores of Phyto- 215
phthora capsici * Efecto de biocontrol e inhibición germinativa de Bacillus spp. sobre zoos-
poras de Phytophthora capsici.
Ley-López N, Márquezera I, Carrillo-Fasio JA, León-Félix J, Cruz-Lachica I, García-Estrada
RS, Allende-Molar R.
Multilocus phylogenetic analysis of fungal complex associated with root rot watermelon 233
in Sonora, Mexico * Análisis filogenético multilocus del complejo fúngico asociado a pudri-
ción radicular de sandía en Sonora, México.
Rentería-Martínez ME, Guerra-Camacho MA, Ochoa-Meza A, Moreno-Salazar SF, Varela-
Romero A, Gutiérrez-Millán LE, Meza-Moller AC.
Effect of pH and temperature on the growth and antagonistic activity of Bacillus subtilis 256
on Rhizoctonia solani * Efecto del pH y temperatura sobre el crecimiento y actividad antagó-
nica de Bacillus subtilis sobre Rhizoctonia solani.
Jiménez-Delgadillo R, Valdés-Rodríguez SE, Olalde-Portugal V, Abraham-Juárez R, García-
Hernández JL.
Pathogenicity of Magnaporthe oryzae in varieties and wheat lines grown in Paraguay * 276
Patogenicidad de Magnaporthe oryzae en variedades y líneas de trigo cultivadas en Paraguay.
Chávez AR, Mohan-Kohli M.
Anatomic alterations and hyperplasia induced by Euphorbia mosaic virus Yucatan Pe- 287
ninsula isolate at the meshophyll * Alteraciones anatómicas e hiperplasia inducidas por
Euphorbia mosaic virus aislamiento Yucatán Península en el mesófilo.
Gamboa-Tec N, Kú-González A, Gutiérrez-Pacheco LC, Castaño E, López-Ochoa L.
Phytophthora capsici and P. drechsleri mating types A1 and A2 coexist in ornamental 298
nursery plants * Tipos de compatibilidad A1 y A2 de Phytophthora capsici y P. drechsleri
coexisten en plantas ornamentales de vivero.
Soto-Plancarte A, Fernández-Pavía SP, Rodríguez-Alvarado G, López-Pérez L, Fernández-
Pavía YL, Pedraza-Santos ME, Álvarez-Vargas JE.
Revista Mexicana de FITOPATOLOGÍA
Mexican Journal of Phytopathology
Organisms associated with damage to post-harvest potato tubers * Organismos asociados 308
a daños en tubérculos de papa en postcosecha.
García-Ávila CJ, Valenzuela-Tirado GA, FlorencioAnastasio JG, Ruiz-Galván I, Moreno-
Velázquez M, Hernández-Macías B, López-Buenfil JA, Bravo-Pérez D, Pineda-Ríos JM,
Quezada-Salinas A, Ávila-Quezada G.
Leafhoppers that carry begomoviruses on roselle crop (Hibiscus sabdariffa L.) * Cicadé- 321
lidos portadores de begomovirus en el cultivo de jamaica (Hibiscus sabdariffa L.)
Martínez-Cruz J, Ochoa-Martínez DL, Hernández-Morales J, Zamora-Macorra EJ, Ramírez-
Rojas S.
Diagramatic scale for quantification of rust severity in teak leaves * Escala diagramática 331
para cuantificación de la severidad de la roya en hojas de teca.
Cristiane-Delmadi L, Cristiane de Pieri, Sander-Porcena A, Luiz-Furtado E.
First Report of Colletotrichum spp. in fruits of allspice (Pimenta dioica) in Veracruz, 342
Mexico * Primer reporte del género Colletotrichum spp. en frutos de pimienta gorda (Pimenta
dioica) en Veracruz, México.
Velázquez-Silva A, García-Díaz SE, Robles-Yerena L, Nava-Díaz C, Nieto-Ángel D.
First report of Cladosporium cladosporioides, a fungus that causes rot in zapote mante 356
fruits in Mexico * Primer reporte de Cladosporium cladosporioides causando pudriciones en
frutos de zapote mante en México.
Nabor-Romero O, Silva-Valenzuela M, Rojas-Martínez RI, Garza-García R.
Response of ten yellow mango cultivars to powdery mildew
(Erysiphe quercicola) damage in Mexico
Amado Pérez-Rodríguez, José Antonio Mora-Aguilera*, Carlos De León-García de Alba, José Sergio
Sandoval-Islas, Instituto de Fitosanidad, Colegio de Postgraduados, km 36.5, Carretera México-Texcoco,
Montecillo, Texcoco, Estado de México, CP. 56230, México; Elías Hernández-Castro, Unidad Académica de
Ciencias Agropecuarias y Ambientales, Universidad Autónoma de Guerrero, Carretera Iguala-Tuxpan km 2.5,
CP. 40101, Iguala, Guerrero, México; Alfonso Vásquez-López, Laboratorio de Fitopatología, Instituto Poli-
técnico Nacional-CIIDIR, Calle Hornos 1003, Colonia Noche Buena, Municipio Santa Cruz Xoxocotlán, CP.
71230, Oaxaca, Oaxaca, México. *Autor para correspondencia: aguilera@[Link].
10 cultivares de mango amarillo nuevos para Méxi- values of incidence, maximum severity, area under
co. Se evaluaron dos métodos de inoculación. El the disease progress curve, apparent infection rate
mejor fue por aspersión de conidios a una concen- and conidia density per cm2 of damaged leaf area
tración de 4.6 × 105 esporas mL-1, en las superficies (LSD, P≤0.05).
adaxial y abaxial de las hojas, a ± 300 – 450 lux y
suspendidos en polisorbato 20 + surfactante a base Key words: leaves, susceptibility, germplasm,
de alcoholes etoxilados al 2%. La prueba de inocu- severity.
lación mostró que el cv. Alphonso fue moderada-
mente tolerante y Neelum y Fairchild ligeramente
tolerantes. En contraste, Nam Doc Mai, Rosigold, Mexico is the seventh largest mango (Mangifera
Ataúlfo Zafiro, Cotaxtla y Kesar fueron suscepti- indica L.) producing country in the world, with
bles y Mallika e Ivory altamente susceptibles. Los an annual volume of more than 1.8 Mt, and is
cultivares más tolerantes presentaron valores me- the main exporter, accounting for 24% of global
nores de incidencia, severidad máxima, área bajo mango exports (FAO, 2016). Between 1992
la curva del progreso de la enfermedad, tasa de in- and 2006, Mexico lost approximately 27.6% of
fección aparente y densidad de conidios por cm2 de its competitiveness as a mango exporter to the
área foliar dañada. United States due to the increased commercial
share of India, Thailand, Peru, Brazil and Ecuador
Palabras clave: hojas, susceptibilidad, germoplas- (Hernández and Martínez, 2009). This growing
ma, severidad. problem is associated with the limited supply
of yellow mangoes on the international market,
since Mexico trades only Ataulfo cv. fruits,
México representa el séptimo país productor whose productivity is low mainly due to diseases,
de mango (Mangifera indica L.) con un volumen parthenocarpic fruits, genetic mixtures, as well as
anual superior a 1.8 Mt y es el principal exportador marked seasonality and alternate bearing (Villegas
con el 24% del volumen exportado global (FAO, and Mora, 2011). To mitigate such limitations,
2016). Entre 1992 y 2006 México perdió compe- in 2011 and 2012, the Colegio de Postgraduados
titividad en aproximadamente 27.6% en la expor- introduced eight new yellow mango cultivars from
tación de mango a [Link]., debido al incremento Florida, USA, that have export potential. Also, the
de la participación comercial de India, Tailandia, Instituto Nacional de Investigaciones Forestales
Perú, Brasil y Ecuador (Hernández y Martínez, Agrícolas y Pecuarias (INIFAP) registered two
2009). Este problema creciente está asociado a la new local cultivars of the Ataulfo clone in 2009 (A.
oferta limitada de mango amarillo en el mercado Diamante) and 2012 (A. Zafiro).
internacional, ya que México comercializa única- Mango powdery mildew caused by Erysiphe
mente frutos del cv. Ataúlfo y este presenta baja quercicola (anamorph: Pseudoidium anacardii)
productividad debido principalmente a presencia (Braun and Cook, 2012; Félix et al., 2013; Tam,
de enfermedades, frutos partenocárpicos, mezclas 2017) is one of the most important diseases that
genéticas y marcada estacionalidad y alternancia de affects mango because of its high level of severity,
cosecha (Villegas y Mora, 2011). Para mitigar estas endemism and cosmopolitan distribution (Raheel
limitantes, el Colegio de Postgraduados introdujo et al., 2008) that cause 80-90% of the mango
en 2011 y 2012 ocho nuevos cultivares de mango production losses (Gupta, 1989b; Shoeman et al.,
amarillo con potencial de exportación procedentes 1995; Nasir et al., 2014). In mango exporting states
de Florida, [Link]. Además, el Instituto Nacional such as Michoacan, it may affect 60% of commercial
de Investigaciones Forestales Agrícolas y Pecua- trees, the equivalent of 30,000 to 50,000 tons of
rias (INIFAP) registró dos nuevos cultivares loca- fruit (Arias et al., 2004); in Sinaloa, the disease
les del clon Ataúlfo en 2009 (A. Diamante) y 2012 causes 70% losses during the flowering stage (Félix
(A. Zafiro). et al., 2017). The fungus damages leaves, flowers
La cenicilla del mango, causada por Erysiphe and young fruits. The infected tissue is covered
quercicola (anamorfo: Pseudoidium anacardii) with white powder due to mycelial growth and
(Braun y Cook, 2012; Félix et al., 2013; Tam, sporulation. The first lesions on leaves are reddish
2017) es una de las enfermedades más importan- in color, but at advanced stages, the fungus deforms
tes de este frutal por su alta severidad, endemis- the leaf lamina and produces abundant sporulation,
mo, distribución cosmopolita (Raheel et al., 2008) necrosis and severe defoliation. In the reproductive
y causar pérdidas de cosecha de 80-90% (Gupta, tissue, it causes fall of flowers, extensive necrosis
1989b; Shoeman et al., 1995; Nasir et al., 2014). of inflorescences and abortion of young fruits
En entidades federativas exportadoras de man- (Sinha et al., 2001; 2002; Nasir et al., 2014).
go como Michoacán puede afectar el 60% de los The effect of foliar infections on the frequency
árboles comerciales, representando 30-50 mil ton and severity of epidemics on inflorescences is
de fruta (Arias et al., 2004) y en Sinaloa ocasio- widely documented, because the fungus survives
nar pérdidas de 70% durante floración (Félix et al., in the form of mycelium in buds and leaves during
2017). El hongo ataca hojas, inflorescencias y fru- the growth season, or from previous years, when
tos juveniles. El tejido infectado se cubre con un environmental conditions do not favor infection, or
polvo blanco debido al crecimiento micelial y es- when there is no reproductive tissue (Schoeman et
porulación. Las lesiones iniciales en follaje son de al., 1995; Misra, 2001; Nasir et al., 2014). When
coloración rojiza, el daño avanzado causa deforma- there are no flowers, early infection on young
ción de lámina foliar con esporulación abundante, leaves perpetuates inoculum availability and favors
necrosis y defoliación severa. En tejido reproduc- the beginning of the infection on panicles (Munshi
tivo induce caída de flores, necrosis extensiva de et al., 1988; Misra et al., 2012). Also, during
inflorescencias y aborto de frutos pequeños (Sinha flowering, sporulation on leaves (with conidia
et al., 2001; 2002; Nasir et al., 2014). attached to conidiophores) increases inoculum
La relevancia de la infección foliar en la recu- development and preserves its viability from 10 to
rrencia y severidad de epidemias en inflorescencias 19 (Gupta, 1989a; Nelson, 2008) or 40 more days
está ampliamente documentada, ya que el hongo (Khalid et al., 2000) compared with free conidia
sobrevive como micelio en yemas y hojas de la deposited on other susceptible host organs, which
estación de crecimiento o de años previos, cuan- favors longer lasting and more intense epidemics,
do las condiciones ambientales a la infección son given that conidia require only from 5 to 7 h to
desfavorables o en ausencia de tejido reproducti- germinate, and from 5 to 8 days to induce the first
vo (Schoeman et al., 1995; Misra, 2001; Nasir et symptoms (Misra, 2001). In turn, the multiple
al., 2014). Cuando las flores aún están ausentes, la vegetative and floral flows that are simultaneously
infección temprana en hojas juveniles perpetúa la formed during the same growth season also
susceptibles, y Sensation y Tommy Atkins lige- necessary to use standardized techniques that
ramente susceptibles a O. mangiferae en Hawái, efficiently reproduce the disease. Given that E.
[Link]. Otros estudios de este tipo para estimar la quercicola is an obligate parasite, most of the
tolerancia a cenicilla fueron realizados por Palti et studies conducted to document its distribution,
al. (1974), Gupta (1976), Peterson (1984), Akhtar importance, biology, epidemiology, management
et al. (1999), Galli et al. (2008), Nofal y Haggag and genetic resistance have been based on
(2006) y Naqvi et al. (2014). Sin embargo, estos naturally infected plants (Nasir et al., 2014), and
enfoques metodológicos presentan inconvenientes for this reason there is little information about the
severos, ya que la incidencia y severidad de ceni- artificial induction of mango powdery mildew.
cilla en campo dependerá de factores como la es- Adikaram et al. (2002) reported that by depositing
tacionalidad, distribución y densidad de inóculo, O. mangiferae spores on Pedilanthus tithymaloides
disponibilidad de tejido susceptible y de condicio- leaves using a paint brush, they produced successful
nes ambientales (Nasir et al., 2014) o de manejo infections and promoted the expected synthesis of
inductivas como la frecuencia e intensidad de riego new anthocyanins and chlorophyll degradation.
(Guillen et al., 2003). In previous studies conducted on mango leaves,
Para evitar el escape a la infección y asegurar the highest levels of O. mangiferae infection
una óptima expresión parasítica del patógeno, es were observed in leaves of 8-12 day-old that were
necesario utilizar técnicas estandarizadas de ino- inoculated at dusk (300–350 Lux) at 4.6 x 105
culación que reproduzcan con eficiencia la enfer- spores mL-1 (Pérez, 2017).
medad. Debido a que E. quercicola es un parásito Based on the different susceptibility to powdery
obligado, la mayoría de los estudios realizados para mildew that all mango cultivars shows (Palti et al.,
documentar su distribución, importancia, biología, 1974; Nasir et al ., 2014), the great influence of E.
epidemiología, manejo y resistencia genética se quercicola foliar infection on the disease cycle and
han basado en plantas infectadas naturalmente (Na- epidemic development (Misra, 2001; Pérez et al.,
sir et al., 2014), por lo que existe escasa informa- 2017a), as well as the need to promote adequate
ción referente a la inducción artificial de cenicilla selection and agronomic use of the new cultivars
del mango. Adikaram et al. (2002) documentaron introduced or developed in Mexico, according to
que la deposición de esporas de O. mangiferae con their sanitary reaction to the pathogen, this study
pincel sobre hojas de Pedilanthus tithymaloides ge- was conducted to determine the response to E.
neró infecciones exitosas y promovió la esperada quercicola at the vegetative stage of ten new
síntesis de nuevas antocianinas y degradación de yellow mango cultivars that have export potential
clorofila. En estudios previos realizados en hojas using nursery plants and an optimized inoculation
de mango se observó que la mayor infección por technique.
O. mangiferae se registró en hojas de 8–12 días de
edad, inoculadas al atardecer (300–350 Lux) con
una concentración de 4.6 x 105 esporas mL-1 (Pérez, MATERIALS AND METHODS
2017).
Con base en la susceptibilidad diferenciada que Study area
presentan todos los cultivares de mango a cenicilla
(Palti et al., 1974; Nasir et al., 2014), la relevancia The study was conducted in 2015 and 2016 at
alta que tiene la infección foliar por E. quercicola the laboratory and greenhouse of the Postgrado de
y depositaron en bolsas de papel para su conser- (0.5%) for 30 s using a manual sprayer, rinsed three
vación temporal y traslado. El tejido se deshidrató times with distilled water and dried for 10 min. Three
por siete días en condiciones de laboratorio (470 ± inoculation treatments were evaluated: T1) spraying
10 lux, 24–26°C y 30% HR). Una porción de tejido conidia suspended in polysorbate 20 (Tween 20®)
deshidratado se conservó en bolsas de papel como at 5% + surfactant based on ethoxylated alcohols
reservorio de inóculo, del resto se recuperaron los (Inex-A®) at 2%; T2) spraying a conidia mixture
conidios con un pincel de pelo fino (Rodin® Núm. containing calcium caseinate (Rennet Casein® 90
5) y suspendieron en tubos de vidrio con 30 mL de mesh, Charotar Casein Company, IndiaMartTM);
agua destilada estéril para su conservación a 24 ± and T3) spraying sterile distilled water (control). A
2ºC y uso posterior como fuente de inóculo. base mixture was prepared from each treatment. For
T1, we used 1 g of inoculum (mycelium, conidia
Tratamientos de inoculación and conidiophores) in 2 mL-1 of the solution; for
T2, 1 g of inoculum in 2 g of casein, and then both
Se identificaron brotes vegetativos con desa- were adjusted to a concentration of 4.6 × 105 spores
rrollo inicial de la enfermedad en plantas del cv. mL-1 in a Neubauer chamber. Inoculation was done
Manililla, altamente susceptibles a E. quercicola y at 18:00 h (± 300–450 lux) on the adaxial and
con características similares de crecimiento y vi- abaxial areas of disinfested leaves that remained
gor. Cuando las hojas tuvieron 8–12 días de edad attached to the plant. Fifty (50) leaves per treatment
se desinfestaron con un aspersor manual con Na- were inoculated (5 leaves per plant; 10 plants per
ClO (0.5%) durante 30 s, se enjuagaron tres veces treatment). The experiment was replicated three
con agua destilada y dejaron secar durante 10 min. times in 2015.
Se evaluaron tres tratamientos de inoculación: T1)
aspersión de conidios en suspensión en polisorbato Varietal tolerance
20 (Tween 20®) al 5% + surfactante a base de alco-
holes detoxilados (Inex-A®) al 2%; T2) espolvoreo For this experiment, 18 month-old mango
de una mezcla de conidios con caseína (Rennet Ca- plants grafted with Nam Doc Mai, Rosigold,
sein® 90 mesh, Charotar Casein Company, India- Neelum, Mallika, Cotaxtla, Kesar, Fairchild, Ivory,
MartTM), y T3) aspersión de agua destilada estéril Alphonso and Ataulfo Zafiro cultivars were used.
(control). De cada tratamiento se preparó una mez- To replicate the symptoms, the most effective
cla base; para el T1 se utilizó 1 g de inóculo (mice- inoculation treatment from previous experiments,
lio, conidios y conidióforos) en 2 mL-1 de la solu- adjusted to 4.6 × 105 spores mL-1, was applied to
ción y para el T2 se usó 1 g de inóculo en 2 g de ca- the adaxial and abaxial areas of leaves at a range
seína y ambos se ajustaron a una concentración de of ± 300–450 lux. Fifty (50) 8-12 day-old leaves
4.6 × 105 esporas mL-1 en una cámara de Neubauer. attached to the plant were inoculated per cultivar
La inoculación se realizó a las 18:00 h (± 300–450 (5 leaves per plant; 10 plants per cultivar). The
lux) en las superficies adaxial y abaxial de las ho- experiment was replicated three times a year in
jas desinfestadas que permanecieron adheridas a la 2015 and 2016.
Figura 1. Diagrama de severidad de cenicilla causada por Erysiphe quercicola en hojas de mango (Mangifera indica) con
base en el patrón de colonización observado en huertos comerciales de Guerrero, México. 2015.
Figure 1. Severity diagram of powdery mildew caused by Erysiphe quercicola in mango (Mangifera indica) leaves based on
the colonization pattern observed in commercial orchards in Guerrero, México. 2015.
Parámetros fitosanitariosx
Tratamientow Pi Inc
Ymax ABCPE b-1
(ddi) (%)
agruparon en cuatro niveles de susceptibilidad. Al- were more susceptible than the monoembryonic
phonso fue moderadamente tolerante (MT) segui- types (Table 2) (LSD, P ≤ 0.05).
do de Neelum y Fairchild, los cuales fueron ligera-
mente tolerantes (LT). Entretanto, Nam Doc Mai,
Rosigold, Ataúlfo Zafiro, Cotaxtla y Kesar se com- DISCUSSION
portaron como susceptibles (S) e Ivory y Mallika
fueron altamente susceptibles (AS) (Figura 2). Aun Spraying conidial inoculum of E. quercicola
cuando ningún cultivar fue resistente, los menos suspended in a mixture of polysorbate 20 (5%) +
susceptibles (MT y LT) presentaron valores consis- surfactant based on ethoxylated alcohols (2%) was
tentemente menores de incidencia, Ymax, ABCPE, more effective than casein to induce the disease
b-1 y Cc. El Pi osciló entre 4 y 6 días y su duración with a higher level of incidence (90.1%), severity
no mostró un patrón concordante con el grado de (Ymax = 4.8, AUDPC = 107) and speed (Pi = 5
susceptibilidad de los cultivares evaluados. Los ddi) in the Manilla cv. (Table 1). Since it proved
cultivares más susceptibles (S y AS) mostraron de to be more effective, this inoculation method
20.6–22.0% mayor incidencia, de 33–38% mayor was used to evaluate the response of cultivars
Ymax, de 95.5–140% más ABCPE, tasas de desa- to infection in this study. No studies were found
rrollo (b-1) más altas de 183–223% y concentración on the effect of polysorbate 20 on E. quercicola
conidial por área dañada (cm2) de 226–300% su- conidial germination. However, because of its
periores respecto a cultivares de los grupos MT y surfactant, adherent and dispersant properties,
LT. En este estudio, los cultivares poliembriónicos polysorbate 20 has been used in some studies to
Nam Doc Mai, Kesar, Cotaxtla, Ivory y Ataúlfo Za- prevent spore agglutination and enable uniform
firo fueron más susceptibles que los monoembrió- spore dispersion. For example, Jansen et al. (2005)
nicos (Cuadro 2) (DMS, P ≤ 0.05). achieved 100% successful infections by inoculating
wheat caryopses with Fusarium graminearum at a
concentration of 1500 macroconidia mL-1 suspended
DISCUSIÓN in polysorbate 20. Similarly, Frias et al. (1995)
favored germination and obtained from 97 to 100%
La aspersión del inóculo conidial de E. querci- infection by inoculating cacao (Teobroma cacao)
cola, en suspensión con una mezcla de polisorbato seedlings with Crinipellis perniciosa basidiospores
20 (5%) + surfactante a base de alcoholes detoxi- suspended in a polysorbate 20 solution containing
lados (2%) superó a la caseína en inducir la enfer- 3% glycerol. Similarly, Jia et al. (2003) observed
medad con mayor incidencia (90.1%), severidad that polysorbate 20 (0.25%) combined with 16 and
(Ymax = 4.8, ABCPE = 107) y rapidez (Pi = 5 ddi) 18 h light-darkness periods increased the levels of
en el cv. Manilla (Cuadro 1). Dada su mayor efi- expected spores adherence and maximum severity
cacia, este método de inoculación se utilizó para of Magnaporthe grisea inoculated on rice (Oryza
evaluar la respuesta a la infección en los cultivares sativa) leaves.
considerados en este estudio. No ese encontraron In this study, we evaluated the reaction of 10
estudios relativos al efecto del polisorbato 20 en la mango cultivars inoculated with E. quercicola using
germinación conidial de E. quercicola. Sin embar- an optimized technique that included the control of
go, por sus características tensioactivas, adherentes inoculum density and effective deposition on foliar
A B C
D E F
G H I
Cuadro 2. Tolerancia de diez cultivares de mango inoculados con Erysiphe quercicola en hojas de 8-12 días
de edad con base en algunos parámetros fitosanitarios en Iguala, Guerrero, México, durante los
ciclos 2015 y 2016.
Table 2. Tolerance of 10 mango cultivars inoculated with Erysiphe quercicola in 8-12 day-old leaves based on
some phytosanitary parameters in Iguala, Guerrero, Mexico, during the 2015 and 2016 cycles.
Parámetros fitosanitariosw
Pi Inc Cc
Cultivar Ymax ABCPE b-1 Reacción Semillax
(ddi) (%) (104 /cm2)
Magnaporthe grisea inoculado en hojas de arroz four susceptibility levels as reported by Naqvi
(Oryza sativa). et al. (2014), who tested 25 mango cultivars and
En este estudio se evaluó la reacción de diez found that although none of them was resistant,
cultivares de mango inoculados con una técnica they exhibited levels of tolerance. In our study,
optimizada que consideró el control de la densidad cv. Alphonso showed the highest tolerance to
inóculo y deposición eficiente en el tejido foliar, E. quercicola, in contrast to Nofal and Haggag
aditivos humectantes para evitar la deshidratación (2006), who indicated that this cultivar was highly
de conidios, así como la fenología del hospedante susceptible. However, Neelum and Fairchild
asociada a la susceptibilidad y condiciones óptimas showed slight tolerance, as reported by Nasir et
de incubación. La carencia de este tipo de estudios al. (2014). The most susceptible cultivars were
limita la estimación precisa de tolerancia varietal a Mallika and Ivory, and this result coincides with
E. quercicola, ya que evaluar este comportamien- that obtained by Palti et al. (1974) and Nofal and
to con base en epidemias naturales, como común- Haggag (2006). Also, the present study reports for
mente se realiza (Akthar et al., 1999; Galli et al., the first time the degree of vegetative susceptibility
2008; Nelson, 2008), puede llevar a conclusiones to E. quercicola in new mango cultivars for Mexico
equivocadas debido a que la ocurrencia e intensi- (Nam Doc Mai, Rosigold, Ataulfo Zafiro and
dad estarán afectadas por la presencia, densidad y Kesar), which have export potential. It is important
distribución variable del inóculo, condiciones am- to consider that the cultivars with the lowest
bientales heterogéneas y disponibilidad de tejido susceptibility consistently showed lower incidence,
susceptible, entre otros factores (Shoeman et al., Ymax, accumulated severity (AUDPC), rate of
1995; Nasir et al., 2014). disease development and sporulation density, and
Nuestros resultados indicaron que todos los that the ranges of magnitude of those values were
cultivares fueron susceptibles a E. quercicola y in agreement with each susceptibility group (MT,
se agruparon en cuatro niveles de susceptibilidad LT, S and AS) (Table 2).
como fue reportado por Naqvi et al. (2014), quie- It is important to note that the previously cited
nes encontraron que de un total de 25 cultivares de tolerance comparisons were based on natural
mango, ninguno fue resistente, pero si exhibieron epidemics (Galli et al., 2008, 2009; Naqvi et
gradientes de tolerancia. En nuestro estudio, el cv. al., 2014), in which conditions to promote the
Alphonso mostró la mayor tolerancia a E. quercico- maximum expression of the pathogen virulence and
la, en contraste con Nofal y Haggag (2006), quienes disease development were not controlled, so the
documentaron una susceptibilidad alta de este cul- level of severity may have been underestimated or
tivar. Sin embargo, Neelum y Fairchild presentaron overestimated. Nasir et al., (2014) documented the
ligera tolerancia como fue documentado por Nasir differentiated virulence of O. mangiferae in terms
et al. (2014). Los cultivares más susceptibles fue- of the level of environmental humidity and length
ron Mallika e Ivory, coincidiendo con lo observado of the driest environmental periods. For this reason,
por Palti et al. (1974) y Nofal y Haggag (2006). it is important to use effective and standardized
Adicionalmente, la presente investigación consig- methods to reproduce the disease under controlled
na por primera vez el grado de susceptibilidad del conditions (laboratory, glass houses or other
follaje a E. quercicola en cultivares de mango nue- protected spaces), as well as integrate the greater
vos para México (Nam Doc Mai, Rosigold, Ataúlfo number of phytosanitary variables and use severity
Zafiro y Kesar) y con potencial de exportación. Es scales based on the symptomatic pattern and
relevante considerar que los cultivares con menor maximum severity degree observed in commercial
susceptibilidad presentaron consistentemente me- orchards (Figure 1) located in particular mango-
nor incidencia, Ymax, severidad acumulada (ABC- producing regions to estimate the varietal tolerance
PE), tasa de desarrollo de la enfermedad, así como more accurately.
densidad de esporulación y los rangos de magnitud All the polyembryonic cultivars (Nam Doc Mai,
de estos valores guardaron concordancia con cada Kesar, Cotaxtla, Ivory and Ataulfo Zafiro) showed
grupo o respuesta de susceptibilidad (MT, LT, S y greater susceptibility when they grouped as S and
AS) (Cuadro 2). AS. However, since monoembryonic cultivars
Es importante señalar que las comparaciones (Rosigold and Mallika) were also grouped into
de tolerancia previamente citadas se han basado en those categories (Table 2), this relationship must
epidemias naturales (Galli et al., 2008, 2009; Na- be verified when doing future comparative studies
qvi et al., 2014), en donde no se controlaron las on a greater number of cultivars of each embryonic
condiciones para promover la óptima expresión de type. It is important to provide evidence of the
virulencia del patógeno y el desarrollo de la enfer- participation of this factor, since it suggests that
medad, por lo que la severidad pudo ser subestima- polyembryony in mango promotes susceptibility to
da o sobreestimada. Nasir et al. (2014) documen- foliar diseases because it causes peroxidase activity
taron la virulencia diferenciada de O. mangiferae and ethylene synthesis to decrease (Campbell,
en función del grado de humedad ambiental y du- 1961) in contrast to soil pathogens, where the
ración de los periodos ambientales más secos. Por resistance increases (Pinto et al., 2002).
esta razón, es importante usar métodos eficaces y Powdery mildew develops in a wide
estandarizados para reproducir la enfermedad en temperature range (10-31 °C) (Ploetz and Freeman,
condiciones controladas (laboratorio, invernaderos 2009), although it is more severe in dry and cold
u otros espacios protegidos) para la correcta esti- environments (50-70% RH, ≈ 20-22°C) (Gupta,
mación de tolerancia, además de integrar en el es- 1989b; Schoeman et al., 1995). Conidia can
tudio mayor número de variables fitosanitarias para germinate in a range from 9 to 32°C (being the
lograr resultados más consistentes y usar una escala optimum 23°C) with relative humidity as low as
de severidad diseñada acorde al patrón de síntomas 20%, so disease development does not usually
y grado máximo de severidad observado en huertos depend on environmental moisture (Ploetz and
comerciales de mango (Figura 1) de las regiones Freeman, 2009). Mango-producing areas in the
productoras de cada país en particular. Mexico’s Pacific basin have climatic gradients
Todos los cultivares poliembriónicos (Nam Doc (dry, humid and subhumid tropics) with different
Mai, Kesar, Cotaxtla, Ivory y Ataúlfo Zafiro) mos- inductivity to powdery mildew. For example, in
traron mayor susceptibilidad al agruparse como dry tropical regions such as the Apatzingan Valley
S y AS; sin embargo, como en estas categorías (Michoacan, Mexico), powdery mildew shows high
también se agruparon cultivares monoembrióni- levels of severity, damages leaves and reproductive
cos (Rosigold y Mallika) (Cuadro 2), esta relación tissue, and causes up to 80% of fruits to fall. In this
debe verificarse en futuros estudios comparativos region, Arias et al. (2004) classified as high-risk
con mayor número de cultivares de cada tipo em- areas for this disease those at altitudes higher than
brionario. Aportar evidencias de la participación de 550 m where night temperatures can reach <17 °C.
este factor es relevante, ya que se sugiere que la po- In agreement with this assumption, Pérez et al.
liembrionía en mango promueve susceptibilidad a (2017b) reported the development of low-severity
enfermedades foliares al originar baja actividad de epidemics (2.98%) and only on inflorescences in
peroxidasas y síntesis de etileno (Campbell, 1961), orchards located in Arcelia, Guerrero (dry tropics),
en contraste con patógenos del suelo donde incre- a municipality located at 330 masl, with ≥ 30 °C
menta la resistencia (Pinto et al., 2002). temperature and ≤ 60% RH during the study. In
El desarrollo de cenicilla ocurre en un rango am- contrast, in subhumid tropical areas such as Tecpan
plio de temperatura (10-31 °C) (Ploetz y Freeman, de Galeana (Guerrero, Mexico), the recurrent
2009), aunque es más severa en ambientes secos presence of cold sea winds favors the appearance
y fríos (50-70% RH, ≈ 20-22°C) (Gupta, 1989b; of multiple vegetative and floral flows that extend
Schoeman et al., 1995). Los conidios pueden ger- the phenological stages of higher susceptibility,
minar en un rango de 9-32°C (con un óptimo de and promote multiple powdery mildew epidemics
23°C) con humedad relativa tan baja como 20%, (Pérez et al., 2017a) of varying intensity. In view
por lo que el desarrollo de la enfermedad es usual- of the above, this study supports the selection of
mente independiente de la humedad ambiental agroecological regions that are more adequate for
(Ploetz y Freeman, 2009). Las zonas de producción growing new yellow mango cultivars for the export
de mango de la cuenca pacífico de México presen- market. For example, cultivars in high demand
tan gradientes climáticos (trópicos seco, húmedo y in the US and Canadian markets, such as Nam
subhúmedo) con distinta inductividad a cenicilla. Doc Mai, Alphonso and Kesar, will have a better
Por ejemplo, en regiones de trópico seco como el productive performance and higher profitability in
Valle de Apatzingán (Michoacán, México), la ce- regions where E. quercicola shows less parasitic
nicilla se presenta con alta severidad, ataca hojas y aptitude and the financial costs for phytosanitary
tejido reproductivo y causa caída de frutos de hasta maintenance will be lower. However, the farmer
80%; en esta región, Arias et al. (2004) clasificaron should consider factors such as the susceptibility
como zonas de alto riesgo para esta enfermedad las of the new cultivars to other important pathogens
ubicadas a una altitud mayor a 550 m y expuestas and their agronomic adaptation to weather and soil
a temperatura nocturna < a 17 °C. En concordan- types when making his decision.
cia con este supuesto, Pérez et al. (2017b) repor- Except for Cotaxtla, the other cultivars
taron el desarrollo de epidemias de baja severidad evaluated in this study were recently established
(2.98%) y únicamente en inflorescencias en huertos in experimental orchards in Guerrero, Oaxaca and
de Arcelia, Gro., (trópico seco), municipio ubicado Chiapas, Mexico, so they are at a young stage.
a 330 m, con temperatura ≥ 30 °C y RH ≤ 60% du- Once they mature, we will continue our studies
rante el estudio. En contraste, en zonas de trópico on varietal response to E. quercicola infection in
subhúmedo, como Técpan de Galeana (Guerrero, reproductive tissues.
México), la presencia recurrente de vientos mari-
nos fríos favorece la aparición de flujos vegetati-
vos y florales múltiples que prolongan las etapas CONCLUSIONS
fenológicas de mayor susceptibilidad y también
promueven epidemias múltiples de cenicilla (Pérez In this study, it was determined that the best
et al., 2017a) con distinta intensidad. Con base en method for inoculating E. quercicola in mango was
lo anterior, este estudio permite apoyar la selección to spray conidia at 4.6 × 105 spore mL-1 on both
de regiones agroecológicas más adecuadas para los leaf areas, at dusk and suspended in polysorbate
nuevos cultivares de mango amarillo emergentes 20 + surfactant based on 2% ethoxylated alcohols
para el mercado de exportación. Por ejemplo, cul- to favor its dispersion and prevent dehydration.
tivares altamente demandados por los mercados de Although the 10 mango cultivars evaluated in this
[Link]. y Canadá, como Nam Doc Mai, Alphonso study were susceptible to E. quercicola, Alphonso,
y Kesar, tendrán mejor comportamiento producti- Neelum and Fairchield were the most tolerant to
vo y mayor rentabilidad en las regiones donde E. foliar infection, while Mallika and Ivory were the
quercicola muestra menor aptitud parasítica y los most susceptible.
costos financieros por mantenimiento fitosanitario
serán menores. Sin embargo, el productor deberá Acknowledgments
considerar factores como la susceptibilidad de los
nuevos cultivares a otras limitantes parasíticas im- The authors wish to thank to the authorities of the
portantes y adaptación agronómica a tipos de clima Postgrado de la Unidad Académica de Ciencias Agropecuarias,
y suelo para ponderar mejor su decisión. Universidad Autónoma de Guerrero for the facilities provided
Con excepción de Cotaxtla, el resto de los culti- to carry out this work.
vares evaluados en este estudio se establecieron re-
End of the English version
cientemente en huertos experimentales ubicados en
Guerrero, Oaxaca y Chiapas, México, por lo que se
encuentran en etapa juvenil. Una vez que alcancen
Agradecimientos
la madurez continuarán los estudios de respuesta
varietal a la infección por E. quercicola en tejidos
Los autores agradecen a las autoridades de Postgrado de la
reproductivos
Unidad Académica de Ciencias Agropecuarias de la Universi-
dad Autónoma de Guerrero por las facilidades otorgadas para
realizar el presente trabajo.
CONCLUSIONES
Arias SJF, Espinosa AJ, Rico PHR, Miranda SMA y Chávez cenicilla (Oidium mangiferae Berthet) en huertos de man-
CX. 2004. La cenicilla Oidium mangiferae Berthet del go (Mangifera indica L.) en Michoacán, México. Revista
mango en Michoacán. INIFAP, CIRPAC. Campo Expe- Mexicana de Fitopatología 21(2):181-188. Disponible en
rimental Valle de Apatzingán. Folleto Técnico Núm. 1. línea: [Link]
Apatzingán, Michoacán, México. Disponible en línea: html
[Link] Gupta JH. 1976. Reaction of mango varieties to powdery mil-
dle/123456789/1288/cenicilla_1288.pdf?sequence=1 dew (Oidium mangiferae) in Uttar Pradesh. Progressive
Braun U and Cook RTA. 2012. Taxonomic manual of the Horticulture 8:63-64.
Erysiphales (Powdery Mildews). CBS-KNAW Fungal Gupta JH. 1989. Longevity of conidia of Oidium mangiferae
Biodiversity Centre, Utrecht, The Netherlands. 707 p. Dis- causing powdery mildew of mango. Indian Journal Myco-
ponible en línea: [Link] logy and Plant Pathology 19:123-124.
mic-manual-of-the-erysiphales-powdery-mildews-book Gupta JH. 1989b. Perpetuation and epidemiology of powdery
Campbell CW. 1961. Comparison of yield of poliembrionic and mildew of mango. Acta Horticulture 231:528-533. https://
monoembrionic mangos. Proceedings of the Florida State [Link]/10.17660/ActaHortic.1989.231.4
Horticultural Society 74: 363-365. Disponible en línea: Hernández SD y Martínez DMA. 2009. Procedimiento para
[Link] el análisis de equilibrio parcial de las exportaciones mexi-
(CAMPBELL).pdf canas de mango (Mangifera indica) a [Link]. Revista
Campbell CL and Benson DM. 1994. Spatial aspects of the Fitotecnia Mexicana 32(3):251-256. Disponible en línea:
development of root disease epidemics. Pp. 195-243. In: [Link]
Campbell CL and Benson DM. (eds.). Epidemiology and 3/[Link]
management of root diseases. Berlin: Springer-Verlag. Jansen C, Wettstein D, Shäfer W, Kogel KH, Felk A and Maier
339p. [Link] FJ. 2005. Infection patterns in barley and wheat spikes ino-
FAO. 2016. Organización de las Naciones Unidas para la Ali- culated with wild-type and trichodiene synthase gene dis-
mentación y la Agricultura. Disponible en línea: [Link] rupted Fusarium graminearum. Proceedings of the National
[Link]/[Link]?PageID=339&lang=es Academy of Sciences, USA 102(46):16892-16897. Dispo-
Félix GR, Herrera RG, Martinez VC, Longoria ERM, Mal- nible en línea: [Link]
donado MIE, Quiroz FFR, Martinez AJC, Garcia PLM [Link]
and Espinoza MS. 2013. First report of powdery mildew Jia Y, Valent B and Lee FN. 2003. Determination of host res-
(Pseudoidium anacardii) of mango trees in Sinaloa, Mexi- ponses to Magnaporthe grisea on detached rice leaves
co. Plant Disease 97(7):994. [Link] using a spot inoculation method. Plant Disease 87:129-
PDIS-11-12-1014-PDN 133. Disponible en línea: [Link]
Félix GR, Maldonado MIE, Beltran PH, Apodaca SMA, Es- publication/249303304_Determination_of_Host_Respon-
pinoza MS, Martínez VMC, Longoria ERM and Olivas ses_to_Magnaporthe_grisea_on_Detached_Rice_Leaves_
PNG. 2017. Powdery mildews in agricultural crops of Using_a_Spot_Inoculation_Method
Sinaloa: Current status on their identification and future Khalid P, Akhtar and Alam SS. 2000. Powdery mildew of
research lines. Revista Mexicana de Fitopatología 35:106- mango: a review. Pakistan Journal of Biological Sciences
129. DOI: 10.18781/[Link].1607-4 3 (7):1119-1122. Disponible en línea: [Link]
Frias GA, Purdy LH and Schmidt RA. 1995. An inoculation [Link]?doi=pjbs.2000.1119.1122&linkid=pdf
method for evaluating resistance of cacao to Crinipellis Misra AK. 2001. Powdery mildew - A serious disease of
perniciosa. Plant Disease 79:787-791. Disponible en línea: mango. Journal of Applied Horticulture 3(1):63-68. Dis-
[Link] ponible en línea: [Link]
sues/Documents/1995Articles/PlantDisease79n08_787. tion/281590887_Powdery_mildew_-A_serious_disease_
PDF of_mango
Galli JA, Fischer IH and Palharini MCA. 2012. Pre and post- Misra AK, Shukla PK and Pandey BK. 2012. Diseases of
harvest diseases in mango varieties cultivated in organic Mango. Pp. 278-335. In: Diseases of fruit crops. Misra
system. Revista Brasileira de Fruticultura 34(3):734-743. AK, Chowdappa P, Sharma P and Khetrapal RK. (eds.).
[Link] Indian Phytopathological Society. New Delhi. 342p. Dis-
Galli JA, Silveira LCP, Michelotto MD and Martins ALM. ponible en línea: [Link]
2008. Powdery mildew (Oidium mangiferae Bert.) infec- tion/311886856_Diseases_of_Mango
tion in mango varieties. Bioscience Journal 24(2):43-46. Munshi GD, Jhooty JS and Jasmit K. 1988. Perennation of
Disponible en línea: [Link] powdery mildew of mango as leaf infections. Indian Jour-
biosciencejournal/article/view/6744/4451 nal Mycologyl and Plant Pathology 18: 68-69.
Galli JA, Silveira LCP, Michelotto MD and Martins ALM. Naqvi SAH, Perveen R, Manzoor SA, Umar HMI, Iqbal MT,
2009. Evaluation of anthracnose incidence, development Liaquat F, Majid T and Irshad A. 2014. Evaluation of
and nutritional status of mango trees varieties for organic various mango varieties against the infection dynamics
cultivation in north center region of São Paulo state. Revis- of powdery mildew (Oidium mangiferae Bert.). Ameri-
ta Brasileira de Fruticultura 31(3):701-709. Disponible en can Journal of Plant Sciences 5:2372-2377. [Link]
línea: [Link] org/10.4236/ajps.2014.515250
Guillén SD, Téliz OD, Mora AG, Mora AA, Sánchez GP y Nasir M, Mughal SM, Mukhtar T and Awan MZ. 2014. Pow-
González HV. 2003. Desarrollo temporal de epidemias de dery mildew of mango: a review of ecology, biology,
epidemiology and management. Crop Protection 64:19- botany, production and uses. CAB International, Wallin-
26. [Link] gford, United Kingdom. 669p. [Link]
Nelson SC. 2008. Mango powdery mildew. Cooperative Ex- %2F9781845934897.0000
tension Service. College of Tropical Agriculture and Hu- Raheel M, Anwar SA, Javed N, Ilyas MB, Iqbal M and Zia
man Resources. University of Hawaii at Manoa. Plant A. 2008. Management of powdery mildew of mango by
Disease: PD-46. Disponible en línea: [Link] foliar spray fungicides. Pakistan Journal of Phytopatholo-
[Link]/oc/freepubs/pdf/[Link] gy 21:173-174. Disponible en línea: [Link]
Nofal MA and Haggag WM. 2006. Integrated management [Link]/publication/235816522_Management_of_pow-
of powdery mildew of mango in Egypt. Crop Protection dery_mildew_of_mango_by_foliar_spray_fungicides
25:480-486. [Link] SAS Institute. 2016. SAS 9.4 OLAP server: User´s Guide,
Palti J, Pinkays Y and Chorin M. 1974. Powdery mildew of SAS Institute. Fifth Edition. Cary, North Caroline, USA.
mango. Plant Disease Report 58:45-49. Disponible en línea: [Link]
Pérez RA. 2017. Tolerancia de cultivares de mango (Mangife- ware/[Link]
ra indica L.) a la cenicilla (Oidium mangiferae Berthet.) Schoeman MH, Manicom BQ and Wingfield MJ. 1995. Epi-
en México. Tesis de Doctorado. Colegio de Postgradua- demiology of powdery mildew on mango blossoms. Plant
dos. Postgrado de Fitosanidad, Fitopatología. Montecillo, Disease 79:524-528. DOI: 10.1094/PD-79-0524
Texcoco, Edo. de México. 78p. Sholberg PL, Lane WD, Haag P, Bedford K and Lashuk L.
Pérez RA, Monteon OA, Mora AA, Hernandez CE. 2017a. 2001. A novel technique for evaluation of apple (Malus x
Epidemiology and strategies for chemical management of domestica Borkh) cultivars for susceptibility to powdery
powdery mildew in mango. Pesquisa Agropecuaria Brasi- mildew. Canadian Journal of Plant Science 81(2):289.296.
leira 52(9):715-723. Disponible en línea: [Link] [Link]
[Link]/pdf/pab/v52n9/[Link] Sinha P, Prajneshu R and Varma A. 2001. Studies on deter-
Pérez RA, Pérez RM, Talavera VA, García EP y Durán TY. mining favourable factors for the germination of conidia
2017b. Manejo Químico de la cenicilla del mango y su in- of Oidium mangiferae. Indian Phytopathology 54(2):197-
teracción con factores ambientales. Revista Mexicana de 200. Disponible en línea: [Link]
Fitosanidad 1(3):30-37. Disponible en línea: rect/abstract/20013126011
[Link] Sinha P, Prajneshu R and Varma A. 2002. Growth models for
FI_30-37_2017.pdf powdery mildew development of mango. Annals of Plant
Peterson RA. 1984. Mango diseases. Pp: 233-247. In: Procee- Protection Sciences 10(1):84-87. Disponible en línea:
dings of the First Australian Mango Research Workshop, [Link]
Cairns, Queensland. CSIRO. 392p. Disponible en línea: &volume=10&issue=1&article=020
[Link] Tam LTT. 2017. Identification powdery mildew Erysiphe quer-
Pinto ACQ, Costa JG and Santos CAF. 2002. Principais cul- cicola damaging on mango in Hanoi, Vietnam. Journal of
tivares. Pp: 95-116. In: GENÚ PJ de C and Pinto AC de Bacteriology and Mycology 4(6):00111. DOI: 10.15406/
Q (eds.). A cultura da mangueira. Brasilia: Embrapa, In- jbmoa.2017.04.00111
formação Tecnológica. 116p. Disponible en línea: https:// Villegas MA y Mora AA. 2011. Avances de la fruticultura en
[Link]/arquivo/1095467/a-cultura-da- México. Revista Brasileira de Fruticultura Vol. Especial:
mangueira 179-186. Disponible en línea: [Link]
Ploetz RC and Freeman S. 2009. Foliar, floral and Soilborne rbf/v33nspe1/[Link].
Diseases. Pp. 231-302. In: Litz RE (2nd ed.). The mango:
Nancy Ley-López, Isidro Márquez-Zequera, José Armando Carrillo-Fasio, Josefina León-Félix, Isabel
Cruz-Lachica, Raymundo Saúl García-Estrada*, Centro de Investigación en Alimentación y Desarrollo,
A.C. Coordinación Culiacán. Km 5.5 Carretera Culiacán-El Dorado, Campo El Diez, CP. 80110. Culiacán, Si-
naloa, México; Raúl Allende-Molar, Facultad de Ciencias Biológicas y Agropecuarias. Universidad Veracru-
zana. Carretera Tuxpan-Tampico km. 7.5 Tuxpan, Veracruz, México. *Autor para correspondencia: rsgarcia@
[Link].
la producción en un rango del 15 al 45% e incluso has led to the emergence of resistant isolates and
pérdida total de los cultivos de chile, tomate y be- environmental pollution (Qi et al., 2012). For this
renjena (González et al., 2009; Wang et al., 2011). reason, new alternatives based on biological control
La alta humedad en el suelo y clima cálido que pre- are being considered for managing Phytophthora,
valece dentro de las plantaciones de tomate y chi- an important strategy in soil-borne phytopathogen
le, favorecen la dispersión y la sobrevivencia de P. management, since they reduce the application of
capsici (Erwin y Riveiro, 1996). agrochemicals (Nguyen et al., 2012; Rios-Velasco
En el manejo y control de este patógeno se han et al., 2016).
utilizado varias estrategias, incluyendo prácticas Different microorganisms have been
culturales, utilización de variedades resistentes reported to suppress P. capsici growth, including
(Yang et al., 2015; Gómez-Rodríguez et al., 2017), Streptomyces spp. (Ko et al., 2010; Nguyen et al.,
aplicación de fungicidas (Lamour et al., 2012) y 2012), Paenibacillus spp. (Naing et al., 2014),
manejo del agua (Sanogo y Ji, 2013), pero ninguna Trichoderma sp. (Segarra et al., 2013), Clitocybe
de estas prácticas de manera individual ha logra- nuda (Chen et al., 2012) Aspergillus sp. (Kang and
do controlar al patógeno por completo (Hausbeck Kim, 2004) and Bacillus spp. (Zhang et al., 2010).
y Lamour, 2004). Aunque algunos fungicidas es- The Bacillus genus has been studied more as part
pecíficos han logrado reducir la severidad de la of biological control, and species of this genus are
enfermedad en forma rápida y efectiva, su uso in- considered ideal candidates for controlling diseases
discriminado ha ocasionado la aparición de cepas due to their antagonistic potential (Zhao et al., 2013;
resistentes y contaminación al ambiente (Qi et al., Torres et al., 2016). Control mechanisms include
2012). Por lo anteriormente señalado, en la actua- the production of antibiotic and lithic enzymes,
lidad para el manejo de Phytophthora se han con- physical and chemical interference, competition,
siderado nuevas alternativas, basadas en el control host resistance induction, hyperparasitism and
biológico, estrategia importante en el manejo de predation (Pal and Gardener, 2006).
fitopatógenos que habitan en el suelo, ya que redu- The objectives of the present study were to
cen la aplicación de agroquímicos (Nguyen et al., determine how Bacillus spp. affects germinative
2012; Rios-Velasco et al., 2016). inhibition by using cells and bacterial filtrates in
Distintos microorganismos han sido reportados vitro on P. capsici zoospores and they can be used
por suprimir el crecimiento de P. capsici, incluyen- as biocontrol, in tomato and chili plants, as well as
do Streptomyces spp. (Ko et al., 2010; Nguyen et to identify those microorganisms.
al., 2012), Paenibacillus spp. (Naing et al., 2014),
Trichoderma sp. (Segarra et al., 2013), Clitocybe
nuda (Chen et al., 2012) Aspergillus sp. (Kang y MATERIALS AND METHODS
Kim, 2004) y Bacillus spp. (Zhang et al., 2010).
El género Bacillus ha sido más estudiado dentro Biological material
del control biológico y las especies de este géne-
ro se consideran candidatos ideales para el control The microorganisms used in this study were two
de enfermedades, debido a su potencial antagó- antagonistic bacterial isolates of the Bacillus genus
nica (Zhao et al., 2013; Torres et al., 2016). Los coded as B17 and B32, and a Phytophthora capsici
mecanismos de control incluyen la producción de isolate from the isolate pool at the Phytopathology
2004); adicionalmente, se identificaron mediante the cycles ended, a final extension step at 72°C for
técnicas moleculares en el Laboratorio de Fitopa- 10 min (McLaughlin et al., 2012).
tología CIAD Unidad Culiacán y en el Laborato- The PCR amplified fragments were analyzed
rio Nacional de Genómica para la Biodiversidad using 1% agarose gel electrophoresis in a
(LANGEBIO) del CINVESTAV, Campus Irapuato, PowerpacTM Basic chamber (BIO-RAD). Once
Gto., México. detected, the expected fragment from the 16S region
Para identificar los aislados bacterianos se tomó was purified and sequenced, and its nucleotidic
una colonia purificada con alrededor de 48-72 h de sequence was compared to the sequences stored in
crecimiento. La extracción de ADN, se realizó de the NCBI database (Altschul et al., 1990). Finally,
acuerdo con la metodología de Heddi et al. (1999); the obtained sequences were deposited in the NCBI
subsecuentemente se realizó la amplificación de gene bank.
gen 16S del ADNr mediante la Reacción en Cadena
de la Polimerasa (PCR), utilizando los iniciadores Inhibiting germination of P. capsici zoospores
universales FD2 (5’-AGAGTTTGATCATGGCT- using a suspension of Bacillus spp. cells
CAG-3’) y RP1 (5’-TACCTTGTTACGACTT-
CACC-3’), los cuales amplifican un fragmento de The germination inhibition bioassay was
1500 pb; la amplificación se realizó en un termo- conducted on concave slides. To induce P. capsici to
ciclador T100 TM Thermal Cycler (Singapore). Las produce sporangia, 5-mm agar disks with mycelium
condiciones de tiempo y temperatura incluyeron: of the pathogen that had been growing for 5 days
un paso inicial de activación de la enzima a 95°C were taken and placed on Petri dishes to which 10
por 5 min, un segundo paso que comprendió 30 ci- mL of distilled water were added, and incubated at
clos incluyendo una desnaturalización a 94°C por 1 25-27°C for 48 h. To release the zoospores from the
min, un paso de alineamiento a 56°C por 1 min, un sporangia, the Petri dishes were incubated at 4°C for
paso de extensión a 72°C por 1 min y cuando los 30 min (Ko et al., 2010) and a concentration of 20
ciclos se completaron, una extensión final a 72°C zoospores/µL was obtained. Each slide concavity
por 10 min (McLaughlin et al., 2012). was filled with 20 µL of the zoospore suspension
Los fragmentos obtenidos de la PCR se analiza- to which 20 µL of bacterial cell suspension of
ron mediante una electroforesis en gel de agarosa al B17 and B32 isolates at a concentration of 1 x 108
1% en una cámara PowerpacTM Basic (BIO-RAD). colony forming units (CFU) 1:1 v/v were added,
Una vez detectado el fragmento esperado corres- covered with a slide to prevent evaporation and
pondiente a la región 16S, se purificó, se secuenció incubated at 25-27°C for 24 h (Ko et al., 2010).
y se comparó su secuencia nucleotídica con se- The zoospores that were not inoculated with the
cuencias disponibles en la base de datos del NCBI bacterial cell suspension were used as a control.
(Altschul et al., 1990); por último, las secuencias To obtain the percentage of zoospore germination
obtenidas fueron depositadas en el banco de genes inhibition in the bioassays where cell suspension
del NCBI. and bacterial filtrates were used, 100 zoospores
Inhibición germinativa de zoosporas de P. capsi- from each concavity were counted using an optical
ci mediante el uso de suspensión celular de Ba- microscope (Carl Zeiss AXIO Imager.A2) with
cillus spp. an integrated camera (AxioCam ERc5s) and 10x
and 40x objectives. Each treatment had seven
El bioensayo de inhibición germinativa se lle- replications and the experiment was conducted in
vó a cabo en portaobjetos cóncavos. Para inducir la duplicate.
formación de esporangios de P. capsici, se tomaron
discos de 5 mm de agar con micelio del patógeno Inhibition of zoospore germination using
con 5 días de crecimiento, éstos se colocaron en bacterial filtrates
cajas Petri con 10 mL de agua destilada e incubada
a 25-27°C por 48 h. Para la liberación de zoosporas The bacterial filtrate was made by placing in an
del esporangio, las cajas Petri se incubaron a 4°C Erlenmeyer flask 50 mL of nutrient broth and 200
por 30 min (Ko et al., 2010), logrando una con- µL of spore suspension of the B17 and B32 bacterial
centración de 20 zoosporas/µL. Se colocaron 20 isolates at a concentration of 1 x 108 UFC. The flasks
µL de suspensión de zoosporas en cada concavidad were incubated at 30°C in an orbital shaker (140
del portaobjeto, se añadió 20 µL de suspensión ce- rpm) for 6 days. The cultures were filtered using
lular bacteriana de los aislados B17 y B32 a una 0.22 µm Millipore® filters to remove bacterial cells
concentración de 1 x 108 UFC 1:1 v/v, se cubrió (Chen et al., 2016b). To inhibit germination, 20
con un cubreobjetos para prevenir la evaporación, µL of the zoospore suspension (20 zoospores/µL),
y se incubó por 24 h a 25-27°C (Ko et al., 2010). mixed with 20 µL of bacterial filtrate (1:1 v/v),
Las zoosporas que no fueron inoculadas con la were placed in the slide cavity, covered with a slide
suspensión celular bacteriana se utilizaron como to prevent evaporation and then incubated at 25-
testigo. El porcentaje de inhibición germinativa 27°C for 24 h (Ko et al., 2010). Zoospores without
de zoosporas, para los bioensayos con suspensión bacterial filtrate were used as a control.
celular y filtrados bacterianos, se registró al con-
tabilizar la germinación de 100 zoosporas en cada Antagonism of Bacillus spp. against P. capsici in
concavidad con la ayuda de un microscopio óptico vivo using cell suspension and bacterial filtrates
(Carl Zeiss AXIO Imager.A2), con cámara integra- in tomato and chili plants
da (AxioCam ERc5s) con los objetivos 10x y 40x.
Cada tratamiento contó con siete repeticiones y el For the present study we used Malinche hybrid
experimento se realizó por duplicado. tomato seedlings and SV3198HJL hybrid chili
seedlings 3 three weeks after germination. The P.
Inhibición germinativa de zoosporas mediante capsici pathogen was inoculated directly into the
el uso de filtrado bacteriano root of both crops using 1 mL of the zoospore
suspension (1 x 103/mL) on both crops, followed
El filtrado bacteriano se obtuvo al colocar en un by inoculation with 10 mL of the bacterial cell
matraz Erlenmeyer, 50 mL de caldo nutritivo con suspension (1 x 108/mL) or their filtrates. All the
200 µL de una suspensión de esporas de los aisla- treatments were applied under the same conditions.
dos bacterianos B17 y B32 con una concentración The level of disease severity or damage was
de 1 x 108 UFC. Los matraces se incubaron a 30°C measured based on a scale for root neck rot
en un agitador orbital (140 rpm) por 6 días. Los symptoms that was proposed by Segarra et al.
cultivos se filtraron utilizando filtros Millipore® de (2013) and modified as follows: 0 = symptomless
0.22 µm para eliminar las células bacterianas (Chen plants, 1 = damage symptoms ˂ 10 mm, 2 = 10-
et al., 2016b). Para la inhibición de la germinación, 19 mm rotted, 3 = 20-30 mm rotted, and 4 = ˃ 30
se colocaron 20 µL de suspensión de zoosporas (20 mm rotted. The percentage of damage severity
zoosporas/µL) en la cavidad del portaobjeto, mez- was calculated using the following formula:
clado con 20 µL del filtrado bacteriano (1:1 v/v), se GDxNP
% SD = ∑ x100 where % DS= percentage
cubrieron con cubreobjetos para prevenir la evapo- EMxTP
ración y se incubaron por 24 h a 25-27 °C (Ko et of damage severity; GD= level of damage; NP=
al., 2010). Las zoosporas sin filtrado bacteriano se number of damaged plants; EM= maximum level
utilizaron como testigo. of damage on the severity scale; and TP= number
of plants included in the treatment (Shanmugam
Antagonismo de Bacillus spp. sobre P. capsici in and Kanoujia, 2011; Li et al., 2012). The control
vivo, con el uso de suspensión celular y filtrados effectiveness was calculated using the following
bacterianos en plantas de tomate y chile. 100 − SD del tratamiento
formula: % EC − x100 where
SD del control
Las plántulas que se utilizaron para este estudio % EC = percentage of the control effectiveness;
fueron, de tomate híbrido Malinche y de chile hí- treatment SD = average damage severity per
brido SV3198HJ con 3 semanas de desarrollo des- treatment; control SD = average damage severity
pués de la germinación. La inoculación del patóge- on the control (Li et al., 2012). The experiment
no P. capsici fue directa a la raíz, se colocó 1 mL de included three replications per treatment and was
suspensión de zoosporas (1 x 103/mL) para ambos conducted in duplicate in the glasshouse. We used
cultivos, en seguida fueron inoculadas con 10 mL a pot with three seedlings as the experiment unit.
de suspensión de células bacterianas (1 x 108/mL) This study was conducted on two different dates,
o sus filtrados, las condiciones fueron las mismas and the analyzed data were reported as evaluation
para todos los tratamientos. averages.
La severidad del daño o enfermedad se midió
de acuerdo a una escala de síntomas de pudri- Statistical analyses
ción del cuello de raíz propuesta por Segarra et
al. (2013) con la modificación de: 0 indica plan- A completely randomized design was used in
ta sin síntomas, 1 = síntomas de daños ˂ 10 mm, both bioassays, in vitro and in vivo and the data
2 = 10 a 19 mm de pudrición, 3 = 20 a 30 mm obtained were analyzed using a variance analysis
de pudrición y 4 = ˃ de 30 mm de pudrición. El (ANOVA) and the Minitab 17 statistical program.
porcentaje de la severidad del daño se calculó me- We used Tukey’s test (p≤0.05) to compare the
GDxNP means.
diante la fórmula: % SD = ∑ x100 dónde:
EMxTP
Ambos aislados resultaron Gram positivos y fla- treatments, 24 h after being released from the
gelos perítricos. Las medidas celulares del aislado sporangium, zoospores showed 100% germination.
B17 oscilaron entre 2.0 a 3.2 µm de longitud; a su The B. amyloliquefaciens isolate caused 88.15%
vez, el tamaño celular del aislado B32 fue de 3.0 a germinative inhibition, but the B. thuringiensis
4.5 µm; además, en este aislado se observó la pre- isolate was more effective and caused 97.05%
sencia de cristales parasporales (proteína Cry), co- inhibition (Table 1).
incidiendo con las características más importantes
de las bacterias pertenecientes al género Bacillus, Inhibition of P. capsici zoospore germination
las cuales son de forma bacillar, movilidad por fla- using Bacillus spp. filtrates
gelos insertados en forma perítrica, tamaño celular
de 0.5-2.5 y 1.2-10 µm y tinción Gram positivas. Bacillus amyloliquefaciens bacterial filtrates
inhibited 24.3% of P. capsici zoospore germination
Identificación molecular in vitro, while B. thuringiensis filtrates produced
49.35% inhibition. The control showed 100%
Las secuencias obtenidas mediante la técni- germination (Table 1).
ca molecular de PCR de los aislados B17 y B32,
mostraron una identidad del 99 al 100% con Ba- Severity of damage caused by P. capsici using
cillus amyloliquefaciens y Bacillus thuringiensis cell suspension and bacterial filtrates in tomato
respectivamente al ser comparadas con secuencias and chili plants.
ya reportadas en la base de datos del Gen Bank
(NCBI); las secuencias fueron depositadas en la
base de datos donde se les asignó el No. de acceso The results indicate that in plants treated with
KX953161.1 para la cepa B17 y KX953162.1 para a B. thuringiensis cell suspension, the disease
B32. incidence was 38.89% in chili and 22.22% in
tomato plants, while in plants treated with a B.
Inhibición germinativa de zoosporas de P. capsi- amilolyquefaciens cell suspension, the incidence
ci mediante el uso de suspensión celular de Ba- was 61.11% in chili and 27.78% in tomato. When
cillus spp. the plants were inoculated with filtrates of B.
amilolyquefaciens and B. thuringiensis, the level
Los resultados muestran que ambas bacterias of severity of neck rot symptoms was greater than
inhiben la germinación de zoosporas; así como, 90% and 70% in chili plants and 60% and 40% in
deformación en el tubo germinativo después de 24 tomato plants, respectively (Table 2).
h (Figuras 1 y 2). En los tratamientos testigo, las
zoosporas a las 24 h después de ser liberadas del Biological effectiveness of Bacillus spp. on
esporangio presentaron un 100% de germinación. P. capsici using cell suspension and bacterial
La cepa de B. amyloliquefaciens causó 88.15% de filtrates in tomato and chili plants.
inhibición germinativa; mientras que, la cepa B.
thuringiensis fue más efectiva al causar un 97.05% The obtained results show that in chili and
de inhibición (Cuadro 1). tomato plants inoculated with a cell suspension of
Figura 2. La morfología de la zoospora de P. capsici germinada con y sin tratamiento bacteriano (suspensión celular o filtra-
dos) de B. amyloliquefaciens y B. thuringiensis. (A) Zoospora germinada sin inoculación. (B y C) tubo germinativo
anormal y zoosporas sin geminación y (D) las paredes de la zoospora de P. capsici se lisaron cuando fueron tratadas
con suspensión celular de B. amyloliquefaciens y B. thuringiensis. Las fotografías fueron tomadas bajo microscopio
con objetivo (40x) en campo claro.
Figure 2. Morphology of a P. capsici germinated zoospore with and without B. amyloliquefaciens and B. thuringiensis bacte-
rial treatment (cell suspension or filtrates). (A) Germinated zoospore without inoculation. (B y C) Unusual ger-
minative tube and non-germinated zoospores, and (D) P. capsici zoospore cells became bare when treated with B.
amyloliquefaciens and B. thuringiensis cell suspension. The photographs were taken under a bright-field micro-
scope with objective (40x).
Inhibición germinativa de zoosporas de P. cap- Cuadro 1. Inhibición de germinación de las zoosporas (P.
capsici) mediante el uso de suspensión celular
sici mediante el uso de filtrado de Bacillus spp. y filtrados de B. amyloliquefaciens y B. thurin-
giensis, 24 h después de la inoculación.
Table 1. Inhibition of (P. capsici) zoospores germination
Los filtrados bacterianos de B. amyloliquefa- using B. amyloliquefaciens and B. thuringiensis
ciens inhibieron la germinación de zoosporas de cell suspension and filtrates 24 h after inoculation.
P. capsici a nivel in vitro 24.3%; mientras que con
% de inhibición de la
los filtrados de B. thuringiensis se obtuvo 49.35% Tratamientos germinaciónx + DE
de inhibición. En el testigo se observó el 100% de Suspensión Cel. Filtrados
germinación (Cuadro 1).
Control (Agua) 0.00 ay 0.00 a
B. amyloliquefaciens 88.15±2.519 b 24.30±6.280 b
Severidad de daño causada por P. capsici con el B. thuringiensis 97.05±1.191 c 49.35±5.031 c
uso de suspensión celular y filtrados bacterianos x
Las medias con letras distintas son significativamente diferen-
en plantas de tomate y chile. tes (ANDEVA), de acuerdo a la prueba de Tukey (P ≤ 0.05) /
x
Means with different letters are significantly different (ANO-
VA), according to Tukey’s test (P ≤ 0.05).
Los resultados indican que las plantas tratadas y
Inhibición germinativa = (Número de zoosporas germinadas/
Total de zoosporas) x 100 (Chen et al., 2016b). DE = Des-
con suspensión celular de B. thuringiensis, pre- viación estándar / yGermination inhibition = (Number of ger-
sentan una incidencia de la enfermedad en ambos minated zoospores/Total of zoospores) x 100 (Chen et al.,
2016b). SD= Standard deviation.
cultivos de 38.89% en plantas de chile y 22.22%
en tomate; mientras que, las plantas tratadas con
suspensión celular de B. amilolyquefaciens, se ob-
serva 61.11% de incidencia de la enfermedad en B. thuringiensis, the efficacy of the biocontrol was
plantas de chile y 27.78% en tomate. Cuando las higher than 60 and 77%, respectively, while in the
plantas fueron inoculadas con filtrados de B. amilo- plants treated with bacterial filtrates, the efficacy
lyquefaciens y B. thuringiensis, la severidad de los was lower than 28 and 56%, respectively (Table
síntomas de la pudrición del cuello fue mayor 90 y 3). The biocontrol efficacy of the cell suspension
70% en plantas de chile y 60 y 40% en plantas de of B. amyloliquefaciens in chili was only 38.89%,
tomate respectivamente (Cuadro 2). while in tomato it was significantly higher, more
than 72%. However, the biocontrol efficacy of its
Eficacia biológica de Bacillus spp. sobre P. cap- bacterial filtrates was lower than 6 and 38% in chili
sici, con el uso de suspensión celular y filtrados and tomato plants, respectively (Table 3, Figure 3).
bacterianos en plantas de tomate y chile.
P. capsici 0 cy 0d
S. Cel. B. amyloliquefaciens-P. capsici 38.89±3.61 b 72.25±2.20 a
S. Cel. B. thuringiensis-P. capsici 61.11±5.03 a 77.78±0.00 a
Filtrado B. amyloliquefaciens-P. capsici 5.56±7.78 c 38.89±3.61 c
Filtrado B. thuringiensis-P. capsici 27.78±3.38 b 55.56±0.00 b
x
Las medias que no comparten una letra son significativamente diferentes
(ANDEVA), de acuerdo a la prueba de Tukey (P≤0.05) / xMeans that do not
share a letter are significantly different (ANOVA), according to Tukey’s test
(P≤0.05).
y
Eficacia de control = (100 - media de severidad de daño por tratamiento)/(me-
dia de severidad de daño del control) x 100 (Li et al., 2012). DE = Desviación
estándar / yEffectivenes of the control = (100 - average severity of damage
per treatment)/(average severity of damage from the control) x 100 (Li et al.,
2012). SD= Standard deviation.
de B. amyloliquefaciens mostró una eficacia de reduce the damage caused by P. capsici in tomato
biocontrol en plantas de chile tan solo de 38.89%; and chili seedlings, the use of biocontrol organisms
mientras que, en tomate fue significante con más could be a promising alternative (Bae et al., 2016;
del 72%; sin embargo, la eficacia de biocontrol de Thampi and Bhai, 2017).
Cuadro 2. Severidad de daño por P. capsici en plántulas de chile y tomate tratadas con suspensión celular
y filtrados de B. amyloliquefaciens y B. thuringiensis después de 7 d de inoculación.
Table 2. Table 2. Severity of damage caused by P. capsici in chili and tomato seedlings treated with B. amy-
loliquefaciens and B. thuringiensis cell suspension and filtrates 7 d after inoculation.
sus filtrados bacterianos estuvo por debajo de 6 y Since the microorganisms of the Bacillus genus
38% en plantas de chile y tomate respectivamente are found mainly in the soil, in this study we used two
(Cuadro 3, Figura 3). bacterial isolates whose morphological traits belong
to that genus. Using molecular techniques, the B17
isolate was identified as B. amyloliquefaciens, and
DISCUSIÓN isolate B32 was in alignment with B. thuringiensis
and B. cereus. However, different authors, such
La enfermedad producida por P. capsici es muy as Sánchez et al. (2016), mention that one of the
importante debido a que afecta a cultivos de im- main differences between B. thuringiensis and
portancia económica como tomate y chile (Agrios B. cereus is that they produce parasporal crystals
2005; Hansen et al., 2012). Tomando en cuenta esta (Cry protein), a characteristic of B. thuringiensis
situación, y a que el control químico y la mayoría observed in the B32 isolate.
de las prácticas culturales no representan herra- It was also demonstrated that they show the effect
mientas efectivas para disminuir la incidencia de of biocontrol and P. capsici zoospore germination
daño por este patógeno en plántulas de tomate y inhibition in tomato and chili seedlings, because
chile, el uso de organismos de biocontrol pueden P. capsici zoospore germination inhibition in
ser una alternativa promisoria (Bae et al., 2016; vitro was 88.15±2.5 and 97.05±1.19% when we
Thampi y Bhai, 2017). used cell suspensions of B. amyloliquefaciens
Figura 3. Eficacia de control de la enfermedad ocasionada por P. capsici en plántulas de chile y tomate mediante el uso de
suspensión celular o filtrados de B. amyloliquefaciens y B. thuringiensis. Las plántulas fueron inoculadas con 1
µL de zoosporas 1x103 y 10 µL de suspensión celular o filtrado. (A) daño por P. capsici en plántulas de chile, (B)
plántulas de chile con P. capsici+suspensión celular de B. thuringiensis, (C) daño por P. capsici en tomate y (D)
plántulas de tomate con P. capsici+suspensión celular de B. thuringiensis.
Figure 3. Effectiveness to control the disease caused by P. capsici in chili and tomato seedlings using B. amyloliquefaciens
and B. thuringiensis cell suspension or filtrates. The seedlings were inoculated with 1 µL of 1x103 zoospores and
10 µL of cell suspension or filtrate. (A) damage caused by P. capsici in chili seedlings, (B) chili seedlings with P.
capsici+cell suspension of B. thuringiensis, (C) damage caused by P. capsici in tomato, and (D) tomato seedlings
using P. capsici+cell suspension of B. thuringiensis.
que contenían quitina, papa y sucrosa, alcanzaron several antifungal cyclic lipopeptides (CLPs),
una inhibición de la germinación de zoosporas del including members of the surfactin, iturine and
100%, lo que demuestra que los agentes de biocon- fengycin families (Torres et al., 2016). It has been
trol son más eficientes en presencia del patógeno a demonstrated that lipopeptides belonging to the
controlar, que si se encuentran en condiciones que iturine, fengycin and surfactin families, are the most
no amenacen su desarrollo. Esto se demostró al uti- important compounds in the biocontrol activity of
lizar filtrados bacterianos de B. amyloliquefaciens Bacillus isolates against different phytopathogenic
y B. thuringiensis, sobre una suspensión de zoospo- fungi in different plant species (Masmoudi et al.,
ras de P. capsici, donde se observó una inhibición 2017; Abdallah et al., 2017). Therefore, using
de la germinación de 24.30±6.28 y 49.35±5.03% Bacillus to control fungal diseases would be a great
respectivamente, mucho menor a la que se observó opportunity for agricultural biotechnology.
al utilizar la suspensión celular. Several authors have reported B. amyloliquefaciens
Durante los experimentos in vivo, se observó una as a biocontrol option for different pathogens (Yu
severidad de daño del 61.11±6.49 y 38.89±4.18% al and Lee., 2013; Wei et al., 2015; Zhang et al., 2015;
utilizar suspensión celular de B. amyloliquefaciens Torres et al., 2016; Chen et al., 2016b; Abdallah
y B. thuringiensis respectivamente, mientras que el et al., 2017). However, there are no reports on P.
control presentó el 100% de daño. Algunas espe- capsici control of tomato and chili in which B.
cies de Bacillus son promisorias dentro del biocon- amyloliquefaciens shows effective biocontrol;
trol, debido a su capacidad de producir una varie- therefore, based on the results obtained in the
dad de metabolitos antibacterianos y antifúngicos present study, more research on this microorganism
(Zhi et al., 2017). Debido a su versatilidad como must be conducted. Bacillus thuringiensis has also
productores de compuestos bioactivos, se están es- proven to be efficient mainly for controlling insects
tudiando diferentes especies de Bacillus para va- in different crops and fruits after harvest (Zheng et
rias aplicaciones potenciales (Torres et al., 2017). al., 2013; Deepak and Jayapradha 2015; Kim et al.,
Por ejemplo, muchas cepas de Bacillus producen 2017). Mojica-Marín et al. (2009) reported they
una variedad de lipopéptidos cíclicos antifúngicos controlled chili wilting using B. thuringiensis, but
(CLP), incluyendo miembros de las familias sur- their study was directly conducted on germination
factina, iturina y fengicina (Torres et al., 2016). Se of seeds inoculated with P. capsici, where 62 to
ha demostrado que los lipopéptidos pertenecientes 93% germination was observed on treated seeds.
a las familias iturina, fengicina y surfactina son los However, information on the use of B. thuringiensis
compuestos más importantes en la actividad de bio- for controlling P. capsici in tomato and chili
control de cepas de Bacillus contra diferentes hon- seedlings is almost nil.
gos fitopatógenos de diferentes especies de plantas
(Masmoudi et al., 2017; Abdallah et al., 2017). Por
lo tanto, el control de las enfermedades fúngicas CONCLUSIONS
por los Bacillus, representaría una oportunidad re-
levante para la biotecnología agrícola. The cell suspensions of B. amyloliquefaciens
Varios autores han reportado a B. amyloliquefa- and B. thuringiensis species produced significantly
ciens como una alternativa de biocontrol para dife- higher inhibition than their filtrates on P. capsici
rentes patógenos (Yu y Lee., 2013; Wei et al., 2015; zoospores. They also showed biological control
Zhang et al., 2015; Torres et al., 2016; Chen et al., potential in tomato and chili crops against P. capsici.
2016b; Abdallah et al., 2017); sin embargo, para This result suggests that these microorganisms
el biocontrol de P. capsici en cultivos de tomate y produce secondary metabolites that have biological
chile no existen reportes donde B. amyloliquefa- activity and can thus be used as P. capsici biocontrol
ciens presente un biocontrol efectivo, por lo que, agents in tomato and chili plants. Therefore,
de acuerdo con los resultados obtenidos en este more studies are required to identify secondary
estudio, es necesario más investigación con este metabolites or bioactive compounds produced by
microorganismo. Así mismo, B. thuringiensis ha these bacteria, as well as to assess their antifungal
demostrado ser eficiente principalmente en el con- capacity.
trol de insectos, en distintos cultivos y frutos pos-
cosecha (Zheng et al., 2013; Deepak y Jayapradha End of the English version
Chen YY, Chen PCh and Tsay TT. 2016 b. The biocontrol effi- Lamour KH, Stam R, Jupe J and Huitema E. 2012. The oomy-
cacy and antibiotic activity of Streptomyces plicatus on the cete broad-host-range pathogen Phytophthora capsici. Mo-
oomycete Phytophthora capsici. Biological Control 98:34- lecular Plant Pathology 13:329-337. DOI: 10.1111/j.1364-
42. [Link] 3703.2011.00754.x
Deepak R and Jayapradha R. 2015. Lipopeptide biosurfac- Li CH, Shi L, Han Q, Hu HL, Zhao MW, Tang CM and Li SP.
tant from Bacillus thuringiensis pak 2310: A potential 2012. Biocontrol of verticillium wilt and colonization of
antagonist against Fusarium oxysporum. Journal de My- cotton plants by an endophytic bacterial isolate. Journal of
cologie Médicale 25:15-24. [Link] Applied Microbiology 113:641-651. DOI: 10.1111/j.1365-
med.2014.10.011 2672.2012.05371.x
Erwin D and Ribeiro O. 1996. Phytophthora Diseases World- Masmoudi F, Khedher SB, Kamoun A, Zouari N, Tounsi S
wide. Minnesota. The American Phytopathological Socie- and Trigui M. 2017. Combinatorial effect of mutagenesis
ty. 562 p. and medium component optimization on Bacillus amylo-
González ChMM, Villordo PE, Pons HJL, Delgadillo SF, Pa- liquefaciens antifungal activity andefficacy in eradicating
redes MR, Godoy HH, Anaya LJL, Gámez VFP, Medina Botrytis cinerea. Microbiological Research. 197:29-38.
CT, Rodríguez GR, Ruiz CE, Ruiz LA, Cárdenas BR, Cár- [Link]
denas AJR, Torres PI, Rendón PE, Martínez SJ, Mojarro McLaughlin RW, Chen M, Zheng J and Wang D. 2012. Analy-
DF, Villaseñor EOM y Guerrero ABZ. 2009. Guía para el sis of the bacterial diversity in the fecal material of the
manejo de la marchitez del chile en Guanajuato. Primera endangered Yangtze finless porpoise, Neophocaena pho-
Edición. Prometeo Editores, S. A. de C. V. CEPROCH- caenoides asiaeorientalis. Molecular Biology Reports
Guanajuato. México, D. F. 34 pp. 39(5):5669-5676. DOI: 10.1007/s11033-011-1375-0
Gómez RO, Corona TT and Aguilar RVH. 2017. Differen- Mojica-Marín V, Luna-Olvera HA, Sandoval-Coronado CF,
tial response of pepper (Capsicum annuum L.) lines to Pereyra-Aferez B, Mrales-Ramos LH, Gonzalez-Aguilar
Phytophthora capsici and root-knot nematodes. Crop NA, Hernandez-Luna CE y Alvarado-Gomez OG. 2009.
Protection 92:148-152. [Link] Control biológico de la marchitez del chile (Capsicum
pro.2016.10.023 annuum L.) por Bacillus thuringiensis. Revista Interna-
Hansen EM, Reeser PW and Sutton W. 2012. Phytophtho- cional de Botánica Experimental 78:105-110. Disponi-
ra beyond agriculture. Annual Review of Phytopa- ble en línea: [Link]
thology 50:359-378. [Link] [Link]
phyto-081211-172946 Naing KW, Anees M, Nguyen XH, Lee YS, Jeon SW, Kim
Hausbeck MK and Lamour KH. 2004. Phytophthora capsici SJ, Kim MH and Kim KY. 2014. Biocontrol of late blight
on vegetable crops: research progress and management disease (Phytophthora capsici) of pepper and the plant
challenges. Plant Disease 88:1292-1303. [Link] growth promotion by Paenibacillus ehimensis KWN38.
org/10.1094/PDIS.2004.88.12.1292 Journal of Phytopathology 162:367-376. DOI: 10.1111/
Heddi A, Grenier AM, Khatchadourian C, Charles H and jph.12198
Nardon P. 1999. Four intracellular genomes direct weevil Nguyen XH, Naing KW, Lee YS, Tindwa H, Lee GH, Jeong
biology: Nuclear, mitochondrial, principal endosymbiont BK, Ro HM, Kim SJ, Jung WJ and Kim KY. 2012. Bio-
and Wolbachia. Proceedings of the National Academy control potential of Streptomyces griseus H7602 against
of Sciences of the United States of America 96:6814- root rot disease (Phytophthora capsici) in pepper. The
6819. Disponible en línea: [Link] Plant Pathology Journal 28(3):282-289. DOI: 10.5423/
tent/96/12/[Link] [Link].03.2012.0040
Kang SW and Kim SW. 2004. New antifungal activity of Pal KK and Gardener BM. 2006. Biological control of plant
Penicillium acid against Phytophthora species. Biote- pathogens. The Plant Health Instructor. [Link]
chnology Letters 26:695-698. [Link] org/10.1094/PHI-A-2006-1117-02
B:BILE.0000024090.96693.a4 Qi R, Wang T, Zhao W, Li P, Ding J and Gao Z. 2012. Activity
Khan MA, Cheng Z, Xiao X, Khan AR and Ahmed SS. 2011. of ten fungicides against Phytophthora capsici isolates re-
Ultrastructural studies of the inhibition effect against sistant to Metalaxyl. Journal Phytopathology 160:717-722.
Phytophthora capsici of root exudates collected from two DOI:10.1111/jph.12009
garlic cultivars along with their qualitative analysis. Crop Rios-Velasco C, Caro-Cisneros JN, Berlanga-Reyes DI, Ruíz-
Protection 30:1149-1155. [Link] Cisneros MF, Ornelas-Paz JJ, Salas-Marina MA, Villalo-
pro.2011.04.013 bos-Pérez E and Guerrero-Prieto VM. 2016. Identification
Kim HS, Noh S and Park Y. 2017. Enhancement of Bacillus and antagonistic activity in vitro of Bacillus spp. and Tri-
thuringiensis Cry1 Ac and Cry1 Ca toxicity against Spo- choderma spp. isolates againts common phytopathogenic
doptera exigua (Hubner) by suppression of a chitin syntha- fungi. Revista Mexicana de Fitopatología 34:84-99. http://
se B gene in midgut. Journal of Asia-Pacific Entomology [Link]: 10.18781/[Link].1507-1
20:199-205. DOI: 10.1016/[Link]. 2016.12.015 Sánchez J, Correa M y Castañeda-Sandoval LM. 2016. Baci-
Ko WH, Tsou YJ, Lin MJ and Chern LL. 2010. Activity and llus cereus un patógeno importante en el control micro-
characterization of secondary metabolites produced by a biológico de los alimentos. Revista Facultad Nacional de
new microorganism for control of plant diseases. New Bio- Salud Pública 34(2):230-242. DOI: 10.17533/[Link].
technology 27:397-402. DOI: 10.1016/[Link].2010.05.014 v34n2a12
Sanogo S and Ji P. 2013. Water management in relation to Wei Z, Huang J, Yang Ch, Xu Y, Shen Q and Chen W. 2015.
control of Phytophthora capsici in vegetable crops. Agri- Screening of suitable carriers for Bacillus amyloliquefa-
cultural Water Management 129:113-119. [Link] ciens strain QL-18 to enhance the biocontrol of tomato
org/10.1016/[Link].2013.07.018 bacterial wilt. Crop Protection 75:96-103. [Link]
Segarra G, Aviles M, Casanova E, Borrero A and Trillas I. org/10.1016/[Link].2015.05.010
2013. Effectiveness of biological control of Phytophthora Yang R, Fan X, Cai X and Hu F. 2015. The inhibitory me-
capsici in pepper by Trichoderma asperellum strain T34. chanisms by mixtures of two endophytic bacteria strains
Phytopathology Mediterranea 52(1):77-83. [Link] isolated from Ginkgo biloba against pepper phytophtho-
[Link]/11441/30458 ra blight. Biological Control 85:59-67. [Link]
Shanmugam V and Kanoujia N. 2011. Biological management org/10.1016/[Link].2014.09.013
of vascular wilt of tomato caused by Fusarium oxysporum Yu SM and Lee YH. 2013. Effect of light quality on Bacillus
f. sp. lycospersici by plant growth-promoting rhizobac- amyloliquefaciens JBC36 and its biocontrol efficacy. Bio-
terial mixture. Biological Control 57:85-93. [Link] logical Control 64:203-210. [Link]
org/10.1016/[Link].2011.02.001 control.2012.11.004
SIAP (Servicio de Información Agroalimentaria y Pesquera). Zhang JX, Gu YB, Chi FM, Ji ZR, Wu JY, Dong QL and Zhou
2016. Cierre de la producción agrícola por estado. www. ZS. 2015. Bacillus amyloliquefaciens GB1 can effectively
siap. [Link]. control apple valsa canker. Biological Control 88:1-7.
Thampi A and Bhai RS. 2017. Rhizosphere actinobacteria for [Link]
combating Phytophthora capsici and Sclerotium rolfsii, Zhang S, White TL, Martinez MC, Mclnroy JA, Kloepper
the major soil borne pathogens of black pepper (Piper JW and Klassen W. 2010. Evaluation of plant growth-
nigrum L.). Biological Control 109:1-13. [Link] promoting rhizobacteria for control of Phytophthora
org/10.1016/[Link].2017.03.006 blight on squash under greenhouse conditions. Biologi-
Torres MJ, Brandan CP, Sabaté DC, Petroselli G, Erra-Balsells cal Control 53:129-135. [Link]
R and Audisio MC. 2017. Biological activity of the lipo- trol.2009.10.015
peptide-producing Bacillus amyloliquefaciens PGPBac- Zhao P, Quan C, Wang Y, Wang J and Fan S. 2013. Baci-
CA1 on common bean Phaseolus vulgaris L. pathogens. llus amyloliquefaciens Q-426 as a potential biocontrol
Biological Control. 105:93-99. [Link] agent against Fusarium oxysporum f. sp. spinaciae. Jo-
biocontrol.2016.12.001 urnal of Basic Microbiology 54:448-456. DOI: 10.1002/
Torres MJ, Perez Brandan CP, Petroselli G, Erra-Balsells R jobm.201200414
and Audisio MC. 2016. Antagonistic effects of Bacillus Zheng M, Shi J, Shi J, Wanga Q and Li Y. 2013. Antimicrobial
subtilis subsp. subtilis and B. amyloliquefaciens against effects of volatiles produced by two antagonistic Bacillus
Macrophomina phaseolina: SEM study of fungal changes strains on the anthracnose pathogen in postharvest mangos.
and UV-MALDI-TOF MS analysis of their bioactive com- Biological Control 65:200-206. [Link]
pounds. Microbiological Research 182:31-39. [Link] biocontrol.2013.02.004
org/10.1016/[Link].2015.09.005 Zhi Y, Wu Q and Xu Y. 2017. Production of surfactin from
Wang CK, Liang CY, Chu CH and Lin MJ. 2011. Genetic waste distillers’ grains by co- culture fermentation of
comparison of sexual and asexual reproduction of Phyto- two Bacillus amyloliquefaciens strains. Bioresource Te-
phthora capsici. Plant Pathology Bulleting 20:98-107. chnology 235:96-103. [Link]
Disponible en línea: [Link] tech.2017.03.090
abstract/20123409244
María Eugenia Rentería-Martínez, Miguel Ángel Guerra-Camacho, Andrés Ochoa-Meza, Sergio Fran-
cisco Moreno-Salazar*, Laboratorio de Biología Molecular, Departamento de Agricultura y Ganadería, Uni-
versidad de Sonora, Carretera Hermosillo-Bahía Kino Km. 21, Hermosillo, Sonora, CP. 83000, México; Ale-
jandro Varela-Romero, Luis Enrique Gutiérrez-Millán, Posgrado en Biociencias, Departamento de Inves-
tigaciones Científicas y Tecnológicas, Universidad de Sonora, Luis Donaldo Colosio S/N, Colonia Centro,
Hermosillo, Sonora, CP. 83000, México; Amparo del Carmen Meza-Moller, Universidad Estatal de Sonora,
Avenida Ley Federal del Trabajo S/N, Colonia Apolo, Hermosillo, Sonora, CP. 83000, México. *Autor para
correspondencia: smoreno@[Link].
Rentería-Martínez ME, Guerra-Camacho MA, Ochoa- Abstract. The state of Sonora is one of the main
Meza A, Moreno-Salazar SF, Varela-Romero A, Gu- producers of watermelons in Mexico. Each year,
tiérrez-Millán LE, Meza-Moller AC. 2018. Multilocus agricultural producers deal with phytosanitary
phylogenetic analysis of fungal complex associated with issues like soilborne pathogens. In this study the
root rot watermelon in Sonora, Mexico. Revista Mexica- presence of phytopathogenic fungi associated
na de Fitopatología 36(2): 233-255. to watermelon root rot was analyzed in the main
DOI: 10.18781/[Link].1710-1 production regions of Sonora. Morphological
analysis revealed three genera: Fusarium (73%),
Primera publicación DOI: 09 de Marzo, 2018. Ceratobasidium (20%) and Rhizoctonia (6%).
First DOI publication: March 09, 2018. Through a multilocus phylogenetic analysis (ITS1,
TEF and RPB2 for Fusarium; ITS1 and RPB2 for
Rhizoctonia and Ceratobasidium), the following
Resumen. El estado de Sonora es uno de los species were identified: Fusarium falciforme, F.
principales productores de sandía en México. Cada brachygibbosum and F. oxysporum. In addition to
año, los productores locales enfrentan problemas this, two anastomosic groups for Ceratobasidium
fitosanitarios, provocados principalmente por hon- sp. (AG-F y AG-A) and two for Rhizoctonia spp.
gos del suelo. En el presente estudio se analizó (AG-4 y AG-6) were identified. Pathogenicity
la presencia de hongos patógenos asociados con assays showed that the representative isolates
pudrición de raíz en plantas de sandía en las dos from these five different species caused root rot
zonas de mayor producción en Sonora. El análisis wounds and wilting in watermelon plantlets 21
morfológico reveló la presencia de tres géneros de days post inoculation. In this study, F. falciforme is
hongos: Fusarium (73%), Ceratobasidium (20%) y reported for the first time and anastomosic groups
Rhizoctonia (6%). Mediante un análisis filogenéti- for Rhizoctonia and Ceratobasidium are defined as
co multilocus (ITS1, TEF y RPB2 para Fusarium; causal agents of watermelon root rot in the region.
ITS1 y RPB2 para Rhizoctonia y Ceratobasidium),
se identificó a: F. falciforme, F. brachygibbosum y Key words: MLST, Fusarium, Ceratobasidium,
F. oxysporum; además de dos grupos anastomósi- Rhizoctonia
cos de Ceratobasidium sp. (AG-F y AG-A) y dos
de Rhizoctonia sp. (AG-4 y AG-6). Aislados repre-
sentativos de estas cinco especies causaron pudri- Mexico is the world’s leading exporter of
ción de raíz y marchitez de plántulas de sandía a los watermelon, with 23% of the total worldwide
21 días después de su inoculación. En este estudio supply of the fruit (FAO, 2014), mainly to the United
se informa por primera vez de F. falciforme y se States, Canada and the Netherlands. In the last ten
define a nivel de grupos anastomósicos las cepas de years, world exports have grown to an average rate
Rhizoctonia y Ceratobasidium como causantes de of 8% a year (SAGARPA, 2014). Sonora is the
pudrición radicular en sandía en la región. main producer of watermelon (Citrullus lanatus)
in Mexico. In 2016, over 9 thousand hectares of
Palabras clave: análisis multilocus, Fusarium, Ce- this crop were planted in this state (SIAP, 2017).
ratobasidium, Rhizoctonia However, one of the limiting factors in Sonora’s
watermelon production are root diseases. In 2013,
in certain watermelon plantations in the valleys of
México es el principal exportador de sandía en Guaymas and the Coast of Hermosillo in Sonora,
el mundo, aportando 23% de este fruto al comercio areas that concentrate over 96% of the surface in
mundial (FAO, 2014), principalmente a Estados the state with this crop, it was observed that before
Unidos, Canadá y los Países Bajos. En los últimos physiological maturity, certain plants presented
diez años las exportaciones han crecido a una tasa yellowing and wilting of leaves; days later, the
promedio anual de 8% (SAGARPA, 2014). Sonora plants died. A visual analysis showed the presence
es el principal productor de sandía (Citrullus la- of lesions and rotting in the cortex of the base of the
natus) en México. En 2016 se plantaron más de 9 stem and the top section of the main root, as well
000 ha en este estado (SIAP, 2017). No obstante, as rotting in the main and secondary roots, typical
uno de los factores limitantes en la producción de of diseases caused by fungi (Meza-Möller et al.,
sandía en este estado, son las enfermedades radi- 2014).
culares. En 2013, en ciertas plantaciones de sandía To date there is no knowledge on work
establecidas en los valles de Guaymas y la Costa published concerning the fungal complexes related
de Hermosillo en Sonora, regiones que concentran to root rotting in watermelon plants grown in
alrededor del 96 % de la superficie estatal estable- Sonora; diagnoses are generally based only on the
cida con este cultivo, se observó que, previamente symptoms of the crop and, in the best of cases, on
a su madurez fisiológica, ciertas plantas presenta- the morphology of the colonies and the observation
ron un amarillamiento y marchitamiento de hojas; of reproductive structures. It is frequently
días después las plantas murieron. El análisis visual mentioned that the root diseases in watermelon
demostró la presencia de lesiones y pudrición en la plants produced in the area are due to the attack
corteza de la base del tallo y la parte superior de la of Fusarium oxysporum, Fusarium solani or
raíz principal, además de pudriciones en las raíces Rhizoctonia solani.
principales y secundarias, típicas de las enferme- The species belonging to the genus Fusarium
dades ocasionadas por hongos (Meza-Möller et al., (Nectriaceae, Hypocreales, Sordariomycetes,
2014). Ascomycota), are ubiquitous and economically
A la fecha no se tiene conocimiento de trabajos very important in agriculture, since most of them
publicados acerca del complejo de hongos asocia- are pathogenic for plants. Some of their species also
dos a la pudrición de raíces en las plantas de sandía produce toxins harmful to humans and animals. This
cultivadas en Sonora; generalmente los diagnósti- monophyletic group is composed of 20 clades that
cos se basan solo en la sintomatología del cultivo y include over 300 species. With some exceptions,
en el mejor de los casos en la morfología de las co- the Fusarium species produce the multi-shafted,
lonias y observación de estructuras reproductivas. macroconidial features and spindle shapes; but
Recurrentemente se menciona que las enfermeda- there are also other morphological characteristics
des radiculares de sandía cultivada en la región son that help to tell species apart (O’Donnell et al.,
debidas al ataque de: Fusarium oxysporum, Fusa- 2013; Geiser et al., 2013; O’Donnell et al., 2015).
rium solani o Rhizoctonia solani. In the Rhizoctonia complex, the hyphal
Las especies pertenecientes al género Fusarium morphology and configuration of the septum help
(Nectriaceae, Hypocreales, Sordariomycetes, As- differentiate the genera, whereas species can be told
comycota), son ubicuas y de gran importancia eco- apart by the number of nuclei present in the somatic
nómica en la agricultura, ya que muchas de ellas son cells of young hyphae and the thickness of the guide
patógenas para las plantas. Algunas de sus especies hyphae, or by the morphometric characteristics of
también producen toxinas nocivas para humanos y the sexual reproductive structures (Cedeño, 2008).
animales. Este grupo monofilético está conformado The group of multinuclear Rhizoctonia includes R.
por 20 clados que incluyen más de 300 especies. solani, R. zeae and R. oryzae.
Con algunas excepciones, las especies de Fusarium R. solani [teleomorph: Thanatephorus
producen las características macroconidias multi- cucumeris] (Ceratobasidiaceae: Cantharellales:
septadas y con forma de huso; pero además exis- Agaricomycetes: Basidiomycota), groups a
ten otras características morfológicas que permiten heterogenous mixture of strains that cause root
diferenciar entre especies (O’Donnell et al., 2013; rotting in many crops around the world (González,
Geiser et al., 2013; O’Donnell et al., 2015). 2013). According to the hyphal fusion analysis
En el complejo Rhizoctonia, la morfología hifal (anastomosis), these strains are split into 14
y configuración del septo permiten diferenciar los anastomosic groups (AG), labelled between AG-1
géneros; mientras que las especies pueden ser dis- and AG-13, plus AG-BI (Carling et al., 2002).
tinguidas por el número de núcleos presentes en las The group of binuclear Rhizoctonia corresponds
células somáticas de hifas jóvenes y el grosor de las to the teleomorphs Ceratobasidium spp. and
hifas guías, o por las características morfométricas Tulasnella spp. According to Sharon et al. (2008),
de las estructuras reproductivas sexuales (Cedeño, Ceratobasidium is composed of 21 anastomosic
2008). El grupo de Rhizoctonia multinucleadas in- groups identified as AG-A to AG-U, some of which
cluye a R. solani, R. zeae y R. oryzae. are highly pathogenic in different plant species.
R. solani [teleomorfo: Thanatephorus cucume- In the past, fungus taxonomy was based on the
ris] (Ceratobasidiaceae: Cantharellales: Agari- morphology of their reproductive structures in the
comycetes: Basidiomycota), agrupa una mezcla he- anamorphic state. The concept of morphological
terogénea de cepas causantes de pudrición radicu- species still prevails as the most common diagnostic
lar en muchos cultivos alrededor del mundo (Gon- method to differentiate fungal species, since the
zález, 2013). De acuerdo al análisis de fusión hifal morphological characteristics of individuals are
(anastomosis), estas cepas se separan en 14 grupos easily traceable and comparable. However, this
anastomósicos (AG), designados desde AG-1 hasta method is unable to find differences between
AG-13 más AG-BI (Carling et al., 2002). El grupo nearby species, underestimating the true fungal
de Rhizoctonia binucleadas corresponde a los te- diversity (Taylor et al., 2000).
leomorfos Ceratobasidium spp. y Tulasnella spp. The molecular techniques based on
De acuerdo a Sharon et al. (2008), Ceratobasidium DNA analysis surpass the disadvantages of
consta de 21 grupos anastomósicos identificados morphological identification, since they are quick,
como AG-A hasta AG-U, algunos de los cuales son precise, objective and applicable to a large number
altamente patogénicos en diferentes especies vege- of samples. They help differentiate between
tales. genotypes and to establish genetic variability
En el pasado la taxonomía de hongos se basaba indices within a population (Narayanasamy, 2011).
en la morfología de sus estructuras reproductivas en In recent years, the concept of phylogenetic species
el estado anamórfico. El concepto de especie mor- between filamentous fungi has become increasingly
fológica aún prevalece como el método de diagnós- popular, based on the consistency of multiple DNA
tico más usual para diferenciar entre especies de gene sequences; this phylogenetic approach helps
hongos, debido a que los caracteres morfológicos define species better (Taylor et al., 2000; Choi et
de los individuos son fácilmente detectables y com- al., 2013).
parables. Sin embargo, no es un método capaz de Since White et al. (1990) published the
detectar diferencias entre especies cercanas, subes- sequences of primers that allowed the amplification
timando la verdadera diversidad fúngica (Taylor et and sequencing of sections of the rDNA operon,
al., 2000). an interest arose in phylogenetic research, which
Las técnicas moleculares basadas en análisis de now dominates fungal taxonomy. The sequencing
ADN superan las desventajas de la identificación of the ITS fragments of rDNA continues to be
morfológica ya que son rápidas, precisas, objetivas the most widely accepted approach in molecular
y aplicables a un gran número de muestras. Permi- mycology to classify and identify specimens or
ten diferenciar entre genotipos y establecer índices cultures of unknown fungi. However, its resolution
de variabilidad genética existente dentro de una in taxonomic relations of a higher level is inferior
población (Narayanasamy, 2011). En años recien- to many other genes. Numerous studies have been
tes se ha popularizado el concepto de especie filo- carried out to identify loci with characteristics
genética entre los hongos filamentosos, basado en of adequate primary barcodes. The AFTOL
la concordancia de secuencias de múltiples genes (Assembling the fungal tree of life) project,
de ADN; este enfoque filogenético permite definir completed in 2008, has established a phylogeny
mejor las especies (Taylor et al., 2000; Choi et al., based on the amplification of genes RPB1, RPB2,
2013). nucLSU, nucSSU, mtSSU, TEF1α and mtATP6
Desde que White et al. (1990) publicaron las se- (Stielow et al., 2015). Knowing the species
cuencias de cebadores que permitieron la amplifi- that cause a disease is crucial for their adequate
cación y secuenciación de secciones del operón de management and control.
rDNA, surgió un marcado interés en la investiga- Based on this, the aim of the present investigation
ción filogenética, que ahora domina la taxonomía was to identify the fungus species that cause rotting
fúngica. La secuenciación de los fragmentos ITS of the roots in watermelon plants in the Coast of
de rDNA, sigue siendo el enfoque más ampliamen- Hermosillo and Valley of Guaymas in Sonora,
te aceptado en la micología molecular para clasifi- based on morphological and multilocus phylogeny
car e identificar especímenes o cultivos de hongos analyses.
desconocidos. Sin embargo, su resolución en rela-
ciones taxonómicas de nivel superior es inferior a
muchos otros genes. Numerosos estudios se han MATERIALS AND METHODS
realizado para identificar loci con características de
código de barras primarias adecuadas. El proyecto Sampling: The study was carried out during the
AFTOL (Assembling the fungal tree of life), com- spring-summer cycles of 2013 and 2014, in four
pletado en 2008, ha establecido una filogenia basa- commercial fields, two of which were located on
da en la amplificación de los genes: RPB1, RPB2, the Coast of Hermosillo (CH1, CH2) and two in
nucLSU, nucSSU, mtSSU, TEF1α y mtATP6 (Stie- the Valley of Guaymas (VG1, VG2), in Sonora,
low et al., 2015). El conocimiento de las especies Mexico, which account for 10% of the state’s
causantes de una enfermedad es indispensable para surface used for the production of watermelon.
su adecuado manejo y control. The varieties planted in these fields were Sugar
En base a lo anterior, el objetivo del presente Red, SuperSeedless 7187HQ F1 and Precious
trabajo fue identificar las especies de hongos cau- Petit. In each cycle, 40 plants (10 plants per field)
santes de pudrición radicular en plantas de sandía were collected at random in the areas with wilting
en la Costa de Hermosillo y Valle de Guaymas en and dryness of runners . The samples were placed
Sonora, en base a análisis morfológicos y de filoge- in polyethylene bags, which were labelled and
nia multilocus. transported in containers with ice to the laboratory
for processing.
MATERIALES Y MÉTODOS Fungal isolation. The plant roots were washed using
water, dried with paper towels, and cut into 1 cm
Muestreo: El estudio se realizó durante los ciclos pieces. Segments were taken from the crown, main
primavera-verano 2013 y 2014, en cuatro campos root and secondary roots. They were disinfected by
comerciales, dos localizados en la Costa de Her- submerging them for 2 min in a solution prepared
mosillo (CH1, CH2) y dos en el Valle de Guaymas with sodium hypochlorite at 6%, ethyl alcohol at
(VG1, VG2), en Sonora, México que representan 96% and sterilized distilled water in a 1:1:8 ratio,
el 10% de la superficie establecida con sandía en respectivly. They were then placed in dishes with
el estado. Las variedades cultivadas en estos cam- agar-water at 2%. The dishes were incubated at
pos fueron Sugar Red, SuperSeedless 7187HQ F1 25 ± 0.1 °C until the mycelium produced from
y Precious Petit. En cada ciclo se colectaron alea- the pieces of plant allowed for the extraction of a
toriamente 40 plantas (10 plantas por campo) en hypha tip. The hypha tips were planted successfully
las zonas donde se observaba marchitez y secazón in Potato Dextrose Agar (PDA) supplemented with
de guías. Las muestras fueron colocadas en bolsas a solution of streptomycin/neomycin and incubated
de polietileno etiquetadas y transportadas en con- at 25 ± 0.1 °C, until a pure culture was obtained.
tenedores con hielo al laboratorio para su procesa-
miento. Morphological and cultural characterization. All
isolates were grouped based on the characteristics
Aislamiento fúngico. Las raíces de plantas enfer- of the cultures and the color developed on both sides
mas se lavaron con agua, se secaron con papel se- of the PDA plate. A representative of each group
cante y se cortaron en pedazos de 1 cm. Se tomaron was used for the morphological characterization.
segmentos de la corona, raíz principal y raíces se- In the isolations with characteristics of Fusarium
cundarias. Se desinfestaron sumergiéndolos por 2 the presence and morphology of microconidia,
min en una solución preparada con hipoclorito de macroconidia, and Chlamydospores was
sodio al 6%, alcohol etílico al 96% y agua destilada established from their growth in carnation leaf agar
esterilizada en proporción 1:1:8, respectivamente. (CLA), after seven days in the dark at 25 ± 0.1 °C
Posteriormente se enjuagaron dos veces con agua (Leslie and Summerell, 2006). The isolations with
destilada estéril, se secaron en papel secante esté- characteristics of Rhizoctonia genus were identified
ril y se colocaron en cajas con agar-agua al 2%. by observing vegetative characteristics such as the
Las cajas se incubaron a 25 ± 0.1 °C hasta que el color of the mycelium, septa, constrictions near
micelio emergido de los trozos vegetales permitió the ramifications, during growth in PDA or Malt
tomar una punta de hifa. Las puntas de hifas fueron Extract Agar (MEA). To determine the number
cultivadas sucesivamente en Agar Dextrosa y Papa of nuclei, hyphae were stained with trypan blue
(PDA) suplementado con una solución de estrepto- in lactophenol. Growth rate was determined in
micina/neomicina e incubados a 25 ± 0.1 °C, hasta PDA, keeping the cultures at 25 ± 0.1 °C and
obtener un cultivo puro. photoperiods of 14h/10h of light/darkness. The
diameter of the culture was measured every 24 h
Caracterización morfológica y cultural. Todos until the mycelium covered the dish completely
los aislados fueron agrupados en base a las carac- (Sneh et al., 1996). All isolations were initially
terísticas de las colonias y al color desarrollado en identified up to the genus level.
el anverso y reverso de la caja de PDA. Un aislado
representativo de cada grupo fue utilizado para la DNA Extraction. A mycelia from pure cultures
caracterización morfológica. En los aislados con in PDA were taken with a sterile microbiological
características de Fusarium se determinó la pre- spatula and placed in a tube of the Kit Power Soil
sencia y morfología de microconidias, macroconi- DNA Isolation (MoBIO Laboratories, California,
dias y clamidosporas a partir de su crecimiento en U.S.A.). Cell lysis was carried out in a Precellys
agar hojas de clavel (CLA), después de siete días Evolution Homogenizer (Bertin Technologies,
en oscuridad a 25 ± 0.1 °C (Leslie and Summerell, France), stirring the tubes at 6500 rpm for three
2006). Los aislados con características del género 20 s cycles with 20 s pauses. DNA integrity
Rhizoctonia se identificaron mediante la observación was verified in a 2% agarose gel. The extracted
de características vegetativas como la coloración del DNA was quantified in the NanoDrop 1000
ITS1 TCCGTAGGTGAACCTGCGG
ITS ≈ 550 White et al. (1990)
ITS4 TCCTCCGCTTATTGATATGC
EF1 ATGGGTAAGGARGACAACAC
TEF-1a ≈ 700 O’Donnell et al. (1998)
EF2 GGARGTACCAGTSATCAT
RPB2-5F2 GGGGWGAYCAGAAGAAGGC
RPB2x ≈ 900 O’Donnell et al. (2013)
fRPB2-7cR CCCATRGCTTGYTTRCCCAT
RPB2-980F TGYCCIGCIGARACICCHGARGG
RPB2z ≈ 674 González et al. (2016)
fRPB2-7cR CCCATRGCTTGYTTRCCCAT
x
Específicos para el género Fusarium / Specific to the genus Fusarium.
z
Específicos para el género Rhizoctonia / Specific to the genus Rhizoctonia.
reverse (IDT Technologies) a una concentración 10 the National Center for Biotechnology Information
mM, 1 μl de ADN a una concentración de 1 ng/ml (NCBI), in which the sequences from regions ITS
y agua grado biología molecular hasta obtener un and RPB2 of Rhizoctonia spp. were also compared,
volumen final de 25 μl. Los productos de PCR se using the “Basic local alignment search tool”
separaron mediante electroforesis en gel de agarosa (BLAST) (Altschul et al., 1990).
al 2%, mezclados previamente con GelRed (Bio-
tium Inc) en 5X Green GoTaq reaction buffer (Pro- Phylogenetic analysis. The Fusarium species
mega) 15 μl:1ml. Se visualizaron en luz UV (Di- and the anastomosic groups of Rhizoctonia and
giDoc-It™, UVP) observando el tamaño del am- Ceratobasidium were determined separately in
plicón y su pureza. La purificación se realizó con two data matrices. In each case, several alignments
ExoSAP-IT PCR Product Cleanup (Affymetrix) were carried out using the software Clustal Omega
o mediante el corte de bandas del tamaño espera- (Sievers et al., 2011). The sequences were linked
do con el kit Wizard® SV Gel and PCR Clean-Up and edited using the software UltraEdit32. The
System (Promega). Los amplicones purificados se phylogenetic analysis of each data matrix was
secuenciaron en ambas direcciones con el equipo carried out separately under the criterion of
ABI 3730xl DNA Analyzer (Applied Biosystems) Maximum Likelihood Estimation (MLE) with the
en GENEWIZ. Cada secuencia se revisó manual- software PAUP 4.0a152 (Swofford, 2002). The
mente y los nucleótidos en posiciones ambiguas best nucleotide substitution model was established
se corrigieron con las secuencias complementarias using ModelTest (Posada and Crandall, 1998).
obtenidas con ambos primers, usando el software The trees were viewed and modified in FigTree and
ChromasPro v2.1.6. Las secuencias de las regio- exported to graphic editors. The consensus trees for
nes ITS, RPB2 y TEF de Fusarium se compararon Rhizoctonia spp. and Fusarium spp., were rooted
mediante alineamiento, con las contenidas en las using Botryobasidium simile (isolation GEL2348)
bases de datos: Fusarium MLST ([Link] and Neofusicoccum parvum (strain CCF216),
[Link]/Fusarium), Fusarium ID ([Link] respectively.
[Link]) y National Center for Biotechnology
Information (NCBI), donde también se compara- Pathogenicity tests. In compliance with Koch’s
ron las secuencias de las regiones ITS y RPB2 de postulates, to assure that the isolates obtained were
Rhizoctonia spp., mediante la herramienta “Basic the causal agents of the root rotting in watermelon
local alignment search tool” (BLAST) (Altschul plants, a monosporic culture was chosen at
et al., 1990). random from each one of the species identified
in the molecular analysis. The treatments were:
Análisis filogenético. La determinación de las es- 1) Non-inoculated control, 2) F. falciforme, 3) F.
pecies de Fusarium y de los grupos anastomósicos oxysporum, 4) F. brachygibbosum, 5) R. solani,
de Rhizoctonia y Ceratobasidium, se realizó por 6) Ceratobasidium sp, 7) F. brachygibbosum + F.
separado en dos matrices de datos. En cada caso, se solani, 8) F. brachygibbosum + F. oxysporum, 9) R.
realizaron múltiples alineamientos usando el soft- solani + Ceratobasidium sp. 10) Ceratobasidium
ware Clustal Omega (Sievers et al., 2011). La con- sp. + F. solani and 11) Ceratobasidium sp. +
catenación y edición de las secuencias se realizó F. oxysporum. Healthy plants of the varieties
con el software UltraEdit32. El análisis filogenéti- SuperSeedless 7187HQ F1 and Precious Petit,
co de cada matriz de datos se realizó por separado aged 21 days, established in pots with a mixture
bajo el criterio de Máxima Verosimilitud (MV) con of soil and perlite (1:3). Six plants were inoculated
el software PAUP 4.0a152 (Swofford, 2002). Se es- for each treatment. Each plant was treated with
tableció el mejor modelo de sustitución de nucleó- rotting and discoloration of vascular bundles,
tidos con ModelTest (Posada y Crandall, 1998). typical symptoms of damages by Fusarium spp.
Los árboles se visualizaron y modificaron en Four discs, 8 mm in diameter, were placed around
FigTree y se exportaron a editores gráficos. Los the root. Healthy plants treated with sterile PDA
árboles consenso para Rhizoctonia spp. y Fusa- discs were used as controls. The pots were placed
rium spp., se enraizaron con Botryobasidium simile in a controlled environment chamber at 25 ± 0.1 °C,
(aislado GEL2348) y Neofusicoccum parvum (cepa with a photoperiod of 14h/10h day/night, until the
CCF216), respectivamente. appearance of symptoms. Irrigation was carried
out based on water requirements, and a Hoagland
Pruebas de patogenicidad. En cumplimiento con nutrient solution was applied on a weekly basis.
los postulados de Koch, para comprobar que los The number of disease plants was observed. The
aislados obtenidos son los agentes causales de la percentage of infected roots was determined using
pudrición de raíz en plantas de sandía, se selec- ten root segments from each plant. These tissue
cionó aleatoriamente un cultivo monospórico de fragments were disinfected separately and placed
cada una de las especies identificadas en el análi- in PDA. The evaluation was carried out observing
sis molecular. Los tratamientos fueron: 1) Testigo the development of mycelia after seven-day
sin inocular, 2) F. falciforme, 3) F. oxysporum, 4) incubation.
F. brachygibbosum, 5) R. solani, 6) Ceratobasi-
dium sp, 7) F. brachygibbosum + F. solani, 8) F.
brachygibbosum + F. oxysporum, 9) R. solani + RESULTS
Ceratobasidium sp. 10) Ceratobasidium sp. + F.
solani y 11) Ceratobasidium sp. + F. oxysporum. Damages observed during sampling. Figure 1A
Se utilizaron plantas sanas de las variedades Super- shows the damages observed in the crop. Plants
Seedless 7187HQ F1 y Precious Petit, de 21 días de with symptoms displayed different types of rotting
edad, establecidas en macetas con una mezcla de in the crown, stem, roots and rootlets. One type of
suelo:perlita (1:3). Se inocularon seis plantas por lesion was small, concave or not, brownish (Figure
cada tratamiento. Cada planta se trató con micelio 1B) and moist-looking, typical in Rhizoctonia sp.
de cinco días de crecimiento en PDA. Se colocaron In certain cases, this type of lesions was observed
cuatro discos de 8 mm de diámetro alrededor de to have small pustules. In other plants, lesions were
la raíz. Plantas sanas tratadas con discos de PDA light brown, discolored and with vascular beam rot,
estéril se utilizaron como testigo. Las macetas se typical in symptoms of damages by Fusarium spp.
colocaron en una cámara de ambiente controlado a (Figure 1C).
25 ± 0.1 °C, con un fotoperiodo de 14h/10h día/no-
che, hasta la aparición de los síntomas. El riego se Isolation and morphology of the colonies and
realizó en base a los requerimientos hídricos y cada reproductive structures of fungi. A total of
semana se aplicó solución nutritiva de Hoagland. 45 fungal isolates were obtained from the four
Se observó el número de plantas enfermas. El por- sampling sites, and in each one, at least one species
centaje de raíces infectadas se determinó utilizando of Rhizoctonia and Fusarium was isolated. The
diez segmentos de raíz de cada planta. Estos frag- distribution of species by site is shown in Figure 2.
mentos de tejido se desinfectaron por separado y se The morphological analysis helped to form two
colocaron en PDA. La evaluación se realizó obser- groups of isolates. One group was formed of 13
vando el desarrollo de micelio después de 7 días de isolations that presented colonies with abundant
incubación. aerial hyphae, ivory-colored at first, turning light
brown or brown after 7 days. In these isolations,
hyphae were robust, with branches in right angles,
RESULTADOS constriction of the ramification and the formation of
a septum near the point of origin, without spores, all
Daños observados durante el muestreo. La Figu- of which are typical characteristics of Rhizoctonia
ra 1A muestra los daños observados en el cultivo. sp. (Sneh et al., 1996). Average growth rate was
Las plantas sintomáticas presentaron diferentes ti- 1.25 mm h-1. Nuclei staining revealed the presence
pos de pudrición en la corona, tallo, raíces y raici- of isolates with both binuclear and multinuclear
llas. Un tipo de lesiones fueron pequeñas, hundidas cells (Figure 3).
y no hundidas, de color marrón (Figura 1B) y de The second group of 32 isolates showed
aspecto húmedo, típicas de Rhizoctonia sp. En cier- the formation of macroconidia, microconidia,
tos casos este tipo de lesiones se observaron con chlamydospores and monophyalides in CLA,
pequeñas pústulas. En otras plantas las lesiones typical of Fusarium sp., according to descriptions
Figura 1. Daños en plantas cultivadas de sandía. A) Daño en campo, B) Raíces de plantas enfermas, C) Daño vascular.
Figure 1. Damage on planted watermelon crops. A) Damage on the field, B) Roots of diseased plants, C) Vascular damage.
Núm. de aislados
15 F. solani
Aislamiento y morfología de las colonias y es-
tructuras reproductivas de los hongos. En total,
10
se obtuvieron 45 aislados fúngicos provenientes de
los cuatro sitios de muestreo y en cada sitio se aisló
5
al menos una especie de Rhizoctonia y Fusarium.
La distribución de especies por sitio se muestra en 0
la Figura 2. CH1 CH2 VG1 VG2
El análisis morfológico permitió formar dos
grupos de aislados. Un grupo formado de 13 aisla- Figura 2. Distribución de especies de hongos patogénicos,
por sitios de muestreo. CH1= Costa de Hermosi-
dos que presentaron colonias con abundantes hifas llo 1. CH2=Costa de Hermosillo 2. VG1=Valle de
aéreas, de color marfil al inicio, tornándose café Guaymas 1. VG2=Valle de Guaymas 2.
Figure 2. Distribution of pathogenic fungi species, by
claro o marrón después de siete días. En estos ais- sampling sites. CH1= Coast of Hermosillo 1.
lados las hifas fueron robustas con ramificaciones CH2=Coast of Hermosillo 2. VG1=Valley of
Guaymas 1. VG2=Valley of Guaymas 2.
en ángulo recto, constricción de la ramificación y
formación de un septo cercano al punto de origen,
sin presencia de esporas, características típicas de by Leslie and Summerell (2006). Twenty-five
Rhizoctonia sp. (Sneh et al., 1996). La velocidad de isolations fit the description of F. solani: cream-
crecimiento promedio fue de 1.25 mm h-1. La tin- colored colonies with red to dark gray pigments
ción de núcleos reveló la presencia tanto de aisla- in the obverse oval-shaped microconidia without
dos con células binucleadas, como multinucleadas septa, long monophyalides, single or paired
(Figura 3). chlamydospores, abundant straight macroconidia
El segundo grupo de 32 aislados mostró la with 3 to 5 septa. Other 2 presented typical
formación de macroconidias, microconidias, cla- characteristics for F. oxysporum: cottonlike mycelia,
midosporas y monofiálides en CLA, típicas de scarce white to pale violet and purple color in the
Fusarium sp., según las descripciones de Leslie agar; short monophyalides. The rest of the isolates
y Summerell (2006). 25 aislados se ajustaron a la produced white mycelia, which turned pink, with
descripción de F. solani: colonias color crema con yellow sporodochia; oval unicellular microconidia,
pigmentos rojo a gris oscuro en el anverso, micro- produced in monophyalides, curved macroconidia
conidias ovales sin septos, monofiálides largas, cla- with 3 to 5 septa, with wide central cells, slightly
midosporas solas o en pares, abundantes macroco- pointy apex, single or chained chlamydospores
nidias rectas con 3 a 5 septos. Otros 2 presentaron (Figure 3). No isolations were found with different
características propias de F. oxysporum: micelio morphology to Rhizoctonia or Fusarium.
algodonoso, escaso blanco a violeta pálido y mora-
do en el agar; monofiálides cortas. El resto de los Molecular identification and phylogenetic
aislados produjo micelio blanco, el cual se torna- analysis of fungi. A first BLAST analysis from
ba rosado, con esporodoquios de color amarillo; the region between the internal transcribed spacers
Identificación molecular y análisis filogenético the form of lesions in the roots and the base of
de los hongos. Un primer análisis BLAST a par- the stem. All the isolation and their combinations
tir de la región comprendida entre el espaciador caused the death of the plants after 21 days. Table
transcrito interno I y II (ITS1-ITS2) de todos los 3 shows the percentage of infected roots in each
aislados, permitió determinar que 25 secuencias treatment. Control plants presented no symptoms.
tenían un 99-100% de similitud a F. solani; 5 a F.
brachygibbosum, 2 a F. oxysporum, 10 a Cerato-
basidium sp. y 3 secuencias a Rhizoctonia solani DISCUSSION
también con 99-100% de similitud con secuencias
homólogas de NCBI. Although Sonora is the main watermelon
El análisis filogenético bajo el criterio de MV producing state in Mexico, there are no formal
para el género Fusarium se realizó con la matriz reports on the fungi related to rotting. The
concatenada de las secuencias de los genes ITS, pathological data in this investigation show that,
RPB2 y TEF1 de los 32 aislados de este estudio individually or in a group, at least five different
y de 25 cepas de referencia depositadas en co- fungal species caused root rot, which led to
lecciones de cultivos (Al-Hatmi et al., 2016). El death of watermelon plants before they reached
mejor modelo de sustitución de nucleótidos fue physiological maturity, during the formation
TIM2+I+G. Se consideraron 1816 nucleótidos en and development of fruits. The characteristics
el conjunto de datos. El análisis multilocus permi- of the colonies, morphology, nuclei staining and
tió definir la identidad correcta de los aislados ini- phylogenetic analysis of sequences helped to
cialmente propuestos como F. solani, ya que éstos identify two species of the Ceratobasidiaceae
forman un clado separado con 100 % de similitud family: Rhizoctonia solani and Ceratobasidium
con los aislados tipo de F. falciforme. Un integran- sp., and three of the Fusarium genus: F. falciforme,
te del complejo de especies de Fusarium solani F. oxysporum and F. brachygibbosum, showing
(FSSC). La identidad de F. brachygibbosum y F. that there is a diverse community of fungi causing
oxysporum fue corroborada (Figura 4). root rot in watermelon planted in the Coast of
Un análisis similar, se realizó con las secuencias Hermosillo and the Valley of Guaymas, Sonora.
de los aislados de Rhizoctonia y Ceratobasidium The predominant species was found to be F.
sp. Se procesó una matriz integrada por las regio- falciforme, with 25 isolations from three fields
nes ITS y RPB2 de 49 aislados, incluyendo los del of the two sites sampled. Initially, this fungus
presente estudio y 36 cepas de referencia (Can- was identified as the polytypic morphospecies F.
tharellales), obtenidas de colecciones de cultivos solani. Based on the linked phylogenetic analysis
(González et al., 2016). El mejor modelo de susti- of the regions ITS, TEF-1α and RPB2 using ML,
tución de nucleótidos fue GTR+I+G. Se considera- a separate clade is formed within the Fusarium
ron 1355 nucleótidos de cada aislado en el conjun- solani Species Complex (FSSC). This complex
to de datos. Este análisis estableció la identidad de groups at least 60 different species that, because of
dos grupos anastomósicos para el género, AG-4 y the similarity in the morphology of their conidia,
AG-6 y dos para el género Ceratobasidium, AG-A are known as cryptic species. They have a wide
y AG-F. (Figura 5). El Cuadro 2 muestra la iden- range of hosts and have been subdivided into
tidad y los números de accesión de las secuencias formae speciale, depending on the specificity of the
obtenidas. host (O’Donnell et al., 2015). Recent phylogenetic
Figura 4. Filogenia por MV de las secuencias concatenadas de los genes ITS, EF y RPB2 de 8 aislados de Fusarium spp. (en
negritas) representativos de 29 obtenidos de plantas de sandía con marchitez y pudrición de raíz. Bootstrap de
1000 réplicas; grupo externo: Neofusicoccum parvum.
Figure 4. Phylogeny by MV of the chained sequences of the genes ITS, EF and RPB2 of 8 Fusarium spp. isolations (in bold)
representative of 29 obtained from watermelon plants with wilting and root rot. Bootstrap of 1000 replications;
external group: Neofusicoccum parvum.
Figura 5. Filogenia por MV de las secuencias concatenadas de los genes ITS y RPB2 de 8 aislados de Rhizoctonia spp. (en
negritas) representativos de 16 obtenidos de plantas de sandía con marchitez y pudrición de raíz. Bootstrap de
1000 réplicas; grupo externo: Botryobasidium simile. AG=Grupo anastomósico.
Figure 5. Figure 5. Phylogeny by MV of the chained sequences of the genes ITS, EF and RPB2 of 8 Rhizoctonia spp. isola-
tions (in bold) representative of 16 obtained from watermelon plants with wilting and root rot. Bootstrap of 1000
replications; external group: Botryobasidium simile. AG=Anastomotic group.
*= Aislados considerados en el análisis filogenético. FSSC= Fusarium solani Species Complex. FSSCa= Fusarium sambucinum
Species Complex. FOSC= Fusarium oxysporum Species Complex. CH1= Costa de Hermosillo1, CH2= Costa de Hermosillo2,
VG1= Valle de Guaymas1, VG2= Valle de Guaymas. AG=Grupo anastomósico. - = sin dato / *= Isolations considered in the
phylogenetic analysis. FSSC= Fusarium solani Species Complex. FSSCa= Fusarium sambucinum Species Complex. FOSC=
Fusarium oxysporum Species Complex. CH1= Coast of Hermosillo1, CH2= Coast of Hermosillo2, VG1= Valley of Guaymas1,
VG2= Valley of Guaymas. AG= Anastomosic group. - = Without data.
Pruebas de patogenicidad: La aparición de sínto- analyses have revealed that each formae speciale
mas en las plantas ocurrió después de 14 días de su belongs to a biologically and phylogenetically
inoculación, en forma de lesiones en la raíz y base different species (Coleman, 2016; O’Donnell et al.,
del tallo. Todos los aislados y sus combinaciones 1998). F. falciforme has been reported as a causal
causaron la muerte de las plantas después de 21 Cuadro 3. Porcentaje de raíces infectadas en las pruebas
de patogenicidad.
días. El Cuadro 3 muestra el porcentaje de raíces Table 3. Percentage of infected roots in the pathogenicity
infectadas en cada tratamiento. Las plantas testigo tests.
no presentaron síntomas.
SS-7187 Precious
Tratamiento
HQ F1 Petit
Testigo 0 0
DISCUSIÓN
F. solani 23 66
F. oxysporum 71 75
Aun cuando el estado de Sonora es el principal F. brachygibbosum 87 100
productor de sandía en México, no se tienen Rhizoctonia solani 54 84
Ceratobasidium 48 100
reportes formales acerca de los hongos asociados F. solani + F. brachygibbosum 55 100
a la pudrición de raíz. Los datos patológicos en esta F. oxysporum + F. brachygibbosum 55 100
investigación demuestran que individualmente o R. solani + Ceratobasidium 71 100
F. solani + Ceratobasidium 40 80
en conjunto, al menos cinco especies diferentes de F. oxysporum + Ceratobasidium 100 100
hongos causan pudrición radicular y eventualmente
la muerte de plantas de sandía antes de alcanzar su
madurez fisiológica, al momento de la formación agent of wilting and root rot in lima bean plants
y desarrollo de frutos. Las características de las and chickpea in Brazil (Sousa et al., 2017, Cabral
colonias, la morfología, la tinción de núcleos y el et al., 2016).
análisis filogenético de secuencias permitió identi- Five F. brachygibbosum isolations belonging
ficar dos especies de la familia Ceratobasidiaceae: to Fusarium sambucinum Species Complex
Rhizoctonia solani y Ceratobasidium sp. y tres del (FSSC) were identified in three sampling sites.
género Fusarium: F. falciforme, F. oxysporum y F. The characteristics of the colonies coincide with
brachygibbosum, lo que demuestra que hay una co- the first description published (Padwick, 1945),
munidad diversa de hongos causando pudrición de they present abundant white to pink aerial mycelia
raíz en sandía cultivada en la costa de Hermosillo y white to amber sclerotia of up to 2.0 mm in
el Valle de Guaymas, Sonora. diameter, oval or fusiform conidia, hyperbolically
La especie predominantemente encontrada fue curved macroconidia, terminal or alternated
F. falciforme, con 25 aislados provenientes de tres chlamydospores, single or in chain, generally
campos de los dos sitios muestreados. Inicialmente, unicellular. As a preliminary product of this
este hongo fue identificado como la morfoespecie investigation, F. brachygibbosum was reported for
politípica F. solani. Con base en el análisis filoge- the first time as a pathogenic agent, causing this
nético concatenado de las regiones ITS, TEF-1α y wilting in watermelon seeds (Rentería-Martínez
RPB2 usando MV se forma un clado separado den- et al., 2015). It has recently been recorded as a
tro del Fusarium solani Species Complex (FSSC). causal agent of rotting in the stem of maize plants
Este complejo agrupa por lo menos a 60 diferentes (Shan et al., 2017), wilting and regressive death in
especies que, por similitud en la morfología de sus Euphorbia larica and olive trees (Al-Mahmooli et
conidias, son llamadas especies crípticas. Cuen- al., 2013; Trabelsi et al., 2017) and of rotting and
tan con un amplio rango de hospederas y han sido cankers in almond and chestnut trees (Stack et al.,
subdvididas en formae speciale, dependiendo de la 2017; Marek et al., 2013).
especificidad al hospedero (O’Donnell et al., 2015). F. oxysporum f. sp. niveum belongs to the
Análisis filogenéticos recientes han revelado que Fusarium oxysporum Species Complex (FOSC);
cada formae speciale corresponde a una especie, it was only isolated from the fields located in
biológica y filogenéticamente distinta (Coleman, the Valley of Guaymas. The components of
2016; O’Donnell et al., 1998). F. falciforme ha sido FOSC cause vascular wilting and root rot in over
reportado como agente causal de marchitamiento y 100 different plant species, and based on their
pudrición de raíz en frijol lima y garbanzo en Brasil specificity with the host, there have been reports of
(Sousa et al., 2017, Cabral et al., 2016). over 80 formae speciale. In this sense, an accurate
Se identificaron cinco aislados de F. brachy- diagnosis, even before symptoms appear, is crucial
gibbosum perteneciente a Fusarium sambucinum for the management of crops (López-Mondéjar et
Species Complex (FSSC) en tres sitios de muestreo. al., 2012).
Las características de las colonias coinciden con la Regarding the Ceratobasidiaceae family,
primera descripción publicada (Padwick, 1945), binuclear Rhizoctonia (teleomorph: Ceratobasidium
presenta micelio aéreo abundante de blanco a rosa, sp.) was the species with the widest distribution,
esclerocios de blanco a ámbar de hasta 2.0 mm de since it was isolated from all the fields sampled,
diámetro, conidias ovoides a fusiformes, macroco- and most frequently, in field No. 2 of the Coast
nidias hiperbólicamente curveadas, clamidosporas of Hermosillo. The symptoms observed in roots
terminales o intercaladas, sencillas o en cadenas, and stems of infected plants were reddish-brown
generalmente de una célula. Como producto pre- lesions located and slightly sunken in the base of
liminar de esta investigación, F. brachygibbosum the stem and 0.2 to 2.0 cm in length. In some cases,
fue reportado por primera vez como agente pató- the discoloration presented by diseased plants
geno, causante de marchitez en plantas de sandía affected almost 90 % of the root system (Meza-
(Rentería-Martínez et al., 2015). Recientemente se Möller et al., 2014).
ha registrado como agente causal de podredumbre The phylogenetic analysis by ML showed that
del tallo del maíz (Shan et al., 2017), marchitez y the isolations obtained from Ceratobasidium sp.
muerte regresiva en Euphorbia larica y olivo (Al- belong to two different anastomosic groups: AG-A
Mahmooli et al., 2013; Trabelsi et al., 2017) y de and AG-F, previously found in diseased Ipomoea
podredumbre y cancros en almendro y nogal (Stack batatas and Arachis hypogaea plants, respectively.
et al., 2017; Marek et al., 2013). The phylogenetic relations of Rhizoctonia fungi
F. oxysporum f. sp. niveum perteneciente al Fu- show consistency between the clades formed and
sarium oxysporum Species Complex (FOSC), se the anastomosic groups to which they belong
aisló solamente de los campos ubicados en el Valle (González et al., 2016).
de Guaymas. Los miembros de FOSC causan mar- It is important to point out that most of
chitez vascular y pudrición radicular en más de 100 the Ceratobasidium sp. isolates found in this
diferentes especies vegetales, y en base a su espe- investigation belong to group AG-F, which coincides
cificidad con el hospedero se han reportado más de with earlier works on root rot in watermelon carried
80 formae speciale. En ese sentido un diagnóstico out in Arizona, U.S.A (Nischwitz et al., 2013) and
certero, aún antes de que se presenten sus síntomas, Italy (Aiello et al., 2012). Ceratobasidium AG-F
es crucial para el manejo de los cultivos (López- is also the causal agent of root rot in strawberry
Mondéjar et al., 2012). (Sharon et al., 2007), Tagetes erecta (Saroj et al.,
En lo que respecta a la familia Ceratobasidiae, 2013) and pistachio (Alaei et al., 2017).
Rhizoctonia binucleada (teleomorfo: Ceratobasi- There is no previous information on the
dium sp.) fue la especie de más amplia distribución, pathogenicity of the anastomosic group AG-A in
ya que se aisló de todos los campos muestreados, y watermelon, but there is on sugar beet and apple
más frecuentemente en el campo No. 2 de la Costa trees (Wang and Wu, 2012).
de Hermosillo. Los síntomas observados en raíces The least frequent isolations belong to the genus
y tallos de plantas infectadas fueron lesiones loca- Rhizoctonia, which, due to the high variability in its
lizadas café-rojizas y ligeramente hundidas en la geographic distribution, morphology, specificity of
base del tallo y de 0.2 a 2.0 cm de largo. En algunos hosts, and pathogenicity, has also been proposed as
casos, la decoloración presentada por las plantas a species complex (González et al., 2006). Isolation
enfermas afectó casi el 90 % de sistema radicular RhDAG18 obtained from site CH2 belongs to
(Meza-Möller et al., 2014). AG-4 and has been morphologically delimited as
El análisis filogenético mediante MV mostró Thanatephorus praticola (Mordue et al., 1989),
que los aislados obtenidos de Ceratobasidium sp., which was later corroborated by the multilocus
corresponden a dos grupos anastomósicos distintos: phylogenetic analysis (González et al., 2016). T.
AG-A y AG-F, previamente registrados en plantas praticola has been presented in association with
enfermas de Ipomoea batatas y Arachis hypo- Ceratobasidium sp. AG-F as part of a fungal
gaea, respectivamente. Se ha demostrado que las complex that cause root rot and deterioration in
relaciones filogenéticas de hongos de Rhizoctonia watermelon plantations in the production stage in
demuestran consistencia entre los clados formados Italy (Aiello et al., 2012).
y los grupos anastomósicos a los que pertenecen The pathogenicity tests showed that isolated
(González et al., 2016). fungi are causal agents of root rot in watermelon
Es importante señalar que la mayoría de los ais- plants. The results of the percentage of infected roots
lados de Ceratobasidium sp. encontrados en esta showed that both watermelon varieties evaluated
investigación pertenecen al grupo AG-F, lo que are susceptible to the five pathogens identified,
coincide con trabajos previos sobre pudrición ra- inoculated separately or in combinations. In this
dicular en sandía realizados en Arizona, EUA (Nis- regard, Aiello et al. (2012) detected percentages
chwitz et al., 2013) e Italia (Aiello et al., 2012). of incidence of the disease higher than 81 % when
Ceratobasidium AG-F también es el agente cau- evaluating 6 different isolations of Ceratobasidium
sal de pudrición radicular en fresa (Sharon et al., from the anastomosic group AG-F.
2007), Tagetes erecta (Saroj et al., 2013) y pistache Due to economic losses resulting from root
(Alaei et al., 2017). diseases in the areas of study, direct planting in
No existe información previa acerca de la pato- the soil has been replaced almost entirely with
genicidad del grupo anastomósico AG-A en sandía, watermelon grafted on patterns resistant to root rot.
pero sí en remolacha azucarera y manzano (Wang The commonly used rootstocks in the region are
y Wu, 2012). hybrids between Cucurbita maxima x C. moschata,
Los aislados de menor frecuencia fueron los although these hybrids have shown susceptibility to
pertenecientes al género Rhizoctonia, que por la root rot (López-Elías et al., 2010). Some rootstocks
alta variabilidad en su distribución geográfi- have shown to be susceptible to Fusarium in
ca, morfología, especificidad de hospederas, y Spain, the main producer of cucurbits in Europe
patogenicidad se ha propuesto también como un (Armengol et al., 2000). On the other hand, the
complejo de especies (González et al., 2006). El apparent resistance to wilting by Fusarium of some
aislado RhDAG18 obtenido del sitio CH2 pertene- commercial varieties of watermelon depends on
ce al AG-4 y ha sido delimitado morfológicamen- the type and initial concentration of the inoculant
te como Thanatephorus praticola (Mordue et al., (Martyn and McLaughlin, 1983); in this sense,
1989), lo que fue corroborado posteriormente por the timely identification of the pathogen will help
el análisis filogenético multilocus (González et al., make a better choice of rootstock. Additionally,
2016). T. praticola se ha presentado en asociación once the pathogenic species present has been
con Ceratobasidium sp. AG-F como parte de un accurately established, the quantification of its
complejo de hongos que causan pudrición de raíz y concentration will manage the disease better.
declive de plantaciones de sandía en etapa de pro- Using the quantitative PCR (qPCR) technique, it is
ducción en Italia (Aiello et al., 2012). possible to detect up to one 1 pg of fungal DNA in
Las pruebas de patogenicidad demostraron que plants without symptoms (Haegi et al., 2013).
los hongos aislados son agentes causales de pudri-
ción radicular en sandía. Los resultados del porcen-
taje de raíces infectadas evidenciaron que las dos CONCLUSIONS
variedades de sandía evaluadas son susceptibles a
los cinco patógenos identificados, inoculados por In the present study, Fusarium falciforme and
separado o en combinaciones. A este respecto, Aie- Thanatephorus praticola are reported for the
llo et al. (2012) detectaron porcentajes de inciden- first time as causal agents of watermelon plants
cia de la enfermedad superiores a 81 %, al evaluar root rotting in Mexico. The Multilocus analysis
6 diferentes aislados de Ceratobasidium del grupo corroborated Fusarium brachygibbosum and
anastomósico AG-F. Ceratobasidium sp. identity, previously reported
Debido a las pérdidas económicas derivadas de in the literature. This research is a first attempt at
enfermedades radiculares en las regiones estudia- generating data that could lead to broader studies
das, la siembra directa en suelo ha sido sustitui- that may contribute to establish adequate control
da casi en su totalidad por sandía injertada sobre strategies for disease management in commercial
patrones resistentes a pudrición de raíz. Los por- watermelon plantations.
tainjertos comúnmente empleados en la región son
End of the English version
híbridos de Cucurbita maxima x C. moschata, sin
embargo, estos híbridos ya han mostrado suscep-
tibilidad a pudrición de raíz (López-Elías et al.,
2010). Algunos portainjertos han mostrado suscep- patógeno permitirá una mejor elección del portain-
tibilidad a Fusarium en España, principal produc- jerto. Adicionalmente, una vez determinada con
tor de cucurbitáceas en Europa (Armengol et al., precisión la especie patogénica presente, la cuan-
2000). Por otro lado, la aparente resistencia a mar- tificación de su concentración, permitiría un mejor
chitez por Fusarium de algunas variedades comer- manejo de la enfermedad. Mediante la técnica de
ciales de sandía, es dependiente del tipo y concen- PCR cuantitativa (qPCR), es posible detectar has-
tración inicial del inóculo (Martyn y McLaughlin, ta 1 pg de ADN fúngico en plantas asintomáticas
1983); en ese sentido, la oportuna identificación del (Haegi et al., 2013).
interactions with grafted melon genotypes. Phytopatholo- fusaria. Fungal Genetics and Biology 52:20-31. https://
gy 103:802-810. [Link] [Link]/10.1016/[Link].2012.12.004
0293-R O’Donnell K, Ward TJ, Robert VARG, Crous PW, Geiser DM
Leslie JF and Summerell BA. 2006. The Fusarium laboratory and Kang, S. 2015. DNA sequence-based identification of
manual. Ed. Wiley-Blackwell. USA. 388p. Fusarium: current status and future directions. Phytopa-
López EJ, Pacheco-Ayala F, Huez-López MA, Rodríguez JC, rasitica 43:583-595. [Link]
Jiménez-León J y Garza-Ortega S. 2010. Sandía (Citru- 0484-z
llus lanatus (Thunb.) Matsum. & Nakai) injertada sobre Padwick GW. 1945. Notes on Indian fungi III. Mycological
diferentes portainjertos de calabaza (Cucurbita maxima Papers. 12:1-15
x Cucurbita moschata). Biotecnia. XII: 3-10. Disponible Posada D and Crandall KA. 1998. MODELTEST: testing the
en línea: [Link] model of DNA substitution. Bioinformatics 14:817-818.
article/view/87 [Link]
López-Mondéjar R, Beaulieu R, Ros M and Pascual JA. 2012. Rentería-Martínez ME, Meza-Moller AC, Guerra-Camacho
SCAR-based real-time TaqMan PCR for early detection M, Romo-Tamayo F, Ochoa-Meza A and Moreno-Salazar
of Fusarium oxysporum in melon seedlings under green- SF. 2015. First report of watermelon wilting caused by Fu-
house nursery conditions. Crop protection 33:1-6. https:// sarium brachygibbosum in Sonora, Mexico. Plant Disease
[Link]/10.1016/[Link].2011.10.009 99:729. [Link]
Marek SM, Yaghmour MA and Bostock RM. 2013. Fusarium SAGARPA, Secretaría de Agricultura, Ganadería, Desarrollo
spp., Cylindrocarpon spp., and environmental stress in the Rural, Pesca y Alimentación. 2014. Servicio de informa-
etiology of a canker disease of cold-stored fruit and nut ción agroalimentaria y pesquera. [2015-09-10]. [Link].
tree seedlings in California. Plant Disease 97: 259-270. [Link]/index
[Link] Saroj A, Kumar A, Saeed ST, Samad A and Alam M. 2013.
Martyn RD and McLaughlin RJ. 1983. Effects of inoculum First report of Tagetes erecta damping off caused by Cera-
concentration on the apparent resistance of watermelons to tobasidium sp. from India. Plant Disease 97:1251. http://
Fusarium oxysporum f. sp. niveum. Plant Disease 67:493- [Link]/10.1094/PDIS-02-13-0145-PDN
495. Disponible en línea: [Link] Shan LY, Cui WY, Zhang DD, Zhang J, Ma NN, Bao YM, Dai
tions/PlantDisease/BackIssues/Documents/1983Articles/ XF and Guo W. 2017. First report of Fusarium brachy-
PlantDisease67n05_493.PDF gibbosum causing maize stalk rot in China. Plant Disease
Meza-Möller AC, Rentería-Martínez ME, Guerra-Camacho 101:837. [Link]
M, Romo-Tamayo F, Ochoa-Meza A, Moreno-Salazar SF. Sharon M, Freeman S, Kuninaga S. and Sneh B. 2007. Genetic
2014. First report of root rot of watermelon caused by Ce- diversity, anastomosis groups and virulence of Rhizoctonia
ratobasidium sp. in Sonora, Mexico. Plant Disease 98:847. spp. from strawberry. European Journal of Plant Pathology
[Link] 117:247-265. [Link]
Mordue JEM, Currah RS and Bridge PD. 1989. An integrated Sharon M, Kuninaga S, Hyakumachi M, Naito S and Sneh
approach to Rhizoctonia taxonomy: cultural, biochemical B. 2008. Classification of Rhizoctonia spp. using rDNA-
and numerical techniques. Micological Research 92:78- ITS sequence analysis supports the genetic basis of the
90. [Link] classical anastomosis grouping. Mycoscience 49:93-114.
Narayanasamy P. 2011. Assessment of variability in fungal [Link]
plant pathogens. Pp:245-272 In: Microbial plant pathogens SIAP. Servicio de Información Agroalimentaria y Pesque-
detection and disease diagnosis. Vol. 1. Springer. Dordre- ra. Producción agrícola por cultivo. [2017-02-14]. http://
cht, Netherlands. 291p. [Link] [Link]/.
481-9735-4_4 Sievers F, Wilm A, Dinee D, Gibson TJ, Karplus K, Li W, Lo-
Nischwitz C, Chitrampalam P and Olsen M. 2013. Ceratoba- pez R, McWilliam H, Remmert M, Söding J, Thompson
sidium root rot: A new disease of watermelon (Citrullus JD and Higgins DG. 2011. Fast, scalable generation of
lanatus) in Arizona. Plant Health Progress. DOI:10.1094/ high-quality protein multiple sequence alignments using
PHP-2013-1125-01-BR Clustal Omega. Molecular Systems Biology 7:539. https://
O’Donnell K, Kistler HC, Cigelnik E and Ploetz RC. 1998. [Link]/10.1038/msb.2011.75
Multiple evolutionary origins of the fungus causing Pana- Sousa ES, Melo MP, Mota JM, Sousa EMJ, Beserra JEA
ma disease of banana: Concordant evidence from nuclear and Matos KS. 2017. First report of Fusarium falciforme
and mitochondrial gene genealogies. Proceedings of the (FSSC 3 + 4) causing root rot in lima bean (Phaseolus
National Academy of Sciences of the United States of lunatus L.) in Brazil. Plant Disease 101:1954. [Link]
America 95:2044-2049. Disponible en línea: [Link] org/10.1094/PDIS-05-17-0657-PDN
[Link]/pmc/articles/PMC19243/ Sneh B, Jabaji-Hare S, Neate S, and Dijst G. 1996. Rhizoctonia
O’Donnell K, Rooney AP, Proctor RH, Brown DW, McCor- Species: Taxonomy, Molecular Biology, Ecology, Patho-
mick SP, Ward TJ, Frandsen RJ N, Lysoe E, Rehner SA, logy and Disease Control. Kluwer Academic Publishers
Aoki T, Robert VARG, Crous PW, Groenewald JZ, Kang S Dordrecht, Netherlands. 578p.
and Geiser DM. 2013. Phylogenetic analysis of RPB1 and Stack AJ, Yaghmour MA, Kirkpatrick SC, Gordon TR and
RPB2 support a middle Cretaceous origin for a clade Bostock RM. 2017. First report of Fusarium brachygibbo-
comprising all agriculturally and medically important sum causing cankers in cold-stored, bare-root propagated
almond trees in California. Plant Disease 101:390. https:// Trabelsi R, Sellami H, Gharbi Y, Krid S, Cheffi M, Kammoun
[Link]/10.1094/PDIS-06-16-0929-PDN S, Dammak M, Mseddi A, Gdoura R and Ali TM. 2017.
Stielow JB, Lévesque CA, Seifert KA, Meyer W, Iriny L, Smits Morphological and molecular characterization of Fusa-
D and Robert V. 2015. One fungus, which genes? Develo- rium spp. associated with olive trees dieback in Tunisia. 3
pment and assessment of universal primers for potential Biotech 7:28. [Link]
secondary fungal DNA barcodes. Persoonia: Molecular Wang PP and Wu XH. 2012. First report of sugar beet see-
Phylogeny and Evolution of Fungi 35:242-263. [Link] dling damping-off caused by binucleate Rhizoctonia AG-A
org/10.3767/003158515X689135 in China. Plant Disease 96:1696. [Link]
Swofford DL. 2002. PAUP*. Phylogenetic Analysis Using PDIS-05-12-0492-PDN
Parsimony (*and Other Methods). Version 4. Sinauer As- White TJ, Bruns T, Lee S and Taylor J.1990. Amplification
sociates, Sunderland, Massachusetts. Disponble en línea: and direct sequencing of fungal ribosomal RNA genes for
[Link] phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ and
Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, White TJ (eds). PCR Protocols: A Guide to Methods and
Hibbett DS and Fisher MC. 2000. Phylogenetic species Applications. Academic Press. San Diego, CA, USA.345p.
recognition and species concept in fungi. Fungal Genetics
Biology 31:21-32. [Link]
de crecimiento para cada cepa. Los sobrenadantes used in the fermentation industry (Veith et al.,
exentos de células obtenidos en diferentes con- 2004; Rey et al., 2004; Fujinami y Fujisawa, 2010)
diciones de crecimiento se usaron en una prueba Bacillus subtilis, as with many in the Bacillus
cuantitativa de actividad antagonista in vitro frente genus, is an extremely common bacterium. It is
a R. solani. Se demostró que el efecto inhibitorio found in soil, water, air, and decomposing plant
de las cepas se presenta principalmente en la fase matter (Ashlee, et al., 2008.). Bacteria in the
estacionaria. Bacillus genus are spore-forming, which means
that they create a thick wall which surrounds their
Palabras clave: biocontrol, tasa de crecimiento, DNA and other internal cell structures. In this
antagonismo, estado fisiológico. way, they are hardy and impervious to extreme
temperatures, chemicals, environmental factors,
even some types of radiation. As a consequence,
El género Bacillus comprende diversas especies they can be use in industrial processes. Bacteria
de importancia industrial que por lo general se uti- are highly responsive to genetic mutation, resulting
lizan en la industria de la fermentación (Veith et al., in experimental uses in a laboratory setting
2004; Rey et al., 2004; Fujinami y Fujisawa, 2010). (Ashlee et al., 2008; Schallmey et al.,2004).
Al igual que muchas de las especies del género Ba- Like most of its closest relative B. subtilis is non-
cillus, Bacillus subtilis es una bacteria muy común, pathogenic, the relative ease of cultivation and
pues se encuentra en el suelo, el agua, el aire y en genetic manipulation, and the efficient secretion of
materia vegetal en descomposición (Ashlee et al., proteins and metabolites (Matarante et al., 2004).
2008). Las bacterias del género Bacillus forman es- Furthermore, many gram-positive bacteria that
poras, es decir, forman una pared gruesa que rodea inhabit complex ecological communities, such
su ADN y otras estructuras celulares internas. Esta as those within soil and aquatic environments,
característica las hace resistentes e inmunes a tem- produce a great variety of special compounds
peraturas extremas, químicos, factores ambientales that are valuable for their pharmacological and
e incluso algunos tipos de radiación, y, por tanto, se antimetabolic properties. Bacillus subtilis is used
pueden utilizar en procesos industriales. Las bacte- to produce many antibiotics, such as difficidin,
rias tienen gran capacidad de mutación genética y, oxydifficidin, subtilosin A, bacillomyin B, and
por ello, se utilizan en experimentos en el labora- bacitracin, bacilysocin which is helpful in treating
torio (Ashlee et al., 2008; Schallmey et al., 2004). bacterial skin infections and preventing infection in
Al igual que la mayoría de sus parientes más cerca- minor cuts and burns (Shelburne et al., 2007; Stein
nos, B. subtilis es no patogénico, se puede cultivar 2005; Tamehiro et al., 2002) Bacillus subtilis is
y manipular genéticamente con relativa facilidad also used as a fungicide (Savluchinske et al., 2004).
y es eficaz en la secreción de proteínas y meta- The bacteria colonize the root system, leaving no
bolitos (Matarante et al., 2004). Además, muchas room for fungal diseases organisms; it is used on
bacterias grampositivas que viven en complejas agricultural seeds of vegetables, its multicellular
comunidades ecológicas, como las que se encuen- behavior and production of a wide variety of
tran en ambientes terrestres y acuáticos, producen toxic substances support usage of Bacillus subtilis
una gran variedad de compuestos especiales que as a powerful biocontrol agent (Bais et al.,2004;
son valiosos por sus propiedades farmacológicas Gong et al., 2006; Leclére et al., 2005; Nagórska
y antimetabólicas. Bacillus subtilis se utiliza en la et al., 2007). The production of these metabolites
producción de numerosos antibióticos, como difi- may be crucial to develop strategies to adapt
cidina, oxidificidina, subtilisina A, bacilomicina B themselves to the soil environment occupied by
y bacitracina, así como bacilisocina, auxiliar en el the plant, which contributes to the survival of
tratamiento de infecciones cutáneas causadas por the organism in complex ecological systems.
bacterias, y evita infecciones en cortaduras y que- The genetically diverse bacilli show promising
maduras leves (Shelburne et al., 2007; Stein, 2005; results for the promotion of growth on several
Tamehiro et al., 2002). Bacillus subtilis se utili- crops and the biological control of various plant
za también como fungicida (Savluchinske et al., pathogens (Bapat y Shah 2000; Bernal et al. 2002;
2004). Las bacterias colonizan el sistema radicular Kim 2010). Unfortunately, the inherent variable
de las plantas y no permiten que se desarrollen or- performance of most biocontrol agents between
ganismos causantes de enfermedades fúngicas; en field locations and cropping seasons has hampered
la agricultura se utiliza en semilla de verduras, ya the commercial development of biological agents
que su comportamiento multicelular y la produc- for use in agriculture (Pal y Gardener, 2006). Most
of this variability has been attributed to differences
ción de una gran variedad de sustancias tóxicas res-
between properties of the natural habitats of
paldan el uso de Bacillus subtilis como un potente
biocontrol agents and the places where they are
agente de biocontrol (Bais et al., 2004; Gong et al.,
applied (O’Callagman et al., 2001; Zhang et al.,
2006; Leclére et al., 2005; Nagórska et al., 2007).
2005). Understanding the environmental factors
La producción de estos metabolitos sería decisiva
that regulate the biosynthesis of antimicrobial
en la formulación de estrategias para su adaptación
compounds by strains of Bacillus is an essential
al ambiente terrestre que ocupa la planta, lo cual
step in improving their antagonistic activities,
contribuiría a la supervivencia del organismo en
which have not been adequately described
sistemas ecológicos complejos. Estos bacilos ge-
(Bloemberg y Lugtenberg, 2001). Physiological
néticamente diversos muestran resultados prome- studies are necessary to develop and optimize the
tedores que justificarían promover su desarrollo en use of biocontrol agents as plant protectants. It is
varios cultivos para el control biológico de diversos important to establish the relationship between
fitopatógenos (Bapat y Shah, 2000; Bernal et al., proliferation and status of the bacteria, as well as the
2002; Kim, 2010). Desafortunadamente, la varia- influence of environmental factors that modulate
bilidad en el comportamiento inherente de muchos the biosynthesis of antifungal compounds. Other
agentes de biocontrol entre los sitios en el campo factors that must be considered are the type and
y los ciclos de cultivo ha impedido el desarrollo concentration of carbon and nitrogen sources,
comercial de agentes biológicos de uso agrícola oxygen tension, osmotic pressure, pH, temperature,
(Pal y Gardener, 2006). Mucha de esta variabilidad and water availability (Kamney, 2008). These
ha sido atribuida a las diferencias entre las propie- studies will provide essential information for
dades de los hábitats naturales de los agentes de the selection of new strains and products for the
biocontrol y los lugares donde éstos son aplicados biological control of plant pathogens. In the
(O’Callagman et al., 2001; Zhang et al., 2005). current study, the effects of pH and temperature on
Conocer los factores ambientales que regulan la antagonistic activity of different strains of Bacillus
biosíntesis de los compuestos antimicrobianos por subtilis were evaluated, while keeping in mind the
las cepas de Bacillus es un paso fundamental para physiological stage of development.
Irapuato) se utilizó como control negativo en la an Automated Spiral Plater 4000 (Spiral Biotech,
actividad antagonista, en tanto que la cepa Kodiak Inc. USA). The kinetic parameters and the time of
(GBO3) de Bacillus subtilis, que se obtuvo como occurrence of the phases of growth were obtained
una formulación de esporas secas (Bayer Crop by the Verhulst-Pearl (Slater, 1985) or the logistic
Science Kansas City, MO, EE UU), se utilizó como model, according to the following equation:
control positivo en la actividad biológica. Para su
almacenamiento prolongado, los cultivos de bac-
K.
terias se mantuvieron a -80 °C en agar infusión de N=
1+expa-µ*t
papa con glicerol al 20%.
cepas. En el centro de placas Petri que contenían pre-amplification step was followed by a second
los diferentes medios suplementados se inoculó un selective amplification using similar primers but
disco de 5 mm de diámetro de un cultivo de agar de with two selective nucleotides. The EcoRI+AG
Rhizotonia solani perteneciente al grupo de anasto- primer was combined with the MseI primer +AA,
mosis AG3 (donado por el Dr. Gil Virgen de la Uni- AC, AG and AT. The EcoRI primer used in the
versidad de Guadalajara). Las placas se incubaron second amplification reaction was radioactively
a 28 °C y se midió el crecimiento de los hongos a labeled by using T4 kinase. AFLP reactions
24, 48, 72 y 96 h después de que comenzó la in- with primers having none or a single selective
cubación. Cada CFS se hizo por triplicado. El cre- nucleotide were performed for 20 cycles with the
cimiento de hongos observado durante 96 h en el following cycle profile: a 30 s DNA denaturation
medio sin suplementos que se utilizó como control. step at 94°C, a 1 min annealing step at 56°C , and
La inhibición del crecimiento (%) se calculó como a 1 min extension step at 72°C. AFLP reactions
la relación entre el diámetro promedio de la colonia with primers having two selective nucleotides were
de hongos en un medio con CFS y el diámetro pro- performed for 36 cycles with the following cycle
medio de la colonia de hongos en un medio sin CFS profile: a 30 s DNA denaturation step at 94°C, a 30 s
multiplicado por 100, y al resultado se le restó 100. annealing step (see below), and a 1 min extension
step at 72°C. The annealing temperature in the first
Análisis AFLP cycle was 65 °C, was subsequently reduced each
El protocolo AFLP que se utilizó fue similar cycle by 0.7°C for the next 12 cycles, and was
al reportado por Vos et al. (1995), excepto que continued at 56°C for the remaining 23 cycles. The
en este caso se utilizaron dos, en lugar de tres, amplification products of the second reaction were
nucleótidos selectivos, a fin de generar un núme- analyzed by electrophoresis on a polyacrylamide
ro adecuado de bandas para el análisis. El ADN sequencing gel and visualized via autoradiography.
genómico bacteriano total fue digerido con las Electrophoresis was performed at constant power,
enzimas de restricción EcoRI y MseI, o con el 110 W, for -2 h. Finally, the gel was analyzed in
isoesquizómero Tru 91. Los iniciadores oligonu- a Li-Cor Automatas sequencer mod. 4200 (Li-Cor
cleótidos utilizados en el paso de pre-amplifica- Lincoln, Nebraska), the bands were captured and
ción fueron 5´-AGCTGCGTACCAATTC/A-3´ y scored by use of LI-COR software.
5´GACGATGAGTCCTGAGTAA/A-3´. Después
del paso de la pre-amplificación se llevó a cabo una Statistical Analyses
segunda amplificación selectiva en la que se utili- The design of the treatments was completely
zaron iniciadores similares, pero con dos nucleóti- random. Data were subjected to ANOVA by using
dos selectivos. El iniciador EcoRI+AG se combinó the version 2.5 FAUANL statistical software, for
con el iniciador MseI +AA, AC, AG y AT. El ini- Microsoft Windows (University of Nuevo Leon,
ciador EcoRI que se utilizó en la segunda reacción Mexico). The significance of the treatments was
de amplificación fue marcado radioactivamente determined by the magnitude of the F value (P <
con quinasa T4. Las reacciones de AFLP con los 0.05). For the differences among treatment means,
iniciadores sin ningún nucleótido o con uno selecti- the least significant difference (LSD) test was
vo se realizaron durante 20 ciclos de acuerdo con el applied to obtain 95% simultaneous confidence
siguiente perfil de ciclo: un paso de desnaturalización intervals.
Figura 1. Huellas AFLP de las cepas de Bacillus utilizando el iniciador EcoRI marcado como 32-P E+AG con tres iniciadores
MseI: MseI+AA (I), MseI+AC (II) y MseI+AT (III). (a) Dendrograma de diferentes cepas de Bacillus con base en
el análisis de AFLP de las muestras con los iniciadores EcoRI+AG y dos MseI; (b) Los fragmentos de AFLP fueron
analizados y los dendrogramas fueron generados como se describe en la sección de materiales y métodos. Kodiak
de B. subtilis (1), PY-79 de B. subtilis (2), LS213 de B. amyloliquefaciens (3), Pseudomonas sp. (4), BEB-8bs de B.
subtilis (5), BEB-DN de B. subtilis (6).
Figure 1. AFLP fingerprints of the Bacillus strains using the 32-P labeled EcoRI primer E+AG with three MseI primers
MseI+AA (I), MseI+AC (II) and MseI+AT (III) (a). Dendogram of different Bacillus strains based on AFLP analy-
sis of the samples with EcoRI+AG and MseI-two primers (b). AFLP fragments were analyzed and dendograms
were generated as described in materials and methods. B. subtilis Kodiak (1), B. subtilis PY-79 (2), B. amylolique-
faciens LS213 (3), Pseudomonas sp. (4), B. subtilis BEB-8bs (5), B. subtilis BEB-DN (6)
altos (0.786), y B. subtilis tuvo una respuesta típica significant decrease in the specific rate of growth
del perfil metabólico de esta cepa (datos no inclui- (μ) of each strain was observed, which contrast
dos). Los efectos del pH y la temperatura en la tasa with the conditions in which the rate dN/dt was
de crecimiento (dN/dt) de las diferentes cepas se maximum. Under suboptimal conditions they
muestran en la Figura 2. Las áreas de la superficie show faster growth rates than optimal conditions,
representan el crecimiento como una función del however, under these conditions there is no
pH y la temperatura. Los análisis ANOVA indica- inhibition of Rhizoctonia except for the BeB 8
ron que la temperatura, el pH y la interacción entre strain. (Figure 3). However, the time required
estos dos factores fueron muy significativos en la to reach the stationary phase was similar for the
tasa de crecimiento (dN/dt) de la cepa PY-79 (Figu- Kodiak and Beb-8 strains, in both conditions, while
ra 2a). Con base en lo anterior, se estableció que las the PY-79 took almost 10 more hours in sub-optimal
condiciones óptimas de desarrollo fueron 28 °C/pH conditions (Table 1A-III and 1B-III). Nevertheless,
5 y 28 °C/pH 8 (Cuadro 1A-II), las cuales produje- the most significant effect was observed in the
ron las máximas tasas de crecimiento de 2.19 x 105 carrying capacity of media (K). Under sub-optimal
y 2.36 x 105 cfu/ mL/ h, respectivamente (Cuadro growth conditions, a reduction of one logarithmic
1A-III). En el caso de la cepa Kodiak, la temperatu- unit (1.97 to 0.19 x105 cfu /mL/ h) was detected for
ra y su interacción con el pH fueron significativas y PY-79 strain, a slight reduction from 0.804 x 106
produjeron la tasa máxima de crecimiento (Figura to 0.65 x 106 cfu /mL/ h corresponded to Kodiak
2b). Esta tasa máxima se observó a 28 °C y a 5 strain, and a reduction from 3.14 x 108 to 2.48 x 108
unidades de pH (Cuadro 1A-II), pero no se obser-
cfu/ mL/ h for the BEB-8 strain was observed. The
varon diferencias estadísticamente significativas en
effect of the physiological stage of each strain on
los valores de dN/dt en este rango (Cuadro 1A-III).
the antagonistic activity against Rhizoctonia solani
En cambio, el pH influyó mucho en la tasa de cre-
AG-3, under optimal and sub-optimal conditions
cimiento de la cepa BEB-8b, pero la temperatura y
of growth is shown in Figure 3. Under optimal
su interacción con el pH no mostraron diferencias
conditions of growth, the BEB-8bs strain showed
significativas (Figura 2c). Las condiciones óptimas
a similar antagonistic activity to the Kodiak strain
de crecimiento se obtuvieron con pH 5 y 8, inde-
(positive control). In the exponential growth phase
pendientemente de la temperatura de incubación,
(log), they both caused 15 to 25% fungal growth
y alcanzaron un valor máximo de dN/dt, de 3.5 a
inhibition, while in the stationary phase, they
4 x 108 cfu /mL/h, respectivamente. Los patrones
caused 64 to 72% of fungal growth inhibition.
de crecimiento observados fueron muy diferentes
As expected, the PY-79 strain (negative control)
entre las diferentes cepas de B. subtilis (Cuadros
showed no significant inhibition of fungal growth
1A-II y 1A-III).
(Figure 3a). Under conditions of minimal growth,
Efecto de las condiciones de crecimiento y la eta- the positive control Kodiak strain in the different
pa fisiológica de las cepas de Bacillus en la pro- stages of development, showed no antagonistic
ducción de metabolitos antagonistas activity, however, the BEB-8 strain in the stationary
phase reduced fungal growth by 25%. These results
Los parámetros cinéticos de cada una de las cepas indicate that the highest biocontrol activity is in the
se determinaron en condiciones óptimas (Cuadro 1A) stationary phase.
Figura 2. Efecto del pH y la temperatura en la tasa de crecimiento (dN/dt) de las cepas de Bacillus subtilis representado por
la superficie, que es considerada una función del pH y la temperatura. Cepa PY-79 como control negativo de la
actividad antagonista (a). cepa Kodiak; control positivo de la actividad antagonista (b), cepa BEB-8b (c).
Figure 2. Effect of pH and temperature on the rate of growth (dN/dt) of the Bacillus subtilis strains represented by the sur-
face, which is considered a function of pH and temperature. PY-79 strain negative control of antagonistic activity
(a). Kodiak strain; positive control of antagonistic activity (b), BEB-8bs strain (c).
No; inóculo inicial (cfu /mL), K; la capacidad de carga de los medios (10n cfu /mL), generalmente interpretada como la cantidad
de recursos expresados en el número de organismos que estos recursos pueden mantener. µ velocidad específica de crecimiento
/ h, µ significativamente diferente de µ = 0, a > 95% del nivel de confianza, dN/dt; tasa máxima de crecimiento (10n cfu /ml/ h),
tdN/dt; tiempo en que se alcanza la tasa máxima o mínima de crecimiento ([Link]). El ajuste de r2 al modelo logístico fue de > 95%
del nivel de confianza / x
xNo; initial inoculum (cfu /mL), K; carrying capacity of media (10n cfu /mL), usually interpreted as the amount of resources
expressed in the number of organisms that can be supported by these resources. µ specific speed of growth / h, µ significantly
different from µ = 0, to > 95% of confidence level, dN/dt; maximum rate of growth (10n cfu /ml/ h), tdN/dt; time in which the maxi-
mum or minimal rate of growth is reached the ([Link]). The adjustment of r2 to the logistic model was > 95% of confidence level.
Figura 3. Efecto del estado fisiológico y condiciones de crecimiento de las cepas de Bacillus subtilis en la actividad antago-
nista contra Rhizoctonia solani AG-3. Crecimiento bacteriano en condiciones óptimas (A) y condiciones subópti-
mas (B) del aislado PY-79 de B. subtilis (a), Kodiak de B. subtilis (b), y BEB-8b de B. subtilis (c).
Figure 3. Effect of the physiological state and growth conditions of Bacillus subtilis strains on the antagonistic activity
towards Rhizoctonia solani. AG-3. Bacterial growth under optimal conditions (A), and under sub-optimal condi-
tions (B) of B. subtilis PY-79 (a), B. subtilis Kodiak (b) and B. subtilis BEB-8bs (c).
más en condiciones subóptimas (Cuadros 1A-III y of root exudates is correlated with the bacterial
1B-III). No obstante, el efecto más significativo se competitive ability and constitutes the nutritional
observó en la capacidad de carga del medio (K). basis of rhizosphere colonization (Bais et al., 2006;
En condiciones subóptimas de desarrollo se detec- Haichar et al., 2008). In this study, the BIOLOG
tó la reducción de una unidad logarítmica (1.97 a test indicated that the isolated BEB-8 was a strain
0.19 x105 cfu /mL/ h) en la cepa PY-79; una ligera of B. subtilis and confirmed the identities of PY-
reducción de 0.804 x 106 a 0.65 x 106 cfu /mL/ h 79 and Kodiak strains used as controls. Our results
correspondió a la cepa Kodiak, y se observó una also confirmed the ability of the different strain of
reducción de 3.14 x 108 a 2.48 x 108 cfu/ mL/ h en Bacillus to use a great variety of carbon sources. As
la cepa BEB-8. En la Figura 3 se muestra el efecto indicated by Goddard et al. (2001) and Smalla et al.
de la etapa fisiológica de cada cepa en la actividad (1998) in yours studies, BIOLOG microtiter plates
antagonista contra Rhizoctonia solani AG-3, bajo were originally developed for classification of
condiciones óptimas y subóptimas de crecimiento. bacterial isolates based on the ability of the isolates
En condiciones óptimas de crecimiento, la cepa to oxidize 95 different carbon sources. However, this
BEB-8b mostró una actividad antagonista similar method has proved to be a useful tool for evaluating
a la de la cepa Kodiak (control positivo). En la fase carbon source utilization patterns of microbial
de crecimiento exponencial (log), ambas causaron communities, potential metabolic differences
una inhibición de 15 a 25% en el crecimiento fún- between rhizosphere bacterial populations as well
gico, en tanto que, en la fase estacionaria, causaron as for studying the effects of introduced inocula on
una inhibición de 64 a 72%. Como se había pre- soil microbial communities. In addition, although
visto, la cepa PY-79 (control negativo) no mostró the metabolic profile of the three strains indicated
inhibición significativa del crecimiento fúngico that they were Bacillus subtilis, the AFLP analysis
(Figura 3a). Bajo condiciones de crecimiento mí- produced high-quality DNA fingerprints with
nimo, la cepa Kodiak (control positivo) no mostró detectable polymorphisms and revealed strain-
actividad antagonista en las diferentes etapas de level variations. This strain to strain variability
crecimiento; sin embargo, la cepa BEB-8 redujo en confirms that they are different strains. Jones et
25% el crecimiento fúngico en la fase estacionaria. al. (2005) described the individualization as the
Estos resultados indican que la mayor actividad de process by which morphological, biochemical
biocontrol ocurre en la fase estacionaria. or genetic characteristics are associated with
a microorganism, such that a combination of
characteristics is unique to that microorganism
DISCUSIÓN and exclude another microorganism. However,
knowledge of the environmental niche where the
La aplicación de inoculantes microbianos como biocontrol agent is able to grow is essential to
agentes de biocontrol no ha tenido mucho éxito establish the conditions for mass-production and
(Compant et al., 2005). Esto se debe a que la pro- also to become highly effective as a biocontrol agent.
tección de las plantas es determinada en gran medi- The most important environmental parameters are
da por la eficiente colonización de la rizosfera por the water availability, temperature and pH of the
los inoculantes y la competencia con la microflora rhizosphere (Costa et al., 2002). The physiological
nativa, que está mejor adaptada (Castro-Sowinski study of the Bacillus strains carried out in this work
et al., 2007; Conn y Franco 2004; Kozdrój y Van, confirmed that environmental factors, such as pH
2000). Estos factores influyen mucho en el estable- and temperature, directly influence the capacity
cimiento, proliferación y actividad de los bacilos of growth and biocontrol activity. The findings
en un ambiente donde los nutrientes son limitados. reported in the present study clearly demonstrate
La utilización de una amplia variedad de exudados that the environmental niche for the optimal growth
de raíz está correlacionada con la capacidad com- of BEB-8 strain is at a temperature range of 15-
petitiva de las bacterias y constituye la base nutri- 37 °C and a pH between 5 and 8. Interestingly
cional de la colonización de la rizosfera (Bais et pH but not temperature influences growth rate
al., 2006; Haichar et al., 2008). En este estudio, la in the ranges of the present study. However, the
prueba BIOLOG indicó que el aislamiento BEB-8 favorable environmental conditions where the
es una cepa de B. subtilis y confirmó las identida- Kodiak commercial preparation is able to grow are
des de las cepas PY-79 y Kodiak utilizadas como 28 °C in a pH range of 5-8, as was indicated by
controles. Nuestros resultados también confirma- the significance of the effect of interaction between
ron la capacidad de las diferentes cepas de Bacillus temperature and pH on dN/dt. A microbial species
de utilizar una gran variedad de fuentes de carbono. usually has a fairly wide range of environmental
Como señalaron Goddard et al. (2001) y Smalla et conditions in which it will grow. However, the
al. (1998) en sus estudios, las placas microtitula- growth rate is the variable physiological microbial
doras BIOLOG originalmente fueron creadas para initially affected by changes in the environment.
clasificar los aislamientos bacterianos con base en The lack of direct measurements of this factor
su capacidad de oxidar 95 distintas fuentes de car- has been a major drawback in understanding the
bono. Sin embargo, este método ha resultado ser rhizosphere effects in soil. Based on this, the
útil para evaluar los patrones de utilización de las biological and physiological characterization of
fuentes de carbono de las comunidades microbia- Bacillus subtilis with antagonistic activity carried
nas y las posibles diferencias metabólicas entre las out in the present work is of great importance. In a
poblaciones bacterianas de la rizosfera, así como recent report, Costa et al. (2002) defined the range
estudiar los efectos de los inóculos introducidos en of environmental conditions over which CPA-2
las comunidades microbianas del suelo. Además, strain of Pantoea agglomerans may be developed
aunque el perfil metabólico de las tres cepas mostró for biological control. They determined the effect
que se trataba de Bacillus subtilis, el análisis AFLP of water availability, temperature, pH, and their
produjo huellas de ADN de alta calidad con poli- interactions on the growth of the bacteria under
morfismos detectables y reveló variaciones a nivel in vitro conditions. Nevertheless, in contrast to
de cepa. La variabilidad entre estas cepas confirmó our results, Costa et al. (2000) did not correlate
que son diferentes. Jones et al. (2005) describieron the growth conditions or physiological status of
la individualización como el proceso mediante el the bacteria with the antagonistic activity of P.
cual las características morfológicas, bioquímicas agglomerans. The results shown in Table 1 and
o genéticas se asocian con un microorganismo, de Figure 3 emphasize the effects of proliferation,
manera tal que la combinación de características kinetics parameters and physiological status for
es únicamente de ese microorganismo y de ningún each strain on antagonistic activity. Under optimal
otro. Sin embargo, es fundamental conocer las con- growth conditions, the CFS obtained from the
diciones ambientales en que el agente de biocontrol exponential growth phase of the Kodiak and BEB-
puede crecer, a fin de establecer las condiciones de 8 strains showed mycelial growth inhibition of R.
producción en masa y también para que se con- solani. However, a greater inhibitory activity was
vierta en un agente de biocontrol muy eficaz. Los achieved using CFS obtained during the stationary
parámetros ambientales más importantes son la phase of either strain. On the contrary, altering pH
Los resultados que se muestran el Cuadro 1 y la phase. These results are similar to those reported
Figura 3 resaltan los efectos de la proliferación, los in the present work (Figure 3). These observations
parámetros cinéticos y el estado fisiológico de cada are particularly relevant since most of the literature
cepa en la actividad antagonista. En condiciones describes the production of antagonistic metabolites
óptimas de desarrollo, el CFS obtenido en la fase by B. subtilis at the early stages of the stationary
de crecimiento exponencial de las cepas Kodiak y phase, which coincides with the beginning of
BEB-8 mostró inhibición del crecimiento micelial the sporulation process. (Leclére et al., 2005;
de R. solani. Sin embargo, hubo mayor actividad Savluchinske et al., 2004). The enzymes required
inhibitoria cuando se utilizó el CFS obtenido du- for production of these metabolites begin in early
rante la fase estacionaria de cada cepa. En cambio, stages of population growth, but it is not until the
al alterar el pH y la temperatura para obtener una end of the exponential phase when the biofilm
tasa de crecimiento mínima, la capacidad antago- begins to form when its activity is greater as shown
nista se redujo o se perdió, independientemente del by the transcriptomic studies conducted by Kröber
estado fisiológico de la bacteria. et al. (2016). The subsequent enzymatic activity
La relación entre la tasa de crecimiento bacte- can cease within a few hours. However, this is not
riano y las condiciones ambientales involucra dife- a general rule, since according to the results shown
rentes mecanismos de respuesta. En este contexto, in Figure 3, there is still antagonistic activity on
se ha reportado que la producción de numerosos Rhizoctonia solani by strains BEB-8 and Kodiak.
metabolitos secundarios es regulada mediante un Finally, each metabolite may require a specific
sistema de dos componentes que es activado por pH-range and temperature for its activity. This study
una señal externa o interna (Grahovac et al., 2015). reveals that all the examined factors influenced
Las señales que activan el sistema son el pH, la the antifungal activity against Rhizoctonia solani
temperatura, la osmolaridad y la densidad bacte- and that interactions between the factors were
riana. Se ha identificado este sistema regulatorio also important. In conclusion, studies focused
en diferentes bacterias y se sabe que está relacio- on the physiological characteristics and kinetic
nado en la regulación de numerosas y diferentes parameters of growth of Bacillus subtilis strains
características bacterianas como la motilidad, la that allow to better understand bacterial behavior
formación de pili, la patogenicidad, los siderófo- in the biological control of Rhizoctonia solani.
ros y la producción de metabolitos secundarios
(Cosby et al., 1998; Horswill, 2007). Ahlem et al. Acknowledgements
(2012) mostraron que la biosíntesis del factor anta-
gónico, así como la eficacia del control biológico, We are grateful to Biol. Fernando Hernández Godínez
dependen estrictamente de las condiciones de cre- for a technical assistance and Dra. June Simpson for a
cimiento (pH, temperatura), y esto respalda nues- critical review of this manuscript. The research was carried
tros resultados. De igual manera, también se debe out in the Department of Biotechnology and Biochemistry
tener en cuenta el estado fisiológico al pensar en Cinvestav-Irapuato. This work received financial support from
la vida de las bacterias cuando se aplican al suelo. the Consejo Nacional de Ciencia y Tecnología; CONACyT,
Esto depende de las condiciones que prevalecen Mexico (Postdoctoral Research). Support for this research also
en el suelo, lo cual representa un factor clave en came from CONACYT-SEP-106401 y 61238.
el establecimiento y mantenimiento de los inóculos End of the English version
bacterianos en ambientes naturales. Esta hipótesis factores también fueron importantes. En conclu-
también es respaldada por los resultados obtenidos sión, los estudios enfocados en las características
por Vandenhove et al. (1993), que demostraron que fisiológicas y los parámetros cinéticos del creci-
al inocular en el suelo células de Azospirillum con miento de las cepas de Bacillus subtilis nos permiten
crecimiento exponencial, esto fomenta el estable- entender mejor el comportamiento bacteriano en el
cimiento de una población más grande y estable control biológico de Rhizoctonia solani.
que cuando se inoculan células durante la fase es-
tacionaria. Los autores llegaron a la conclusión de Agradecimientos
que el estado fisiológico de un inóculo tiene gran
influencia en su supervivencia. Además, Selim et Los autores desean expresar su agradecimiento al Biol.
al. (2005) reportaron que la producción del factor Fernando Hernández Godínez por la asistencia técnica que les
antagónico de la cepa B2 de Paenibacillus sp. fue proporcionó, y a la Dra. June Simpson por la revisión críti-
detectada a mediados de la fase de crecimiento ex- ca de este manuscrito. La investigación se llevó a cabo en el
ponencial, pero la máxima producción ocurrió al Departamento de Biotecnología y Bioquímica del Cinvestav-
final de la fase estacionaria. Estos resultados son Irapuato. Para la realización de este trabajo se recibió apoyo
similares a los que se presentan en este trabajo (Fi- económico del Consejo Nacional de Ciencia y Tecnología;
gura 3). Estas observaciones son particularmente CONACyT, México (investigación de posdoctorado). Agrade-
relevantes, ya que la mayor parte de la literatura cemos también el apoyo que nos proporcionaron CONACYT-
indica que B. subtilis produce metabolitos antago- SEP-106401 y 61238.
nistas en las primeras etapas de la fase estacionaria,
que coincide con el comienzo del proceso de espo-
rulación (Leclére et al., 2005; Savluchinske et al., LITERATURA CITADA
2004). Las enzimas requeridas para producir estos
Ahlem H, Mohammed E, Badoc A and Ahmed L. 2012. Effect
metabolitos empiezan a formarse en las primeras of pH, temperature and water activity on the inhibition of
etapas del crecimiento de la población, pero no es Botrytis cinerea by Bacillus amyloliquefaciens isolates.
African Journal of Biotechnology 11:2210-2217. Disponi-
sino hasta el final de la fase exponencial cuando ble en línea: [Link] DOI:
se empieza formar el biopelícula, es decir, cuando 10.5897/AJB11.645
Ashlee M, Losick ER and Kolter R. 2008. Ecology and geno-
tiene mayor actividad, como lo muestran los estu- mics of Bacillus subtilis. Trends in Microbiology 16:269-
dios transcriptómicos realizados por Kröber et al. 275. [Link]
Ashlee M, Losick ER and Kolter R. 2007. Bacillus subtilis
(2016). La actividad enzimática posterior puede Genome Diversity. Journal. Bacteriology 189:1163-1170.
terminar en pocas horas. Sin embargo, esta no es Disponible en línea: [Link]
short
una regla general, ya que, de acuerdo con los resul- Bais HP, Fall R and Vivanco JM. 2004. Biocontrol of Bacillus
tados que se muestran en la Figura 3, aún hay acti- subtilis against infection of Arabidopsis roots by Pseudo-
monas syringae is facilitated by biofilm formation and sur-
vidad antagonista en Rhizoctonia solani impulsada factin production. Plant Physiology 134:307-319. https://
por las cepas BEB-8 y Kodiak. [Link]/10.1104/pp.103.028712
Bais HP, Weir TF, Perry LG, Gilroy S and Vivanco JM. 2006.
Por último, cada metabolito requiere un rango The role of root exudates in rhizosphere interactions with
específico de pH y temperatura para su actividad. plants and other organisms. Annual Review of Plant
Biology 57:233-266. [Link]
Este estudio revela que todos los factores evalua- plant.57.032905.105159
dos influyeron en la actividad antifúngica contra Bapat S and Shah AK. 2000. Biological control of fusarial wilt
of pigeon pea by Bacillus brevis. Canadian Journal of Mi-
Rhizoctonia solani y que las interacciones entre los crobiology 46:25-132. [Link]
Bernal G, Illanes A and Ciampi L. 2002. Isolation and partial The ISME Journal 2:1221-1230. https//[Link]/10.1038/
purification of a metabolite from a mutant strain of Ba- ismej.2008.80
cillus sp. with antibiotic activity against plant pathogenic Horswill AR, Stoodley P, Stewart PS and Parsek MR. 2007.
agents. Electronic Journal of Biotechnology 5:12-20. Dis- The effect of the chemical, biological, and physical en-
ponible en línea: [Link] vironment on quorum sensing in structured microbial
Bloemberg G and Lugtenberg B. 2001. Molecular basis of communities. Analytical and Bioanalytical Chemistry
plant growth promotion and biocontrol by rhizobacteria. 387:371-380. [Link]
Current Opinion Plant Biology 4:343-350. [Link] Johnson LF and Curl EA. 1972. Culture media. In Methods for
org/10.1016/S1369-5266(00)00183-7 research on the ecology of soil borne plant pathogens. Bur-
Castro SS, Herschkovitz Y, Okon Y and Jurkevitch E. 2007. gges Publishing Company Auburn, Alabama 16:187-208.
Effects of inoculation with plant growth-promoting rhizo- Disponible en línea: [Link]
bacteria on resident rhizosphere microorganisms. Micro- abstract/19731903549
biology Letters 276:1-11. [Link] Jones SW, Dobson ME, Francesconi SC, Schoske R and
6968.2007.00878.x Crawford R. 2005. DNA assays for detection, identifi-
Compant S, Duffy B, Nowak J, Clement C and Ait Barka E. cation, and Individualization of select agent microor-
2005. Use of plant growth-promoting bacteria for bio- ganisms. Croatian Medical Journal 46:522-529. Dis-
control of plant diseases: Principles, mechanisms of ac- ponible en línea: [Link]
tion, and future prospects. Applied and Environmental sues/2005/46/4/[Link]
Microbiology 71:4951-4959. https//[Link]/10.1128/ Kamnev AA. 2008. FTIR spectroscopic studies of bacterial
AEM.71.9.4951-4959.2005 cellular responses to environmental factors, plant-bacterial
Conn VM and Franco CMM. 2004. Effect of microbial ino- interactions and signalling. Journal of Spectroscopy 22:83-
culants on the indigenous actinobacterial endophyte po- 95. [Link]
pulation in the roots of wheat as determined by terminal Kim PLL, Ryu J, Kim YH and ChI YT. 2010. Production of
restriction fragment length polymorphism. Applied and biosurfactant lipopeptides Iturin A, fengycin, and surfactin
Environmental Microbiology 70:6407-6413. [Link] a from Bacillus subtilis CMB32 for control of Colletotri-
org/10.1128/AEM.70.11.6407-6413.2004 chum gloeosporioides. Journal Microbiology and Biotech-
Cosby WM, Vollenbroich D, Lee OH and Zuber P. 1998. Alte- nology 20:138-145. http//[Link]/10.4014/jmb.0905.05007
red srf expression in Bacillus subtilis resulting from chan- Kozdrój J and Van Elsas JD. 2000. Response of the bacterial
ges in culture pH is dependent on the Spo0k oligopeptide community to root exudates in soil polluted with heavy
permease and the ComQX system of extracellular com- metals assessed by molecular and cultural approaches.
pounds. Journal of Bacteriology 180:1438-1445. Dispo- Soil Biology and Biochemistry 32:1405-1417. [Link]
nible en línea: [Link] org/10.1016/S0038-0717(00)00058-4
Costa E, Usall J, Teixido N, Delgado J and Viñas I. 2002. Kröber M, Verwaaijen B, Wibberg D, Winkler A, Pühler A and
Water activity, temperature and pH effects on growth of Schlüter A. 2016. Comparative transcriptome analysis of
the biocontrol agent Pantoea agglomerans CPA-2. Cana- the biocontrol strain Bacillus amyloliquefaciens FZB42 as
dian Journal of Microbiology 48:1082-1088. [Link] response to biofilm formation analyzed by RNA sequen-
org/10.1139/w03-001 cing. Journal Biotechnology 231:212-223. DOI: 10.1016/j.
Fujinami S and Fujisawa M. 2010. Industrial applications of jbiotec.2016.06.013
alkaliphiles and their enzymes-past, present and future. Leclére V, Béchet M, Adam A, Guez JS, Wathelet B, Ongena
Environmental Technology 31:845-856. [Link] M, Thonart P, Gancel F, Chollet-Imbert M and Jacques P.
org/10.1080/09593331003762807 2005. Mycosubtilin overproduction by Bacillus subtilis
Goddard VJ, Bailey MJ, Darrah P, Lilley AK and Thompson BBG100 enhances the organism’s antagonistic and biocon-
IP. 2001. Monitoring temporal and spatial variation in trol activities. Applied and Environmental Microbiology
rhizosphere bacterial population diversity: a community 71:4577-4584. [Link]
approach for the improved selection of rhizosphere com- 4584.2005
petent bacteria. Plant and Soil 232:181-193. [Link] Matarante A, Baruzzi F, Cocconcelli PS and Morea M. 2004.
org/10.1023/A:1010302607616 Genotyping and toxigenic potential of Bacillus subti-
Gong M, Wang JD, Zhang J, Yang H, Lu XF, Pei Y and lis and Bacillus pumilus strains occurring in industrial
Cheng JQ. 2006. Study of the antifungal ability of Baci- and artisanal cured sausages. Applied and Environmen-
llus subtilis strain PY-1 in vitro and identification of its tal Microbiology 70:5168-5176. [Link]
antifungal substance (Iturin A). Acta Biochimica et Bio- AEM.70.9.5168-5176.2004
physica Sinica 38:233-240. [Link] Nagórska K, Bikowski M and Obuchowski M. 2007. Multice-
7270.2006.00157.x llular behaviour and production of a wide variety of toxic
Grahovac JA, Rončević ZZ, Tadijan IŽ, Jokić AI and Dodić substances support usage of Bacillus subtilis as a powerful
JM. 2015. Optimization of media for antimicrobial com- biocontrol agent. Acta Biochimica Polonica 54:495-508.
pounds production by Bacillus subtilis. Acta Alimentaria Disponible en línea: [Link]
44:427-435. DOI: 10.1556/066.2015.44.0014 med/17882321
Haichar FZ, Marol C, Berge O, Rangel-Castro JI, Prosser JI, O´Callagman M, Gerrard EM and Johnson VW. 2001. New
Balesdent J, Heulin T and Achouak W. 2008. Plant host habi- Zeland Plant Protection 54:128-135. Disponible en línea:
tat and root exudates shape soil bacterial community structure. [Link]
Ongena M and Jacques P. 2008. Bacillus lipopeptides: versati- Smalla K, Wachtendorf U, Hever H, Liu WT and Forney L.
le weapons for plant disease biocontrol. Trends Microbio- 1998. Analysis of BIOLOG GN substrate utilization pat-
logy 16:116-125. DOI: 10.1016/[Link].2007.12.009 terns by microbial communities. Applied and Environ-
Pal KK and B. Mc Spadden Gardener. 2006. Biological Con- mental Microbiology 64:1220-1225. Disponible en línea:
trol of Plant Pathogens. The Plant Health Instructor. DOI: [Link]
10.1094/PHI-A-2006-1117-02 Stein T. 2005. Bacillus subtilis antibiotics: structures, syntheses
Rey MW, Ramaiya P, Nelson BA, Brody-Karpin SD, Zaretsky and specific functions. Molecular Microbiology 56:845-
EJ, Tang M, López de León A, Xiang H, Gusti V, Clausen 857. [Link]
IG, Olsen PB, Rasmussen MD, Andersen JT, Jørgensen Tamehiro N, Okamoto-Hosoya Y, Okamoto S, Ubukata M,
L, Larsen TS, Sorokin A, Bolotin A, Lapidus A, Galleron Hamada M, Naganawa H and Ochi K. 2002. Bacilysocin,
N, Ehrlich SD and Berka RM. 2004. Complete genome a novel phospholipid antibiotic produced by Bacillus sub-
sequence of the industrial bacterium Bacillus lichenifor- tilis 168. Antimicrobial Agents and Chemotherapy 46:315-
mis and comparisons with closely related Bacillus species. 320. [Link]
Genome Biology 5:r77. [Link] Vandenhove H, Merck R, Van Steenbergen M and Vlassak
5-10-R77 K. 1993. Microcalorimetric characterization, physiologi-
Savluchinske FS, Barbosa A, Cabrita M, Nunes L, Esteves A, cal stages and survival ability of Azospirillum brasilense.
Roseiro JC and Curto MJ. 2004. Antifungal activity of Ba- Soil Biology and Biochemistry 25:513-519. [Link]
cillus subtilis 355 against wood-surface contaminant fun- org/10.1016/0038-0717(93)90077-O
gi. Journal of Industrial Microbiology and Biotechnology Veith B, Herzberg C, Steckel S, Feesche J, Maurer KH, Ehr-
31:199-203. [Link] enreich P, Bäumer S, Henne A, Liesegang H, Merkl R,
Schallmey M, Singh A and Ward OP. 2004. Developments Ehrenreich A and Gottschalk G. 2004. The complete ge-
in the use of Bacillus species for industrial production. nome sequence of Bacillus licheniformis DSM13, an orga-
Canadian Journal of Microbiology 50:1-17. [Link] nism with great industrial potential. Journal of Molecular
org/10.1139/w03-076 Microbiology and Biotechnology 7:204-211. [Link]
Selim S, Negrel J, Govaerts C, Gianinazzi S and Van Tuinen org/10.1159/000079829
D. 2005 Isolation and partial characterization of antago- Vos P, Hoger R, Bleker M, Reijans M, Van de Lec T, Hones
nistic peptides produced by Paenibacillus sp. strain B2 M, Frijters A, Pot J, Peleman J, Kaiper M and Zabeau
isolated from the sorghum mycorrhizosphere. Applied and M. 1995. AFLP: A new technique for DNA fingerprin-
Environmental Microbiology 71:6501-6507. [Link] ting. Nucleic Acid Research 23:4407-4414. [Link]
org/10.1128/AEM.71.11.6501-6507.2005 org/10.1093/nar/23.21.4407
Shelburne CE, An FY, Dholpe V, Ramamoorthy A, Lopatin DE Zhang X, Zhanng B, Zhang Z, Shen W, Yang C, Yu J and Zhao
and Lantz MS. 2007. The spectrum of antimicrobial activi- Y. 2005. Survival of the biocontrol agents Brevibacillus
ty of the bacteriocin subtilosin A. Journal of Antimicrobial brevis ZJY-1 and Bacillus subtilis ZJY-116 on the spikes of
Chemotherapy 59:297-300. [Link] barley in the field. Journal Zhejiang University SCIENCE.
dkl495 B. 6:770-777. [Link]
Slater J. 1985. Microbial growth dynamics. In: Comprehen-
sive biotechnology, Mac-Young, M. (eds). Oxforf Perga-
mosm, p. 184-213.
Chávez AR, Mohan-Kohli M. 2018. Pathogenicity of Abstract. Wheat blast caused by Magnaporthe
Magnaporthe oryzae in varieties and wheat lines grown oryzae pathotype Triticum has become one of the
in Paraguay. Revista Mexicana de Fitopatología 36(2): most important crop production problems in South
276-286. America. Given the availability of few sources of
DOI: 10.18781/[Link].1712-3 resistance, the identification of newer sources has
become urgent. The present study was designed to
Primera publicación DOI: 06 de Marzo, 2018. evaluate the reaction of major wheat varieties grown
First DOI publication: March 06, 2018. in Paraguay to M. oryzae infection. Thirty-two
wheat varieties and four advanced breeding lines
were provided by the National Wheat Program of
Resumen. El brusone causado por Magnaporthe the Paraguayan Institute of Agrarian Technology.
oryzae patotipo Triticum, es uno de los problemas These varieties were spray inoculated with three
más serios para la producción de trigo en Sudamé- isolates of M. oryzae using 5.104 conidia mL-1.
rica. Debido al número reducido de fuentes de re- The disease reaction was evaluated on a severity
sistencia, la identificación de nuevas fuentes es de scale of 0-4, 15 days after inoculation. Data were
suma importancia. En este trabajo se evaluó la re- analyzed using the Kruskal-Wallis test. Considering
acción de las variedades de trigo sembradas en Pa- the median rating of infection, the materials were
raguay a la infección por M. oryzae. Treinta y dos classified as Resistant (0-1), Moderately Resistant
variedades y cuatro líneas avanzadas del Programa (1.1-2), Moderately Susceptible (2.1-3) and
Nacional de Investigación de Trigo del Instituto Pa- Susceptible (3.1-4). The variety Canindé 1 was
raguayo de Tecnología Agraria se inocularon con resistant to all isolates, and CD 116 was resistant
tres cepas, mediante aspersión, con una suspensión to one and moderately resistance to two isolates.
de 5 x 104 conidios mL-1. La evaluación se realizó All the remaining varieties were susceptible
a los 15 días utilizando una escala de severidad de or moderately susceptible to the three isolates,
0-4. Los datos se analizaron mediante la prueba de showing the susceptibility of major wheat varieties
Kruskal-Wallis. Con base en las medianas de se- grown in Paraguay, and an urgent need for widening
veridad, los materiales se clasificaron como Resis- the genetic basis of resistance to wheat blast disease
tentes (0-1), Moderadamente Resistentes (1.1-2), in the National Wheat Breeding Program.
Moderadamente susceptibles (2.1-3) y Suscepti-
bles (3.1-4). La variedad Canindé 1 fue resistente a Key words: Pyricularia, resistance, Triticum.
las tres cepas, mientras CD 116 fue resistente a uno
y moderadamente resistente a dos. Los demás ge-
notipos fueron susceptibles y moderadamente sus- Wheat blast or brusone caused by Magnaporthe
ceptibles a las tres cepas, demostrando la suscepti- oryzae pathotype Triticum (MoT) is one of the
bilidad de las variedades sembradas en Paraguay y most serious problems for wheat production in
la necesidad de ampliar la base de resistencia en el the tropical/subtropical region of South America.
programa nacional de mejoramiento. The disease appeared for the first time in northern
Paraná, Brazil in 1985 (Igarashi et al., 1986) and
Palabras clave: Pyricularia, resistencia, Triticum. was later detected in Paraguay in 1989 (Cunfer et
al., 1993). However, the first blast epidemic was
reported in 2002 and caused production losses
La piricularia o el brusone del trigo causado por greater than 70% in early-sown fields (Viedma and
M. oryzae patotipo Triticum (MoT), es uno de los Morel, 2002). The environmental conditions that
problemas más serios para la producción de trigo favor blast epidemics are temperatures between
en la región tropical/subtropical de Sudamérica. La 18 and 25°C and high relative humidity during
enfermedad tuvo su primera aparición en el norte heading and flowering, usually during the El Niño
de Paraná, Brasil en 1985 (Igarashi et al., 1986) y phenomenon (Kohli et al., 2011; Cunha et al.,
se identificó en Paraguay en 1989 (Cunfer et al., 2017).
1993). Sin embargo, su primera epifitia se reportó Given that wheat blast is a disease that is difficult
en 2002, causando pérdidas mayores al 70% de la to control, its management must include the use of
producción en campos sembrados tempranamente resistant wheat varieties along with chemical control
(Viedma y Morel, 2002). Las condiciones ambien- practices to reduce production losses. However, it
tales que desencadenan una epifitia son tempera- has been difficult to develop resistant varieties due
turas de entre 18 a 25°C, acompañadas de alta hu- to the low number of available resistance sources.
medad relativa durante la época de espigamiento y Some varieties derived from CIMMYT’s Milan line
floración, por lo general coincidiendo con la preva- have shown high levels of resistance to wheat blast
lencia del fenómeno de El Niño (Kohli et al., 2011; (Kohli et al., 2011). Recently, (Cruz et al., 2016)
Cunha et al., 2017). determined that the 2NS translocation, derived from
Considerando que la piricularia del trigo es una Triticum ventricosum, is responsible for conferring
enfermedad de control difícil, su manejo debe inte- resistance to Milan and other derived varieties. For
grar el uso de variedades resistentes junto a prácti- this reason, identifying different resistance sources
cas de control químico para disminuir las pérdidas. and characterizing the reaction of new genotypes
Sin embargo, el desarrollo de variedades ha sido are considered of vital importance. This study was
difícil debido al número reducido de fuentes de conducted to evaluate the reaction of Paraguayan
resistencia disponibles. Algunas variedades deri- wheat varieties to Magnaporthe oryzae infection,
vadas de Milan, una línea del CIMMYT, han sido as well as that of several advanced lines developed
identificadas con altos niveles de resistencia a la in the country and the main foreign varieties
enfermedad (Kohli et al., 2011). Recientemente, currently sown in Paraguay.
(Cruz et al., 2016) determinaron que la transloca- The trial was conducted in the greenhouse of the
ción 2NS cuyo origen es Triticum ventricosum, es Centro de Investigación Hernando Bertoni, Instituto
responsable de la resistencia en Milan y otras varie- Paraguayo de Tecnología Agraria, (IPTA) in
dades derivadas. Por tal motivo, la identificación de Caacupé, Paraguay (south latitude 25°23’25.314”,
distintas fuentes de resistencia y la caracterización west longitude 57°11’27.848”). The trial included
de la reacción de nuevos genotipos es considerada 32 wheat varieties and four advanced lines provided
de vital importancia. Este trabajo se realizó con el by the IPTA’s Programa Nacional de Investigación
objetivo de evaluar la reacción de las variedades de Trigo (Table 1), all of them currently sown in
paraguayas de trigo, así como algunas líneas avan- Paraguay. The varieties were sown on 12 April 2016
zadas desarrolladas en el país, y las principales va- in 15x25 cm plastic pots containing a substratum
riedades extrajeras sembradas actualmente en Para- made up of soil and leaf mulch at a 3:1 ratio. Two
guay a la infección de Magnaporthe oryzae. plants per pot were sown for each fungus isolate,
El ensayo se realizó en el invernadero del Cen- and four pots were planted for each variety. Each
tro de Investigación Hernando Bertoni, Instituto pot was considered a replication. The greenhouse
Paraguayo de Tecnología Agraria, IPTA, Caacupé, was kept at a temperature of 15 ± 2°C, and the
Paraguay, ubicado en latitud Sur 25°23’25.314”, agronomic management consisted of one 15-15-
longitud Oeste 57°11’27.848”. Se utilizaron 32 va- 15 fertilizer application at a dose of 5 g per pot 15
riedades, y cuatro líneas avanzadas de trigo, que days after emergence, plus one application of urea
fueron proveídas por el Programa Nacional de In- 45 days after emergence using the same amount.
vestigación de Trigo del IPTA (Cuadro 1), todas Irrigation was applied twice a week, and the plants
sembradas actualmente en Paraguay. Estas varie- were monitored on a weekly basis to detect pests.
dades se sembraron el 12 de abril de 2016, en ma- Magnaporthe oryzae pathotype Triticum (MoT)
cetas de plástico de 15x25 cm, que contenían un isolates used in the study were taken from infected
sustrato compuesto por suelo y mantillo de hojas wheat spikes collected in the field, as follows: P13-
en la proporción 3:1, a razón de dos plantas por 009 was collected in Capitán Miranda, Itapúa, in
maceta, se sembraron cuatro macetas de cada va- the 2013 cycle; P14-025, in Yhovy, Canindeyú, in
riedad, para cada cepa del hongo, cada maceta se the 2014 cycle; and P14-039, in La Flor farm, Alto
consideró como una repetición. La temperatura del Paraná, in 2014. These isolates were selected based
invernadero se mantuvo a 15 ± 2°C, y el manejo on their virulence in previous trials and on their
agronómico, consistió en una fertilización con fer- places of origin, which represent the main wheat
tilizante 15-15-15, a razón de 5 gramos por mace- production areas in Paraguay. The isolates were
ta, 15 días luego de la emergencia, más una ferti- kept on filter paper at -18 °C as part of the isolates
lización con urea a los 45 días de la emergencia, collection of the Pyricularia in Wheat Project.
en la misma cantidad; los riegos se realizaron dos They were replicated in Petri dishes containing
veces por semana, y se monitoreó semanalmente oatmeal flour agar culture medium and incubated
Cuadro 1. Variedades y líneas de trigo utilizadas en el estudio, con su genealogía y días a la espigazón.
Table 1. Wheat varieties and lines used in the present study, including their genealogy and days to heading.
Espigazón
Variedad Genealogía
(días)
para detectar la aparición de plagas. Las cepas de for 10 days at 25°C and a 12-h photoperiod. The
MoT utilizadas en el estudio se aislaron a partir de mycelium was later crushed using an L-shaped
espigas de trigo enfermas recolectadas en campo. glass rod, and the dishes were exposed to continuous
Estas fueron P13-009, colectada en Capitán Miran- fluorescent light for three days to favor sporulation.
da, Itapúa durante el ciclo 2013; P14-025 colectada Then, the spores were removed using a paint brush
en Yhovy, Canindeyú, 2014 y P14-039, colectada and sterile distilled water (Marangoni et al., 2013).
en la Estancia Flor, Alto Paraná, en 2014; se se- The conidia concentration was adjusted with a
leccionaron con base en su virulencia en ensayos Neubauer hemacytometer at 5x104 conidia ml-1 by
previos y a su origen, que representan las tres prin- adding sterile distilled water to dilute it (Chávez
cipales zonas de producción de trigo en Paraguay. et al., 2015). Inoculation was performed when
Las cepas se encontraban conservadas en el cepario each variety reached stage 59 on Zadok’s scale,
del Proyecto Pyricularia en Trigo, sobre papel de this is, when the spikes were completely out of
filtro a -18 °C. Fueron repicadas a cajas de Petri the flag leaf sheath. Spikes were sprayed using a
con medio de cultivo Harina de Avena-Agar y se manual sprayer (three sprayings per spike). After
incubaron durante 10 días a 25°C y fotoperiodo de the spikes were sprayed, the plants were kept in
12 horas. Posteriormente, el micelio se aplastó con darkness for 24 h, at 80±5% moisture and 27±2°C
una varilla de vidrio con forma de L, y las placas se temperature in a heated room in the greenhouse
expusieron a luz fluorescente continua durante tres to favor infection. After that period, the plants
días, para favorecer la esporulación. Posteriormen- were removed from the heated room and kept in
te las esporas se removieron con ayuda de un pin- the greenhouse, at the same temperature, 60 ± 5%
cel y agua destilada esterilizada (Marangoni et al., moisture and 12-h photoperiod. Symptoms were
2013). La concentración de conidios se ajustó uti- observed and evaluated 15 days after inoculation.
lizando un hemacitómetro Neubauer, a 5x104 coni- The scale proposed by Tagle et al. (2014) was
dios ml-1, utilizando para la dilución agua destilada adapted to evaluate infection severity on the
esterilizada (Chávez et al., 2015). La inoculación spikes. This scale classifies symptoms as follows:
se realizó a medida que cada variedad alcanzó el 0 = no infection; 1 = small lesions, < 1.5 mm; 2
estadio 59 de la escala de Zadok, es decir, cuando = intermediate lesions, < 3 mm; 3 = mixture of
las espigas se encontraban completamente fuera de green and white glumes, without apparent necrosis,
la hoja bandera, mediante aspersión con un asper- caused by a hypersensitive reaction; 4 = complete
sor manual (tres aspersiones por espiga). Luego de spike necrosis. Data were analyzed using Kruskal-
asperjadas las espigas, las plantas se mantuvieron Wallis’ test and the INFOSTAT (version 2016e)
en una sala climatizada dentro del invernadero, en statistical program. Based on the infection means,
oscuridad por 24 horas con 80±5% de humedad y on which the test is based, the genetic materials
27±2°C de temperatura para favorecer la infección. were classified as Resistant (0-1), Moderately
Trascurrido ese tiempo, las plantas se retiraron de resistant (1.1-2), Moderately susceptible (2.1-3)
la sala climatizada y se mantuvieron a la misma and Susceptible (3.1-4).
temperatura, a humedad de 60 ± 5 %, con un foto- Significant statistical differences were found
periodo de 12 h dentro del invernadero. La obser- between the varieties and their interaction with
vación de síntomas y evaluación se realizó 15 días the inoculated isolates (Table 2). For the P13-009
después de la inoculación. Se evaluó la severidad isolate, two varieties (Canindé 1, CD 116) were
de la infección en las espigas, adaptando la esca- classified as resistant; three were moderately
la propuesta por Tagle et al. (2014). Esta escala resistant (TBIO Toruk, TBIO Iguazu, TBIO
clasifica los síntomas de la siguiente manera: 0 = Sintonía), and the rest were moderately susceptible
Sin infección; 1 = Lesiones pequeñas, < 1.5 mm; and susceptible. For the P14-025 and P14-039
2 = Lesiones de tamaño intermedio, < 3 mm; 3 = isolates only one variety was classified as resistant
Mezcla de glumas verdes y blancas, sin necrosis (Canindé 1), and two were moderately resistant (CD
aparente, causado por una reacción de hipersen- 116 and TBIO Sintonía). The rest were classified
sibilidad; 4 = Espiga completamente necrosada. as moderately susceptible and susceptible. As for
Los datos fueron analizados mediante la prueba de the Paraguayan varieties, Canindé 1 was the only
Kruskal-Wallis, utilizando el programa estadístico one classified as resistant to the three inoculated
INFOSTAT (versión 2016e). Teniendo en cuenta isolates, while Itapúa 75 that was inoculated with
las medianas de infección, en las cuales se basa isolate P14-025, and Canindé 3, with isolates P13-
la prueba, se clasificaron los materiales genéticos 009 and P14-039, were moderately susceptible. The
como Resistentes (0-1), Moderadamente Resisten- remaining varieties, as well as the four advanced
tes (1.1-2), Moderadamente susceptibles (2.1-3) y lines evaluated, were susceptible. The interaction
Susceptibles (3.1-4). among varieties and the fungus isolates used is
Se encontraron diferencias estadísticas signifi- limited to intermediate cases, in which a variety
cativas entre las variedades y su interacción con las classified as moderately resistant to an isolate
cepas inoculadas (Cuadro 2). Para la cepa P13-009, shows a moderately susceptible reaction to another
dos variedades (Canindé 1, CD 116) se clasificaron isolate, and vice versa (TBIO Iguazú, TBIO Toruk:
como resistentes; tres moderadamente resistentes MR P13-009; MS P14-025). This kind of interaction
Cuadro 2. Clasificación de la reacción de las variedades y líneas de trigo, a las tres cepas de Magnaporthe oryzae estudiadas,
de acuerdo a la mediana, rankeadas según la Prueba de Kruskal-Wallis.
Table 2. Classification of wheat varieties and lines resistance to three Magnaporthe oryzae isolates, according to means and
ranked using Kruskal-Wallis’ test.
(TBIO Toruk. TBIO Iguazu, TBIO Sintonía), y las among wheat varieties and Magnaporthe isolates
demás fueron moderadamente susceptibles y sus- shows the specific reactions between the host and
ceptibles. Para las cepas P14-025 y P14-039 solo the pathogen that must be thoroughly studied in the
una variedad fue clasificada resistente (Canindé 1), future.
y dos moderadamente resistentes (CD 116 y TBIO It should be noted that Canindé 1 was resistant to
Sintonía). El resto de las variedades se clasificaron the three pathogen isolates, while CD 116, its sister
como moderadamente susceptibles y susceptibles. line derived from the same genealogy, was resistant
En cuanto a las variedades paraguayas, Canindé 1, to one of the isolates (P13-009) and moderately
fue la única clasificada como resistente a las tres resistant to the other two (P14-025 and P14-039).
cepas inoculadas; mientras que Itapúa 75 con la Considering that both varieties are derived from the
cepa P14-025, y Canindé 3 con las cepas P13-009 Milan line, which contains the 2NS segment that
y P14-039, fueron moderadamente susceptibles; confers resistance to the disease (Kohli et al., 2011;
las demás, al igual que las cuatro líneas avanzadas Cruz et al., 2016), the difference in their reactions
evaluadas fueron susceptibles. La interacción entre is due to their genetic background, which can vary
variedades y los aislados del hongo utilizados se during the process of selecting a progeny. It is also
limita a los casos intermedios, donde una variedad important to highlight the moderate resistance of
clasificada como moderadamente resistente para the TBIO Sintonía variety to the three isolates used.
una cepa muestra la reacción moderadamente sus- The susceptible and/or moderately susceptible
ceptible para otra cepa y viceversa (TBIO Iguazú, reaction of most wheat varieties sown in Paraguay
TBIO Toruk: MR P13-009; MS P14-025). Este tipo could be a warning that strong epidemics could
de interacción entre variedades de trigo y cepas de occur under favorable conditions. Evaluation under
Magnaporthe señalan la especificidad de reaccio- controlled conditions is valuable as a reference for
nes entre el huésped y patógeno que debe ser inves- genetic improvement activities aimed at selecting
tigada detalladamente en el futuro. resistant materials to wheat blast mildew, but it
Es interesante observar que Canindé 1, se mos- is possible that the varieties may react differently
tró resistente a las tres cepas del patógeno, mien- under field conditions. The difference in the
tras que su línea hermana, derivada de la misma varieties’ performance under field conditions and
genealogía, CD 116, fue resistente a una de las when inoculated in the greenhouse has already
cepas (P13-009) y moderadamente resistente a las been observed by Igarashi (1990) and Urashima
otras dos (P14-025 y P14-039). Considerando que and Kato (1994) and is attributed to the pathogenic
las dos variedades son derivadas de la línea Milan, variability of the fungus (Urashima et al., 2004). In
poseedora del segmento 2NS, que confiere resis- Paraguay, Kohli et al. (2012) reported the reaction
tencia a la enfermedad (Kohli et al., 2011; Cruz of varieties Canindé 3, Canindé 11, Canindé 12,
et al., 2016), la diferencia de reacción entre ellas Canindé 13, Itapúa 40 and Itapúa 70 as moderately
puede ser explicada por su fondo genético, que susceptible to susceptible in the field, while
puede variar en el proceso de selección de una pro- Canindé 1 and Itapúa 75 were moderately resistant.
genie. También es importante destacar la modera- Except for Itapúa 75, a long-cycle variety, the
da resistencia de la variedad TBIO Sintonía, a las reactions observed in the field coincided with those
tres cepas utilizadas. La reacción susceptible y/o observed in this study under controlled greenhouse
moderadamente susceptible en la mayor parte de conditions. In Brazil, Fronza et al. (2016) observed
las variedades de trigo sembradas en el Paraguay that varieties QUARTZO, FUNDACEP RAICES,
podría ser una señal de alerta sobre la probabili- BRS 220 and IPR 85 are moderately resistant
dad de una epifitia fuerte bajo condiciones favora- under field conditions. In the present study, these
bles. La evaluación bajo condiciones controladas varieties were classified as moderately susceptible
tiene su valor como referencia en los trabajos de and susceptible to the three isolates. However, both
mejoramiento genético para seleccionar materiales studies agree on the resistance of variety CD 116.
resistentes a esta enfermedad; sin embargo, es po- Considering that environmental conditions play an
sible que en condiciones de campo la reacción de important role in the expression of the disease in
estas variedades sea diferente. Ésta diferencia en el the field, it is necessary to evaluate the resistance
comportamiento de las variedades en condiciones of genetic materials while controlling the spectrum
de campo y al ser inoculadas en invernadero, ya of environmental conditions and widening the
fue observada por Igarashi (1990) y Urashima y pathogen’s variability under controlled conditions.
Kato (1994), la cual se atribuye a la variabilidad This study shows the susceptibility of most of
patogénica del hongo (Urashima et al., 2004). En the wheat varieties sown in Paraguay, both local
Paraguay, Kohli et al. (2012), reportan la reacción and foreign, which means that they would be
a campo de las variedades Canindé 3, Canindé 11, vulnerable to severe wheat blast epidemics under
Canindé 12, Canindé 13, Itapúa 40 e Itapúa 70, favorable conditions. It also shows the first evidence
como moderadamente susceptible a susceptible, of the interactions that may exist between wheat
mientras que Canindé 1 e Itapúa 75 son moderada- varieties and different isolates of the Magnaporthe
mente resistentes. Con excepción de Itapúa 75, una oryzae pathotype Triticum fungus. For this reason,
variedad de ciclo largo, las reacciones observadas it is urgent to identify and introduce new resistance
en campo coincidieron con aquellas observadas en sources in the improvement program in order to
este trabajo con condiciones controladas de inver- increase the number of resistant varieties in the
nadero. En Brasil, Fronza et al. (2016), observa- future.
ron que las variedades QUARTZO, FUNDACEP
RAICES, BRS 220 e IPR 85 son moderadamente Acknowledgments
resistentes en condiciones de campo. En el presen-
te estudio, estas variedades se clasificaron como To Consejo Nacional de Ciencia y Tecnología
moderadamente susceptibles y susceptibles a las (CONACYT)-Paraguay for their financial support through the
tres cepas. Sin embargo, los dos estudios coinciden PROCIENCIA Program.
en la resistencia de la variedad CD 116. Conside-
End of the English version
rando que las condiciones ambientales juegan un
papel importante en la expresión de la enfermedad
en el campo, es necesario evaluar la resistencia de
los materiales genéticos, controlando el espectro de
condiciones ambientales y ampliando la variabili-
dad del patógeno bajo condiciones controladas. Agradecimientos
El estudio expone la susceptibilidad de una gran
mayoría de las variedades de trigo sembradas en Al Consejo Nacional de Ciencia y Tecnología, CONA-
Paraguay, tanto nacionales como extranjeras, que CYT, Paraguay por el apoyo económico brindado a través del
Cruz CD, Peterson GL, Bockus WW, Kankanala P, Dubkovs- Igarashi, S. 1990. Update on wheat blast (Pyricularia oryzae)
ky J, Jordan KW, Akhunov E, Chumley F, Baldelomar FD in Brazil. Pp:480-483. In: Saunders, DA (Ed.) Proceeding
and Valent B. 2016. The 2NS translocation from Aegilops of the International Conference-Wheat for the nontraditio-
ventricosa confers resistance to the Triticum pathotype of nal warm areas. CIMMYT. México, MX.
Magnaporthe oryzae. Crop Science 56:990-1000. Dispo- Kohli MM, Mehta YR, Guzman, E, Viedma L and Cubilla
nible en línea: [Link] L. 2011. Pyricularia blast- A threat to wheat cultivation.
PMC5087972/pdf/[Link] Czech Journal of Genetics and Plant Breeding 47:S130-
Cunfer BM, Yorinori T and Igarashi S. 1993. Wheat blast. S134. (Special Issue). Disponible en línea: [Link]
Pp:125-128. In: Mathur SB, Cunfer BM (eds.). Seed borne [Link]/publicFiles/[Link]
diseases and seed health testing of wheat. Danish Gover- Kohli M, Cabrera G y Cubilla L. 2012. Guía práctica para
nment Institute of Seed Pathology for Developing Coun- el manejo y la producción de Trigo. IPTA/CAPECO/
tries. Copenhagen. INBIO. 52 p. Disponible en línea: [Link]
Cunha, JMF, Nicolau M, Pavan WM, Amaral C, Karrei M, de py/uploads/Gui%CC%81a_pra%CC%81ctica_para_el_
Vargas F, Boeira JL, Tagliari A and Tsukahara R. 2017. A manejo_y_la_produccio%CC%81n_de_trigo_2012.pdf
weather-based model for predicting early season inoculum Marangoni M, Nunes M, Fonseca N and Metha Y. 2013. Pyri-
build-up and spike infection by the wheat blast patho- cularia blast on white oats: a new threat to wheat cultiva-
gen. Tropical plant pathology 42: 230-237. [Link] tion. Tropical Plant Pathology 38:198-202. [Link]
org/10.1007/s40858-017-0164-2 org/10.1590/S1982-56762013005000004
Fronza V, Moresco ER, Maciel JLN, Silva MS, Scheeren PL Tagle AG, Chuma I and Tosa Y. 2014. Rmg7, a new gene for
and Soares Sobrinho J. 2016. Reaction of Brazilian wheat resistance to Triticum isolates of Pyricularia oryzae iden-
cultivars to wheat blast in the Cerrado Región. Pp:142. In: tified in tetraploid wheat. Phytopathology 105:495-499.
Madeiros Del Ponte E, Bergstrom G, Pavan W, Lazzaretti [Link]
A, Cunha Fernandes JM. (eds.) Book of Abstracts. 5th In- Urashima AS and Kato H. 1994. Varietal resistance and che-
ternational Symposium on Fusarium head blight. 2nd Inter- mical control of wheat blast fungus. Summa Phytopatho-
national Workshop on Wheat Blast. Universidade de Paso logica 20:107-112.
Fondo, RS. BR. Disponible en línea: [Link] Urashima AS, Lavorent NA, Goulart ACP and Metha YR.
br/~events/[Link] 2004. Resistance spectra of wheat cultivars and virulence
Igarashi S, Utimada C.M, Igarashi LC, Kazuma AE e Lopes diversity of Magnaporthe grisea isolates in Brazil. Fitopa-
RC. 1986. Pyricularia sp. em trigo. I. Ocorrência de Pyri- tologia Brasileira 29:511-518. [Link]
cularia sp. no estado do Paraná. Fitopatologia Brasileira S0100-41582004000500007
11:351-352. Viedma LQ y Morel W. 2002. Añublo o Piricularia del Trigo.
Díptico. MAG/DIA/CRIA. Programa de Investigación de
Trigo, CRIA, Capitán Miranda, Itapúa.
Naivy Gamboa-Tec, Angela Kú-González, Luis Carlos Gutiérrez-Pacheco, Enrique Castaño, Luisa López-
Ochoa*, Unidad de Bioquímica y Biología Molecular de Plantas, Centro de Investigación Científica de Yucatán,
Calle 43 No. 130, Colonia Chuburná de Hidalgo CP. 97200. Mérida, Yucatán. México. *Autor para correspon-
dencia: luisa_lopez@[Link].
Gamboa-Tec N, Kú-González A, Gutiérrez-Pacheco LC, Abstract. Euphorbia mosaic virus isolated from
Castaño E, López-Ochoa L. 2018. Anatomic alterations the Yucatan Peninsula is a bipartite begomovirus
and hyperplasia induced by Euphorbia mosaic virus Yu- with a wide range of experimental hosts, including
catan Peninsula isolate at the meshophyll. Revista Mexi- species of economic importance, such as bean, chilli
cana de Fitopatología 36(2): 287-297. and tomato, among others. This virus produced
DOI: 10.18781/[Link].1712-2 severe symptoms on Nicotiana benthamiana
leaves, leaf blade deformations, loss of tissue and
Primera publicación DOI: 09 de Marzo, 2018. cell identity, as well as changes in the mesophyll
First DOI publication: March 09, 2018. structure. Unlike other bipartite begomoviruses,
EuMV-YP induced cell proliferation at the
mesophyll; it also positively regulated the
Resumen. Euphorbia mosaic virus aislamiento expression of cycA1, cycA2 and cdkB2.2, genes
Yucatan Peninsula es un begomovirus bipartita con involved in the G2/M transition of the mitotic cell
una amplia gama de hospedantes experimentales, cycle, and localized at the mesophyll. This is the
que incluyen especies de importancia económica, first example of a bipartite begomovirus capable
como frijol, chile y tomate, entre otras. Este virus of inducing cell proliferation.
provocó síntomas severos en hojas de Nicotiana
benthamiana, pérdida de identidad celular y tisu- Key words: geminivirus; cell cycle.
lar, deformaciones de la lámina foliar y de la ner-
vadura central, cambios en la estructura del mesó-
filo y proliferación celular, a diferencia de otros Euphorbia mosaic virus, isolated from the
begomovirus bipartitas. Activó la expresión de los Yucatan Peninsula (EuMV-YP) is a bipartite
genes cycA1, cycA2 y cdkB2.2, implicados en la begomovirus with a wide range of experimental
transición G2/M del ciclo celular mitótico y se lo- hosts. The gene silencing induced by EuMV-YP in
calizó en el mesófilo de las hojas. EuMV-YP es el Nicotiana benthamiana begins in the-midribs and
primer ejemplo de un begomovirus bipartita capaz extends to the rest of the leaf (Villanueva et al.,
de inducir la proliferación celular. 2013), which indicates that it is capable of reaching
the mesophyll. Most bipartite begomoviruses have
Palabras clave: geminivirus; ciclo celular. specific hosts in which they are restricted to the
phloem. The Tomato golden mosaic virus (TGMV)
and the African cassava mosaic virus (ACMV) can
Euphorbia mosaic virus aislamiento Yucatan invade the mesophyll. There is a correlation in its
Peninsula (EuMV-YP) es un begomovirus bipartita capability to exit the phloem and to produce severe
con una amplia gama de hospedantes experimenta- symptoms in N. benthamiana (Wege et al., 2001).
les. El silenciamiento génico inducido por EuMV- The replication of geminiviruses takes place in the
YP en Nicotiana benthamiana inicia en las nerva- nuclei of differentiated cells, and for this, they
duras y se extiende hacia el resto de la hoja (Villa- induce their entry into the cell cycle. The bipartite
nueva et al., 2013), lo que sugiere que es capaz de begomoviruses and mastreviruses promote DNA
alcanzar el mesófilo. La mayoría de los begomovi- synthesis without undergoing cell division (revised
rus bipartitas tienen hospedantes específicos, en los by Hanley et al., 2013); whereas curtoviruses
cuales permanecen restringidos al floema. El To- induce mitosis, producing enations in the leaves
mato golden mosaic virus (TGMV) y el African midribs (Park et al., 2004; Latham et al., 1997).
cassava mosaic virus (ACMV) pueden invadir el This investigation posed the question of whether
mesófilo. Existe una correlación en su capacidad de EuMV-YP is able to reach cells of the N.
salir del floema y la de producir síntomas severos benthamiana mesophyll and if its tissue tropism
en N. benthamiana (Wege et al., 2001). La replica- correlates with the severity of the symptoms
ción de los geminivirus ocurre en el núcleo de las produced. To inoculate with the wild virus,
células diferenciadas, para ello inducen su entrada previously constructed infective clones were used
al ciclo celular. Los begomovirus bipartitas y los (Villanueva et al., 2013), and to locate the virus,
mastrevirus promueven la síntesis de ADN sin pa- expression vector pEuMV-YPDAV1:GFP was
sar por la división celular (revisado por Hanley et constructed. The combinations of plasmids used
al., 2013); mientras que los curtovirus inducen la per treatment are indicated in Table 1. In each
mitosis, produciendo verrugas en la nervadura cen- treatment, 20 N. benthamiana plants with four true
tral (Park et al., 2004; Latham et al., 1997). En este leaves were inoculated, as reported previously
trabajo se abordó la pregunta de si EuMV-YP es (Villanueva et al., 2013); in this investigation, a
capaz de infectar las células del mesófilo de N. ben- pressure of 70 psi was applied at a distance of 6 cm,
thamiana y si su localización correlaciona con la as well as 1 μm gold particles covered with 5 μg of
severidad de los síntomas producidos. Para inocu- each plasmid. Fifteen days post inoculation (dpi),
lar con el virus silvestre se emplearon clonas infec- leaves number nine and 10 were harvested . They
tivas construidas previamente (Villanueva et al., are were named “systemic leaves,”in this
2013), para localizar al virus se construyó el vector manuscript, since they emerged after inoculation
de expresión pEuMV-YPDAV1:GFP. Las combi- Paraffin inclusions of fixed tissues, and 8-10 μm
naciones de plásmidos utilizados por tratamiento se transversal cuts of the center of the leaves were
indican en el Cuadro 1. En cada tratamiento se ino- made, as reported previously (Moo et al., 2012).
cularon 20 plantas de N. benthamiana de cuatro Images were taken using a 40x lens of an Olympus
hojas verdaderas, como se reportó previamente FV100 SW laser confocal microscope, and they
(Villanueva et al., 2013), en este trabajo se aplicó were processed using the FV10 ASW software
una presión de 70 psi a 6 cm de distancia y partícu- version 4.1. The GFP fluorescence was captured
las de oro de 1 μm recubiertas con 5 μg de cada with 488/507 nm wavelengths of excitation/
plásmido. A los 15 días después de la inoculación emission, respectively. For the histological analysis,
(ddi) se recolectaron las hojas número nueve y 10, the sections were dyed with toluidine blue. Images
denominadas “hojas con infección sistémica” por- were taken of transversal sections and of the
que emergieron después de la inoculación. Estas se midsections of leaves with systemic infections
fijaron y se embebieron en parafina, se hicieron using the 6.5x lens of a Nikon E200 microscope.
cortes transversales de 8-10 μm en el centro de las The leaf’s thickness was measured and the number
hojas tal como se reportó previamente (Moo et al., of cells per mm2 was counted in four plants with
2012). Se adquirieron imágenes con el objetivo 40x moderate to severe symptoms at 15dpi. The number
de un microscopio confocal láser modelo Olympus of cells and the thickness of the leaf blade were
FV100 SW y se procesaron con el software FV10 graphed using 12 individual values. We tested the
ASW versión 4.1. La fluorescencia de GFP se cap- null hypothesis that the means of plants with severe
turó con longitudes de onda de excitación/emisión and moderate symptoms are equal to healthy plants.
de 488/507 nm, respectivamente. Para el análisis F tests were performed on two samples to determine
histológico, las secciones se tiñeron con azul de to- the homogeneity of variances. The statistical
luidina. Se registraron imágenes de secciones significance between the pairs of means (severe or
transversales y de la región media de las hojas con moderate symptoms vs healthy plants) was obtained
infección sistémica con el objetivo 6.5x de un mi- using the Student’s t-test on two samples, assuming
croscopio Eclipse E200 Nikon. Se midió el grosor unequal variances, using Excel’s Data Analysis
de la hoja y se contó el número de células por mm2 ToolPak program. For the gene expression studies,
de cuatro plantas con síntomas moderados o seve- leaves with systemic infections were taken from
ros a los 15 ddi. Se graficó el número de células y three plants, frozen, and ground together in liquid
(datos no mostrados). Estos resultados demuestran of total RNA, Oligo-dT [d (T) 23VN] and the
que EuMV-YP es capaz de invadir todos los tipos ProtoScript M-MuLV kit, following the
de células del mesófilo en N. benthamiana en una manufacturer protocol (New England Biolabs,
alta proporción, tal como lo hacen ACMV y TGMV U.S.A.), and the final volume was adjusted to 50
(Wage et al., 2001). EuMV-YP también causó sín- μL. For the second strand,0.2 μM of specific
tomas severos en N. benthamiana; a los 15 ddi se primers were used for genes cycA1, cycA2,
encontraron plantas con distintos grados de severi- cdkB2.2 (Caracuel et al., 2012) and ubi3 (Kotakis
dad: siete leves, ocho moderados y cinco severos. et al., 2010), 5 μL of the cDNA, 0.2 mM dNTPs,
Las hojas con infección sistémica de plantas con 1.25 units of Taq polymerase and Thermo Pol
síntomas severos presentaron enrollamientos pro- buffer (New England Biolabs) in 25 μL, with the
nunciados del margen hacia el envés, así como program: 94 °C for 5 min / 28 cycles at 94 °C for 30
arrugamientos o abultamientos abundantes (Figura s, 56 °C for 60 s and 72 °C for 1 min / 72 °C for 10
2A, 2B y 2C), estos síntomas se mantuvieron hasta min. We separated 10 μL in an agarose gel at 0.8%
los 21 ddi. A los 25 ddi aparecieron mosaicos clo- stained with ethidium bromide. GFP was found
róticos y a los 28 ddi se observó la atenuación de directly in all types of mesophyll cells, such as the
síntomas (Figura 2D), que permanecieron así hasta upper epidermis and the parenchyma in palisade
la finalización del experimento. Estos resultados (Figure 1A), the spongy parenchyma and the lower
demuestran que al igual que ACMV y TGMV, Eu- epidermis (Figure 1C) of the leaves with systemic
MV-YP es capaz de inducir síntomas severos en N. infections 15 dpi. No GFP was found in healthy
benthamiana. Se han descrito tres determinantes plants (Figure 1B and 1C). GFP fluorescence was
genéticos que confieren la localización tisular de low and was not directly detectable in the phloem
TGMV (Morra y Petty, 2000). EuMV-YP pertenece of the midrib and in other cells of the vascular
a un clado taxonómico distinto (Hernández et al., bundles, although it was found using
2007), por tanto, los determinantes genéticos que le immunodetection (data not shown). These results
confieren la capacidad de invadir el mesófilo y de show that EuMV-YP is capable of invading all
producir síntomas severos pueden ser distintos. Los types of mesophyll cells in N. benthamiana in a
abultamientos observados en las hojas de las plan- high proportion, just as ACMV and TGMV (Wage
tas con síntomas severos sugerían que EuMV-YP et al., 2001). EuMV-YP also caused severe
causaba alteraciones anatómicas en las hojas (Figu- symptoms in N. benthamiana; at 15 dpi, plants
ra 2A), además de una alta frecuencia de eventos de were found with different degrees of severity:
división celular (Figura 1A). Para caracterizar este seven mild, eight moderate and five severe. The
hallazgo, se hizo un análisis histológico exhaustivo leaves with systemic infections from plants with
de las hojas en regiones discretas a lo largo de toda severe symptoms presented strong downward
la lámina foliar (Figura 3A). En las plantas sanas se curling of the margins, as well as abundant crinkling
observó la organización tisular típica de N. bentha- or bulging (Figure 2A, 2B and 2C); these symptoms
miana; epidermis superior, inferior y el parénqui- remained until 21 dpi. At 25 dpi, chlorotic mosaics
ma en empalizada de una sola capa de células, éste appeared and at 28 dpi, the symptoms became
último con células alargadas anticlinales; el parén- attenuated (Figure 2D), and remained mitigated
quima esponjoso con dos o tres capas de células until the end of the experiment. These results show
esféricas (Figura 1A). En plantas infectadas se that, like ACMV and TGMV, EuMV-YP is capable
Figura 3. Análisis cuantitativo del efecto de EuMV-YP. Sección transversal de una hoja (A). Gráficas de grosor de la lámina
foliar y del número de células (B) en plantas con síntomas moderados, severos o sanas. Se incluyen barras de error
de desviación estándar.
Figure 3. Quantitative analysis of the effect of EuMV-YP. Cross section of a leaf (A). Graphs of the thickness of the leaf
blade and number of cells (B) in plants with moderate or severe symptoms, or healthy plants. Includes standard
deviation error bars.
observaron regiones con cambios en la morfología parenchyma of one single layer of cells, the latter
de las células y regiones engrosadas (Figura 4B, D, with elongated anticlinal cells; the spongy
E y F), representando el 20 y el 50% de la hoja de parenchyma with two or three layers of spherical
las plantas con síntomas moderados y severos, res- cells (Figure 4F). In infected plants, areas were
pectivamente. El valor medio de las regiones en- noticed with changes in the morphology of cells
grosadas (alteradas) en plantas que mostraron sín- and thickened regions (Figure 4B, D, E and F),
tomas severos fue significativamente diferente al accounting for 10 and 50% of the leaf in plants with
de las regiones sin cambios (normales) en pruebas moderate and severe symptoms, respectively. The
de t student (t ≤ 7.55, P << 0.01); lo mismo ocurrió average value of the thickened regions (altered) in
en regiones alteradas vs normales de plantas con plants that displayed severe symptoms was
síntomas moderados (t ≤ 2.71, P ≤ 0.02) (Figura 3B significantly different to that of the regions without
Izq.). El número de células fue significativamente changes (normal) in Student’s t tests (t ≤ 7.55, P <<
mayor en las plantas con síntomas severos o mode- 0.01); the same happened in regions vs normal
rados en comparación con el de las sanas (t ≤ 6.18, regions of plants with moderate symptoms (t ≤
P <0.01, t <3.87, P <= 0.01, respectivamente), con 2.71, P ≤ 0.02) (Figure 3B Left). The number of
incrementos de 50 y 100% de las plantas con sínto- cells was significantly higher in plants with severe
mas moderados y severos, respectivamente (Figura or moderate symptoms in comparison with those in
3B Der.). La proliferación celular se observó en el healthy plants (t ≤ 6.18, P <0.01, t <3.87, P <= 0.01,
parénquima en empalizada y esponjoso (Figura 4), respectively), with increases of 50 and 100% of the
Figura 4. Cambios anatómicos inducidos por EuMV-YP. Plantas sanas (A) o con síntomas severos (B-F). Cambios de mor-
fología celular en parénquima esponjoso (SP) y en empalizada (PP) (B-C). Epidermis superior (UE) e inferior
(LE). Aumento de 680x. Barras: 20 μm.
Figure 4. Anatomical changes induced by EuMV-YP. Healthy plants (A) or with severe symptoms (B-F). Changes in cell
morphology in spongy (SP) and in palisade parenchyma (PP) (B-C). Upper (UE) and lower (LE) epidermis. 680x
scale. Bars: 20 μm.
que comúnmente tenían cuatro capas de células plants with moderate and severe symptoms,
(Figura 4E y 4F). Sin embargo, en las plantas con respectively (Figure 3B Right). Cell proliferation
los síntomas más severos, se encontraron hasta 10 was observed in the palisade and spongy
capas (datos no mostrados). Ciertas regiones de las parenchyma (Figure 4), which commonly had four
hojas presentaban alteración de la morfología celu- layers of cells (Figure 4E and 4F). However, in
lar, particularmente del parénquima en empalizada plants with the most severe symptoms, up to 10
y esponjoso (Figura 4B y 4B). Además, se observa- layers were found (data not shown). Certain regions
ron células esféricas y de tamaño reducido en las of the leaves presented alterations in cell
regiones con mayor proliferación celular (Figura morphology, particularly of the palisade and
4F). Estos resultados confirman que los abulta- spongy parenchyma (Figure 4B y 4B). Also,
mientos de las hojas son producto de la inducción shpere-shaped and small cells were observed in the
de la división celular en el mesófilo de N. bentha- regions with the greatest cell proliferation (Figure
miana. Resultados similares se encontraron al ex- 4F). These results confirm that the bulges in the
presar la proteína C12 del Chrysanthemum virus B leaves are a product of the induction of cell division
(CVB) en las hojas de N. tabacum, la cual es un in the N. benthamiana mesophyll. Similar results
determinante de patogenicidad y virulencia. CVB were found when expressing protein C12 of the
provoca enrollamientos y proliferación celular en Chrysanthemum virus B (CVB) in N. tabacum
las hojas del crisantemo, su hospedero natural leaves, which is a determinant of pathogenicity and
(Lukhovitskaya et al., 2014). De hecho, muchos vi- virulence. CVB causes curling and cell proliferation
rus producen síntomas similares, pero no se han in the leaves of chrisanthemum, its natural host
realizado los estudios histológicos que revelen la (Lukhovitskaya et al., 2014). In fact, many viruses
naturaleza de los síntomas, he aquí la relevancia del produce similar symptoms, though no histological
presente estudio. Cabe destacar que EuMV-YP es studies have been carried out to reveal the nature of
el primer ejemplo de un geminivirus que puede in- the symptoms, and hence the relevance of this
ducir la división celular en el parénquima en empa- study. It is worth pointing out that EuMV-YP is the
lizada y esponjoso, por tanto, resulta un modelo first example of a geminivirus that can induce cell
interesante para estudiar los determinantes genéti- division in the palisade and spongy parenchyma,
cos que están induciendo este fenómeno. Por el and is therefore an interesting model to study the
contrario, existen múltiples reportes de la induc- gene determinants that are inducing this
ción de la división celular en las células del floema phenomenon. On the other hand, there are several
y células asociadas en las nervaduras de las hojas. reports on the induction of cell division in the
Tal es el caso de los Curtovirus y los begomovirus phloem and phloem-associated cells in the leaf
monopartitas, entre los geminivirus (Park et al., midribs. Such is the case of Curtoviruses and the
2004; Srivastava et al., 2017) y de virus de RNA monopartite begomoviruses, amongst the
(Xie et al., 2014; Shen et al., 2016), en todos estos geminiviruses (Park et al., 2004; Srivastava et al.,
casos, la proliferación celular inducida conlleva a 2017) and RNA viruses (Xie et al., 2014; Shen et
la producción de tumores en las nervaduras de las al., 2016); in all these cases, the induced cell
hojas. En concordancia con los resultados anterio- proliferation leads to the production of tumors in
res, la expresión los de los genes cycA1, cycA2 the leafmidribs. In consistency with the previous
y cdkB2.2 se incrementó en las hojas de plantas results, the expression of genes cycA1, cycA2 and
infectadas a los 15 y 21 ddi en comparación con la cdkB2.2 increased in the leaves of infected plants
de plantas sanas (Figura 5), mientras que el gen at 15 and 21 dpi in comparison with those for
ubi3 se mantuvo sin cambio. La regulación positiva healthy plants (Figure 5), while gene ubi3 remained
de genes que participan en la entrada a la fase mitó- unchanged. The positive regulation of genes that
tica (Breyne et al., 2002) es congruente con los in- participate in the entry into the mitotic phase (M)
crementos del número de células en plantas con (Breyne et al., 2002) is consistent with the cell
síntomas moderados o severos. Resultados simila- increases in number found in plants with moderate
res se observaron en plantas infectadas con BCVT or severe symptoms. Similar results were observed
(Park et al., 2004), CBV (Lukhovitskaya et al., in plants infected with BCVT (Park et al., 2004),
2014) y el Rice black-streaked dwarf virus CBV (Lukhovitskaya et al., 2014) and the Rice
(RBSDV; Shen et al., 2016). Por el contrario, los black-streaked dwarf virus (RBSDV; Shen et al.,
begomovirus bipartitas Cabbage leaf curl virus 2016). On the other hand, the bipartite
(CaLCuV) y TGMV, activan la entrada al endoci- begomoviruses Cabbage leaf curl virus (CaLCuV)
clo en Arabidopsis thaliana y en N. benthamiana, and TGMV, activate the entry to the endocycle in
respectivamente (Nagar et al., 2002; Ascencio et Arabidopsis thaliana and in N. benthamiana,
al., 2008). CaLCuV activa la expresión de la mayo- respectively (Nagar et al., 2002; Ascencio et al.,
ría de los genes que participan en la entrada al ciclo 2008). CaLCuV activates the expression of most of
celular en la fase de síntesis de ADN y reprime la the genes that participate in the entry to the cell
expresión de la mayoría de los genes asociados con cycle in the phase of DNA synthesis and suppresses
la fase M o de división celular como CDKB2 en A. the expression of most genes associated to M phase
thaliana (Ascencio et al., 2008), lo que explica que or cell division such as CDKB2 in A. thaliana
CaLCuV induzca la endoreduplicación y no la divi-
sión celular. Los aislados EuMV-Jal y EuMV-YP,
que producen síntomas similares en varios hospe-
deros experimentales y son incompatibles en repli-
cación, han adquirido secuencias únicas en sus re-
giones intergénicas que los distinguen de virus filo-
genéticamente relacionados (Gregorio et al., 2010).
EuMV-YP puede haber perdido las secuencias ne-
cesarias para bloquear el punto de control G2 / M o
puede haber adquirido determinantes genéticos
para inducir un ciclo mitótico completo, mediante
mutación o la incorporación de secuencias genómi- Figura 5. EuMV-YP induce la expresión de genes relacio-
nados con la mitosis. RT-PCR de genes cycA1,
cas de otros virus. Esto queda por determinarse. En cycA2, cdkB2.2 a los 15 y 21 ddi en plantas sa-
conclusión, EuMV-YP es capaz de producir sínto- nas, con síntomas moderados y severos. El gen
ubi3 permanece sin cambio.
mas severos en N. benthamiana y de llegar el mesó- Figure 5. EuMV-YP induces the expression of genes re-
filo, donde induce la mitosis y cambios en la mor- lated to mitosis. RT-PCR of genes cycA1, cycA2,
cdkB2.2 at 15 and 21 dpi in healthy plants or
fología celular, así como la expresión de genes re- with moderate and severe symptoms. Gene ubi3
lacionados con la división celular. remains unchanged.
Park J, Hwang H, Shim H, Im K, Auh CK, Lee S and Davis Villanueva AH, Us CR, López 0L, Robertson D, Guerra PO,
KR. 2004. Altered cell shapes, hyperplasia, and secondary Minero GY and Moreno VO. 2013. A new virus-induced
growth in Arabidopsis caused by beet curly top geminivi- gene silencing vector based on Euphorbia mosaic virus-
rus infection. Molecules and Cells 17:117-124. Disponible Yucatan peninsula for NPR1 silencing in Nicotiana ben-
en línea: [Link] thamiana and Capsicum annuum var. Anaheim. Biote-
Shen J, Chen X, Chen J and Sun L. 2016. A phloem-limited chnology Letters 35:811-823. [Link]
fijivirus induces the formation of neoplastic phloem tissues s10529-013-1146-1
that house virus multiplication in the host plant. Scientific Wege C, Saunders, K, Stanley J and Jeske H. 2001. Com-
Reports 6:29848. [Link] parative analysis of tissue tropism of bipartite gemini-
Srivastava A, Agrawal L, Raj R, Jaidi M, Raj SK, Gupta S, viruses. Journal of Phytopathology 149:359-368. DOI:
Dixit R, Singh PC, Tripathi T, Sidhu OP, Singh BN, Shukla 10.1046/j.1439-0434.2001.00640.x
S, Chauhan PS and Kumar S. 2017. Ageratum enation vi- Xie L, Lv MF, Zhang HM, Yang J, Li JM, Chen JP. 2014. Tu-
rus Infection Induces Programmed Cell Death and Alters mours induced by a plant virus are derived from vascular
Metabolite Biosynthesis in Papaver somniferum. Frontiers tissue and have multiple intercellular gateways that faci-
in Plant Science 8:1172. DOI: 10.3389/fpls.2017.01172 litate virus movement. Journal of Experimental Botany
65:4873-4886. DOI: 10.1093/jxb/eru254
Soto-Plancarte A, Fernández-Pavía SP, Rodríguez-Alva- Abstract. The presence of both mating types
rado G, López-Pérez L, Fernández-Pavía YL, Pedraza- of Phytophthora species in the same pot has not
Santos ME, Álvarez-Vargas JE. 2018. Phytophthora been reported in hosts of commercial nurseries in
capsici and P. drechsleri mating types A1 and A2 coexist Mexico. Isolates of Phytophthora were collected in
in ornamental nursery plants. Revista Mexicana de Fito- commercial nurseries of Mexico City and Morelos
patología 36(2): 298-307. state during 2015. Mating types A1 and A2 of
DOI: 10.18781/[Link].1712-5 Phytophthora capsici and P. drechsleri were detected
on wilted plants of Capsicum annuum (stems) and
Primera publicación DOI: 11 de Abril, 2018. Petunia x hybrida (rhizosphere), respectively.
First DOI publication: April 11, 2018. Phytophthora isolates coinoculated in planta
formed oospores under greenhouse conditions.
Phytophthora was reisolated from inoculated
Resumen. No se ha reportado la presencia de am- plants, and identified with morphological and
bos tipos de compatibilidad de especies de Phyto- molecular tools. Mating types A1 and A2 of
phthora en plantas hospedantes sembradas en una Phytophthora capsici and P. drechsleri occur
misma maceta en viveros comerciales de México. simultaneously within nursery plants, this suggests
En 2015, se colectaron aislados de Phytophthora that sexual recombination and genetic variation is
en viveros comerciales en la Ciudad de México y occurring. Mating types A1 and A2 of Phytophthora
en el estado de Morelos. Se detectaron los tipos de capsici and Phytophtora dechsleri were detected
compatibilidad A1 y A2 de Phytophthora capsici for the first time in Capsicum annuum and Petunia
y P. drechsleri en plantas marchitas de Capsicum x hybrid respectively, in Mexican nurseries.
annuum (tallos) y Petunia x hybrida (rizósfera),
respectivamente. Los aislados de Phytophthora co- Key words: Oomycetes, Oospores, Petunia,
inoculados in planta formaron oosporas en condi- Capsicum annuum.
ciones de invernadero. Phytophthora fue re-aislada
de plantas inoculadas e identificada mediante he-
rramientas morfológicas y moleculares. Los tipos The ornamental plant Petunia x hybrid and chili
de compatibilidad A1 y A2 de Phytophthora cap- pepper plants for home gardens are produced in
sici y P. drechsleri se presentan simultáneamente Morelos state and Mexico City, two of the most
en plantas de invernadero, lo cual sugiere que es- important locations that grow ornamental nursery
tán ocurriendo recombinación sexual y variación flower pot plants in Mexico (Mundo-Ocampo,
genética. Los tipos de compatibilidad A1 y A2 2006). Nevertheless, production is limited by root
de Phytophthora capsici y Phytophtora dechsleri diseases caused by various Phytophthora species.
fueron detectados por primera vez en Capsicum P. capsici is a highly destructive pathogen with
annuum y Petunia x hybrida respectivamente, en a host range of over 50 plant species including
viveros mexicanos. Solanaceous, Cucurbitaceous, Fabaceous and
ornamental plants around the world (Lamour et al.,
Palabras clave: Oomicetes, oosporas, Petunia, 2012; Fernández-Pavía et al., 2013), on the other
Capsicum annuum. hand P. drechsleri, has been reported affecting
over 25 horticultural and ornamental plant species
(Lamour et al., 2012; Fernández-Pavía et al.,
La planta ornamental Petunia x hybrida, así 2013; Olson et al., 2011; Truong et al., 2012). In
como plantas de chile para huertos familiares, se Mexico, one of the most important root pathogens
producen en el estado de Morelos y en la Ciudad is Phytophthora capsici, which is a highly
de México, dos de las más importantes entidades destructive pathogen of chili pepper plants. These
productoras de plantas ornamentales de inverna- Phytophthora species are heterothallic, requiring
dero en México (Mundo-Ocampo, 2006). Sin em- the presence of opposite mating types (A1 and
bargo, su producción es afectada por enfermedades A2) for oospore formation. The occurrence of
que afectan a la raíz, causadas por varias especies mating types of P. capsici and P. drechsleri in the
de Phytophthora. P. capsici es un patógeno muy same nursery on different hosts has been detected
destructivo con un rango de plantas hospedantes de in previous studies conducted in our laboratory
más de 50 especies vegetales a nivel mundial, entre in Mexico (data not published). However, the
ellas, solanáceas, cucurbitáceas, fabaceas y plantas presence of both mating types of these species
ornamentales (Lamour et al., 2012; Fernández- in the same host in ornamental nurseries has not
Pavía et al., 2013). Por otro lado, se ha reportado been documented. The objective of this study was
que P. drechsleri afecta a más de 25 especies de to determine if both, A1 and A2, mating types of
plantas hortícolas y ornamentales (Lamour et al., Phytophthora species can be present in the same
2012; Fernández-Pavía et al., 2013; Olson et al., host, and if oospores are formed in planta under
2011; Truong et al., 2012). En México, uno de los greenhouse controlled conditions.
más importantes patógenos que afectan la raíz es Phytophthora isolates were obtained from
Phytophthora capsici, y es sumamente destructivo commercial nursery plants of Capsicum annuum
en plantas de chile. Estas especies de Phytophthora and Petunia x hybrid with wilting symptoms in
son heterotálicas y requieren la presencia de tipos Morelos and Mexico City, Mexico, during 2015.
de compatibilidad opuestos (A1 y A2) para formar Plant tissue of Capsicum annuum and Petunia x
oosporas. La presencia de los tipos de compatibili- hybrid soil of the rhizosphere from diseased plants
dad de P. capsici y P. drechsleri en diferentes plan- with wilt and root rot symptoms were analyzed for
tas hospedantes en un mismo vivero ha sido detec- pathogen isolation. Plant tissues were rinsed with
tada en estudios anteriores realizados en nuestro running water, small diseased tissue fragments
laboratorio en México (datos no publicados). Sin were cut, plated out onto NARPH-V8 medium
embargo, no se ha documentado la presencia de (Delvocid Instant (0.02 g L-1) [(50% natamycin,
ambos tipos de compatibilidad de esas especies en 50% lactose)], Ampicillin (0.27 g L-1), Rifampicin
una misma planta hospedera en viveros de plantas (0.01 g L-1), PCNB (0.10 g L-1), and Hymexazol
ornamentales. El objetivo del presente estudio fue (0.075 g L-1) and incubated at 25 °C in the dark.
determinar si ambos tipos de compatibilidad (A1 Soil samples of the rhizosphere were subjected
y A2) de especies de Phytophthora pueden estar to Rhododendron sp. leaves baiting. Briefly, six
presentes en la misma planta hospedante, y si las Rhododendron leaves were floated over flooded
oosporas se forman in planta bajo condiciones con- soil (10 g of soil:20 mL of sterile water) and
troladas de invernadero. incubated for 48 h at 25 °C, the petiole was
Los aislados de Phytophthora se obtuvieron de removed, disinfested with 10% commercial bleach
viveros comerciales de plantas de Capsicum an- (0.6% sodium hypochlorite) for 30 sec, rinsed
nuum y Petunia x hybrida con síntomas de mar- with sterile distilled water twice, blotted dry with
chitamiento en Morelos y en la Ciudad de México sterile paper towels, transferred to NARPH-V8
en 2015. Para aislar el patógeno se analizó tejido plates, and incubated as above. Phytophthora
vegetal de Capsicum annuum y Petunia x hybrida isolates were identified by examination under
colectado de la rizósfera de plantas infectadas que a microscope and transferred to corn meal agar
mostraban síntomas de marchitez y pudrición de media (CMA, 17 g L-1) to obtain pure cultures by
raíz. Los tejidos vegetales fueron enjuagados con the hyphal tip method. Sporangia were produced
agua corriente; se cortaron pequeños fragmentos and morphologically characterized by incubating
infectados, se sembraron en un medio de cultivo V8 agar blocks plus mycelia, in sterile distilled
NARPH-V8 (Delvocid Instant (0.02 g L-1) [(50% water at 25 °C under continuous fluorescent
natamicina , 50 % lactosa)], ampicilina (0.27 g L-1), light for three to five days. Mating type of the
rifampicina (0.01 g L-1), PCNB (0.10 g L-1) e hi- Phytophthora isolates was determined by pairing
mexazol (0.075 g L-1), y se incubaron a 25 °C en them with known A1 and A2 strains of P. capsici
obscuridad. Muestras de suelo de la rizósfera fue- and P. cinnamomi on V8 agar at 25 °C in the dark
ron sometidas a la utilización de hojas de Rhodo- and examined after 20 days. Additionally, opposite
dendron sp. como cebo. Brevemente, se pusieron a mating types of the Phytophthora capsici (A1 and
flote seis hojas de Rhododendron sobre suelo com- A2) and P. drechsleri (A1 and A2) isolates were
pletamente inundado (10 g de suelo:20 mL de agua paired out. Pairing of opposite mating types in
estéril) e incubadas por 48 h a 25 °C; se eliminó el planta was carried out by inoculating Phytophthora
peciolo, se desinfestó con cloro comercial al 10% isolates on healthy plants of Capsicum annuum
(0.6% hipoclorito de sodio) por 30 seg, se enjuagó and Petunia x hybrid. Inoculum consisted of six
dos veces con agua destilada estéril, se secó con mm disks of V8 agar with mycelia and sporangia.
toallas de papel estériles, se transfirió a cajas que One disk of a Phytophthora isolate A2 was placed
contenían NARPH-V8 y se incubó como se indicó on the base of the stem, while a second disk of
anteriormente. Los aislados de Phytophthora fue- a Phytophthora isolate A1 was placed three cm
ron identificados bajo el microscopio y, a continua- apart from the first disk. Control plants were
ción, se transfirieron a medio de cultivo harina de inoculated with six mm disks of V8 agar without
maíz agar (CMA, 17 g L-1), con la finalidad de ob- the pathogen. Plants were flooded for 24 h to favor
tener cultivos puros utilizando el método de punta disease development. Oospore formation in planta
de hifa. Se produjeron esporangios que fueron ca- was confirmed by observing under a bright field
racterizados morfológicamente incubando bloques microscope at 40x samples of necrotic stem tissue.
de agar V8 con micelio en agua destilada estéril a Tissues were gently washed in soapy water, rinsed
25 °C bajo luz fluorescente continua de tres a cinco with distilled sterile water, clarified in boiling 96%
días. El tipo de compatibilidad de los aislados de ethanol for 40 sec, cooled down for 30 min, and
Phytophthora se determinó apareándolos con cepas repeating the ethanol clarification step for 40 sec,
conocidas, A1 y A2 de P. capsici y P. cinnamomi afterwards, the tissue was mounted on a glass slide.
en agar V8 a 25 °C en obscuridad y examinándo- Genomic DNA extraction was obtained by
los 20 días después. También se aparearon los ti- culturing the isolates on 2% clarified liquid V8 at
pos de compatibilidad opuestos de los aislados de 21 °C for 15 to 20 days, and the protocol by Möller
Phytophthora capsici (A1 y A2) y de P. drechsleri et al., (1992) was followed with modifications as
(A1 y A2). El apareamiento de los tipos de com- previously described by Robideau et al., (2011).
patibilidad opuestos in planta se llevó a cabo me- At the final step, DNA pellet was resuspended in
diante la inoculación de aislados de Phytophthora 0.1X TE buffer containing 50 μg/mL of RNase A
en plantas sanas de Capsicum annuum y Petunia and incubated at 65 °C for 10 min.
x hybrida. El inóculo consistió en discos de 6 mm The ribosomal DNA ITS (internal transcribed
con agar V8 con micelio y esporangios. Uno de los spacer) region was amplified using primers UN-
discos que contenía el aislado A2 de Phytophthora up18S42 (Bakkeren et al., 2000), UN-lo28S1220
se colocó en la base del tallo, y el segundo, que (Bala et al., 2010), Oom-up18S67, UN-lo28S22
contenía el aislado A1 de Phytophthora, se colocó and ITS4 (Lévesque and De Cock 2004). Partial
a 3 cm de distancia del primer disco. Las plantas sequences of the mitochondrial gene COI
control fueron inoculadas con discos de 6 mm que (cytochrome c oxidase subunit 1) were amplified
contenían agar V8 sin el patógeno. Las plantas se with primers OomCoxILevup and Fm85mod
inundaron durante 24 h para favorecer el desarrollo (Martin and Tooley, 2003), and β-tubulin with
de la enfermedad. Para confirmar la formación de primers Oom-Btub-up415 and Oom-Btub-lo1401
oosporas in planta se observaron muestras de tejido (Bilodeau et al., 2007).
necrótico del tallo bajo un microscopio de campo PCR amplifications were performed using the
luminoso con el objetivo 40x. Los tejidos fueron following conditions: all reactions had an initial
lavados con cuidado en agua jabonosa, enjuagados denaturation step at 95 °C for 3 min and a final
con agua destilada estéril, aclarados durante 40 seg extension step at 72 °C for 8-10 min. The ITS
en etanol al 96% hirviendo, enfriados durante 30 region amplified with primers Oom-up18S67 and
min; el aclarado con etanol se repitió durante 40 UN-lo28S1220 was performed with 35 cycles of
seg y posteriormente, el tejido se colocó en un por- 95 °C for 30 sec, 58 °C for 45 sec, and 72 °C for 2
taobjetos de vidrio. min. The same region amplified with primers UN-
Para extraer el ADN genómico, los aislados se up18S42 and ITS4 utilized 40 cycles of 95 °C for
cultivaron en medio líquido de V8 clarificado al 2% 30 sec, 68 °C for 45 sec, and 72 °C for 1.5 min.
a 21 °C por 15 a 20 días, y se siguió el protocolo Amplification conditions for COI were the
de Möller et al. (1992) con modificaciones previa- same as those described by Robideau et al., (2011).
mente descritas por Robideau et al. (2011). En el Amplification of the β-tubulin gene for P. capsici
último paso, la pastilla de ADN fue re-suspendida isolates were 40 cycles of 95 °C for 1 min, 55 °C
en una solución amortiguadora 0.1X TE a la cual se for 1 min, and 72 °C for 1 min. For the P. drechsleri
agregaron 50 μg/mL de ribonucleasa (RNasa) A, y isolates a touch-down PCR was performed under
se incubó a 65 °C por 10 min. the conditions described by Blair et al., (2008),
La región del ITS (espaciador transcrito interno) decreasing the temperature from 68 to 58 °C.
del ADN ribosómico fue amplificada utilizando los An Applied Biosciences Prism® 3130xl
iniciadores UN-up18S42 (Bakkeren et al., 2000), genetic analyzer was used to generate the DNA
UN-lo28S1220 (Bala et al., 2010), Oom-up18S67, sequences from the amplification sequencing
UN-lo28S22 y ITS4 (Lévesque y Cock, 2004). Se- reactions. The sequences were assembled, edited
cuencias parciales del gen mitocondrial COI (cito- to obtain consensus sequences, aligned with
cromo c oxidasa subunidad 1) fueron amplificadas published sequences (NCBI, National Center for
con los iniciadores OomCoxILevup y Fm85mod Biotechnology Information, [Link]
(Martin y Tooley, 2003), y β-tubulina con los ini- [Link]/), and analyzed using the Blast program
ciadores Oom-Btub-up415 y Oom-Btub-lo1401 (Geneious 8.1, [Link]) to determine
(Bilodeau et al., 2007). identity percentages. Sequences were submitted to
Las amplificaciones en PCR se realizaron bajo GenBank.
las siguientes condiciones: todas las reacciones A multi-locus phylogenetic analysis by
fueron sometidas a un paso inicial de desnaturaliza- maximum likelihood and Bayesian inference
ción a 95 °C por 3 min y un paso final de extensión a method, to confirm isolates identity with ex-type
72 °C de 8 a 10 min. La región ITS amplificada con sequences was constructed in the science gateway
los iniciadores Oom-up18S67 y UN-lo28S1220 se CIPRES v. 3.3 (Miller et al., 2010).
llevó a cabo en 35 ciclos de 95 °C por 30 seg, 58 Two P. drechsleri isolates with opposite mating
°C por 45 seg, y 72 °C por 2 min. La misma región types were obtained from the rhizosphere soil of
fue amplificada con los iniciadores UN-up18S42 y a Petunia x hybrid plant. Two P. capsici isolates
ITS4 en 40 ciclos de 95 ºC por 30 seg, 68 ºC por 45 with opposite mating types were obtained from
seg y 72 ºC por 1.5 min. stem tissues of a C. annuum plant. Morphological
Las condiciones para amplificar el COI fueron and molecular characterization and phylogenetic
las mismas descritas por Robideau et al. (2011). analysis (Figure 1) confirmed the identity of the
La amplificación del gen β-tubulina de los aislados isolates. The accession numbers of the isolates
de P. capsici consistió en 40 ciclos de 95 °C por 1 are shown in Table 1. All isolates had 99%
min, 55 °C por 1 min y 72 °C por 1 min. Para los similarity with sequences available in the database
0.02
Figura 1. Análisis filogenético concatenado de los genes ITS, β-tubulina y COI utilizando máxima verosimilitud e inferencia
bayesiana de Phytophthora capsici y P. drechsleri con Phytophthora cryptogea como grupo externo. Los valores
bootstrap de máxima verosimilitud y las probabilidades posteriores de la inferencia bayesiana en porcentajes se
indican en los puntos de la rama, respectivamente. La barra de la escala indica 0.02 sustituciones por sitio por
rama.
Figure 1. Phylogeny analysis derived from Maximum likelihood and Bayesian inference of concatenated ITS, β-tubulin and
COI genes from Phytophthora capsici and P. drechsleri with Phytophthora cryptogea as an outgroup. Maximum
likelihood bootstrap values and Bayesian inference posterior probabilities in percentages are indicated in the
branch points, respectively. Scale bar indicates 0.02 substitutions per site per branch.
drechsleri fueron depositados en la colección del (Erwin and Ribeiro, 1996; Lamour et al., 2012).
Departamento de Agricultura y Agri-Food Canadá, Moreover, isolates with resistance to fungicides
en Ottawa, Canadá. may develop and the disease will be more difficult to
Las plantas de Capsicum annuum inoculadas manage. This work showed that both mating types
con aislados de ambos tipos de compatibilidad de of P. capsici and P. drechsleri can occupy the same
P. capsici mostraron clorosis, defoliación, marchi- niche in nursery environments. Growers should
tez y necrosis en el tallo cinco días después de la improve management practices as recommended
inoculación (ddi). Las plantas de Petunia x hybrida by Parke and Grünwald (2012), according to their
inoculadas con los tipos de compatibilidad A1 y A2 economic resources, to reduce losses. This is the
Cuadro 1. Número de acceso de los genes ITS, b-tubulina y COI, de los aislados.
Table 1. Accesion numbers of the genes ITS, b-tubulin and COI, of the isolates.
Figura 3. Oospora de Phytophthora drechsleri formada in planta en tejidos de la raíz de Petunia x híbrida co-inoculados con
aislados de los tipos de compatibilidad A1 y A2.
Figure 3. Oospore of Phytophthora drechsleri formed in planta in Petunia x hybrid root tissues coinoculated with mating
type A1 and A2 isolates.
plantas hospedantes, y pueden introducir nuevos first report of mating types A1 and A2 of P. capsici
genotipos recombinantes de Phytophthora a zonas and P. drechsleri detected in commercial nursery
nuevas. Dado que los viveros comerciales mues- pot plants in Mexico.
treados distribuyen plantas a muchos estados de la
República Mexicana, es muy probable que estos Acknowledgment
patógenos sean diseminados a nuevas zonas agrí-
colas, forestales y urbanas. Otro factor de riesgo es We express our sincere gratitude to C. Andre Lévesque
el amplio rango de plantas hospedantes de P. cap- and Tara Rintoul from Agriculture and Agri-Food Canada
sici y P. drechsleri (Erwin y Ribeiro, 1996; Lamour department for their support. First author thanks to Consejo
et al., 2012). Además, los aislados podrían generar Nacional de Ciencia y Tecnología (CONACyT) for the
resistencia a los fungicidas y sería más difícil con- doctoral scholarship (no. 254151).
trolar la enfermedad. El presente estudio mostró
que ambos tipos de compatibilidad de P. capsici End of the English version
y P. drechsleri pueden ocupar el mismo nicho en
los ambientes de los viveros. Los productores de-
berían mejorar sus prácticas de manejo, como lo Molecular detection of Phytophthora ramorum by real-
recomiendan Parke y Grünwald (2012), dependien- time polymerase chain reaction using TaqMan, SYBR
Green, and molecular beacons. Phytopathology 97:632-
do de sus recursos económicos, a fin de reducir las 642. [Link]
pérdidas. Este es el primer reporte sobre los tipos Blair JE, Coffey MD, Park SY, Geiser DM and Kang S. 2008. A
de compatibilidad A1 y A2 de P. capsici y P. dre- multi-locus phylogeny for Phytophthora utilizing markers
derived from complete genome sequences. Fungal Gene-
chsleri detectados en plantas producidas en maceta tics and Biology 45:266-277. [Link]
en viveros comerciales en México. fgb.2007.10.010
Erwin DC and Ribeiro OK. 1996. Phytophthora Diseases
Worldwide. American Phytopathological Society Press.
Agradecimientos St. Paul, Minnesota, USA. 562 p.
Fernández-Pavía SP, Díaz-Celaya M and Rodríguez-Alvarado
G. 2013. Phytophthora in Mexico. Pp:215-221. In: La-
Queremos expresar nuestro sincero agradecimiento a C. mour K (eds.). Phytophthora: A global perspective. CABI
Andre Lévesque y Tara Rintoul del Departamento de Agri- Press. Boston, MA., USA. 244p.
cultura y a Agri-Food Canadá por su apoyo. El primer autor Lamour KH, Stam R, Jupe J and Huitema E. 2012. The
oomycete broadhost-range pathogen Phytophthora cap-
agradece al Consejo Nacional de Ciencia y Tecnología (CO- sici. Molecular Plant Pathology 13:329-337. [Link]
NACyT) por la beca que le otorgaron (no. 254151). org/10.1111/j.1364-3703.2011.00754.x
Lehtinen A and Hannukkala A. 2004. Oospores of Phytophtho-
ra infestans in soil provide an important new source of pri-
LITERATURA CITADA mary inoculum in Finland. Agricultural and Food Science
13:399-410. Disponible en línea: [Link]
Bala K, Robideau GP, De´saulniers N, De Cock AWAM and pdf/[Link]
Lévesque CA. 2010. Taxonomy, DNA barcoding and Martin FN and Tooley PW. 2003. Phylogenetic relationships
phylogeny of three new species of Pythium from Canada. among Phytophthora species inferred from sequence
Persoonia: Molecular Phylogeny and Evolution of Fungi analysis of mitochondrially encoded cytochrome oxidase I
25:22-31. [Link] and II genes. Mycologia 95:269-284. Disponible en línea:
Bakkeren G, Kronstad JW and Lévesque CA. 2000. Compari- [Link]
son of AFLP fingerprints and ITS sequences as phylogene- Miller MA, Pfeiffer W and Schwartz T. 2010. “Creating the
tic markers in Ustilaginomycetes. Mycologia 92:510-521. CIPRES Science Gateway for inference of large phylo-
Disponible en línea: [Link]/stable/3761510 genetic trees” in Proceedings of the Gateway Computing
Bilodeau GJ, Lévesque CA, De Cock AWAM, Duchaine C, Environments Workshop (GCE), 14 Nov. 2010, New Or-
Brière S, Uribe P, Martin FN and Hamelin RC. 2007. leans, LA pp 1-8. DOI: 10.1109/GCE.2010.5676129
Möller EM, Bahnweg G, Sandermann H and Geiger HH. 1992. Parke JL and Grünwald NJ. 2012. A systems approach for ma-
A simple and efficient protocol for isolation of high mole- nagement of pests and pathogens of nursery crops. Plant
cular weight DNA from filamentous fungi, fruit bodies and Disease 96:1236-1244. [Link]
infected plant tissues. Nucleic Acids Research 20:6115- 11-0986-FE
6116. Disponible en línea: [Link] Robideau GP, De Cock AW, Coffey MD, Voglmayr H,
pmc/articles/PMC334490/ Brouwer H, Bala K, Chitty DW, Désaulniers N, Eggert-
Mundo-Ocampo J. 2006. El vivero ornamental. First Edition. son QA, Gachon CMM, Hu CH, Küpper FC, Rintoul TL,
Universidad Autónoma del Estado de Morelos. México. Sarhan E, Verstappen ECP, Zhang Y, Bonants PJ, Ristaino
461 p. JB and Lévesque CA. 2011. DNA barcoding of oomycetes
Olson HA, Carbone I and Benson DM. 2011. Phylogenetic with cytochrome c oxidase subunit I and internal transcri-
history of Phytophthora cryptogea and P. drechsleri isola- bed spacer. Molecular Ecology Resources 11:1002-1011.
tes from floriculture crops in North Carolina greenhouses. [Link]
Phytopathology 101:1373-1384. [Link] Truong NV, Burgess L and Liew E. 2012. Cross-infectivity
PHYTO-11-10-0302 and genetic variation of Phytophthora isolates from chilli
and black pepper in Vietnam. Australasian Plant Pathology
41:439-447. Disponible en línea: [Link]
article/10.1007/s13313-012-0136-4
García-Ávila CJ, Valenzuela-Tirado GA, Florencio- Abstract. The potato (Solanum tuberosum L.) is
Anastasio JG, Ruiz-Galván I, Moreno-Velázquez M, one of the crops with the highest human consumption
Hernández-Macías B, López-Buenfil JA, Bravo-Pérez worldwide. The crop is threatened from its
D, Pineda-Ríos JM, Quezada-Salinas A, Ávila-Quezada beginnings by different organisms; some of them
G. 2018. Organisms associated with damage to post-har- cause superficial damage to the tubers, which reduce
vest potato tubers. Revista Mexicana de Fitopatología the quality and appearance and causes rejection
36(2): 308-320. by the consumer. Out of a total of 34 potato tuber
DOI: 10.18781/[Link].1801-1 samples destined for human consumption, obtained
through directed visual sampling, at the Central de
Primera publicación DOI: 02 de Mayo, 2018. Abastos de Ecatepec, microorganisms associated
First DOI publication: May 02, 2018. with some physical damage or superficial alteration
were identified; in addition, of atypical spots on
the surface of tubers. Of the total samples, in the
Resumen. La papa (Solanum tuberosum L.) es 50% were identified bacterial damages caused by
uno de los cultivos de mayor consumo humano a Enterobacter aerogenes, Pseudomonas fluorescens
nivel mundial. El cultivo es amenazado desde sus and Streptomyces sp. In the 41% were identified
inicios por distintos organismos; algunos de ellos fungi and protozoa like Fusarium oxysporum,
ocasionan daños superficiales en los tubérculos, F. solani, F. verticillioides, Rhizoctonia solani,
que reducen la calidad y apariencia lo que provo- Alternaria sp., Colletotrichum sp., Clonostachys
ca el rechazo por el consumidor. De un total de 34 sp., Geotrichum sp., and Spongospora subterranea
muestras de tubérculos de papa destinados para f. sp. subterranea. 9% of the remaining samples,
consumo humano, obtenidas mediante muestreo no organism related to the damage was identified.
visual dirigido, en la Central de Abastos de Eca- Key words: Solanum tuberosum, microorganisms,
tepec, se identificaron a los microorganismos aso- fungi, bacteria.
ciados a algún daño físico o alteración superficial;
además, de manchas atípicas en la superficie de
tubérculos. Del total de las muestras en el 50% se The potato (Solanum tuberosum L.) is one of
identificaron a las bacterias Enterobacter aeroge- the crops with the highest human consumption
nes, Pseudomonas fluorescens y Streptomyces sp. worldwide. Every year, 381 million tons of this
En el 41% se identificaron a hongos y protozoarios crop are produced worldwide (FAO, 2014).
como Fusarium oxysporum, F. solani, F. vertici- In Mexico, it is number five in terms of food
llioides, Rhizoctonia solani, Alternaria sp., Colle- importance, after maize, wheat, beans and rice. Out
totrichum sp., Clonostachys sp., Geotrichum sp., y of the total of the country’s production, 56% is used
Spongospora subterranea f. sp. subterranea. Del for consuming fresh, 29% for industrial use, and
9% de las muestras restantes no se identificó nin- 15%, as a seed (Mora-Aguilar, 2014). Worldwide,
gún organismo relacionado al daño. roughly 70 diseases and physiological disorders
have been reported to affect this crop and cause
Palabras clave: Solanum tuberosum, microorga- severe damages, particularly in tubers (Herrera and
nismos, hongos, bacterias. Scott, 1993; Stevenson, 2001). Some of the main
symptoms of the diseases that affect tubers are
root nodules, spots, and rotting (Fiers et al., 2012),
La papa (Solanum tuberosum L.) es uno de los which may be caused by fungi, bacteria, nematodes
cultivos más utilizados para el consumo humano a and viruses. There are also other factors that, aside
nivel mundial. De este tubérculo se producen 381 from the physical appearance, can downgrade the
millones de toneladas anualmente en el mundo quality of the tubers, leading to rejection from
(FAO, 2014). En México ocupa el quinto lugar en consumers; however, Fiers et al. (2010) mentioned
importancia alimenticia, superado por el maíz, trigo, that surface spots only affect the epidermis of the
frijol y arroz. Del total de la producción nacional, el tubers, and do not alter their taste or nutritional
56% se destina para consumo en fresco, 29% para properties (Jemison et al., 2008; Vázquez-Carrillo
la industria y el 15% como semilla (Mora-Aguilar, et al., 2013). Some of these surface alterations that
2014). A nivel mundial, se han reportado alrede- affect the peridermis of the tubers are a result of
dor de 70 enfermedades y desordenes fisiológicos the presence of pathogens such as Colletotrichum
que afectan a este cultivo y causan severos daños coccodes, Helminthosporium solani, Rhizoctonia
especialmente en los tubérculos (Herrera y Scott, solani, Spongospora f. sp subterranea and
1993; Stevenson, 2001). Entre los síntomas de las Streptomyces spp., as well as, in many cases, a
enfermedades que afectan tubérculos se identifican means of entry for opportunist microorganisms that
agallas, manchas y pudriciones (Fiers et al., 2012), lead to the rotting of tubers. Fungi species such as
principalmente; estos pueden ser ocasionados por Fusarium sp. frequently damage relevant damages
hongos, bacterias, nematodos y virus. Asimismo, to tubers on fields and in storage worldwide; in the
existen otros factores que además de la apariencia latter, it may affect up to 60% of the production
física, demeritan la calidad de los tubérculos pro- (Boyd, 1972). Other conditions may also appear
vocando el rechazo por el consumidor; sin embar- that lead to poor quality and appearance. They may
go, Fiers et al., (2010) mencionó que las manchas be due to mechanical damages, insects, abiotic
superficiales afectan solamente la epidermis de los factors such as humidity and temperature, the
tubérculos, sin alterar su sabor y propiedades nu- use of chemical products, nutritional deficiencies,
tricionales (Jemison et al., 2008; Vázquez-Carrillo and other damages of unknown causes, known
et al., 2013). Algunas de estas alteraciones super- as atypical spots (Friedmans, 1960; Stevenson et
ficiales que afectan la peridermis de los tubérculos al., 2001; Fiers, 2010; Naerstad et al., 2012). On
son el resultado de la presencia de patógenos como the other hand, the bacteria and fungi that cause
Colletotrichum coccodes, Helminthosporium sola- rotting or more severe damage to the peridermis
ni, Rhizoctonia solani, Spongospora f. sp subterra- of tubers produce a wide range of enzymes such
nea y Streptomyces spp.; además, de ser en muchos as pectinases, cellulases, xylanases and proteases,
casos vía de entrada para otros microorganismos responsible for the maceration of tissues and cell
oportunistas que conducen a la pudrición de tubér- death (Olivieri et al., 2004). Symptoms include dry
culos. Especies de hongos como Fusarium sp., con or soft rotting, discoloring of the tuber and annular
frecuencia causan daños relevantes a nivel mundial rotting, and they are caused by fungi such as
en tubérculos que se encuentran en campo y alma- Fusarium spp., Verticillium spp.; bacteria such as
cenamiento, en esta última puede llegar a afectar Pectobacterium carotovorum subsp. carotovorum,
hasta el 60% de la producción (Boyd, 1972). Tam- Pectobacterium carotovorum subsp. atrosepticum,
bién se pueden presentar otras condiciones que Ralstonia solanacearum, and others (de Haan et
provocan la mala calidad y apariencia, estas pue- al., 2008; Czajkowski et al., 2011; Fiers et al.,
den ser debidas a daños mecánicos, por insectos, 2012; Gashgari and Gherbawy, 2013). Due to
factores abióticos como la humedad y temperatu- the above, the aim of this study was to identify
ra, el uso de productos químicos, deficiencias nu- the microorganisms related to the symptoms and
trimentales, y otros daños que se desconocen sus damages potato tubers in postharvest, produced
causas, conocidos como manchas atípicas (Fried- for human consumption which can be found in
mans, 1960; Stevenson et al., 2001; Fiers, 2010; commercial places, such as the Central de Abastos
Naerstad et al., 2012). Por otra parte, las bacterias of Ecatepec.
y hongos que ocasionan pudriciones o daños más
severos en la peridermis de tubérculos, producen Sampling. Potato tubers destined for human
una amplia gama de enzimas como pectinasas, ce- consumption were collected in August, 2017,
lulasas, xilanasas y proteasas, responsables de la from the Central de Abastos de Ecatepec, State
maceración del tejido y muerte celular (Olivieri et of Mexico. For this, samples were taken, aimed
al., 2004). Los síntomas incluyen ya sea pudricio- at those that displayed some physical damage or
nes secas o blandas, decoloración del tubérculo y superficial alteration, as well as atypical spots.
pudrición anular, y son debidas a diversos hongos Each tuber was wrapped in a paper towel and
como Fusarium spp., Verticillium spp.; bacterias, placed inside polyethylene bags. They were then
como Pectobacterium carotovorum subsp. caroto- transported to the Mycology and Bacteriology Lab
vorum, Pectobacterium carotovorum subsp. atro- of the National Plant Health Reference Center. They
septicum, Ralstonia solanacearum, entre otras (de were classified according to the symptoms and/or
Haan et al., 2008; Czajkowski et al., 2011; Fiers et typical damages caused by the presence of fungi,
al., 2012; Gashgari y Gherbawy, 2013). Debido a bacteria or insects, such as necrosis, dry rotting,
lo anterior, el objetivo de este estudio fue identifi- spots, corklike lesions, black scabs, obtaining a
car a los microorganismos asociados a síntomas y total of 34 samples, which were processed on the
daños en postcosecha de tubérculos de papa des- same day for their diagnosis.
tinados para consumo humano que se pueden en-
contrar en sitios comerciales, como la Central de Isolation of fungi. Photographs were taken of
Abastos de Ecatepec. symptoms or damages from each sample suspected
of having fungi and bacteria. Later, 1 cm2 sections
Muestreo. Se recolectaron tubérculos de papa en were taken from the stains in tubers and the
agosto de 2017 destinados para consumo humano transition from healthy to diseased tissue. They
en la central de abastos de Ecatepec, Estado de were disinfected with 4% sodium hypochlorite for
México, para esto se realizó un muestreo dirigido 1 minute, washed three times with distilled water
a aquellos que presentaban algún daño físico o al- for 3 minutes each, and dried using sterilized paper
ternación superficial, además de manchas atípicas, towels. They were then placed in a PDA (potato-
cada tubérculo se envolvió en papel absorbente y dextrose-agar) medium in 90 x 15 mm Petri-dishes.
depositados en bolsas de polietileno, inmediata- On the other hand, in order to promote the growth
mente fueron transportadas al laboratorio de Mi- of microorganisms on the tuber, humidity chambers
cología y Bacteriología del Centro Nacional de were performed for each tuber and symptom
Referencia Fitosanitaria, se clasificaron de acuerdo planted in PDA, two samples were taken from
a los síntomas y/o daños típicos por la presencia each tuber, and they were disinfested following the
de hongos, bacterias o insectos, como necrosis, method described above. In both cases, incubation
pudriciones, pudriciones secas, manchas, lesiones was performed at a temperature of 22±2 °C and a
corchosas, costras negras, obteniendo un total de photoperiod of 12 hours. After five days, from the
34 muestras, las cuales fueron procesadas el mismo dishes that presented fungal culture, we performed
día para su diagnóstico. monospore culture growth in new dishes with PDA.
The identification was carried out using taxonomical
Aislamiento de hongos. De cada muestra sospe- codes and morphometric characteristics (Sneh et
chosa para hongos y bacterias se tomaron fotogra- al., 1991; Barnett and Hunter, 2006; Leslie and
fías de los síntomas o daños. Posteriormente, de Summerell, 2006; Seifert and Gams, 2011).
manchas en tubérculos y de la transición de tejido In the case of tubers with symptoms of pustules
sano-enfermo se tomaron secciones de 1 cm2, se and root nodules suspected to have been caused by
desinfestaron con hipoclorito de sodio al 1% du- Spongospora subterranea, the present structures
rante 1 minuto, se lavaron con tres cambios de agua were observed under the microscope, histological
destilada estéril por tres minutos cada uno y seca- cuts were made, and permanent preparations
ron en papel absorbente estéril, posteriormente se were made for the identification of S. subterranea
colocaron sobre medio PDA (agar-papa-dextrosa) using taxonomic codes. To confirm the presence
contenido en cajas Petri de 90 x 15 mm. Por otra of Spongospora subterranea f sp. subterranea
parte, para propiciar el desarrollo de microorganis- a PCR test was carried out using specific Sos1
mos sobre el tubérculo, se realizaron cámaras hú- (5’-CCTGGGTGC-GATTGTCTGTT-3’) and Sps2
medas de cada tubérculo y síntoma sembrado en (5’-CACGCCAATGGTTAGA-GACG-3’) primers
PDA, se tomaron dos muestras de cada tubérculo reported by Bell et al. (1999).
ticillioides), Rhizoctonia solani, Alternaria sp., Fiers et al. (2010), reported Fusarium spp.,
Colletotrichum sp., Clonostachys sp., Geotrichum Rhizoctonia spp., Penicillium spp., Alternaria
sp., y al protozoario Spongospora subterranea f sp. spp., Clonostachys spp. as the most common
subterranea (Figura 1 y 2). Las especies del Alter- genera that colonize the surface of potato tubers
naria, Colletotrichum, Clonostachys, Fusarium, in storage conditions. Likewise, Gherbawy and
Rhizoctonia, han sido asociadas anteriormente a Gashgari (2013), identified Fusarium, Penicillium,
colonizar la superficie de los tubérculos (Fiers et Ilyonectria, Alternaria, and Rhizoctonia, in a study,
al., 210; Naerstad et al., 2012; Gherbawy y Gash- as the most common genera isolated in different
gari, 2013; Zimudzi et al., 2017). types of symptoms in potato tuber spots. On the
Por otra parte, de los tubérculos que presenta- other hand, Naerstad et al. (2012) pointed out
ron síntomas de necrosis o pudrición, se identificó that the pathogens that most commonly produce
a Enterobacter aerogenes y Pseudomonas fluores- spots in tubers, and reduce yield and quality, are
cens (Figura 3). Así también, en el 11.7% de los Rhizoctonia solani, Spongospora subterranea
A B C
D E F
Figura 1. A) Tubérculos de papa con manchas oscuras superficiales, realacionadas a Clonostachys sp. y Colletotrichum
sp. B) Pudriciones secas, donde se identificaron los hongos Fusarium sp., Rhizoctonia solani, Alternaria sp., y
Geotrichum sp. C) Hundimiento del corazón del tubérculo. D) Pústulas o costras circulares sobre la superficie
del tubérculo características debidas a Spongospora subterranea. E) Manchas o lesiones corchosas en forma de
figuras poliédricas, daños característicos de Streptomyces sp. F) Costras negras, duras similar a la tierra, que son
esclerocios que forma Rhizoctonia solani sobre la peridermis del tubérculo.
Figure 1. A) Potato tubers with dark surface spots related to Clonostachys sp. and Colletotrichum sp. B) Dry rotting, where
the fungi Fusarium sp., Rhizoctonia solani, Alternaria sp., and Geotrichum sp. were identified. C) Sinking of the
heart of the tuber. D) Pustules or circular scabs on the surface of the tuber, characteristics caused by Spongospora
subterranea. E) Spots or corklike lesions in polyhedral shapes, damages characteristically caused by Streptomyces
sp. F) Hard, black scabs, similar to soil, that are sclerotia formed by Rhizoctonia solani on the periderm of the
tuber.
A B C
D E F
G H I
A B
C D
Figura 3. Tubérculos de papa con síntomas de necrosis en la peridermis del tubérculo, en todos los casos se aislo e identificó
a las bacterias Enterobacter aerogenes y Pseudomonas fluorescens.
Figure 3. Potato tubers with symptoms of necrosis in the peridermis of the tuber; in all cases, the bacteria Enterobacter
aerogenes and Pseudomonas fluorescens were identified.
En tubérculos de papa se pueden presentar di- 2013; Zimundzi et al., 2017) and the species
ferentes daños superficiales que demeritan su valor F. oxysporum has been isolated from most of
comercial. Algunos son causados por patógenos o the cultivars studied (Manici and Cerato, 1994;
por insectos, o por factores abióticos y otra serie de Zimundzi et al., 2017). Apart from Fusarium spp.,
alteraciones que se desconocen sus causas, es decir, other fungi were found to colonize the same spots
desórdenes fisiológicos. Fiers et al. (2010), repor- of the tubers, such as Alternaria sp., Colletotrichum
tó a Fusarium spp., Rhizoctonia spp., Penicillium sp., Clonostachys sp., Rhizoctonia solani, and
spp., Alternaria spp., Clonostachys spp., como los Geotrichum sp. The latter has not been reported
géneros más comunes que colonizan la superficie to colonize or cause damages to the crop or potato
de tubérculos de papa en condiciones de almace- tubers, but is found throughtout the soil, although
namiento. De igual forma, Gherbawy y Gashga- only one specie is important as a pathogenic
ri (2013), en un estudio realizado identificaron a agent: Geotrichum candidum, a specie that has
Fusarium, Penicillium, Ilyonectria, Alternaria, y been reported as the causaling agent of bitter
Rhizoctonia, como los géneros más comunes ais- rotting in post-harvest citrus fruits (Brown 1988;
lados en diferentes tipos de síntomas de manchas López-García et al., 2003; Talibi et al., 2012), as
en tubérculos de papa. Por su parte, Naerstad et al. well as soft rottings in post-harvest strawberry
(2012), señalaron que los patógenos más comu- (Fraire-Cordero et al., 2003) and other crops, and
nes que ocasiona manchas en tubérculos, reducen therefore, further studies are recommended in
el rendimiento y calidad son: Rhizoctonia solani, order to determine their pathogenic condition. In
Spongospora subterranea f. sp. subterranea, Hel- the case of potato tubers, it has not been related
minthosporium solani, Colletotrichum coccodes, as a pathogenic agent, and could be considered as
Fusarium sp. y Streptomyces sp. En cuanto a Fu- a pollutant on the surface of the potato tubers in
sarium sp., los resultados obtenidos en este trabajo post-harvest or as a suppressor of the pathogenic
coinciden con los reportados en estudios previos microorganisms in this study.
ya que este se identificó como uno de los géneros The different genera and species of fungi that
más frecuentemente aislado en la peridermis de tu- have been identified as colonizing the surface of
bérculos de papa (Chelkowski, 1989; Fiers et al., the periderm of potato tubers, not only have a
2010; Gherbawy y Gashgari, 2013; Zimundzi et pathogenic behavior on the crop, but some genera
al., 2017) y la especie F. oxysporum se ha aislado may have an antagonistic behavior with pathogenic
de la mayoría de los cultivares estudiados (Manici organisms, which have been evaluated to determine
y Cerato, 1994; Zimundzi et al., 2017). Además, their potential as biocontrol agents. The fungus
de Fusarium spp, se identificó a otros hongos co- Clonostachys spp., known for its antifungal
lonizando las mismas manchas de los tubérculos, capability and mycoparasitic action against
como Alternaria sp., Colletotrichum sp., Clonosta- pathogens, produces a wide range of volatile organic
chys sp., Rhizoctonia solani, y Geotrichum sp., este compounds. Studies show that Clonostachys sp.
último no se ha reportado colonizando u ocasio- presents antibiosis and an effective colonization
nando daños en el cultivo o tubérculos de papa, se of the lesions caused by mechanical damages,
encuentra cosmopolitamente en el suelo, pero solo avoiding the entry of pathogenic agents (Gan et
una especie es importante como agente patogénico, al., 2007; Assefa, 2013), and limiting the growth
Geotrichum candidum, especie que se ha reporta- of other organisms in the potato tuber (Gan et al.,
do como el agente causal de la pudrición amarga de 2007). On the other hand, the species Gliocladium
los cítricos en postcosecha (Brown 1988; López- roseum (anamorph: Clonostachys rosea) has been
García et al., 2003; Talibi et al., 2012); además, reported as a pathogen in potato and a causing
de pudriciones blandas en postcosecha en fresa agent of dry rotting (Theron, 1991).
(Fraire-Cordero et al., 2003) y otros cultivos; por Danyluk et al. (2013), pointed out that the
lo que se recomienda realizar estudios subsecuen- microbiota that dominates in freshly-harvested
tes para poder determinar su condición patogénica. orchards is composed of bacteria Enterobacter,
En el caso de tubérculos de papa, no se ha asocia- Bacillus spp., Pantoea spp., Cyanobacterium,
do como agente patogénico, y podría considerarse Erwinia spp., Pectobacterium and Pseudomonas,
como contaminante en la superficie de los tubércu- resulting from contact with the soil, air and water.
los de papa en postcosecha o como supresor de los In the areas damaged by necrosis or rotting in some
microrganismos patogénicos en este estudio. of the tubers collected in this investigation, bacteria
Los diferentes géneros y especies de hongos were identified and we found a marked delimitation
que se han identificado colonizando la superficie that stopped the rot from advancing, which may
de la peridermis de tubérculos de papa; además de suggest that the antagonistic bacteria identified
papa, ocasionada por Fusarium spp., al producir di- as different bacteria known for being antagonistic
ferentes metabolitos antifúngicos (Schisler, 1994); of pathogenic microorganisms. In this study, the
además, puede reducir la severidad de la enferme- fungus Alternaria sp. was isolated more frequently
dad hasta un 25% (Chelkowski, 1989; Schisler et in the tubers collected. Symptoms of either necrosis
al., 1995; Schisler et al., 2000). Pseudomonas fluo- or rotting, or both, were found to be consistently
rescens también se reportó como agente de biocon- associated to the antagonistic bacteria Enterobacter
trol de bacterias como Erwinia carotovora subsp. aerogenes and Pseudomonas fluorescens, limiting
atroseptica al producir el componente antimicro- the advancement of the necrosis in the potato tuber
biano 2,4-diacetylphloroglucinol (DAPG) que in- tissue. However, further research is required to
hibe el crecimiento de esta bacteria en condiciones understand the interaction of these organisms on
in vitro (Cronin et al., 1997). the surface of potato tubers.
En el 9% de las muestras analizadas, no se es-
tableció una relación clara entre un microorganis- End of the English version
mo con los daños o síntomas en el tubérculo, los
síntomas se identificaron como hundimientos en
Pseudomonas fluorescens, limitando el avance de
el centro del tubérculo de color marrón. Las prin-
la necrosis en el tejido del tubérculo de papa; sin
cipales causas de los desórdenes fisiológicos son
embargo, se requiere más investigación para cono-
una respuesta de la planta a estrés, estos incluyen
cer la interacción de estos organismos en la super-
prácticas culturales inadecuadas durante el cultivo,
ficie de los tubérculos de papa.
incluida la elección de los cultivares susceptibles,
la manipulación o almacenamiento, temperaturas
LITERATURA CITADA
extremas, el pH del suelo, niveles de humedad y
niveles de nutrientes inadecuados (Fiers, 2010; Mi- Assefa JT. 2013. Postharvest Biological control of Fusarium
dry-rot diseases in potato tubers using Clonostachys rosea
kitzel, 2014). Zotarelli et al. (2013), mencionaron strain IK726. Disponible en línea: [Link]
que debido a la lixiviación de nutrientes como el se/5248/12/assefa-jima_t_130130.pdf (consulta, octubre
2017).
nitrato conduce a un estrés nutricional de la plan- Barnett HL and Hunter BB. 2006. Illustrated Genera of Imper-
ta, lo que da lugar a alteraciones fisiológicas, como fect Fungi, 4th. (Ed.), APS Press. The American Phytopa-
thological Society, St. Paul, Minnesota, USA. 218p.
son el centro marrón, corazón hueco, necrosis por Bell KS, Roberts J, Verrall S, Cullen DW, Williams NA,
el calor interno, agrietamiento, entre otros. Harrison JG and Claxton JR. 1999. Detection and quan-
tification of Spongospora subterranea f. sp. subterranea
El objetivo de este estudio fue identificar los or- in soils and on tubers using specific PCR primers. Euro-
ganismos asociados a daños en tubérculos de papa. pean Journal of Plant Pathology 105:905-915. [Link]
org/10.1023/A:1008782309333
En conclusión, se encontró una diversidad de mi- Boyd AEW. 1972. Potato storage diseases. Review of Plant
croorganismos patogénicos colonizando un mismo Pathology 51:297-321. Disponible en línea: [Link]
[Link]/isc/FullTextPDF/2006/[Link]
tubérculo; además de distintas bacterias conocidas Brown GE. 1988. Efficacy of guazatine and iminoctadine
por ser antagónicas de microorganismos patógenos. for control of postharvest decays of oranges. Plant Di-
sease 72:906-908. Disponible en línea: [Link]
En este estudio el hongo Alternaria sp., se aisló con [Link]/publications/PlantDisease/BackIssues/
mayor frecuencia en los tubérculos colectados. Se Documents/1988Articles/PlantDisease72n10_906.PDF
Chelkowski J. 1989. Toxinogenic of Fusarium species causing
encontraron asociados de manera consistente ya dry rot of potato tubers. Pp 435-440. In: Chelkowski J.
sea síntomas de necrosis o pudriciones, o ambos a (ed.). Fusarium: Mycotoxins, Taxonomy and Pathogenici-
ty. Elsevier Publishing Company, New York, USA. 492 p.
las bacterias antagónicas Enterobacter aerogenes y [Link]
Cronin D, Moënne-Loccoz Y, Fenton A, Dunne C, Dowling DN Gherbawy YA and Gashgari RM. 2013. Mycobiota associated
and O’gara F. 1997. Ecological interaction of a biocontrol with superficial blemishes of potato tubers. Food Biotech-
Pseudomonas fluorescens strain producing 2, 4-diacetyl- nology 27:137-151. [Link]
phloroglucinol with the soft rot potato pathogen Erwinia 3.781947
carotovora subsp. atroseptica. FEMS Microbiology Eco- Goszczynska T, Serfontein JJ and Serfontein S. 2000. In-
logy 23:95-106. [Link] troduction to practical phytobacteriology; a manual for
tb00394.x phytobacteriology by SAFRINET, SDC Switzerland.
Czajkowski R, Perombelon MC, van Veen JA and van der Wolf 83p. Disponible en línea: [Link]
JM. 2011. Control of blackleg and tuber soft rot of potato publication/237021880_Introduction_to_Practical _
caused by Pectobacterium and Dickeya species: a review. Phytobacteriology_A_manual_for_phytobacteriology
Plant pathology 60:999-1013. [Link] de Haan EG, Dekker-Nooren TC, van den Bovenkamp GW,
j.1365-3059.2011.02470.x Speksnijder AG, van der Zouwen PS and van der Wolf
Danyluk MD, Fatica MK, Brar PK, McEgan R, Valadez JM. 2008. Pectobacterium carotovorum subsp. caroto-
AM, Schneider KR and Trinetta V. 2013. Fruits and Ve- vorum can cause potato blackleg in temperate climates.
getables. Chapter 50. In: Salfinger Y and Tortorello ML. European Journal of Plant Pathology 122:561. [Link]
(Eds.). Compendium of methods for the microbiological org/10.1007/s10658-008-9325-y
examination of foods. 5th edition. American Public Health Herrera JE and Scott GJ. 1993. Factores limitantes a la pro-
Association (APHA Press). Washington, D.C. USA. ducción y usos de la papa: resultados de la encuesta a los
515,533,561pp. [Link] programas nacionales de América Latina. Revista Lati-
El-Ghaouth A, Wilson CL and Wisniewski M. 1998. Ultras- noamericana de la papa 5:122-134. Disponible en línea:
tructural and cytochemical aspects of the biological con- [Link]
trol of Botrytis cinerea by Candida saitoana in apple cle/viewFile/63/65
fruit. Phytopathology 88:282-291. [Link] Jemison Jr JM, Sexton P and Camire ME. 2008. Factors in-
PHYTO.1998.88.4.282 fluencing consumer preference of fresh potato varieties in
FAO (Organización de las Naciones Unidas para la Alimenta- Maine. American Journal of Potato Research 85:140-149.
ción y la Agricultura). 2014. FAOSTAT. Food and agricul- [Link]
ture data. Disponible en línea: [Link] Leslie JF and Summerell BA. 2006. The Fusarium laboratory
es/#data/QC (consulta, octubre 2017). manual. Blackwell Publishing Professional, Iowa, USA.
Fiers M. 2010. Origins of the blemishes of potato tubers: from 388p. Disponible en línea: [Link]
the soil microbiology to the pedoclimatic environment. doi/10.1002/[Link]/pdf (consulta, oc-
Food and Nutrition. Université de Bourgogne, France. tubre 2017).
261p. Disponible en línea: [Link] López-Garcı́a B, Veyrat A, Pérez-Payá E, González-Candelas
tel-00572491/document (consulta, octubre 2017). L and Marcos JF. 2003. Comparison of the activity of anti-
Fiers M, Chatot C, Edel-Hermann V, Le Hingrat Y, Konate AY, fungal hexapeptides and the fungicides thiabendazole and
Gautheron N and Steinberg C. 2010. Diversity of micro- imazalil against postharvest fungal pathogens. Internatio-
organisms associated with atypical superficial blemishes nal Journal of Food Microbiology 89:163-170. [Link]
of potato tubers and pathogenicity assessment. European org/10.1016/S0168-1605(03)00118-1
Journal of Plant Pathology 128:353-371. [Link] Manici LM and Cerato C. 1994. Pathogenecity of Fusa-
org/10.1007/s10658-010-9657-2 rium oxysporum f. sp. tuberosi isolates from tubers and
Fiers M, Edel-Hermann V, Chatot C, Le Hingrat Y, Alabouvet- potato plants. Potato Research 37:129-134. [Link]
te C and Steinberg C. 2012. Potato soil-borne diseases. A org/10.1007/BF02358713
review. Agronomy for Sustainable Development 32:93- Mikitzel L. 2014. Tuber physiological disorders. Chapter 14.
132. [Link] Pp: 237. In: Navarre R, Pavek MJ. (eds.). The Potato: Bo-
Friedmans BA. 1960. Market diseases of fresh fruits and tany, Production and uses. CABI, USA. 382p. [Link]
vegetables. Economic Botany 14:145-156. [Link] org/10.1079/9781780642802.0000
org/10.1007/BF02860016 Mora-Aguilar R. 2014. Consumo y mercado de la papa en
Fraire-Cordero MDL, Yáñez-Morales MDJ, Nieto-Angel D y México. XXVI Congreso bienal de la Asociación Latinoa-
Vázquez-Gálvez G. 2003. Hongos patógenos en fruto de mericana de la Papa (ALAP). Disponible en línea: https://
fresa (Fragaria x ananassa Duch.) en postcosecha. Revis- [Link]/2014/11/28/
ta Mexicana de Fitopatología 21:285-291. Disponible en consumo-y-mercadeo-de-la-papa-en-mxico/ (consulta,
línea: [Link] abril 2018).
Gan Z, Yang J, Tao N, Liang L, Mi Q, Li J and Zhang KQ. Naerstad R, Dees MW, Le VH, Holgado R and Hermansen A.
2007. Cloning of the gene Lecanicillium psalliotae chiti- 2012. Occurrence of skin blemish diseases (scab and scurf)
nase Lpchi1 and identification of its potential role in the in Norwegian potato production. Potato Research 55:225-
biocontrol of root-knot nematode Meloidogyne incognita. 239. [Link]
Applied Microbiology and Biotechnology 76:1309-1317. Olivieri FP, Maldonado S, Tonon CV and Casalongue CA.
[Link] 2004. Hydrolytic activities of Fusarium solani and Fusa-
Gashgari RM and Gherbawy YA. 2013. Pathogenicity of some rium solani f. sp eumartii Associated with the Infection Pro-
Fusarium species associated with superficial blemishes of cess of Potato Tubers. Journal of Phytopathology 152:337-
potato tubers. Polish Journal of Microbiology 62:59-66. 344. [Link]
Schisler DA. 1994. Selection and performance of bacterial Talibi I, Askarne L, Boubaker H, Boudyac, EH, Msanda F,
strains for biologically controlling Fusarium dry rot of Saadi B, Ait Ben and Aoumar A. 2012. Antifungal acti-
potatoes incited by Gibberella pulicaris. Plant Disease vity of Moroccan medicinal plants against citrus sour
78:251-255. [Link] rot agent Geotrichum candidum. Letters in Applied Mi-
Schisler DA, Kurtzman CP, Bothast RJ and Slininger PJ. 1995. crobiology 55:155-161. [Link]
Evaluation of yeasts for biological control of Fusarium 765X.2012.03273.x
dry rot of potatoes. American Journal of Potato Research, Vázquez-Carrillo MG, Rubio-Cobarruvias OA, Salinas-More-
72:339-353. [Link] no y Santiago-Ramos D. 2013. Usos alternativos de la papa
Schisler DA, Slininger PJ, Kleinkopf G, Bothast RJ and Os- en el Estado de México Disponible en línea: [Link]
trowski RC. 2000. Biological control of Fusarium dry rot [Link]/profile/David_Santiago-Ramos/publica-
of potato tubers under commercial storage conditions. tion/260437185_Usos_alternativos_de_la_papa_en_el_
American Journal of Potato Research 77:29-40. https:// Estado_de_Mexico/links/004635315013a361e4000000/
[Link]/10.1007/BF02853659 [Link]
Schaad NW, Jones JB and Chum W. 2001. Laboratory Gui- (consulta, octubre 2017).
de for Identification of Plant Pathogenic Bacteria. 3rd Ed. Zimudzi J, Coutinho TA and Van der Waals JE. 2017. Pathoge-
APS Press, St. Paul, MN, USA 398p. nicity of Fungi Isolated from Atypical Skin Blemishes on
Seifert KA and Gams W. 2011. The genera of Hyphomyce- Potatoes in South Africa and Zimbabwe. Potato Research
tes-2011 update. Persoonia 27:119-129. [Link] 60:119-144. [Link]
org/10.3767/003158511X617435 Zotarelli L, Reyes-Cabrera JE, Worthington CM, Hutchinson
Sneh B, Burpee L and Ogoshi A. 1991. Identification of Rhi- C, Byrd S, Gergela D y Rowland DL. 2013. Trastornos
zoctonia species. 3rd print. APS press. St Paul, Minnesota, fisiológicos de la papa-Necrosis por calor interno. Depar-
USA. 133p. tamento del Ciencias para la Horticultura, Servicio de Ex-
Stevenson WR, Loria R, Franc GD and Weingartner DP. 2001. tensión Cooperativa de la Florida, Instituto de Alimentos y
Compendium of potato diseases. Second Edition. The Ame- Ciencias Agrícolas, Universidad de la Florida. (UF/IFAS).
rican Phytopathological Society Press. St. Paul, MN, USA. 4p. Disponible en línea: [Link]
144p. [Link] HS/[Link] (consulta, octubre 2017).
Theron DJ. 1991. Dry rot of potatoes caused by Gliocla-
dium roseum. Plant Pathology 40:302-305. [Link]
org/10.1111/j.1365-3059.1991.tb02380.x
Martínez-Cruz J, Ochoa-Martínez DL, Hernández-Mo- Abstract. The viruses of the Begomovirus genus
rales J, Zamora-Macorra EJ, Ramírez-Rojas S. 2018. have a worldwide distribution and to date it is
Leafhoppers that carry begomoviruses on roselle crop known that they are transmitted exclusively by
(Hibiscus sabdariffa L.). Revista Mexicana de Fitopato- Bemisia tabaci. In Mexico, in 2016, a complex of
logía 36(2): 321-330. begomoviruses associated with the yellowing of
DOI: 10.18781/[Link].1801-4 roselle (Hibiscus sabdariffa) was reported, in which
Okra yellow mosaic Mexico virus (OYMMV) is
Primera publicación DOI: 03 de Mayo, 2018. present. The objective of this study was to know the
First DOI publication: May 03, 2018. carrier insects of begomoviruses associated with
roselle. Insects were collected from plants with
Resumen. Los virus del género Begomovirus tie- yellowing, vein clearing and mosaic and analyzed
nen una distribución mundial y a la fecha se sabe by PCR. Three species of leafhoppers that carry
que son transmitidos exclusivamente por Bemisia OYMMV were identified: Trypanalebra maculata,
tabaci. En 2016, se reportó un complejo de bego- Kunzeana scimetara and Agallia excavata. In T.
movirus asociados al amarillamiento de la jamaica maculata and A. modesta, Sida golden mosaic
(Hibiscus sabdariffa L.) en México,entre los que Buckup virus (SiGMBuV) and Melon chlorotic leaf
se encuentra el Okra yellow mosaic Mexico virus curl virus (MCLCuV) were detected, respectively.
(OYMMV). Con el propósito de conocer la ento- This is the first report of leafhoppers as carriers of
mofauna asociada al cultivo de jamaica portadora begomoviruses.
de begomovirus, se colectaron insectos en plantas
con amarillamiento, aclaramiento de nervadu- Key words: virus vector insects, Agallia,
ras y mosaico y se analizaron mediante PCR. Se Trypanalebra, Kunzeana.
identificaron tres especies de cicádelidos portado- The Begomovirus genus belongs to the
ras de OYMMV: Trypanalebra maculata, Kunzea- Geminiviridae family, which includes pathogens
na scimetara y Agallia excavata. Asimismo, se en- that have circular genomes of single-stranded
contró que T. maculata y A. modesta son portado- DNA with one or two components of 2700-
ras de los begomovirus Sida golden mosaic Buckup 3000 pb within incomplete icosahedral particles
virus (SiGMBuV) y Melon chlorotic leaf curl virus (geminated). They are responsible for several
(MCLCuV), respectivamente. Este es el primer re- diseases that affect economically important crops
porte de cicadélidos portadores de begomovirus. in tropical and subtropical regions worldwide
(Moffat, 1999). Based on its host range, insect
Palabras clave: insectos vectores de virus, Aga- vector, genomic composition and sequence
llia, Trypanalebra, Kunzeana. similarity, the Geminiviridae family is divided into
seven genera (Varsani et al., 2009; Varsani et al.,
2014). One of them is the Begomovirus genus that
El género Begomovirus pertenece a la familia includes over 60 species exclusively transmitted by
Geminiviridae, el cual comprende patógenos que a Bemisia tabaci species complex (Markham et al.,
poseen genomas circulares de DNA monocatenario 1994). In Mexico, roselle (Hibiscus sabdariffa L.)
compuesto por uno o dos componentes de 2700- is a crop of great economic importance, and Ayutla
3000 pb, contenidos dentro de partículas icosaédri- and Tecoanapa, Guerrero, are the municipalities
cas (geminadas) incompletas. Son responsables de with the greatest cultivated area at the national level
diversas enfermedades en cultivos de importancia (SIAP, 2015). Worldwide, four viruses associated
económica en regiones tropicales y subtropicales with this crop have been reported: Cotton leaf
del mundo (Moffat, 1999). Con base en su gama curl virus (CLCuV), Malva vein clearing virus
de hospedantes, insecto vector, organización de su (MVCV) (Brunt et al., 1996), Okra mosaic virus
genoma y similitud de secuencias, la familia Gemi- (OkMV) (Stephan et al., 2008) and Mesta yellow
niviridae se divide en siete géneros (Varsani et al., vein mosaic virus (MYVMV) (Chatterjee et al.,
2009; Varsani et al., 2014). Uno de éstos es el gé- 2008). In Mexico, a begomovirus complex was
nero Begomovirus que agrupa más de 60 especies found associated with roselle yellowing, including
transmitidas exclusivamente por un complejo de Okra yellow mosaic Mexico virus (OYMMV)
especies de Bemisia tabaci (Markham et al., 1994). (Velázquez et al., 2016). In the 2015 cycle, the
En México, la jamaica (Hibiscus sabdariffa L.) es disease was detected in two plots in Tecoanapa
un cultivo de gran importancia económica, Ayut- with 100% incidence. Whitefly populations are
la y Tecoanapa, Guerrero, son los municipios con very low on crops in that production area. Based on
mayor superficie cultivada a nivel nacional (SIAP, this, the objective of the present study was to find
2015). En el ámbito mundial se reportan cuatro out if there are other insects that carry OYMMV or
virus asociados al cultivo, Cotton leaf curl virus other begomoviruses.
(CLCuV), Malva vein clearing virus (MVCV) In 2016, two samplings of the municipalities
(Brunt et al., 1996), Okra mosaic virus (OkMV) of Tecoanapa and Ayutla, Guerrero, were done
(Stephan et al., 2008) y Mesta yellow vein mosaic (Table 1). The first sampling took place in the 2015
virus (MYVMV) (Chatterjee et al., 2008). En México, cycle, from August 3 to 5, when the crop was in
se consignó un complejo de begomovirus asociados its vegetative stage, in locations where there was
al amarillamiento de la jamaica, entre los cuales a high incidence of plants showing yellowing. The
se encuentra Okra yellow mosaic Mexico virus second sampling took place during the 2016 cycle,
(OYMMV) (Velázquez et al., 2016). En el ciclo from November 26 to 28, when calyces were being
2015 esta enfermedad se presentó en dos parcelas harvested, in plots where the incidence of yellowing
de Tecoanapa con una incidencia de 100%. Sien- was high. In all cases, insects were collected with
do además muy bajas las poblaciones de mosquita a sweep net from roselle plants and surrounding
blanca en el cultivo en esa zona productora. Con weeds showing yellowing, vein clearing and
base en lo anterior, el objetivo del presente estudio mosaic, and placed in plastic containers containing
fue conocer si existen otros insectos portadores de 96% ethanol. In the laboratory, the insects were
OYMMV u otros begomovirus. separated according to their morphological
Durante 2016 realizaron dos recorridos en los similarities and kept at -20 °C. Total DNA was
municipios de Tecoanapa y Ayutla, Guerrero (Cua- extracted from 2 or 3 individuals in each insect
dro 1). El primero del 3 al 5 de agosto cuando el group using CTAB (Sambrook and Rusell, 2001).
cultivo se encontraba en etapa vegetativa en locali- The remaining insects in each group were kept in
dades donde se tuvo una alta incidencia de plantas ethanol to be identified later, in case they tested
con amarillamiento en el ciclo 2015. El segundo positive for begomoviruses through PCR using
recorrido se hizo del 26 al 28 de noviembre en la AV494/AC1048 universal primers and under the
época de cosecha de cálices en sitios donde la inci- amplification conditions reported by Wyatt and
dencia de amarillamiento fue alta en el ciclo 2016. Brown (1996), which amplify a 550 pb fragment.
En todos los casos se colectaron insectos de plantas
The amplified products were sequenced and
de jamaica y maleza adyacente a ellas que mostra-
compared to those in the GenBank database. The
ban amarillamiento, aclaramiento de nervaduras y
insects that tested positive for begomoviruses were
mosaico con una red de golpeo y se colocaron en
mounted, identified using taxonomic keys (Table 1)
envases de plástico que contenían etanol 96%. En
and photographed using an optical microscope.
el laboratorio los insectos se separaron con base
During the first sampling, insects of the
en sus semejanzas morfológicas y se mantuvie-
Thysanoptera (207 individuals), Coleoptera (76
ron a -20 °C. Se tomaron de 2 a 3 individuos de
individuals) and Hemiptera orders were found. Four
cada grupo de insectos y se extrajo DNA total con
families of the Hemiptera order were identified:
CTAB (Sambrook y Rusell, 2001). El resto de los
Membracidae (17 individuals), Pyrrhocoridae
insectos de cada grupo se mantuvieron en alcohol
(62 individuals from the Dysdercus genus) and
para su posterior identificación en caso de resultar
Aleyrodidae and Cicadellidae. Pérez et al. (2009)
positivos por PCR para begomovirus con el par de
iniciadores universales AV494/AC1048 y las con- studied the entomofauna associated with roselle in
diciones de amplificación reportadas por Wyatt Chiautla de Tapia, Puebla, and reported 17 species
y Brown (1996) que amplifican un fragmento de belonging to six orders, 11 families and 19 genera.
550 pb. Los productos amplificados fueron se- The authors reported Atta mexicana, Sphenarium
cuenciados y comparados con la base de datos del purpurascens, Melanoplus spp. and Aphis gossypii
GenBank. Los insectos que resultaron positivos a as pests that cause considerable damage to the
begomovirus fueron montados e identificados con roselle crop, but they were not found in this study.
claves taxonómicas (Cuadro 1) y fotografiados con The density of leafhoppers observed was higher
un microscopio óptico. than that of whiteflies.
Cuadro 1. Insectos del orden Hemiptera asociados a jamaica en 11 localidades de dos municipios de Guerrero.
Table 1. Insects of the Hemiptera order associated with roselle at 11 locations in two municipalities of Guerrero.
Ayutla Tecoanapa
San José San El
Insectos Cortijo Cotzalzin Tutepec Cuanacasapa Xalpatlauhac Colotepec Apantla Pericon Total
La Hacienda Miguel Salitre
Av Bw A B B A B A B A B A B A B A B A B A B A B
Trypanalebra
97 0 1 2 0 0 1 -x - 0 - 2 - 11 3 - 44 - 2 - - 8 148 23
maculata
Kunzeana
3 2 0 46 1 4 3 - - 2 - 9 - 13 20 - 12 - 6 - - 11 45 87
scimetara
Agallia sp. 2 3 0 11 0 3 4 - - 0 - 2 - 3 3 - 27 - 2 - - 20 38 42
Otros cicadélidosy 5 0 2 34 2 1 8 - - 0 - 6 - 10 28 - 20 - 7 - - 1 72 52
Moscas blancasz 57 1 2 5 2 5 0 - - 1 - 17 - 2 8 - 8 - 1 - - 10 78 41
Total 164 6 5 98 5 13 16 - - 3 - 36 - 39 62 - 111 - 18 - - 50
v
A: primera colecta: 3-5 de agosto 2016 / vA: first sampling: August 3-5, 2016.
w
B: segunda colecta: 26-28 de noviembre 2016 / wB: second sampling: November 26-28, 2016.
x
-: sitio no muestreado / x-: site not sampled.
y
Cicadélidos no identificados / y Unidentified leafhoppers.
z
Complejo de moscas blancas / z Whitefly complex.
En el primer recorrido se encontraron insectos From the first batch of insects collected, 45
de los órdenes Thysanoptera (207 individuos), Co- groups of insects were analyzed by PCR, 8 of
leoptera (76 individuos) y Hemiptera; de este últi- which were found to have the expected 550-pb
mo se identificaron cuatro familias: Membracidae fragment of begomovirus. On insects obtained from
(17 individuos), Pyrrhocoridae (62 individuos del the first sampling, Okra yellow mosaic Mexico
género Dysdercus), Aleyrodidae y Cicadellidae. virus (OYMMV) was detected in Trypanalebra
Pérez et al. (2009) estudiaron la entomofauna aso- maculata, Agallia sp., Kunzeana scimetara and
ciada a jamaica en Chiautla de Tapia, Puebla y re- A. excavata, while in A. modesta we found Melon
portan 17 especies pertenecientes a seis órdenes, 11 chlorotic leaf curl virus (MCLCuV) (Figure1,
familias y 19 géneros. Estos autores mencionan a Table 2). MCLCuV was reported by Brown et
Atta mexicana, Sphenarium purpurascens, Mela- al. (2001) in Guatemala, and they suggested that
noplus spp. y Aphis gossypii como plagas que oca- it is a new species derived from the Squash leaf
sionan daños considerables al cultivo, las cuales no curl virus (SLCV) group that includes bipartite
fueron encontradas en el presente estudio. Se ob- begomoviruses native to Central America and
servó que la densidad de cicadélidos fue mayor que Mexico. MCLCuV had not been detected before in
las de mosca blanca. roselle or in weeds associated with it in the study
En la primera colecta se analizaron por PCR 45 area. In the second sampling, OYMMV was found
grupos de insectos de los cuales en ocho se observó in T. maculata collected in San Miguel and Cortijo.
el fragmento esperado de 550 pb para begomovirus Sida golden mosaic Buckup virus (SiGMBuV) was
mediante esta prueba. En insectos obtenidos du- found in Agallia sp. from Cortijo. Stewart et al.
rante el primer muestreo se detectó al Okra yellow (2014) point out that plants of the Sida genus are
mosaic Mexico virus (OYMMV) en Trypanalebra SiGMBuV hosts. However, Ortega et al. (2017)
maculata, Agallia sp., Kunzeana scimetara y A. ex- detected OYMMV in Sida collina, S. aggregata, S.
cavata, mientras que en A. modesta se encontró a acuta, S. hankeana and Malacra fasiata plants that
Melon chlorotic leaf curl virus (MCLCuV) (Figura were associated with roselle crops in the study area,
1, Cuadro 2). MCLCuV fue reportado por Brown but no SiGMBuV. This may be due to the fact that
et al. (2001) en Guatemala y sugieren que se trata OYMMV has a higher transmission efficiency or is
de una nueva especie derivada del grupo Squash better able than SiGMBuV to infect the diversity of
leaf curl virus (SLCV) que incluye begomovirus Sida species in this region. The four insect species
bipartitas nativos de América Central y México. that tested positive for begomoviruses belong to the
MCLCuV no se había detectado antes en jamai- Cicadellidae family. T. maculata and K. scimetara
ca ni en maleza asociada a este cultivo en la zona belong to the Typhlocybinae subfamily, which
de estudio. En el segundo muestreo se encontró a includes the Empoasca genus, including E. papayae
OYMMV en T. maculata colectada en las localida- (Acosta et al., 2017) and E. devastans (Hague and
des de San Miguel y Cortijo. En Agallia sp. proce- Parasram, 1973), known to be the vector of 16SrII
dente de Cortijo se encontró a Sida golden mosaic phytoplasma that causes papaya bunchy top (PBT)
Buckup virus (SiGMBuV). Stewart et al. (2014) se- disease (Acosta et al., 2017). Another species from
ñalan que plantas del género Sida son hospedantes this subfamily known to be a phytoplasma vector
de SiGMBuV; sin embargo, Ortega et al., (2017) is Alebroides nigroscutellatus, which transmits
detectaron a OYMMV en plantas de Sida collina, S. the phytoplasma Potato purple top roll (16SrIII-B)
Figura 1. Cicadélidos asociados a jamaica positivos a begomovirus colectados en diferentes localidades de Ayutla y Tecoana-
pa, Guerrero. a) Trypanalebra maculata; b) Kunzeana scimetara; c) Agallia excavata; d) A. modesta.
Figure 1. Leafhoppers associated with roselle that were collected at different locations in Ayutla and Tecoanapa, Guerrero,
and tested positive for begomoviruses. a) Trypanalebra maculata; b) Kunzeana scimetara; c) Agallia excavata; d) A.
modesta.
Cuadro 2. Begomovirus detectados en cicadélidos colectados en plantas de jamaica y maleza con síntomas de amarillamien-
to en dos municipios de Guerrero, México.
Table 2. Begomoviruses detected on leafhoppers collected from roselle plants and weeds showing yellowing symptoms in
two municipalities of Guerrero, Mexico.
w
OYMMV: Okra yellow mosaic Mexico virus / wOYMMV: Okra yellow mosaic Mexico virus.
x
MCLCuV: Melon chlorotic leaf curl virus / xMCLCuV: Melon chlorotic leaf curl virus.
y
SiGMBuV: Sida golden mosaic Buckup virus / ySiGMBuV: Sida golden mosaic Buckup virus.
z
NS: No aisgnado aún por el GenBank / zNS: Not yet assigned by the GenBank.
aggregata, S. acuta, S. hankeana y Malacra fasiata (Rojas, 2009). To date, no viruses are reported
asociadas al cultivo de jamaica en la zona de estu- to be transmitted by species of this subfamily.
dio, pero no al SiGMBuV. Lo anterior puede deber- Dietrich (2013) mentions that the members of the
se a que el OYMMV posee una mayor eficiencia Typhlocybinae subfamily prefer to eat parenchyma
de transmisión o una mejor capacidad de infectar a cells, which suggests that there is low or no
las diversas especies de Sida que el SiGMBuV en probability that they acquired begomovirus that
esta región. Las cuatro especies de insectos posi- are limited to the phloem. On the other hand,
tivas a begomovirus pertenecen a la familia Cica- Agallia excavata and A. modesta belong to the
dellidae. T. maculata y K. scimetara pertenecen a Deltocephalinae subfamily, whose members prefer
la subfamilia Typhlocybinae, dentro de la cual se phloem (Zahniser and Dietrich, 2008) and, given
encuentra el género Empoasca que incluye a E. pa- this habit, would be able to transmit viruses. Such
payae (Acosta et al., 2017) y E. devastans (Hague is the case of Dalbulus maidis, vector of Maize
y Parasram, 1973) conocidas como vectoras del rayado fino virus (MRFV) that causes one of the
fitoplasma 16SrII causante de la enfermedad papa-
most important diseases affecting maize in Latin
ya bunchy top (PBT) (Acosta et al., 2017). Otra es-
America (Nault et al., 1980). Within the Agallia
pecie conocida como vectora de fitoplasma dentro
genus there are species such as A. constricta and
de esta subfamilia es Alebroides nigroscutellatus
A. cuadripundata, which are confirmed vectors
que transmite el fitoplasma Potato purple top roll
of the New Jersey variant of Potato yellow dwarf
(16SrIII-B) (Rojas, 2009). A la fecha no hay repor-
virus (Rhabdoviridae) and Wound tumor virus
tes de virus transmitidos por especies de esta subfa-
(Reoviridae) in eastern United States (Belatra et
milia. Dietrich (2013) menciona que los miembros
al., 2017).
de la subfamilia Typhlocybinae se alimentan prefe-
Although little is known about the interactions
rentemente de las células del parénquima, lo cual
that cause geminivirus-vector specificity,
sugeriría que hay poca o nula probabilidad de que
adquirieran a los begomovirus que están limitados several studies indicate that the coat protein is
al floema. Por otro lado, Agallia excavata y A. mo- responsible. Briddon et al. (1990) demonstrated
desta pertenecen a la subfamilia Deltocephalinae, that the exchange of the African cassava mosaic
cuyos miembros se alimentan preferentemente del virus (ACMV) coat protein gene (transmitted by
floema (Zahniser y Dietrich, 2008) y, debido a este whiteflies) along with the Beet curly top virus
hábito alimenticio, podrían ser capaces de transmi- (BCTV) (transmitted by leafhoppers) altered the
tir virus. Tal es el caso de Dalbulus maidis, vec- vector’s specificity and resulted in the transmission
tor de Maize rayado fino virus (MRFV) causante of this ACMV chimerical isolate by leafhoppers.
de una de las enfermedades más importantes que On the other hand, Roumagnac et al. (2015)
afecta maíz en América Latina (Nault et al., 1980). recently demonstrated that Alfalfa leaf curl virus
Dentro del género Agallia existen especies como is transmitted by Aphis craccivora and suggested
A. constricta y A. cuadripundata que son vectores that this virus be considered a new genus within
confirmados de la variante Nueva Jersey del Potato the Geminiviridae family (and proposed it should
yellow dwarf virus (Rhabdoviridae) y Wound tumor be named Capulavirus), which would include
virus (Reoviridae) en el este de los Estados Unidos different recently discovered geminiviruses that
(Belatra et al., 2017). have no known vector.
Aunque se sabe poco acerca de las interaccio- In this study no begomoviruses were detected
nes que conducen a la especificidad geminivirus- in the B. tabaci individuals analyzed (Access No.
vector, diversos estudios señalan a la proteína de MG675920). However, this species is made up
la cápside como responsable. Briddon et al. (1990) of multiple “biotypes” that differ in their level of
demostraron que el intercambio del gen de la pro- competence as a vector, the number and type of
teína de la cápside de African cassava mosaic virus endosymbionts, and their genetic composition
(ACMV) (transmitido por mosca blanca) con el (Brown et al., 1995). Several studies indicate that
Beet curly top virus (BCTV) (transmitido por chi- at least two different mechanisms can explain
charritas), alteró la especificidad del vector dando the fact that begomoviruses are not transmitted
como resultado la transmisión de este aislado qui- by whiteflies: (1) the particles lose their capacity
mérico de ACMV por chicharritas. Por otro lado, to penetrate the insect’s intestinal epithelium; (2)
recientemente Roumagnac et al. (2015) demos- the virions can reach the insect’s hemolymph, but
traron la transmisión de Alfalfa leaf curl virus por they cannot become correctly associated with the
Aphis craccivora y sugieren que este virus sea con- GroEL protein (Rosell et al., 1999; Morin et al.,
siderado en un nuevo género dentro de la familia 2000). Also, it has been demonstrated that certain
Geminiviridae (nombre propuesto Capulavirus), Abutilon mosaic virus (AbMV) isolates are not
que incluiría geminivirus divergentes descubiertos transmitted by B. tabaci (Wu et al., 1996; Höfer
recientemente que no tienen un vector conocido. et al., 1997). In this case, the epithelial cells in
En el presente estudio no se detectaron begomo- the intestine of B. tabaci are the first barrier that
virus en los individuos de B. tabaci analizados (No. begomovirus must cross in order to be transmitted,
acceso MG675920). Sin embargo, esta especie se and it is probable that those AbMV isolates have
encuentra constituída por múltiples “biotipos” que lost their capacity to join the receptors within the
difieren en su grado de competencia como vector, whitefly’s digestive tract (Morin et al., 2000).
número y tipo de endosimbiontes y composición It was demonstrated that Trypanalebra
genética (Brown et al., 1995). Diversos estudios maculata, Kunzeana scimetara, Agallia excavata
indican que al menos dos mecanismos diferentes and Agallia modesta collected from roselle plants
pueden explicar la no transmisibilidad de los be- and weeds associated with yellowing, vein clearing
gomovirus por moscas blancas: (1) las partículas and mosaic are carriers of three begomoviruses.
pierden su capacidad de penetrar en el epitelio in-
testinal del insecto; (2) los viriones pueden alcan- Acknowledgments
zar la hemolinfa del insecto, pero no pueden aso-
ciarse correctamente con la proteína GroEL (Rosell The authors wish to thank the Consejo Nacional de Ciencia
et al., 1999; Morin et al., 2000). Asimismo, se ha y Tecnología (CONACYT) for granting the scholarship that
demostrado que ciertos aislamientos de Abutilon allowed the first author to obtain her [Link]. degree, and Dr.
mosaic virus (AbMV) no son transmitidos por B. James N. Zahniser, national expert on Heteroptera, USDA-
tabaci (Wu et al., 1996; Höfer et al., 1997). En APHIS-PPQ-NIS of the National Museum of Natural History,
este caso, las células epiteliales del intestino de B. Smithsonian Institution, Washington, DC, for the taxonomical
tabaci constituyen la primera barrera que los be- identification of the leafhoppers included in the present study.
gomovirus deben cruzar para ser transmitidos y es
probable que estos aislamientos de AbMV hayan End of the English version
perdido la capacidad de unirse a los receptores den- Brunt A, Crabtree AK, Dallwitz MJ, Gibbs AJ, Watson L and
Zurcher EJ. 1996. Plant Viruses Online: Descriptions and
tro del tracto digestivo de la mosca blanca (Morin, Lists from the VIDE Database. Disponible en línea: http://
et al., 2000). [Link]/vide/[Link]#Hibiscus sabdariffa
Chatterjee A, Roy A and Ghosh SK. 2008. Acquisition, trans-
Se comprobó que Trypanalebra maculata, Kun- mission and host range of a begomovirus associated with
zeana scimetara, Agallia. excavata y Agallia mo- yellow vein mosaic disease of mesta (Hibiscus cannabin-
us and Hibiscus sabdariffa). Australasian Plant Pathology
desta colectadas en plantas de jamaica y maleza 37:511-519. Disponible en línea: [Link]
asociada con síntomas de amarillamiento, aclara- content/pdf/10.1071%[Link]
Dietrich CH. 2013. South American leafhoppers of the tribe
miento de nervaduras y mosaico son portadoras de Typhlocybini (Hemiptera: Cicadellidae: Typhlocybinae).
tres begomovirus. Zoologia 30:519-568. [Link]
46702013000500008
Hague SQ and Parasram S. 1973. Empoasca stevensi, a new
Agradecimientos vector of bunchy top disease of papaya. Plant Disease
Reporter 57:412-413. Disponible en línea: [Link]
[Link]/cgi/pt?id=mdp.39015001262768;view=1up
Al Consejo Nacional de Ciencia y Tecnología (CONA- ;seq=436
Höfer P, Bedford ID, Markham PG, Jeske H and Frischmu-
CYT) por otorgar la beca para la realización de los estudios de th T. 1997. Coat protein gene replacement results in
maestría de la primera autora. whitefly transmission of an insect nontransmissible ge-
minivirus isolate. Virology 236:288-295. Disponible en
Al Dr. James N. Zahniser, especialista nacional de Hete- línea: [Link]
roptera, USDA-APHIS-PPQ-NIS del National Museum of [Link]?_tid=9630256c-
fbbd-11e7-a7d8-00000aacb362&acdnat=1516217915_
Natural History, Smithsonian Institution, Washington, DC por b778550a58dbea340439c09687fff1cf
la identificación taxonómica de los cicadélidos estudiados en Markham PG, Bedford ID, Liu S and Pinner M. 1994.
The transmission of geminiviruses by Bemisia tabaci.
el presente trabajo. Pest Management Science 42:123-128. DOI: 10.1002/
ps.2780420209
Moffat AS. 1999. Geminiviruses emerge as serious rop threat.
LITERATURA CITADA Science 286:1835. DOI:10.1126/science.286.5446.1835
Morin S, Ghanim M, Sobol I, and Czosnek H. 2000. The Gro-
Acosta KI, Zamora L, Piñol B, Quiñones ML, Ramos PL, EL protein of the whitefly Bemisia tabaci interacts with
Luis M, Leyva LNE and Arocha Y. 2017. Empoasca pa- the coat protein of transmissible and nontransmissible
payae Oman, 1937 (Hemiptera: Cicadellidae) the simul- begomoviruses in the yeast two-hybrid system. Virology
taneous vector of phytoplasmas and rickettsia associated 276:404-416. DOI: 10.1006/viro.2000.0549
with “Bunchy Top Symptom” in Cuba. Anales de Biología Nault LR, Gingery RE and Gordon DT. 1980. Leafhopper
39:35-42. Disponible en línea: [Link] transmission and host range of maize rayado fino virus.
debiologia/numeros/39/PDF/39_2017_03.pdf Phytopathology 70:709-712. Disponible en línea: https://
Belatra O, Boukraa H, Loukhche H and Benmessaoud BH. [Link]/publications/phytopathology/backissues/
2017. Potential leafhopper vectors of plant pathogens po- Documents/1980Articles/Phyto70n08_709.PDF
tato in the high plateaus Algerians (Hemiptera: Cicado- Ortega AC, Ochoa MDL, Hernández MJ y Ramírez RS. 2017.
morpha: Auchenorryncha). Advances in Environmental Identificación de malezas hospedantes de Okra yellow mo-
Biology 11:52-56. Disponible en línea: [Link] saic Mexico virus y determinación de su transmisión por
[Link]/AENSIWEB/aeb/aeb/2017/January/[Link] semilla. Tesis de Maestría en Ciencias. Colegio de Postgra-
Briddon RW, Pinner MS, Stanley J and Markham PG. 1990. duados, México.
Geminivirus coat protein replacement alters insect specifi- Pérez TBC, Aragón GA, Bautista MN, Tapia RAM y López
city. Virology 177:85-94. Disponible en línea: [Link] OJF. 2009. Entomofauna asociada al cultivo de jamaica (Hi-
[Link]/science/article/pii/004268229090462Z biscus sabdariffa L.) en el municipio de Chiautla de Tapia,
Brown JK, Frohlich DR and Rosell RC. 1995. The sweetpota- Puebla. Acta Zoológica Mexicana 25:239-247. Disponible
to or silverleaf whiteflies: biotypes of Bemisia tabaci or a en línea: [Link]
species complex. Annual Review of Entomology 40:511- pdf
534. Disponible en línea: [Link] Rojas MRI. 2009. Insect vectors of phytoplasmas In: Tropi-
doi/pdf/10.1146/[Link].40.010195.002455 cal Biology and Conservation Management - Volume 7:
Brown JK, Idris AM, Rogan D, Hussein MH and Palmieri M. Phytopathology and Entomology. Eolss Publishers Co
2001. Melon chlorotic leaf curl virus, a new begomovi- Ltd., Oxford, United Kingdom. Disponible en línea: https://
rus associated with Bemisia tabaci infestations in Gua- [Link]/sample-chapters/C20/[Link]
temala. Plant Disease 85:1027. [Link] Roumagnac P, Granier M, Bernardo P, Deshoux M, Ferdinand
PDIS.2001.85.9.1027C R, Galzi S, Fernandez E, Julian C, Abt I, Filloux D, Mes-
léard F, Varsani A, Blanc S, Martin DP and Mesléard F. Varsani A, Shepherd DN, Dent K, Monjane AL, Rybicki EP
2015. Alfalfa leaf curl virus: An aphid-transmitted gemi- and Martin DP. 2009. A highly divergent South African
nivirus. Journal of Virology 89:9683-9688. [Link] geminivirus species illuminates the ancient evolutionary
org/10.1128/JVI.00453-15 history of this family. Virology Journal 6:36. [Link]
Rosell RC, TorresJI and Brown JK. 1999. Tracing the gemi- org/10.1186/1743-422X-6-36
nivirus-whitefly transmission pathway by polymerase Velázquez FP, Zamora MEJ, Ochoa MDL, Negrete FG y
chain reaction in whitefly extracts, saliva, hemolymph, Hernández MJ. 2016. Virus asociados al amarillamien-
and honeydew. Phytopathology 89:239-246. [Link] to de Hibiscus sabdariffa en Guerrero, México. Revis-
org/10.1094/PHYTO.1999.89.3.239 ta Mexicana de Fitopatología 34:200-207. [Link]
Sambrook J and Rusell D. 2001. Molecular Cloning. A labora- org/10.18781/[Link].1602-1
tory Manual. 3rd ed. Cold Spring Harbor Laboratory Press. Wu ZC, Hu JS, Polston JE, Ullman DE and Hiebert E. 1996.
Disponible en línea: [Link] Complete nucleotide sequence of a nonvector-transmis-
ple/2013/MC4/[Link] sible strain of Abutilon mosaic geminivirus in Hawaii.
SIAP, Sistema de Información Agroalimentaria y Pesquera. Phytopathology 86:608-613. Disponible en línea: https://
2015. [Link] (Consulta, noviembre 2017). [Link]/publications/phytopathology/backissues/
Stephan D, Siddiqua M, Hoang AT, Engelmann J, Winter S Documents/1996Articles/Phyto86n06_608.pdf
and Maiss E. 2008. Complete nucleotide sequence and ex- Wyatt SD and Brown JK. 1996. Detection of subgroup III gemi-
perimental host range of Okra mosaic virus. Virus Genes nivirus isolates in leaf extracts by degenerate primers and
36:231-240. DOI: 10.1007/s11262-007-0181-1 polymerase chain reaction. Phytopathology 86:1288-1293.
Stewart C, Kon T, Rojas M, Graham A, Martin D, Gilbertson Disponible en línea: [Link]
R and Roye M. 2014. The molecular characterisation of phytopathology/backissues/Documents/1996Articles/
a Sida-infecting begomovirus from Jamaica. Archives of Phyto86n12_1288.PDF
Virology 159:375-378. DOI: 10.1007/s00705-013-1814-4 Zahniser JN and Dietrich CH. 2008. Phylogeny of the le-
Varsani A, Navas CJ, Moriones E, Hernández ZC, Idris A, afhopper subfamily Deltocephalinae (Insecta: Aucheno-
Brown JK, Murilo ZF and Martin DP. 2014. Establishment rrhyncha: Cicadellidae) and related subfamilies based
of three new genera in the family Geminiviridae: Becur- on morphology. Systematics and Biodiversity 6:1-24.
tovirus, Eragrovirus and Turncurtovirus. Archives of Vi- DOI: 10.1017/S1477200007002617
rology 159:2193-2203. DOI: 10.1007/s00705-014-2050-2
Leila Cristiane-Delmadi*, Universidade do Estado de Mato Grosso – UNEMAT, Rua São Jorge, 586 - Casa 04,
Bairro Cavalhada, CP. 78200-000, Cáceres, Mato Grosso, Brasil; Cristiane de Pieri, Alex Sander-Porcena,
Edson Luiz-Furtado, Universidade Estadual Paulista “Júlio de Mesquita Filho” – UNESP, Campus de Botu-
catu, Faculdade de Ciências Agronômicas, Departamento de Produção Vegetal, CP. 18610-307, Botucatu, São
Paulo, Brasil. *Autor para correspondencia: [Link]@[Link].
Cristiane-Delmadi L, Cristiane de Pieri, Sander-Porcena Abstract. Teak (Tectona grandis) rust, caused
A, Luiz-Furtado E. 2018. Diagramatic scale for quantifi- by the fungus Olivea tectonae, has been present in
cation of rust severity in take leaves. Revista Mexicana several regions of Brazil in severe cases that lead to
de Fitopatología 36(2): 331-341. the premature fall of the leaves and even the death of
DOI: 10.18781/[Link].1708-5 the plant. However, there is still no standard method
for assessment of disease severity in the field. The
Primera publicación DOI: 04 de Mayo, 2018. objective of this study was to develop and validate
First DOI publication: May 04, 2018.
a diagrammatic scale to quantify the rust severity
in leaves of teak. The diagrammatic scale was
developed based on disease severity encompassing
Resumen. La roya de la teca (Tectona grandis),
0, 2.5, 5, 10, 20, 40 and 80% of the leaf area with
causada pelo fungo Olivea tectonae, se ha presen-
rust symptom. The scale was validated by 10 raters,
tado en varias regiones de Brasil en casos graves
who analyzed 50 leaves with a range of disease
que conducen a la caída prematura de las hojas e in-
severity, without and with diagrammatic scale as an
cluso la muerte de la planta. Sin embargo, todavía
no existe un método estándar para la evaluación de assessment aid. The raters presented differences in
la severidad de la enfermedad en el campo. El ob- the perception of the severity levels of the disease.
jetivo de este estudio fue desarrollar y validar una With the adoption of the diagrammatic scale all
escala diagramática para cuantificar la severidad de the raters improved the accuracy of the estimates,
la roya en hojas de teca. La escala diagramática se there was a reduction in the absolute errors and
desarrolló en función de la severidad de la enfer- good estimates of repeatability. The proposed
medad que abarca 0, 2.5, 5, 10, 20, 40 y 80% del diagrammatic scale is suitable for the evaluation
área foliar con síntomas de roya. La escala fue va- of the rust severity in teak leaves, being able to
lidada por 10 evaluadores, que analizaron 50 hojas provide accuracy and repeatability of estimates.
con un rango de severidad de la enfermedad, sin Key words: Tectona grandis, Olivea tectonae,
y con escala diagramática como ayuda de evalua- disease assessment.
ción. Los evaluadores presentaron diferencias en la
percepción de los niveles de severidad de la enfer-
medad. Con la adopción de la escala diagramática The Brazilian forestry sector has a great
todos los evaluadores mejoraron la precisión de las potential for growth due to lower costs, production
estimaciones, hubo reducción en los errores abso- cycles, a higher productivity, and the variables that
lutos y buenas estimaciones de repetitividad. La are less active to fluctuations in the finance market.
escala diagramática propuesta es adecuada para la Brazil has all competitive advantages of other
evaluación de la severidad de la roya en las hojas countries in the forestry sector, due to its favorable
de teca, siendo capaz de proporcionar precisión y natural conditions, scientific advances, and the
repetitividad das estimativas. entrepreneurial spirit, which results in a high
growth potential (AMATA, 2009; ABRAF, 2013).
Palabras clave: Tectona grandis, Olivea tectonae, A species that has stood out in the forestry sector,
evaluación de enfermedad. and particularly in the foreign market, is the teak
(Tectona grandis), originally from India, Myanmar,
Thailand and Laos. It is species that flourishes in
El sector forestal brasileño tiene un gran po- humid tropical climates with summer rains and dry
tencial de crecimiento, por menor costo, ciclo de winters. In Brazil, the teak grows best in areas with
producción, mayor productividad, y las variables average annual rainfalls ranging between 1250
menos activas a las fluctuaciones en el mercado and 2500 mm and with an average temperature of
financiero. Brasil resume las ventajas competiti- 24 °C. A dry period of three to five months favors
vas con respecto a otros países en el sector fores- the quality of the wood (Cáceres Florestal, 1997;
tal, debido a sus favorables condiciones naturales, EMBRAPA, 2007).
avances científicos y al espíritu empresarial, lo que Various studies indicate that the teak has
resulta en un alto potencial de crecimiento (AMA- presented pathologies in Brazilian and international
TA, 2009; ABRAF, 2013). Una especie que se ha plantations. These diseases worry producers of
destacado en el sector forestal, especialmente en this crop throughout the country, particularly,
el mercado exterior es la teca (Tectona grandis), teak rust, given its aggressiveness (Pieri et al.,
originaria de la India, Myanmar, Tailandia y Laos. 2011). The disease presents yellow and powdery-
Es una especie de clima tropical húmedo, con llu- looking pustules on the surface of the underside,
vias de verano e invierno seco. En Brasil la teca se and a premature defoliation takes place in all
desarrolla mejor en zonas con precipitación media phenological phases of the culture, reducing the
anual entre 1250 y 2500 mm y con temperatura me- speed of growth of the plant, causing a reduction
dia de 24 °C. Un periodo seco de tres a cinco meses of the photosynthetic rate, and consequently
favorece la calidad de la madera (Cáceres Florestal, impacting the rate of wood production (Arguedas-
1997; EMBRAPA, 2007). Gamboa, 2004).
Varios estudios indican que la teca ha presen- This disease was first reported in the American
tado patologías en las plantaciones internaciona- continent in Panama, in November 2003; later, in
les y en Brasil. Estas enfermedades preocupan a Costa Rica in January 2004 (Arguedas-Gamboa,
productores de este cultivo en todo el país, en es- 2004); in Ecuador in September, and in Mexico in
pecial la roya de la teca, dada su agresividad (Pieri December 2005 (NAPPO, 2005). In 2005, it was
et al., 2011). La enfermedad presenta pústulas de reported in Colombia (Céspedes and Yepes, 2007),
color amarillo y de aspecto polvoso en la superfi- and in 2006, in Cuba (Pérez et al., 2008). The first
cie del envés, y se produce una desfolia prematura report of this disease in Brazil took place in 2009
en todas las fases fenológicas de la cultura, redu- and was later verified in several municipal areas of
ciendo la velocidad de crecimiento de las plantas, different Brazilian states (Pieri et al., 2011).
ocasionando reducción de la tasa fotosintética y The appropriate methods for the evaluation of
consecuentemente influenciando en la producción the disease must allow a greater degree of accuracy,
de madera (Arguedas-Gamboa, 2004). precision and repetitiveness, therefore such methods
En el continente Americano, esta enfermedad vary depending on the causal agents of the disease
fue reportada por primera vez en Panamá en no- (Berger, 1980). Severity is the variable used in the
viembre de 2003, posteriormente en Costa Rica case of foliar diseases and the quantification of this
en enero de 2004 (Arguedas-Gamboa, 2004), en variable is crucial for subsidizing different actions
Ecuador en septiembre y en México en diciem- in agriculture, such as epidemiological studies,
bre 2005 (NAPPO, 2005). En 2005 se registró en evaluations of control strategies, selecting resistant
Colombia (Céspedes y Yepes, 2007) y en 2006 en genotypes and carrying out tests with agrochemical
Cuba (Pérez et al., 2008). El primer reporte de esta products (Campbell and Madden, 1990). The
enfermedad en Brasil fue en 2009 y posteriormente evaluation of severity is normally carried out in
fue constatada en varios municipios de diferentes a subjective manner through visual analyses, and
estados brasileños (Pieri et al., 2011). therefore the diagrammatic scales have become an
Los métodos adecuados para la evaluación de important tool in these studies (Kranz, 1988; Nutter
la enfermedad deben permitir un mayor grado de Jr. et al., 2006). Scales are used in the normalization
exactitud, precisión y repetitividad, por lo que tales of the visual estimation; therefore, the evaluation is
métodos varían según el agente causal de la enfer- more precise and accurate between evaluators and
medad (Berger, 1980). La severidad es la varia- it reduces errors in visual estimations (Campbell
ble utilizada en el caso de enfermedades foliares and Madden, 1990).
y la cuantificación de esta variable es crucial para Some of the most important characteristics in a
dar subsidios a diversas acciones en la agricultu- diagrammatic scale are the ease of use, applicability
ra, como los estudios epidemiológicos, evaluar las in the face of a large variety of conditions with
estrategias de control, seleccionar genotipos resis- reproducible results, and the existence of intervals
tentes y realizar pruebas con productos agroquími- that represent all the stages of development of
cos (Campbell y Madden, 1990). La evaluación la the disease (Berger, 1980; Bergamin Filho and
evaluación de la severidad se lleva a cabo normal- Amorim, 1996).
mente de manera subjetiva por medio de análisis Proposing a standardized system to orient the
visuales, por lo tanto, la escala diagramática se ha evaluation of the severity of a particular disease is
convertido en una herramienta importante en estos an important responsibility, since, if the system is
estudios (Kranz, 1988; Nutter Jr. et al., 2006). Las deficient, the cost of its use may be higher than the
escalas se usan en la normalización de la estima- benefits obtained with its use (Leite and Amorim,
ción visual, por lo que la evaluación es más precisa 2002; Nutter Jr. and Schultz, 1995). However,
y exacta entre los evaluadores y reduce el error en a standardization of the disease evaluation
la estimación visual (Campbell y Madden, 1990). methodology is highly desirable, since it helps
Entre las características más importantes en una compare results obtained in different institutions
escala diagramática se encuentran: facilidad de and locations (Bergamin Filho and Amorim, 1996).
uso, aplicabilidad ante una amplia gama de condi- The aim of this study, therefore, was to develop
ciones con resultados reproducibles y la existencia and validate a diagrammatic scale to quantify teak
de intervalos que representan todas las etapas de rust in the field.
desarrollo de la enfermedad (Berger, 1980; Berga- In order to do this, 200 adult teak leaves, aged
min Filho y Amorim, 1996). 10 years, were gathered in an experimental field in
La propuesta de establecer un sistema estandari- the Hacienda Lageado - UNESP/FCA (Botucatu,
zado para orientar la evaluación de la severidad de São Paulo, Brasil) in the Tropical Flora company
una determinada enfermedad es de gran responsa- (Garça, São Paulo, Brasil), all of which presented
bilidad, pues, si el sistema es deficiente, el costo de different levels of damage due to rust; they were
su utilización puede ser mayor que los beneficios collected along with healthy leaves.
alcanzados con su uso (Leite y Amorim, 2002; Nut- Each leaf was evaluated according to the
ter Jr. y Schultz, 1995). Sin embargo, la estandari- proportion of the diseased area and the real severity
zación es altamente deseable, pues la uniformiza- of the disease, as a percentage. The healthy and
ción de la metodología de evaluación de enferme- affected areas were determined in RGB (red, green,
dades permite comparaciones entre los resultados blue) based on the methodology described by
obtenidos en diferentes instituciones y localidades Masson et al. (2008). Later, the intermediate levels
(Bergamin Filho y Amorim, 1996). of the scale of severity were determined according
Por lo tanto, este estudio tuvo como objetivo el to the Weber-Fechner law (Horsfall and Barratt,
desarrollo y la validación de una escala diagramáti- 1945).
ca para cuantificar la roya de teca en campo. The scale was validated by 10 evaluators, who
Para la realización de este trabajo, se utilizaron analyzed 50 digital images of adult teak leaves,
200 hojas adultas de teca colectadas en la plantación both healthy and with symptoms of rust at different
experimental en la Hacienda Lageado - UNESP/ levels of severity. The evaluators had different levels
FCA (Botucatu, São Paulo, Brasil) con 10 años de of experience, some with previous knowledge of a
edad y en la empresa Tropical Flora (Garça, São scale, and others without experience or knowledge.
Paulo, Brasil), las cuales presentaban diferentes ni- Each image of a leaf was projected for the
veles de daño por la roya; además, de hojas sanas. evaluators using Power Point for 30 seconds in
Posteriormente las hojas fueron escaneadas para two stages: the first observation was performed
análisis y preparación de la escala. Cada hoja se without the use of a diagrammatic scale; the
evaluó de acuerdo a la relación de área enferma y evaluators carried out the evaluation by placing a
la severidad real de la enfermedad en porcentaje. value, expressed as a percentage, in a previously
El área afectada y área foliar sana fueron determi- established format. In the second stage, the
nadas en RGB (rojo, verde, azul) con base en la evaluators received a new format along with the
metodología utilizada por Masson et al. (2008). diagrammatic scale for reference. The images of the
Posteriormente, los niveles intermedios de la escala 50 teak leaves were projected for their evaluation
de severidad se determinaron de acuerdo con la ley against the scale.
de la agudeza visual de Weber-Fechner (Horsfall y Using the information obtained from the
Barratt, 1945). evaluations with and without scales, we determined
La validación de la escala se realizó por 10 eva- the precision of the estimations obtained by
luadores que analizaron 50 imágenes digitales de calculating the coefficient of determination of the
hojas adultas de teca, sanas y con síntomas de roya accuracy and the variance of absolute errors. A
en diferentes niveles de severidad. Los evaluado- simple linear regression analysis was carried out,
res presentaban diferentes niveles de experiencia, considering the real severity as the independent
algunos con conocimiento previo de una escala y variable and the estimated severity, as the dependent
otros sin experiencia y desconocimiento. variable. The precision of the estimations was
Cada imagen de una hoja fue proyectada a los evaluated using the precision or determination
evaluadores a través del programa Power Point, por coefficient (r²) and the variance of the absolute
30 segundos en dos etapas: la primera observación errors (estimated severity minus real severity)
se realizó sin el uso de la escala diagramática, los (Kranz, 1988; Nutter Jr. et al., 1993).
evaluadores realizaron la evaluación colocando un The diagrammatic scale of teak rust presented
valor expresado en porcentaje en un formato pre- seven severity levels, base don the distribution of
viamente establecido. En la segunda etapa, los eva- the sample: N0 = 0% (no symptoms or signs); N1 =
luadores recibieron un nuevo formato junto con la 2.5%; N2 = 5%; N3 = 10%; N4 = 20%; N5 = 40%;
escala diagramática para su referencia, nuevamente N6 = 80%, exponentially, according to the Weber-
se proyectaron las imágenes de las 50 hojas de teca Fechner law, as shown in Figure 1.
para ser evaluadas con respecto a la escala. In the validation of the diagrammatic scale,
Con la información obtenida de las evaluaciones the 10 evaluators presented differences in the
con y sin escala se determinó la precisión de las es- perception of the severity levels of the disease.
timaciones obtenidas mediante el cálculo del coefi- The evaluators presented a good accuracy, with
ciente de determinación de exactitud y la varianza and without scales, due to the estimated severity
de los errores absolutos. Se realizó un análisis por values being near the real values. Absolute errors
regresión lineal simple, teniendo en cuenta la seve- decreased when the diagrammatic scale was used
ridad real como la variable independiente y la esti- as an aid for evaluation (Figure 2).
mada como variable dependiente. La precisión de The evaluators displayed adequate estimations
las estimaciones se evaluó mediante el coeficiente for repetitiveness, which can be viewed in the
de determinación o precisión (r²) y la varianza de results of the regression between the first and
los errores absolutos (severidad estimada severidad second evaluation (with and without a scale). Due
menos real) (Kranz, 1988; Nutter Jr. et al., 1993). to the proximity of the estimated severity values
La escala diagramática de la roya de la teca pre- and the real intensity values, the validation obtained
sento siete niveles de severidad en función de la very promising results (Figure 2).
distribución de la muestra: N0 = 0% (sin síntomas The severity estimated using the scale and the
o signos); N1 = 2,5%; N2 = 5%; N3 = 10%; N4 = regression lines obtained between the actual value
20%; N5 = 40%; N6 = 80%, de manera exponen- and the estimation (continuous line) of rust in adult
cial, de acuerdo con la ley de Weber-Fechner como teak leaves are shown in Figure 2. The intercept
se muestra en la Figura 1. (a) and slope coefficients (b) and determination r²,
Figura 1. Escala diagramática para la evaluación de la severidad de la roya de la teca causada por el hongo Oliveae tectonae.
Valores en porcentaje de área foliar con síntomas.
Figure 1. Diagrammatic scale for the evaluation of the severity of teak rust cause by the fungud Oliveae tectonae. Values in
percentages of leaf area with symptoms.
En la validación de la escala diagramática, los obtained in the regressions between the real and the
10 evaluadores presentaron diferencias en la per- estimated, with and without the use of a diagram,
cepción de los niveles de severidad de la enferme- are shown in Table 1.
dad. Los evaluadores presentaron buena precisión, There was a reduction in the absolute errors
con y sin escala, debido a que los valores de seve- when the diagrammatic scale was used as an aid
ridad estimados estaban cerca de los valores rea- for evaluation (Figure 2).
les. Hubo una reducción en los errores absolutos With the adoption of the diagrammatic scale
cuando se utilizó la escala diagramática como una proposed, all evaluators improved the precision
ayuda para la evaluación (Figura 2). of the estimations (r²=0.93) in comparison with
Los evaluadores mostraron buenas estimacio- the result obtained without the use of the scale
nes de repetitividad, que se pueden ver en los resul- (r²=0.88).
tados de la regresión entre la primera y la segunda Similar values between the estimated and real
evaluación (con y sin escala). Debido a la proxi- valued determine the accuracy of the evaluations.
midad de los valores de severidad estimados a los Precision is a factor to consider in the validation of
valores de la intensidad real, la validación obtuvo a diagram scale, and it is defined as the precision
resultados muy prometedores (Figura 2). o fan operation that supposed rigor and accuracy.
Estimados (%)
60 60
40 40
20 20
0 0
0 20 40 60 80 100 0 20 40 60 80 100
60 Estimados (%) 60
40 40
20 20
0 0
0 20 40 60 80 100 0 20 40 60 80 100
Real Real
Figura 2. Validación estadística de la escala diagramática para evaluar la severidad de la roya de la teca. Los evaluadores 5
y 7 fueron seleccionados para representar el análisis de regresión lineal entre la severidad real y la estimada con y
sin usar la escala diagramática. Esos evaluadores tenían la precisión más baja y más alta (r2), respectivamente.
Figure 2. Statistical validation of the diagrammatic scale to assess teak rust severity. Evaluators 5 and 7 where selected to
represent the linear regression analysis between actual and estimated severity with and without using the dia-
grammatic scale. Those evaluators had the lowest and highest precision (r2), respectively.
La severidad estimada con la ayuda de la escala Precision can be evaluated by determining the
y las líneas de regresión obtenidas entre el valor coefficient of regression analysis, which must be
actual y el estimado (línea continua) a la roya en near to 1, and by the variation of absolute error
las hojas adultas de la teca se muestran en la Figura (difference between estimated and real severity)
2. Los coeficientes angulares (a), lineares (b) y de- (Bergamin Filho and Amorim, 1996).
terminación r², obtenidos en las regresiones entre lo The difference between evaluators in the
real y el estimado, con y sin el uso de diagrama se quantification of teak rust confirms observations by
presentan en el Cuadro 1. Nutter Jr. and Schultz (1995) regarding the variation
Hubo una reducción en los errores absolutos in the ability between individuals to discriminate
cuando se utilizó la escala diagramática como una disease levels. The quality of the disease estimation
ayuda para la evaluación (Figura 2). is not only influenced by stimuli and psychological
Con la adopción de la escala diagramática pro- answers but can also be affected by factors such
puesta, todos los evaluadores mejoraron la precisión as the complexity of the sampling unit, size and
Cuadro 1. Intercepción (a), pendiente (b) y coeficiente de determinación (r2) obtenidos de una regresión lineal simple entre valo-
res reales y estimaciones de severidad de roya de la teca realizados por diez evaluadores mediante el uso, y sin uso, de
la escala diagramática.
Table 1. Intercept (a), slope (b) and determination coefficient (r²) obtained with simple linear regression between real values and
estimations of teak rust severity for ten evaluators with and without using the diagrammatic scale.
Evaluadores
Escala Coeficientes 01 02 03 04 05 06 07 08 09 10 Media
a 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01
Sin b 0.05 0.12 0.07 0.04 0.18 0.11 0.06 0.07 0.01 0.17 0.09
r² 0.89 0.87 0.87 0.86 0.82 0.92 0.95 0.87 0.91 0.86 0.88
a 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01
Con b 0.04 0.11 0.02 0.03 0.24 0.01 0.02 0.01 0.01 0.09 0.06
r² 0.93 0.91 0.93 0.93 0.88 0.97 0.97 0.93 0.94 0.92 0.93
de las estimaciones (r²=0.93) en comparación con el shapes of the lesions, color and number of lesions
resultado obtenido sin el uso de la escala (r²=0.88). in the sampling unit (Kranz, 1988), fatigue and
Valores similares entre los valores estimados difficulty of concentration on the task (Shokes et
y los reales determinan la exactitud de las evalua- al., 1987).
ciones. La precisión es un factor a considerar en The improvement in the accuracy of the
la validación de una escala diagrama, y se define estimations of the severity of rust in teak leaves
como la precisión de una operación que suponga el with the use of the diagrammatic scale is similar
rigor y la exactitud. La precisión se puede evaluar to the results obtained in several studies carried out
mediante la determinación del coeficiente de aná- earlier, involving other pathosystems (Del Ponte et
lisis de regresión, que debe estar cerca de 1, y por al., 2017).
la variación de error absoluto (diferencia entre la Even without the use of the diagrammatic scale,
severidad estimada y real) (Bergamin Filho y Amo- evaluators presented good levels of accuracy in
rim, 1996). the estimations, similar to the one confirmed in the
La diferencia entre los evaluadores en la cuan- validation of diagrammatic scales for rust in coffee
tificación de la roya de la teca confirma las obser- (Capucho et al., 2011), sugarcane (Klosowski et al.,
vaciones de Nutter Jr. y Schultz (1995) en cuanto 2013), bean (Godoy et al., 1997) , soybean (Godoy
a la variación en la habilidad entre individuos para et al., 2006) and grapevine (Angelotti et al., 2008),
discriminar niveles de enfermedad. La calidad de and may be a result of the ease of evaluation of the
la estimación de la enfermedad, además de ser in- severity of the disease, due to the size of the rust
fluenciada por estímulos y respuestas psicológicas, pustules on leaves.
puede ser afectada por factores como la compleji- The evaluators presented certain levels of
dad de la unidad de muestreo, tamaño y forma de absolute errors in the estimations, even with the
las lesiones, color y número de lesiones en la uni- use of the diagrammatic scale. However, according
dad de muestreo (Kranz, 1988), fatiga y dificultad to statements by Stonehouse (1994), the presence
concentración en la tarea (Shokes et al., 1987). of some level of error in the evaluations may be
La mejora en la precisión de las estimaciones compensated by the speed and standardization
de la severidad de la roya en hojas de teca con la that result from the use of diagrammatic scales.
utilización de la escala diagramática se asemeja a Likewise, as in most disease severity quantification
los resultados obtenidos en varios estudios realiza- methods, the use of diagrammatic scales is
dos previamente involucrando otros patosistemas subjected to a certain degree of subjectivity, which
(Del Ponte et al., 2017). can be minimized by training the evaluators (Nutter
Incluso sin la utilización de la escala diagramá- Jr. and Schultz, 1995; Nutter et al., 2006).
tica los evaluadores presentaron buena precisión en The improvement in the repeatability of the
las estimaciones, que se asemeja al constatado en la disease severity estimations, as obtained in this study
validación de escalas diagramáticas para royas en with the use of the diagrammatic scale, is important
café (Capucho et al., 2011), caña de azúcar (Klo- in developing standard disease evaluation methods,
sowski et al., 2013), frijol (Godoy et al., 1997) , since it indicates that evaluations performed in
soya (Godoy et al., 2006) y vid (Angelotti et al., different moments by a same evaluator presents a
2008), y pueden ser resultado de la facilidad de higher level of accuracy (Campbell and Madden,
evaluación de la severidad de la enfermedad debi- 1990).
do al tamaño de las pústulas de roya en las hojas. The diagrammatic scale proposed and validated
Los evaluadores presentaron determinados ni- in this study serves various items listed in a recent
veles de errores absolutos en las estimaciones in- article (Del Ponte et al., 2017) on the best practices
cluso con la utilización de la escala diagramática. for conducting and validating diagrammatic scales
Sin embargo, Conforme a lo destacado por Stone- to quantify plant diseases.
house (1994), la presencia de algún nivel de error
absoluto en las evaluaciones puede ser compensa-
do por la rapidez y estandarización que resultan CONCLUSIONS
del uso de escalas diagramáticas. Además, como la
mayoría de los métodos de cuantificación de seve- The diagrammatic scale proposed is adequate
ridad de enfermedades, el uso de escalas diagramá- for the evaluation of the severity of rust in teak
ticas está sujeto a cierto grado de subjetividad, lo leaves, since it is able to provide accuracy and
que puede ser minimizado con el entrenamiento de repeatability of the estimations. This standard
los evaluadores (Nutter Jr. y Schultz, 1995; Nutter procedure may be highly valuable for applying in
et al., 2006). field surveys, in epidemiological Studies, and the
La mejora en la repetitividad de las estimacio- evaluation of disease control measures.
nes de severidad de la enfermedad, como obteni-
da en este estudio con la utilización de la escala End of the English version
diagramática, es una característica importante en
el desarrollo de métodos estándar de evaluación
de enfermedades, pues indica que evaluaciones y validación de escalas diagramáticas para cuantifi-
realizadas en diferentes momentos por un mismo cación de enfermedades de plantas.
evaluador presenta elevada precisión (Campbell y
Madden, 1990).
La escala diagramática propuesta y validada CONCLUSIONES
en este estudio atiende a varios ítems listados en
reciente artículo (Del Ponte et al., 2017) sobre las La escala diagramática propuesta es adecuada
mejores prácticas para la conducción de desarrollo para la evaluación de la severidad de la roya en las
Shokes FM, Berger RD, Smith DH, Rasp JM. 1987. Reliability Stonehouse J. 1994. Assessment of Andean bean diseases
of disease assessment procedures: a case study with late using visual keys. Plant Pathology 43:519-527. [Link]
leafspot of peanut. Oléagineux 42:245-251. org/10.1111/j.1365-3059.1994.tb01586.x
Aidé Velázquez-Silva, Silvia Edith García-Díaz, Departamento de Ingeniería Forestal, División de Cien-
cias Forestales, Universidad Autónoma Chapingo, Km 38.5 Carretera México-Texcoco, Estado de México, CP.
56230, México; Leticia Robles-Yerena*, Cristian Nava-Díaz, Daniel Nieto-Ángel, Instituto de Fitosanidad,
Colegio de Posgraduados, Km. 36.5 Carretera México-Texcoco, Montecillo, Texcoco, Estado de México, CP.
56230, México. *Autor para correspondencia: pagin03@[Link].
con y sin herida previa a la inoculación, los testigos identification and of two additional species were
fueron tratados con agua destilada estéril. Se evaluó confirmed: C. fragariae and C. boninense.
la incidencia y severidad. Para la caracterización
molecular se extrajo el ácido desoxirribonucleico Key words: spice, anthracnose, morphological,
por el método de extracción y purificación CTAB. pathogenic and molecular characterization.
La región del ITS fue amplificada con los primers
ITS4, ITS5. La caracterización morfológica iden-
tificó dos especies: C. acutatum y C. gloeospo- Allspice is a plant used in the culinary arts and
rioides. Todos los aislados resultaron patogénicos it is produced in tropical areas of the coastal areas
en los frutos después de 11 días de la inoculación. of the Gulf of Mexico. More than 15 thousand tons
Molecularmente se confirmaron los resultados de of allspice are produced in municipal areas of the
la identificación morfológica y de dos especies adi- Sierra del Totonacapan and distributed nationwide,
cionales: C. fragariae y C. boninense. as well as to countries in the European Union. Its
production is currently being affected by fungi that
Palabras clave: especia, antracnosis, caracteriza- attack leaves, stem, flowers, and mainly the flowers
ción morfológica, patogénica y molecular. of this plant, which has contributed to the loss in
quality of the product, and has lead to investigations
on the cause of such reduction (Carballo PI. 2016,
La pimienta gorda es una planta utilizada en el abril 10).
arte culinario, es producida en regiones tropicales Anthracnose is a disease that affects plant
en la zona costera del Golfo de México. Más de species of different botanical families from hot
15 mil toneladas de pimienta gorda por año se pro- and humid areas, caused by different species of the
ducen en municipios de la Sierra del Totonacapan, genus Colletotrichum. The symptoms commonly
estas son distribuidas a nivel nacional y a países caused by this pathogen are dark brown concave
de la Unión Europea. Actualmente la producción spots on leaves, stems, flowers or fruits, leading to
es afectada por hongos que atacan follaje, tallo, the death of tissues (Rivera, 2007).
flor y principalmente los frutos de esta planta, lo In August of 2014, M. C. Silvia E. García Díaz
que ha contribuido en la perdida de la calidad en (personal communication) performed a diagnosis
el producto, por lo que se investigan las causas que on allspice fruits, stems and leaves with material
ocasionan dicha reducción (Carballo PI. 2016, abril from the field in Northern Veracruz, and found
10). symptoms of anthracnose; the disease caused
La antracnosis es una enfermedad que afecta es- losses of 20 to 50% of the production in pre and
pecies vegetales de diferentes familias botánicas de post harvest. Due to a lack of information on this
zonas calurosas y húmedas, causada por diferentes fungus in the host, this investigation was carried
especies del género Colletotrichum. Los síntomas out between 2015 and 2016, in order to detect
comunes que este patógeno provoca son: manchas the presence of the pathogen with certainty.
hundidas de color café oscuro, en hojas, tallos, flo- Because of this, the aim of our investigation was
res o frutos, dando lugar a la muerte de los tejidos to characterize, pathogenically and molecularly,
(Rivera, 2007). different isolations obtained from allspice fruits
En agosto del 2014, la M. C. Silvia E. García (Pimenta dioica L. Merrill) with symptoms of
Díaz (Comunicación personal), realizó un diagnos- anthracnose and determine the causal agent.
tico en frutos, tallos y hojas de pimienta gorda con The sampling and collection of plant material
material procedente de campo de la zona norte de (leaves, stems and fruits) with symptoms of
Veracruz, se detectaron síntomas de antracnosis en- anthracnose was carried out in three orchards
fermedad que causo pérdidas del 20 hasta el 50% alternated with allspice and basic crops, located
de la producción en pre y postcosecha. Al no contar in Northern Veracruz (Location 1: La Fábrica,
con información de este hongo en el hospedante se Coxquihui (20.177222°/-97.560278°); Location 2:
realizó el presente trabajo entre el 2015-2016, para Chapultepec, Espinal (20.204444°/-97.545000°)
detectar con certeza la presencia del patógeno. Por and Location 3: Sta. Isabel, Espinal (20.191111°/-
lo anterior, la presente investigación tuvo como ob- 97.529722°). Three samples were taken from each
jetivo caracterizar morfológica, patogénica y mole- orchard, one for each tree chosen, based on the
cularmente diferentes aislados obtenidos de frutos presence of symptoms, and the phenological state
de pimienta gorda (Pimenta dioica L. Merrill) con of the trees was the stage of fructification. The
síntomas de antracnosis y determinar el agente cau- first experiment was carried out in July of 2015,
sal. and the second one, in August of 2016 (production
El muestreo y colecta de material vegetal (hojas, season), in the Postharvest Diseases Laboratory of
tallos y frutos) con síntomas de antracnosis se rea- the Instituto de Fitosanidad-Fitopatología of the
lizó en tres huertos intercalados de pimienta gorda Colegio de Postgraduados, Campus Montecillos.
y cultivos básicos, ubicados al norte de Veracruz From each collection sitee, fruits were collected
(Localidad 1: La Fábrica, Coxquihui (20.177222°/- with symptoms of the disease, disinfected with
97.560278°); Localidad 2: Chapultepec, Espinal sodium hypochlorite at 1% for 1 min, washed
(20.204444°/-97.545000°) y Localidad 3: Sta. Isa- using sterile distilled water, and dried with sterile
bel, Espinal (20.191111°/-97.529722°)). De cada paper towels. Later, they were placed in humidity
huerto se colectaros tres muestras, una por cada chambers at 25 ± 1 °C for five days. After finding
árbol seleccionado en base a la presencia de sínto- signs of the pathogen on the surface of the fruits,
mas, el estado fenológico de los árboles fue etapa preparations were made and the fungus of interest
de fructificación. El primer experimento se realizó was confirmed. From these, we obtained monosopre
en julio del 2015 y el segundo en agosto de 2016 cultures in a PDA culture medium (39 gr in 1L
(época de producción), en el laboratorio de Enfer- water), following the dilution and dispersion
medades de Postcosecha del Instituto de Fitosani- method (Echandi, 1971). Each monospore culture
dad-Fitopatología del Colegio de Postgraduados, developed in the culture medium for seven days.
Campus Montecillos. De cada sitio de colecta, se For the morphology, discs were taken from those
seleccionaron frutos con síntomas de la enferme- cultures, each 0.5 cm in diamater, four repetitions
dad, se desinfestaron con hipoclorito de sodio al were planted per isolation in Petri dishes with a
1% por 1 min, se lavaron con agua destilada estéril PDA medium (Bioxon), they were incubated at
y se secaron en papel absorbente estéril. Posterior- 28 °C and their growth was evaluated every 48 h
mente, se colocaron en cámaras húmedas a 25 ± 1 °C until the pathogen filled the dish. The following
por cinco días. Al observar signos del patógeno en macroscopic variables were recorded after 10
la superficie de los frutos, se realizaron preparacio- days: 1) Growth in diameter; 2) Margin of the
nes y se confirmó el hongo de interés. De estos se colony; 3) Type of mycelia; 4) Color of colony;
obtuvieron cultivos monospóricos en medio de cul- 5) Concentric growth rings; 6) Sporulated colony.
tivo PDA (39 gr en 1L agua) siguiendo la metodología After each isolation, preparations were made to
de dilución y rayado (Echandi, 1971). Cada culti- characterize the microvariables. The microscopic
vo monospórico se desarrolló en medio de cultivo The microscopic variables evaluated were: 7) Type
durante siete días. Para la morfología se extrajeron of conidia; 8) Sexual stage; 9) Color and dimension
discos de 0.5 cm de diámetro de esas colonias y se of appressoria, using a compound miscrospoe
sembraron cuatro repeticiones por aislado en cajas (Micro Star, American Optical) with a 40x lens to
de Petri con medio PDA (Bioxon), se incubaron a observe these characteristics; 10) Dimensions of 50
28 °C y se evaluó el crecimiento cada 48 h hasta conidia pero isolation; amd 11) Dimensions of 50
que el patógeno llenara la caja. Se registraron las appressoria. The appressoria were obtained after 5
siguientes variables macroscópicas evaluadas a los days of preparing conidia in humidity chambers to
10 días: 1) Crecimiento en diámetro; 2) Margen de induce their formation. A total random experimental
la colonia; 3) Tipo de micelio; 4) Color de colonia; design was used and the data were analyzed in
5) Anillos concéntricos de crecimiento; 6) Colonia two ways: 1) applying a multivariate analysis by
esporulada. Posteriormente de cada aislamiento se clusters for the variables used in the identification,
realizaron preparaciones para caracterizar a las mi- thus obtaining a clustering dendrogram of the
crovariables. Las variables microscópicas evalua- morphological characteristics to know which
das fueron: 7) Tipo de conidio; 8) Estado sexual; species were involved in the development of
9) Color y dimensión de apresorio, para observar symptoms of anthracnose in allspice; 2) a normal
estas características se utilizó un microscopio com- analysis of variance was carried out, in which the
puesto (Micro Star, American Optical) con objetivo diameters of six day old colonies were compared.
40x; 10) Dimensiones de 50 conidios por aislado; y Mathematical analyses were carried out using
11) Dimensiones de 50 apresorios. Los apresorios the statistical analysis package SAS® System
se obtuvieron a los cinco días de poner preparacio- for Windows V9, 2002. The identification of the
nes de conidios en cámaras húmedas para inducir Colletotrichum isolations in allspice fruits was
su formación. Se utilizó un diseño experimental based on the morphological and morphometric, as
completamente al azar y los datos fueron analiza- well as the clustering obtained from the multivariate
dos de dos formas: 1) aplicando un análisis multi- analysis compared with the descriptions and keys
variado por clusters para las variables empleadas by (Bailey et al., 1996; Barnett y Hunter, 1998).
en la identificación y así obtener un dendograma To verify that the symptoms observed in the fruits
de agrupamiento de las características morfológi- gathered in the field were caused by the isolations
cas para conocer las especies involucradas en el obtained, Koch’s postulates (Agrios, 2002).
desarrollo de síntomas de antracnosis en pimienta Healthy fruits were gathered (approximately
gorda; 2) se realizó un análisis de varianza normal 300 allspice fruits) and 13 Colletotrichum spp.
donde se compararon diámetros de colonias de monospore isolations obtained from allspice.
seis días. Los análisis matemáticos se realizaron In order to increase the inoculant, the isolations
utilizando el paquete de análisis estadístico SAS® were planted in corn meal agar (CMA). Using the
System for Windows V9, 2002. La identificación developed spores, a mother solution was prepared,
de los aislados de Colletotrichum en frutos de pi- and the concentration was determined using a
mienta gorda se basó en las variables morfológi- hemocytometer, adjusted to 1x106 spores/mL. The
cas, morfométricas, así también en el agrupamiento fruits were disinfected using sodium hypochlorite
obtenido del análisis multivariado comparado con (NaClO) at 1% for 1 min and rinsed twice with
las descripciones y claves de (Bailey et al., 1996; sterile distilled water and left to dry for 15 min.
Barnett y Hunter, 1998). They were then placed in Petri dishes that were, in
Para corroborar que los síntomas observados en turn, placed in humidity chambers. Fruit inoculation
los frutos colectados en campo, fueron ocasionados was carried out with the spore suspension; for two
por los aislados obtenidos, se realizaron los postu- isolation that displayed sporulation, we used discs,
lados de Koch (Agrios, 2002). Se colectaron frutos 0.5 cm in diamater, which contained mycelium.
sanos (aproximadamente 300 frutos de pimien- We placed 5 µL of the conidia suspension on fruits
ta gorda) en los sitios de muestreo y se utilizaron without lesions (w/o/l) and with lesions (w/l), made
13 aislados monospóricos de Colletotrichum spp. with a dissection needle, to a depth of 1 mm. In
obtenidos de pimienta gorda. Para incrementar el the controls, 5 µL of distilled water were applied
inoculo, los aislados fueron sembrados en medio de in fruits w/o/l and w/l, per sampling site. The
cultivo harina de Maíz (AHM), con las esporas de- humidity chambers were sealed and incubated at
sarrolladas se preparó una solución madre, la con- 23±1 °C, with natural light for 11 days. To evaluate
centración se determinó con un Hematocitómetro the pathogenicity, we determined the presence or
y se ajustó a 1x106 esporas/mL. Los frutos fueron absence of circular or deformed necrotic spots, the
desinfestados con hipoclorito de sodio (NaClO) percentage of incidence, and the severity of the
al 1% por 1 min y enjuagados dos veces con agua fungus on the fruit. Incidence was evaluated as a
destilada estéril, se dejaron secar durante 15 min; parecentage of fruits affected by the pathogen. For
se colocaron en cajas de Petri y estas en cámaras the analysis, the data of w/o/l and w/l were groupd
húmedas. La inoculación de los frutos se realizó by isolation and location, using equation (1),
con la suspensión de esporas; para dos aislados que suggested by Anculle and Álvarez (1999). Severity
no presentaron esporulación se utilizaron discos de was evaluated as the percentage of tissue affected
0.5 cm de diámetro que contenían micelio. Se colo- by the pathogen, using the visual scale by Anculle
caron 5 µL de la suspensión de conidios sobre fru- and Alvarez (2006), modified and adapted to the
tos sin herida (s/h) y con herida (c/h) realizada con experiment; considering the degree of the condition
una aguja de disección a una profundidad de 1 mm; graded visually in each fruit, it was valued using
en los testigos se aplicaron 5 µL de agua destilada severity equation 2 according to Anculle and
estéril en frutos s/h y c/h, por sitio de muestreo. Alvarez (1999).
Las cámaras húmedas fueron selladas e incubadas
a 23±1 °C, con luz natural durante 11 días. Para
evaluar la patogenicidad se determinó la presencia No. de frutos enfermos
Incidencia (I) = *100 (1)
o ausencia de manchas necróticas circulares o de- No. total de frutos
formes, el porcentaje de incidencia y la severidad
del hongo sobre el fruto. La incidencia se evaluó
como porcentaje de frutos afectados por el patóge- No. de frutos en cada grado
Severidad (S) = *100 (2)
no. Para el análisis se agruparon los datos c/h y s/h No. total de frutos
por aislado y por localidad, utilizando la siguien-
te ecuación (1), sugerida por Anculle y Álvarez
(1999). La severidad se evaluó como porcentaje de
tejido afectado por el patógeno, utilizando la esca- The treatments were a combination of isolations,
la visual de Anculle y Alvarez (2006), modificada inoculation and host method, established under a
y adaptada al experimento; teniendo en cuenta el total random design with five repetitions inoculated
grado de afección calificado visualmente en cada with a lesion (w/w) and five without a lesion
fruto, fue valorada con la ecuación 2 de severidad (w/o/l), comapring the degree of damage on the
según Anculle y Alvarez (1999). fruit, the isolation and the sampling site for the
variable of severity; for the variable of incidence,
we used a multivariate analysis comparing the
No. de frutos enfermos number of damaged fruits w/l and w/o/l, the
Incidencia (I) = *100 (1)
No. total de frutos isolations and the incidence on the three sampling
sites. Mathematical analyses were performed using
the statistical analysis package SAS® System for
No. de frutos en cada grado Windows V9, 2002. To confirm Koch’s postulates,
Severidad (S) = *100 (2)
No. total de frutos we reisolated the pathogen, extracting fragments
of tissue and/or sporulation, which were deposited
in PDA, observed and we compared the macro
and microscopic variables of the reisolations with
Los tratamientos fueron una combinación de which the original allspice fruits were presented.
aislado, método de inoculación y hospedante, es- The experiment was carried out twice.
tablecido bajo un diseño completamente al azar Monospore cultures from all 13 isolations
con cinco repeticiones inoculados con herida (c/h) were incubated for 10 days at a room temperature
y cinco sin herida (s/h) comparando el grado del of 23 ±1 °C in a PDA culture medium. A sample
daño sobre el fruto, el aislado y el sitio de muestreo of mycelium was taken from each isolation and
para la variable severidad; para la variable inciden- deposited into an Eppendorf tube to be maceraed.
cia se utilizó un análisis multivariado comparando DNA was extracted with the CTAB extraction
el número de frutos dañados c/h y s/h, los aislados and purification method (Wagner et al., 1987).
y la incidencia en los tres sitios de muestreo. Los Later, DNA concentration was quantified using
análisis matemáticos se llevaron a cabo usando el a NanoDrop 2000 Spectrophotometer (Thermo
paquete de análisis estadístico SAS® System for Scientific). We completely amplified genes ITS-
Windows V9, 2002. Para la confirmación de los 1, ITS-2 and 5.8S, and partially, gene 18S and
postulados de Koch, se reaisló el patógeno extra- 28S of the 13 Colletotrichum spp. isolations;
yendo fragmentos de tejido y/o esporulación, que primers ITS 5 and ITS 4 were used. The PCR
fueron depositados en PDA, se observaron y com- amplification and sequencing (ITS) of the DNA
pararon las variables macro y microscópicas de los extracted were carried out using the Sanger method
reaislados con las que presentaron los originales de in the company Macrogen (Korea). The sequences
los frutos de pimienta gorda. El experimento se re- of the 13 isolations were compared with those
pitió dos veces. deposited in the National Center for Biotechnology
Cultivos monospóricos de los 13 aislamien- Information (NCBI), with the support of the Blast
tos fueron incubados por 10 días a temperatura tool. The sequences with the greatest similarities
ambiente 23 ±1 °C en medio de cultivo PDA. De were extracted from the data bank for phylogenetic
cada aislado se tomó una muestra de micelio, se analyses and then, along with those obtained
depositó en un tubo Eppendorf para ser macerado. from the fruits, they were aligned (Clustar W)
La extracción de ADN se realizó por el método de and processed using the UPGMA method in the
extracción y purificación CTAB (Wagner et al., program Mega 6 (Molecular Evolutionary Genetic
1987). Posteriormente de cada muestra se cuanti- Analysis), to obtain a phylogenetic analysis.
fico la concentración de ADN mediante un Nano- Thirteen Colletotrichum spp. monospore
Drop 2000 Spectrophotometer (Thermo Scientific). cultures were obtained, out of which four isolated
Se amplificaron completamente los genes ITS-1, allspice fruit species were identified as presenting
ITS-2 y 5.8S; y parcialmente al gen 18S y 28S de symptoms of anthracnosis (Figure 1). The growth
los 13 aislados de Colletotrichum spp.; se utiliza- in diameter was similar for most isolations, except
ron los primers ITS 5 e ITS 4. La amplificación for three with a slow growth, identified as C.
PCR y la secuenciación (ITS) del ADN extraído se acutatum. Out of all the cultures, 69% presented
llevó a cabo con el método de Sanger en la em- a circular growth and edge, while 31% presented
presa Macrogen (Korea). Las secuencias de los 13 a circular growth and a wavy edge, although most
aislados fueron comparadas con las depositadas presented concentric rings. Andrades et al. (2009)
en el Centro Nacional de Información Biotecnoló- and Chowdappa et al. (2012), described cultures
gica (NCBI), con apoyo de la herramienta Blast. with regular edges and a circular growth; Morales
Las secuencias de mayor similitud fueron extraídas et al. (2009) and Saldarriaga et al. (2008), observed
del banco de datos para los análisis filogenéticos y a formation of growth rings in some of their
posteriormente junto con las obtenidas de los frutos isolations. On the other hand, 15% of the isolations
fueron alineadas (Clustar W) y después procesadas presented aerial mycelia and 54% was flat; 8%
mediante el método UPGMA en el programa Mega presented a dense mycelium and in 23%, it was
6 (Análisis de Genética Evolutiva Molecular), para scarce fue escaso. Similar results were presented by
la obtención de un análisis filogenético. Saldarriaga et al. (2008), since 70% of their strains
Se obtuvieron 13 cultivos monospóricos de presented a thin, superficial growth, mycelial
Colletotrichum spp. de los cuales se identificaron aggregates. The color of the culture was initially
cuatro especies aislados de frutos de pimienta gor- white-salmon, and later turned dark gray; 54% had
da con síntomas de antracnosis (Figura 1). El cre- a salmon-white-gray, 31% was white-gray, 8%
cimiento en diámetro fue similar para la mayoría was salmon and 7% were white cultures; similar
de los aislados, excepto para tres con crecimiento percentages were reported by Dominguez et al.
lento, identificados como C. acutatum. El 69% de (2012). On the other hand, Freeman et al. (1998),
las colonias presentaron un crecimiento y margen report that C. acutatum developed salmon-colored
circular, mientras que el 31% un crecimiento cir- conidial masses, and C. gloeosporioides, a gray
cular y un margen ondulado, pero la mayoría pre- sporulation. Out of the isolations, 77% produced
sentó anillos concéntricos. Andrades et al. (2009) unicellular hyaline conidia with rounded edges and
y Chowdappa et al. (2012), describieron colonias only 23% presented conidia with one rounded edge,
con márgenes regulares y un crecimiento circular; and another acute edge; Villanueva et al. (2008),
Morales et al. (2009) y Saldarriaga et al. (2008), reported the formation of hyaline, aceptados,
observaron formación de anillos de crecimiento en cyllindrical and straight. Robles (2015) mentioned
algunos de sus aislados. Por otra parte, el 15% de that 83% of his isolations developed unicellular,
los aislados presentó un micelio aéreo y el 54% fue hyaline conidia with rounded edges, 11% presented
plano; el 8% micelio denso y el 23% fue escaso; conidia with one rounded edge and another acute
C. acutatum
C. fragariae
C. gloeosporioides
C. boninense
Figura 1. Características macroscópicas y algunas microscópicas de las especies de Colletotrichum spp., obtenidos de frutos
de pimienta gorda en el norte de Veracruz.
Figure 1. Macroscopic and some microscopic characteristics of the Colletotrichum spp. species obtained from allspice fruits
in Northern Veracruz.
resultados parecidos fueron reportados por Salda- edge, and 6% of conidia with both ends being
rriaga et al. (2008) el 70% de sus cepas presento acute. Villanueva et al. (2008), reported that the
creciemiento ralo superficial, agregados miceliales. C. gloeosporioides conidia presented obtuse ends,
El color de colonia inicialmente fue blanca-salmón, but some are narrow, and C. Fragariae, and obtuse
posteriormente se tornó gris obscuro; el 54% pre- end and another narrow end. The length and width
sentó una coloración salmón-blanco-gris, el 31% of the conidia ranged between 18.1 - 44.9 µm and
blanco-gris, el 8% salmón y el 7% colonias blan- 4.2 - 13.6 µm, respectively; the total average for
cas, porcentajes similares fueron reportados por the size of conidia was 28.4 x 8.4 µm. Statistically,
Dominguez et al. (2012). Por su parte, Freeman et no significant differences were found in the length
al. (1998), reportan que C. acutatum desarrollo ma- and width (Pr>F: <0.0001; α: 0.05; LSD length and
sas conidiales de color salmón y C. gloeosporioides width of conidium: 1.2891 and 0.4377). Similar
una esporulación grisácea. El 77% de los aislados results were reported by Villanueva et al. (2008).
produjo conidios unicelulares, hialinos, con extre- Irregular appressoria were observed, with different
mos redondeados y solo el 23% presentó conidios shapes, and with a dark brown color. Length ranged
con un extremo redondeado y el otro agudo; Villa- between 9.2 and 90.2 µm, while the width ranged
nueva et al. (2008), reportaron la formación de co- between 5.9 and 57.1 µm; the average was 25.9
nidios hialinos, aceptados, cilíndricos y rectos. Ro- x 15.5 µm; statistically, no significant differences
bles (2015), mencionó que el 83% de sus aislados were found in length (Pr>F: 0.0014, α: 0.05, LSD:
desarrollaron conidios unicelulares, hialinos, con 6.0527) and width (Pr>F: 0.0001, α: 0.05, LSD:
extremos redondeados, el 11% presentó conidios 3.4877). Robles (2015) and Oliveira et al. (2005)
con un extremo redondeado y el otro agudo y el 6% reported similar results to those obtained in this
conidios con ambos extremos agudos. Villanueva experiment; Villanueva et al. (2008), observed
et al. (2008), reportó que los conidios de C. gloeos- that the appressoria formed by C. fragariae, C.
porioides presentaron extremos obtusos pero algu- gloeosporioides and C. orbiculare were dark brown,
nos angostos y en C. fragariae un extremo obtuso and with similar shapes and sizes; C. boninense
y otro angosto. La longitud y ancho de los conidios promotes appressoria in short chains or solitary,
osciló entre 18.1 - 44.9 µm y 4.2 - 13.6 µm, respec- brown-colored, with thick walls, whole or crenate
tivamente; el promedio total en tamaño de conidios edges, rarely lobulated, with irreguar shapes, but
fue de 28.4 x 8.4 µm; estadísticamente no se en- commonly in the shape of a projectile 4.5-18 x 4-11
contraron diferencias significativas en la longitud y µm according to Damm et al. (2012). Only one
ancho (Pr>F: <0.0001; α: 0.05; LSD largo y ancho isolation presented asci with hyaline ascospores,
de conidio: 1.2891 y 0.4377). Resultados similares slightly curves and with rounded vertices, and
fueron reportados por Villanueva et al. (2008). Se the rest had no presence. Robles (2015), reports
observaron apresorios irregulares, de formas dife- a scarce formation of perithecia in a PDA culture
rentes, de color café oscuro; la longitud osciló de medium. A multivariate analysis was carried out
9.2 - 90.2 µm mientras el ancho de 5.9 - 57.1 µm; using data obtained from the 11 macroscopic and
el promedio fue de 25.9 x 15.5 µm; estadísticamen- microscopic characteristics, and an eigenvalue of
te no se encontraron diferencias significativas en 2.07 was found for the four clusters or groups.
la longitud (Pr>F: 0.0014, α: 0.05, LSD: 6.0527) This information was confirmed using the value
y ancho (Pr>F: 0.0001, α: 0.05, LSD: 3.4877). of the Pseudo F that peaked at 21.9 for the four
Robles (2015) y Oliveira et al. (2005) reportarón clusters or groups. These values affirm that when
resultados similares a los obtenidos en este experi- analyzing the groups alongside the evaluated, the
mento; Villanueva et al. (2008), observaron que los 13 isolations can be classified into four groups.
apresorios formados por C. fragariae, C. gloeospo- The aggressiveness of the isolations was variable
rioides y C. orbiculare fueron de color café, forma in the form of inoculation (w/l and w/o /l), type
y tamaño similar; C. boninense promueve apreso- of inoculation (suspension and section of growth
rios solitarios o en cadenas cortas, color marrón, de media) and between isolations; these differences
paredes gruesas, borde entero o crenado, rara vez helped prove that some isolations are capable
lobulados, de forma irregular comúnmente en for- of inducing more aggressiveness than others,
ma de proyectil de 4.5-18 x 4-11 µm de acuerdo a regardless of the condition of the inoculation. Some
Damm et al. (2012). Solo un aislado presentó ascas allspice fruits presented brown, circular necrotic
con ascosporas hialinas, ligeramente curveadas y spots on the epidermis of the fruit, concave, moist
con los vértices redondeados; los demás sin presen- and soft lesions. As the infection progressed, the
cia; Robles (2015), reporta una escasa formación de spots turned brownish-maroon to dark; salmon-
peritecios en medio de cultivo PDA. Con los datos colored, pink to orange sporulation appeared on the
obtenidos de las 11 características macroscópicas y lesions, and in some cases, white mycelia formed
microscópicas se realizó un análisis multivariado; from the inicial lesion, until it covered the fruits.
se encontró un eigenvalue de 2.07 a los cuatro clus- These results coincide with those reported by
ters o grupos. Esta información se confirmó con el Somashekhara et al. (2013).
valor de la Pseudo F que alcanzó un punto máximo Incidence percentages obtained ranged from
de 21.9 a los cuatro grupos o clusters. Con estos 20 to 100% from Colletotrichum spp. on the total
valores se asevera que al analizar paralelamente las amount of fruits. A higher incidence was observed
variables evaluadas, los 13 aislados se pueden cla- in fruits from location 2, which was lower than in
sificar en cuatro grupos. location 1. Bogantes and Mora (2013) reported
La agresividad de los aislados fue variable en a high incidence (70%) but low severity in
forma de inoculación (c/h y s/h), tipo de inocula- papaya fruits. The multivariate analysis found an
ción (suspensión y bocado) y entre los aislados; eigenvalue of 6.32 in two clusters or groups. This
estas diferencias permitieron probar que algunos information was confirmed when reviewing the
aislados son capaces de inducir más agresividad value of Pseudo F that reached a maximum point
que otros, independientemente de la condición de of 20.9 for the two highest clusters or groups. On
inoculación. Se observaron frutos de pimienta gor- the other hand, the results of the severity evaluation
da con manchas necróticas circulares de color café showed that it was higher in allspice fruits from
sobre la epidermis del fruto, lesiones hundidas, hú- location2, and to a lesser extente, in locations 1 and
medas y blandas; conforme la infección avanzó, las 3 (Pr>F: <.0001, α:0.05, LSD: 6.9888; difference
manchas se tornaron marrón-café a oscuras, sobre in averages of 35.644 A in location 2 against
las lesiones se presentó esporulación de color sal- 5.604 B in location 1 ) (Figure 2). In this way,
món, rosa a naranja y en algunos casos se desarro- high percentages for severity were also obtaine in
lló micelio blanco que cubrió los frutos a partir de inoculations, and a null percentage was observed
la lesión inicial; Estos resultados coinciden con lo in inoculations with water (Pr>F: <.0001, α: 0.05;
reportado por Somashekhara et al. (2013). LSD: 13.778; difference in averages of 16.773 A
Se obtuvieron porcentajes de incidencia desde for suspension against 0.000 B in inoculation with
20 a 100% por Colletotrichum spp. sobre la totali- water). The severity of each isolation in fruits from
dad de frutos; se observó mayor incidencia en fru- location 2 was of 100% (Pr>F: 0.0094, α: 0.05 y
tos de la localidad 2 y esta fue menor en proporción LSD: 20.636), invading the fruits completely,
en aquellos procedentes de la localidad 1. Bogan- with abundant sporulation, and in some, white
tes y Mora (2013), reportaron una alta incidencia to gray mycelia developed. Similar results were
(70%), pero baja severidad en frutos, de papaya. En obtained by Bogantes and Mora (2013), obtaining
el análisis multivariado se encontró un eigenvalue a percentage of 100% for papaya fruits affected by
de 6.32 a los 2 clusters o grupos. Esta información anthracnose, with an average of 36% for severity
se confirmó al revisar el valor de la Pseudo F que in fruits.
alcanzó un punto máximo de 20.9 a los dos grupos The reisolations obtained from the inoculated
mayores o clusters. Por su parte, los resultados de fruits displayed symptoms and signs with similar
la evaluación de severidad mostraron que esta fue macro and micro morphological characteristics to
mayor en frutos de pimienta gorda de la localidad those of the original isolations, complying with
2, y en menor proporción en las localidades 1 y 3 Koch’s 4° postulate in a satisfactory manner.
(Pr>F: <.0001, α:0.05, LSD: 6.9888; diferencia The ITS region of the thirteen isolations
en medias de: 35.644 A en la localidad 2 contra obtained from allspice fruits was amplified, and this
5.604 B en la localidad 1 ) (Figura 2), así también helped compare and determine the fungus species.
se obtuvieron porcentajes de severidad altos en las The results obtained from the GenBank with the
inoculaciones, y se observó un nulo porcentaje en Blast tool of the amplified sequences revealed that
inoculaciones con agua (Pr>F: <.0001, α: 0.05; the 13 existing isolations were divided into four
Figura 2. Aislados de Colletotrichum spp. que causan el mayor grado de severidad en frutos de pimienta gorda.
Figure 2. Colletotrichum spp. isolations that cause the highest degree of severity in allspice ftuirs.
LSD: 13.778; diferencia en medias de: 16.773 A species of the genus Colletotrichum: C. acutatum,
por suspensión contra 0.000 B en inoculación con C. fragariae, C. gloeosporioides and C. boninense.
agua). La severidad de cada aislado en frutos de la Using the sequences, we created a phylogenetic tree
localidad 2 fue del 100% (Pr>F: 0.0094, α: 0.05 (Figure 3), which shows the clustering of associates
y LSD: 20.636), invadiendo completamente a los species. According to the similar characteristics of
frutos, abundante esporulación y en algunos se de- the isolations, three groups can be distinguished:
sarrolló micelio de color blanco a gris. Resultados the group with the highest number of isolations
similares fueron reportados por Bogantes y Mora is composed of the species C. gloeosporioides,
(2013), obteniendo un 100% de frutos de papaya and within this set with analogous characteristcs
afectados por antracnosis con un promedio de 36% is C. fragariae; the second group differs by a
de severidad en fruta. lower proportion of the largest set and includes
Los reaislamientos que se obtuvieron de los fru- the species C. boninense; and the last group that
tos inoculados, presentaron síntomas y signos con desynchronizes molecularly and morphologically
características macro y micro morfológicas iguales from the other isolations includes the species C.
a las de los aislados originales, con lo que se cum- acutatum.
plió satisfactoriamente el 4° postulado de Koch. The use of molecular techniques for this
La región ITS de los trece aislados obtenidos investigation was of great importance, since the
de frutos de pimienta gorda, fue amplificada per- species belonging to this genus show a great genetic
mitiendo comparar y determinar las especies de variability, which is expressed in morphological
hongos; los resultados obtenidos del GenBank me- variability, virulence, and aggressiveness (Freeman
diante la herramienta Blast de las secuencias am- et al., 2000).
plificadas de los iniciadores, revelaron que los 13 Thirteen monospore isolations were obtained
aislados existentes se dividieron en cuatro especies from Colletotrichum spp., from allspice fruits
del género Colletotrichum: C. acutatum, C. fraga- taken from three locations. Uisng morphological
riae, C. gloeosporioides y C. boninense. Con las characterizations, we identified C. acutatum (23%),
secuencias se obtuvo un árbol filogenético (Figura a species of slow growth, with rounded and sharp
3), en el que se observa el agrupamiento de las es- edges, and C. gloeosporioides (77%), a pathogen
pecies asociadas, según las características similares of fast growth, with conidia with rounded edges;
de los aislados, se diferencian tres grupos: el grupo the variable of sexual state of phase was found in
con mayor número de aislados lo conforma la espe- an isolation. In pathogenic characterization, we
cie C. gloeosporioides, dentro de este conjunto con found a variation in the aggressiveness between
características análogas se encuentra C. fragariae; Colletotrichum isolations on allspice fruits, finding
el segundo grupo difiere en menor proporción del a higher number of aggressive isolations in fruits in
conjunto mayor y ubica a la especie C. boninen- the location of Chapultepec, Espinal, Ver., which
se; y el último grupo que se desfasa molecular y helped affirm that, at least for this investigation,
morfológicamente de los demás aislados coloca a pathogenicity does depend in the location from
la especie C. acutatum. which the isolation is taken. Out of the two methods
La utilidad de las técnicas moleculares para esta of inoculation (w/l and w/o/l), the best results were
investigación fue de considerable importancia ya obtained using the method w/l, which showed a
que las especies pertenecientes a este género mues- higher incidence and severity of Colletotrichum
tran una gran variabilidad genética, que se expresa in the fruits; controls displayed no symptoms.
en variabilidad morfológica, virulencia y agresivi- Molecular identification confirmed the results of
dad (Freeman et al., 2000). morphological characterization and showed the
Se obtuvieron 13 aislados monospóricos de presence of two additional species, therefore, out
Colletotrichum spp., de frutos de pimienta gorda of the 13 isolations, three belonged to C. acutatum,
provenientes de tres localidades productoras. Con one belonged to the species C. fragariae, eight
Figura 3. Árbol filogenético de los 13 aislados de Colletotrichum spp. obtenidos de frutos de pimienta gorda en el norte de
Veracruz.
Figure 3. Phylogenetic tree for the 13 Colletotrichum spp. isolations obtained from allspice fruits in Northern Veracruz.
Freeman S, Katan T and Shabi E. 1998. Characterization of en aislados de Colletotrichum spp. obtenidos de frutos
Colletotrichum species resposible for Anthracnose disea- de aguacate a nivel nacional. Colegio de Postgraduados,
ses of various fruits. Plant Disease 82:596-604. http:// Campus Montecillos. Fitosanidad-Fitopatología, Texcoco
[Link]/10.1094/PDIS.1998.82.6.596 de Mora, Edo. México. Tesis Doctoral. Pp. 167.
Freeman S, Minz D, Jurkevitch E, Maymos M and Shabi E. Saldarriaga CA, Castaño Z y Arango I. 2008. Caracterización
2000. Molecular analyses of Colletotrichum species from del agente causante de la antracnosis en tomate de árbol
almond and other fruits. Phytopathology 90:608-614. manzano y mora. Revista de la Academia Colombiana de
[Link] Ciencias Exactas, Físicas y Naturales 32:145-156. Dis-
Morales GJL, Azpìroz RHS y Pedraza SME. 2009. Caracte- ponible en línea: [Link]
rización cultural, morfológica, patogénica e isoenzimati- tion/257652278_Caracterizacion_del_Agente_Causal_
ca de aislados de Colletotrichum gloeosporioides Penz. de_la_Antracnosis_en_Tomate_de_Arbol_Manzano_y_
Causante de la antracnosis en aguacate (Persea america- Mora
na Mill) en Michoacán, México. Revista UDO Agrícola Somashekhara A, Vasanthakumari M, Mahishi P, Mallikarju-
9:848-856. Disponible en línea: [Link] naswamy G and Shivanna M. 2013. Prevalence and Seve-
servlet/articulo?codigo=3394147 rity of Anthracnose of Yam (Dioscorea alata and D. bulbi-
Oliveira R, Moral J, Bouhmidi K. y Trapero A. 2005. Carac- fera) caused by Colletotrichum gloeosporioides in Bhadra
terización morfológica y cultural de aislados de Colleto- Wildlife Sanctuary in Karnataka. Journal Mycology Plant
trichum spp. causantes de la antracnosis del olivo. Boletín Pathology 43:282-290. Disponible en línea: [Link]
de sanidad vegetal 31:531-548. Disponible en línea: http:// [Link]/publication/256838587
[Link]/xmlui/handle/10396/2420 Villanueva A, Yañez MJ y Hernandez AM, 2008. Especies de
Rivera G. 2007. Conceptos Introductorios a la Fitopatología (1 Colletotrichum en Chirimolla (Annona cherimola Mill.).
ed.). EUNED, ed.) Costa Rica. Disponible en línea: https:// Agrociencia 42:689-701. Disponible en línea: http://
[Link]/books?id=xpTHXEWG_t8C&pg=PA6 [Link]/[Link]?script=sci_arttext&pid
&lpg=PA6&dq=Conceptos+Introductorios+a+la+Fitopat =S1405-31952008000600009
olog%C3%ADa&source=bl&ots=OQNO_7ozWd&sig=S Wagner D, Furnier G, Saghay-Maroof M, Williams S, Dancik
jX_YMlwt5cJucIh8oKsQBUrA34&hl=es-419&sa=X&ve B and Allard R. 1987. Chloroplast DNA polymorphisms in
d=0ahUKEwjlgfiAh7rLAhXq74MKHb8mBkQQ6AEIIT lodgepole and jack pines and their hybrids. Proceedings of
AB#v=onepage&q&f=false the National Academy of Science USA (pp. 2097-2100).
Robles L. 2015. Caracterización morfológica, molecular, pa- Disponible en línea: [Link]
togenicidad cruzada y Resistencia a productos químicos articles/PMC304592/
La descripción morfológica de los aislamientos disinfected with 1% sodium hypochlorite and rinsed
se realizó con preparaciones temporales, y perma- with sterile distilled water. Two levels of inoculum
nentes, se observaron bajo microscopio las estruc- (1 x 106 and 1 x 104 conidia per mL) were evaluated
turas fungosas y se midieron al menos 50 veces and used to inoculate two groups of 20 fruits. A
cada una de ellas, posteriormente para la determi- conidial suspension was obtained from monosporic
nación del género se siguieron las claves de Barnett cultures of the MTCc and MTCO isolates. In the
y Hunter (1998) y Bensch et al. (2012). Con base fruits of each treatment small cuts were made using
en estas claves los aislamientos obtenidos se de- a sterile needle, and then sprayed with 3 mL of
nominaron MTCc (144 aislamientos), MTCO (22 the conidial suspension. Small cuts with a sterile
aislamientos) y MT1 (14 aislamientos). needle were also made on the 20 control fruits,
En las pruebas de patogenicidad solo se utiliza- and sprayed with sterile distilled water. All 60
ron los aislamientos MTCc y MTCO (tratamientos) fruits in each treatment were placed in a moisture
y en cada caso se utilizó el morfotipo con mayor chamber at 27 °C for 12 days, during which the
frecuencia. Se inocularon 40 frutos maduros de za- fruit developed symptoms; when the symptoms
pote mante, asintomáticos, los cuales se desinfesta- became evident, isolates of the mycelium growing
ron con hipoclorito de sodio al 1% y se enjuagaron on the symptoms were made. This experiment was
con agua destilada estéril. Se evaluaron dos niveles repeated one more time. It should be noted that in
de inóculo, 1 x 106 y 1 x 104 conidios por mL para both assays, neither the isolate called MTCO nor
inocular dos grupos de 20 frutos. La suspensión the control treatment induced symptoms in the
de conidios se obtuvo a partir de cultivos monos- inoculated fruits. In contrast, the MTCc isolate at
póricos de los aislamientos MTCc y MTCO, res- each level of inoculum induced symptoms very
pectivamente. En los frutos de cada tratamiento se similar to those observed in the field. The re-
produjeron pequeñas heridas con una aguja estéril, isolates obtained were named MTCc-pp and kept
a las que se les asperjaron tres mL de la suspensión on petri dishes containing PDA at 27 °C in total
de conidios; de igual manera a los 20 frutos testigo darkness.
se les produjeron pequeñas heridas con una aguja For the molecular characterization of the
estéril y se les asperjó agua destilada estéril. Los MTCc isolate and of the isolates obtained from
60 frutos de cada tratamiento se colocaron en una the pathogenicity test (MTCc-pp), total genomic
cámara húmeda a 27 °C durante 12 días, tiempo en DNA was extracted. We used 200 mg of mycelium
el cual se registró el desarrollo de síntomas en los grown for five days in PD (potato dextrose) liquid
frutos; cuando estos fueron evidentes, se realizaron medium and kept in a thermo-shaker at 112 rpm.
aislamientos de micelio crecido en el síntoma. Este The 200 mg of mycelium were incubated for 1 h
experimento se repitió una vez más. Cabe señalar at 60 °C in 1,000 µL of extraction buffer (NaCl
que en ambos ensayos el aislamiento denominado 0,7 M, Tris 0,1 M pH 7,5, 0,01 M EDTA pH
MTCO y el tratamiento testigo no indujeron ningún 8,0, 1% ß-ME and 1% CTAB) and moderately
síntoma en los frutos inoculados. En contraste, el shaken every 5-10 min. Subsequently, 200 µL of
aislamiento MTCc con cada nivel de inoculó in- NaAc 3 M were added, and placed at -20 °C for
dujo síntomas muy similares a los observados en 20 min, followed by centrifugation at 10,000 rpm
campo. Los reaislamientos obtenidos se denomina- for 10 min. For DNA precipitation, 750 µL of the
ron MTCc-pp, se mantuvieron en placas de PDA a supernatant were taken and placed in a new 1.5 mL
27 °C en oscuridad total. tube; then, 750 µL of cold isopropanol were added
Para la caracterización molecular del aisla- and kept at -20 °C for 20 min. After this period,
miento MTCc y de los aislamientos obtenidos de they were centrifuged for 10 min at 12,000 rpm, the
la prueba de patogenicidad (MTCc-pp); se extra- supernatant was discarded, the pellet was washed
jo el ADN genómico total. Se utilizaron 200 mg three times with 100 µL of cold 70% ethanol, dried
de micelio crecido durante cinco días en medio at room temperature and re-suspended in 30 µL of
líquido PD (papa dextrosa) mantenido en un ter- water free of DNase. Finally, the DNA was stored
mo agitador a 112 rpm. Los 200 mg de micelio se at -20 °C.
incubaron por 1 h a 60 °C en 1,000 µL de buffer de For the polymerase chain reaction,
extracción (NaCl 0,7 M, Tris 0,1 M pH 7,5, 0,01 M the universal primers ITS1F (5´-
EDTA pH 8,0, 1% ß-ME, y 1% CTAB) agitando CTTGGTCATTTAGAGGAAGTAA-3´) and
moderadamente cada 5-10 min. Posteriormente se ITS4R (5´- TCCTCCGCTTATTGA TATGC-3´)
le adicionó 200 µL de NaAc 3 M, y se colocó a were used. The mixture for the PCR with a final
-20 °C durante 20 min, seguido de una centrifuga- volume of 25 µL consisted of DNase-free water,
ción a 10,000 rpm por 10 min. Para la precipitación 1X reaction buffer, MgCl2 2.5 mM, dNTP´s 2 mM,
del ADN se tomaron 750 µL del sobrenadante y se 1U of Taq DNA polymerase (Promega®), 1 pmol
colocó en un tubo nuevo de 1,5 mL, enseguida se primers and 100 ng/µL of DNA, with the following
añadieron 750 µL de isopropanol frio y se mantu- amplification conditions: one cycle at 94 °C for 5
vo a -20 °C por 20 min. Una vez transcurrido este min, 30 cycles at 94 °C for 30 s, 55 °C for 30 s and
tiempo, se centrifugó por 10 min a 12,000 rpm, se 72 °C for one min. The amplification products were
desechó el sobrenadante, la pastilla se lavó tres ve- visualized in 1% agarose gel + ethidium bromide
ces con 100 µL de etanol frío al 70%, se secó a in a Gel-Doc 2,000 photo-documentation system.
temperatura ambiente y se resuspendió en 30 µL Later, the products of the MTCc and MTCc-pp
de agua libre de ADNsas. Finalmente, el ADN se isolates obtained through PCR were purified using
almacenó a -20 °C. the Wizard® SV gel kit and PCR Clean-up System
En la reacción en cadena de la polimerasa se (Promega) and sequenced using an automatic
usaron los iniciadores universales ITS1F (5´- CTT- 16-capillary DNA sequencer (Applied Biosystems,
GGTCATTTAGAGGAAGTAA -3´) e ITS4R (5´- model 3130xl).
TCCTCCGCTTATTGA TATGC-3´). La mezcla The obtained sequences were assembled using
para PCR con un volumen final de 25 µL, consistió the Mega 7 program, where they were cleansed to
en agua libre de ADNsas, buffer de reacción 1X, correct possible sequencing errors; then they were
MgCl2 2,5 mM, dNTP´s 2 mM, 1U de Taq ADN aligned to obtain a consensus sequence of 572
polimerasa (Promega®), iniciadores 1 pmol y 100 base pairs, which was compared to the sequences
ng/µL de ADN, con las siguientes condiciones de reported in the National Center for Biotechnology
amplificación: un ciclo a 94 °C por 5 min, 30 ciclos Information (NCBI) database using the Blast
a 94 °C por 30s, 55 °C por 30s y 72 °C por un min. tool. Then a phylogenetic analysis was performed
Los productos de amplificación se visualizaron en following the Neighbor-Joining method with 5,000
gel de agarosa al 1% + bromuro de etidio, en un bootstrap replications.
fotodocumentador Gel-Doc 2,000. Posteriormente, From the obtained isolates, two fungi were
el producto de PCR de los aislamientos MTCc y identified: Colletotrichum sp. (MTCO) and
MTCc-pp se purificaron con el kit Wizard® SV gel Cladosporium sp. (MTCc); a third one produced
and PCR Clean-up System (Promega) y se secuen- a sclerosed stroma (MT1), but was not identified.
ciaron en un secuenciador automático de ADN de Cladosporium sp. was the most frequently present
16 capilares (Applied Biosystems, modelo 3130xl). fungus and showed an 80.5% association with the
Las secuencias obtenidas se ensamblaron en el disease lesions. The Cladosporium sp. isolates
programa Mega 7, en donde se realizó una limpie- showed similar culture traits consistent with those
za para corregir los posibles errores de secuencia- reported for this genus (Bensch et al., 2012). The
ción, posteriormente se alinearon para obtener una presence of nodulous macronematous cylindrical
secuencia consenso de 572 pares de bases, la cual conidiophores far from each other, with a single
se comparó con secuencias reportadas en la base de conidiogenic cell was observed under a compound
datos del Centro Nacional para la Información Bio- microscope; conidia had one or no septum and were
tecnológica (NCBI) mediante la herramienta Blast. 3 to 5 μm wide, which are characteristics reported
Enseguida, se hizo un análisis filogenético usando for C. cladosporioides (Bensch et al., 2012).
el método Neighbor-Joining con 5,000 réplicas de In the pathogenicity tests using the two evaluated
bootstrap. inoculum levels, sunken areas were observed in the
De los aislamientos obtenidos, se identificaron epicarp 48 h after inoculation. At 72 h, brown spots
dos hongos: Colletotrichum sp. (MTCO) y Clados- were observed on the sunken areas which later
porium sp. (MTCc) y un tercero que produjo un became necrotic and coalesced on the fruit. White
estroma esclerosado (MT1), el cual no fue identifi- mycelium grew on the spots and had morphological
cado. Cladosporium sp. fue el que se presentó con structures very similar to those of the MTCc isolate.
mayor frecuencia con un 8.5% de asociación con The re-isolates obtained coincided with the culture
las lesiones de la enfermedad. Los aislamientos de and morphological traits of the isolate, which
Cladosporium sp., presentaron características cul- proved that this isolate produced the sunken spots
turales similares, consistentes con las reportadas in zapote mante (Figure 1).
para este género (Bensch et al., 2012). En el mi- The obtained sequences were analyzed using
croscopio compuesto se observó la presencia de co- the NCBI BLAST tool and the results showed that
nidióforos cilíndricos macronematosos nodulosos they were 99% similar to the sequences reported
alejados entre sí, con una sola célula conidiogénica, for Cladosporium cladosporioides. The sequence
los conidios presentan uno o ningún septo y midie- of the MTCc isolate was deposited in the GenBank
ron de ancho 3 a 5 μm, siendo estas características (access number KP788715). In the phylogenetic
las reportadas para C. cladosporioides (Bensch et analysis, the identity of the MTCc isolate was
al., 2012). established based on its close relationship with
En las pruebas de patogenicidad, con los dos isolates reported as Cladosporium cladosporioides.
niveles de inóculo evaluados, se observaron zonas The symptoms observed coincide with those
hundidas en el epicarpio 48 h después de la inocu- described for Cladosporium cladosporioides,
lación. A las 72 h, en las zonas hundidas se obser- which affects tangerine (Citrus reticulata), papaya
varon manchas de color marrón que posteriormente (Papaya carica), passion fruit (Passiflora edulis)
se necrosaron y coalescieron en el fruto. Sobre las and mango (Mangifera indica L.) (Guillen-
manchas, se desarrolló micelio de color blanco que Sánchez et al., 2007; Vásquez et al., 2012; Tashiro
presentaba estructuras morfológicas muy similares et al., 2013), and demonstrates the impact of this
a las del aislamiento MTCc. Los reaislamientos pathogen on different fruit crops; it also reduces
obtenidos coincidieron con las características cul- their commercial value due to the unpleasant
turales y morfológicas de dicho aislamiento, de- appearance of the epicarp. As far as we know,
mostrándose así que esta originaba la mancha hun- this is the first time in Mexico that Cladosporium
dida en frutos de zapote mante (Figura 1). cladosporioides has been reported to produce
necrotic spots on zapote mante fruits.